Study of the role of the covalently linked cell wall protein (Ccw14p) and yeast glycoprotein (Ygp1p) within biofilm formation in a flor yeast strain

Study of the role of the covalently linked cell wall protein (Ccw14p) and yeast glycoprotein... Abstract Flor yeasts are Saccharomyces cerevisiae strains noted by their ability to create a type of biofilm in the air–liquid interface of some wines, known as ‘flor’ or ‘velum’, for which certain proteins play an essential role. Following a proteomic study of a flor yeast strain, we deleted the CCW14 (covalently linked cell wall protein) and YGP1 (yeast glycoprotein) genes—codifying for two cell surface glycoproteins—in a haploid flor yeast strain and we reported that both influence the weight of the biofilm as well as cell adherence (CCW14). flor yeast, flor biofilm, Ccw14p, Ygp1p, cell adherence, cell surface hydrophobicity INTRODUCTION Flor yeasts are Saccharomyces cerevisiae strains known in the enological field due to their ability to form a type of biofilm in the wine–air interface, known as ‘flor’ or ‘velum’, which confers sensorial properties during the elaboration of Sherry-like wines (López-Alejandre 2005; Peinado and Mauricio 2009; Legras et al.2016). During the wine elaboration process, the lack of sugars that have been consumed during the previous fermentation triggers flor yeast to develop the flor in the wine–air interface that allows them to reach an oxygen-rich zone where it is possible to oxidatively catabolize the remaining carbon sources from the fermentation, ethanol or glycerol (Zara et al.2010, 2011; Alexandre 2013). This feature is significantly attributed to a high cell surface hydrophobicity (Martínez, Perez-Rodriguez and Benitez 1997), increased cell buoyancy, yeast lipid content/composition (Zara et al.2009) and the presence of certain proteins such as Flocculin-11 (Flo11p), Batten disease protein 2 (Btn2p), 12 kDa heat shock protein (Hsp12p) and Transcriptional regulator NRG1 (Nrg1p) (Zara et al.2002; Ishigami et al.2004; Espinazo-Romeu et al.2008). Among them, Flo11p plays an essential role. This is a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that contributes to the cell rising and hydrophobicity (Reynolds and Fink 2001; Ishigami et al.2004; Zara et al.2005; Fidalgo et al.2006; Purevdorj-Gage et al.2007). Although several traits of the flor formation have been revealed, other aspects like the composition of an extracellular matrix reported by Zara et al. (2009) or the existence of other parietal proteins besides Flo11p involved in the flor formation persist unknown. Moreno-García et al. (2016) investigated the proteome of a flor yeast, and they identified two extensively glycosylated cell surface proteins, Ccw14p (Covalently linked Cell Wall protein) and Ygp1p (Yeast GlycoProtein), that may have a crucial function in the flor formation process. In this work, we evaluated the contribution of proteins Ccw14 and Ygp1 to the biofilm ability of a flor strain using a haploid strain in which the relative ORFs have been deleted, and phenotypes related to the flor biofilm formation were analyzed. MATERIAL AND METHODS Saccharomyces cerevisiae P3-D5 MAT α strain CLIB 1772 (Jura, France), a haploid flor yeast strain was used for the genotypic/phenotypic studies (Coi et al.2016, 2017). Ccw14p and Ygp1p were selected for their ORFs deletion, according to the following election criteria: high concentration under a flor biofilm formation condition (Moreno-García et al.2016) and similarity with Flo11p on the base of hydrophobic character and cell surface location (Fig. 1). Protein hydrophobicity was determined in silico by using the Saccharomyces Genome Database (SGD) and Uniprot databases taking into account the protein hydropathicity index (positively rated proteins being more hydrophobic) and the number of glycosylation sites in the amino acid sequence. FIGURE 1. View largeDownload slide Criteria for the selection of the proteins. FIGURE 1. View largeDownload slide Criteria for the selection of the proteins. Phleomycin markers flanked by sequences homologous to the genes CCW14 and YGP1 were amplified by PCR using oligos shown in Table 1 to construct the deletion cassettes called Ble. The PCR reaction mix (50 μl) contained: 5 μl 10X PCR Buffer-MgCl2 Invitrogen (Carlsbad, California), 2 mM dNTP Mix, 50 mM MgCl2, 10 mM of each construction primer (Table 1), 25 ng pUG66 template DNA, 2.5 U Taq DNA Polymerase Invitrogen. PCR conditions were 94°C for 3 min, 94°C for 45 sec, 55°C for 30 sec, 72°C for 1 min 30 sec (30 cycles), 72°C for 10 min. The PCR product was purified (Qiagen, Inc., Hilden, Germany) and used to transform the strains P3-D5 MAT α using the protocol described by Güldener et al. (1996). Selection of transformants was performed on YPD (1% yeast extract, 2% peptone, 2% glucose and 2% agar) plates containing 150 μg/mL phleomycin. Confirmation of allele deletion was made by PCR using primers indicated in the Table 1 and consisting in a 12.5 μL PCR reaction mix: 1.25 μl 10X PCR Buffer-MgCl2 Invitrogen, 2 mM dNTP Mix, 50 mM MgCl2, 10 mM of each verification primer and 10 μM for Ble1 and Ble 2 (Table 1) (VerFw-VerRv for the first PCR verification, VerFw-Ble1 for the second and VerRv-Ble2 for the third), 15 μg template DNA, 0.625 U Taq DNA Polymerase Invitrogen. PCR conditions were the same as in the cassette construction. The proper insertion of deletion cassettes in place of CCW14 or YGP1 was verified also by Sanger sequencing (GATC-Biotech, Konstanz, Germany sequencing service) using their respective verification primers, after PCR amplification and purification (Qiagen PCR purification kit) of the corresponding regions. DNA homology searches were performed using the Basic Local Alignment Search Tool (BLAST) algorithm through the National Center for Biotechnology Information (NCBI) and SGD. TABLE 1. DNA primers. Primer  Sequence  Purpose  CCW14PhleFw  5΄ CAGCACTACTAGACTCGTTCAACACTCGTTATATA TTATCGTACGCTGCAGGTCGACAAC 3΄  Construction of the CCW14::PHLEO cassette from pUG66  CCW14PhleRv  5΄ GATAGATACCTTAACCCATTAGAAATAAAGTGATAGATAAACTATAGGGAGACCGGCAGA 3΄  Construction of the CCW14::PHLEO cassette from pUG66  CCW14VerFw  5΄ CCAGAATACGACGAGGACGG 3΄  Verification of insertion of CCW14::PHLEO cassette  CCW14VerRv  5΄ CCCAGATATGTACCGCCACC 3΄  Verification of insertion of CCW14::PHLEO cassette  YGP1PhleFw  5΄ TCTACTGGATTAATCGTCAGTTAAGTAATACAGTAAT AGAAAGTACGCTGCAGGTCGACAAC 3΄  Construction of the YGP1::PHLEO cassette from pUG66  YGP1PhleRv  5΄ AAAGAATCTCTATGCTTCGCTAGATTTAATATCTATCAGTACTATAGGGAGACCGGCAGA 3΄  Construction of the YGP1::PHLEO cassette from pUG66  YGP1VerFw  5΄ CGGCTTCTCGATGCTACAGT 3΄  Verification of insertion of YGP1::PHLEO cassette  YGP1VerRv  5΄ AGAAGGGGGTGAGATCCCTT 3΄  Verification of insertion of YGP1::PHLEO cassette  Ble1  5΄ GTGGGCGAAGAACTCCAG 3΄  Verification of insertion of PHLEO cassette  Ble2  5΄ GTTCTACCGGCAGTGCAAAT 3΄  Verification of insertion of PHLEO cassette  Primer  Sequence  Purpose  CCW14PhleFw  5΄ CAGCACTACTAGACTCGTTCAACACTCGTTATATA TTATCGTACGCTGCAGGTCGACAAC 3΄  Construction of the CCW14::PHLEO cassette from pUG66  CCW14PhleRv  5΄ GATAGATACCTTAACCCATTAGAAATAAAGTGATAGATAAACTATAGGGAGACCGGCAGA 3΄  Construction of the CCW14::PHLEO cassette from pUG66  CCW14VerFw  5΄ CCAGAATACGACGAGGACGG 3΄  Verification of insertion of CCW14::PHLEO cassette  CCW14VerRv  5΄ CCCAGATATGTACCGCCACC 3΄  Verification of insertion of CCW14::PHLEO cassette  YGP1PhleFw  5΄ TCTACTGGATTAATCGTCAGTTAAGTAATACAGTAAT AGAAAGTACGCTGCAGGTCGACAAC 3΄  Construction of the YGP1::PHLEO cassette from pUG66  YGP1PhleRv  5΄ AAAGAATCTCTATGCTTCGCTAGATTTAATATCTATCAGTACTATAGGGAGACCGGCAGA 3΄  Construction of the YGP1::PHLEO cassette from pUG66  YGP1VerFw  5΄ CGGCTTCTCGATGCTACAGT 3΄  Verification of insertion of YGP1::PHLEO cassette  YGP1VerRv  5΄ AGAAGGGGGTGAGATCCCTT 3΄  Verification of insertion of YGP1::PHLEO cassette  Ble1  5΄ GTGGGCGAAGAACTCCAG 3΄  Verification of insertion of PHLEO cassette  Ble2  5΄ GTTCTACCGGCAGTGCAAAT 3΄  Verification of insertion of PHLEO cassette  View Large Flo11p-related phenotypes were analyzed in different media. Biofilm formation was observed when yeasts (107 cells/mL) were grown after 5 days under static conditions at 30°C in 24-wells polystyrene microplates with 2 mL 0.67% (w/v) YNB without amino acids and 4% (v/v) ethanol (called YNB 4% ETOH medium); a diluted standard red wine with 4% (v/v) ethanol (red wine 4% ETOH) and a synthetic flor medium (Coi et al.2016) with 4% (v/v) ethanol (SFM 4% ETOH). Flor biofilms were photographed at day 5. For the flor dry weight measurement, 50 mL of medium containing 0.67% (w/v) YNB without amino acids and 3% (v/v) ETOH adjusted to pH 3.5 (YNB 3% ETOH pH 3.5) was inoculated with 6 × 107 cells/mL (Ishigami et al.2004)—to attain a high biomass—and cultivated under static conditions for 7 days at 21°C. Flor biofilm was collected by aspiration and remaining yeasts (non-biofilm forming yeasts) were collected by centrifugation and dry weight was measured. Lastly, for the adherence test, yeasts were grown overnight in SC (0.67% (w/v) YNB without amino acids) with 2% (w/v) glucose, and then in SC + 0.1% glucose and aliquoted in 96-wells microplates during 3 hr under static conditions at 25°C. Cells that adhered to plastic were colored with 100 μL crystal violet (1% w/v). After 30 min wells were washed with sterile water and 100 μL 10% SDS was added to each well. After 30 min, 100 μL of sterile water was added, and plates were photographed and adherence was quantified by measuring absorbance at 570 nm. RESULTS Our analyses show that both P3-D5 Δccw14 and P3-D5 Δygp1 flor biofilms were less visible than that of the wild type P3-D5 when cultured in YNB 4% ETOH (Fig. 2). In the other two studied conditions, differences among mutants and wild-type strain were less pronounced. It should be noted that these two conditions were less similar to the flor velum formation condition used for the proteome analyses (0.67% (w/v) YNB without amino acids, 1% w/v glycerol, 10 mM of glutamic acid and 10% (v/v) ETOH) by Moreno-García et al. (2016). FIGURE 2. View largeDownload slide Test for flor velum formation. Cells were resuspended in 2 mL of medium. The wells were photographed after 3 days of static incubation at 30°C. FIGURE 2. View largeDownload slide Test for flor velum formation. Cells were resuspended in 2 mL of medium. The wells were photographed after 3 days of static incubation at 30°C. Biofilm weight and percentage of total biomass (flor forming/flor forming + non-flor forming yeast weight) measurements indicates significant differences depending on the strain as well (F-test P-value < 0.05) (Fig. 3a and c). The two mutants formed less flor than the wild-type strain. Interestingly, the weight of yeast cells that were not forming flor (Fig. 3b) as well as the total weight (flor + non-flor cells) was higher in the case of the mutants. These results are compatible with the hypothesis that the deletion of the CCW14 and YGP1 did not affect yeast growth while determining a significant decrease of flor formation. FIGURE 3. View largeDownload slide Weight of flor biofilm (a) non-flor forming yeast or free yeast (b) and flor weight/free yeast percentage (c) and yeast adherence measured for yeast strains P3-D5 wild type, P3-D5 Δccw14 and P3-D5 Δygp1. Adherence was quantified by absorbance at 570 nm obtained from the adherence to polystyrene tests. Different letters indicate different homogeneous groups among the three strains with significant differences at 0.05 level according to the F-test. The alphabetical order indicates an increasing value. FIGURE 3. View largeDownload slide Weight of flor biofilm (a) non-flor forming yeast or free yeast (b) and flor weight/free yeast percentage (c) and yeast adherence measured for yeast strains P3-D5 wild type, P3-D5 Δccw14 and P3-D5 Δygp1. Adherence was quantified by absorbance at 570 nm obtained from the adherence to polystyrene tests. Different letters indicate different homogeneous groups among the three strains with significant differences at 0.05 level according to the F-test. The alphabetical order indicates an increasing value. The distinct appearance of flor biofilms and the weight values indicate that both, Ccw14p and Ygp1p, have a role in the process of forming flor. Fig. 3b shows the adherence to plastic of the mutant Δccw14 was significantly lower than in the parental strain (F-test P-value < 0.05). Therefore, Ccw14p is needed to achieve a strong adherence to surfaces. DISCUSSION Cell adhesion is defined as the attachment of a cell, either to another cell or to an underlying substrate such as the extracellular matrix, via cell adhesion molecules. In flor yeasts, adhesion to other cells and other inert surfaces makes the biofilm stable. Flo11p, Btn2p and Hsp12p were also reported to have a role in cell adhesion, more specifically in cell to cell adhesion (Zara et al.2002; Espinazo-Romeu et al.2008; Váchová et al.2011). On the contrary, CCW14 has never been annotated with the cell adhesion phenotype in S. cerevisiae. Covalently linked cell wall protein or Ccw14p shares several traits with the biofilm formation-related protein Flo11p: GPI-anchoring, extensively O-glycosylated mannoprotein and cell surface location (Moukadiri et al.1997; Mrsa et al.1999; Yin et al.2005; Yofe et al.2016). The deletion of CCW14 gene resulted in the decrease of the weight of biofilm formed as well as the cell adherence to polystyrene (Fig. 3). The glycosylated nature of Ccw14p, which contributes to the cell surface hydrophobicity (SGD 2017), together with adherence properties, suggest that this protein could regulate flor biofilm formation on flor yeast in a Flo11p similar fashion. Furthermore, as this protein has been reported to have a role in the cell wall organization (Moukadiri et al.1997), it can be speculated as well that Ccw14p promotes flor formation through the arrangement of constituent parts, assembly or disassembly of the cell wall. Ygp1p, on the other hand, is a cell wall-related secretory extensively N-glycosylated glycoprotein that deletion of its codifying gene revealed a significant decrease in the flor dry weight. However, the presence of this protein did not show influence on the adherence of the cells. As Ygp1p has only been localized in the extracellular region (Curwin, Fairn and McMaster 2009), we hypothesize that this protein may form a portion of the composition of an extracellular matrix not described although its presence has been revealed in flor yeasts (Zara et al.2009) and flocculent yeasts (Beauvais et al.2009). Ygp1p protein is hydrophobic not only because of the presence of attached carbohydrate groups, but also because of the hydrophobicity of the polypeptide chain itself (Uniprot 2017). If compared with Flo11p, the hydropathicity index shows that Ygp1p amino acid sequence is hydrophobic (0.12), while Flo11p is hydrophilic (−0.37). Moreover, in terms of the attached carbohydrates, Ygp1p has 14 glycosylation sites in their amino acid sequence compared to 2 in Flo11p. CONCLUSION Ccw14p and Ygp1p are two proteins that affect flor formation in a medium that simulated Sherry wine elaboration conditions, and they can be regarded as potential targets to promote the flor formation during the Sherry wine elaboration process. Moreover, these two proteins share homology with other proteins synthesized by other yeasts (with annotated genomes available in databases) such as the biofilm forming-pathogen yeast Candida glabrata (Ccw14p shares 72% and Ygp1p 51%); thus, they can also be considered potential targets to prevent biofilm formation in C. glabrata and other pathogenic biofilm yeasts. FUNDING This work was supported by the Spain's Ministry of Economy and Competitiveness and the European Community (FEDER), Grant RTA2011-00020-C02-02, MINECO-INIA-CCAA; ‘XXI Programa Propio de Fomento de la Investigación 2017’ from University of Cordoba; funding from the University of Córdoba: the scholarship ‘Ayuda para la realización de estancias para la obtención de la mención internacional en el título de doctor’ [Jaime Moreno-García]. Conflict of interest. None declared. REFERENCES Alexandre H. Flor yeasts of Saccharomyces cerevisiae—their ecology, genetics and metabolism. Int J Food Microbiol  2013; 167: 269– 75. Google Scholar CrossRef Search ADS PubMed  Beauvais A, Loussert C, Prevost MC et al.   Characterization of a biofilm-like extracellular matrix in FLO1-expressing Saccharomyces cerevisiae cells. FEMS Yeast Res  2009; 9: 411– 9. Google Scholar CrossRef Search ADS PubMed  Coi AL, Bigey F, Mallet S et al.   Genomic signatures of adaptation to wine biological ageing conditions in biofilm-forming flor yeasts. Mol Ecol  2017; 26: 2150– 66. Google Scholar CrossRef Search ADS PubMed  Coi AL, Legra JL, Zara G et al.   A set of haploid strains available for genetic studies of Saccharomyces cerevisiae flor yeasts. FEMS Yeast Res  2016; 16: 1– 9. Google Scholar CrossRef Search ADS   Curwin AJ, Fairn GD, McMaster CR. Phospholipid transfer protein Sec14 is required for trafficking from endosomes and regulates distinct trans-Golgi export pathways. J Biol Chem  2009; 284: 7364– 75. Google Scholar CrossRef Search ADS PubMed  Espinazo-Romeu M, Cantoral JM, Matallana E et al.   Btn2p is involved in ethanol tolerance and biofilm formation in flor yeast. FEMS Yeast Res  2008; 8: 1127– 36. Google Scholar CrossRef Search ADS PubMed  Fidalgo M, Barrales RR, Ibeas J et al.   Adaptive evolution by mutations in the FLO11 gene. Proc Natl Acad Sci  2006; 103: 11228– 33. Google Scholar CrossRef Search ADS PubMed  Güldener U, Heck S, Fielder T et al.   A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res  1996; 24: 2519– 24. Google Scholar CrossRef Search ADS PubMed  Ishigami M, Nakagawa Y, Hayakawa M et al.   FLO11 is essential for flor formation caused by the C-terminal deletion of NRG1 in Saccharomyces cerevisiae. FEMS Microbiol Lett  2004; 237: 425– 30. Google Scholar PubMed  Legras JL, Moreno-Garcia J, Zara S et al.   Flor yeast: new perspectives beyond wine aging. Front Microbiol  2016; 7: 1– 11. Google Scholar CrossRef Search ADS PubMed  López-Alejandre MM. Los vinos de Montilla–Moriles . 2nd ed. Sevilla, Spain: Junta de Andalucía, Consejería de Agricultura y Pesca, 2005. Martínez P, Perez-Rodriguez L, Benitez T. Velum formation by flor yeasts isolated from sherry wines. Am J Enol Vitic  1997; 48: 55– 62. Moreno-García J, Mauricio JC, Moreno J et al.   Stress responsive proteins of a flor yeast strain during the early stages of biofilm formation. Process Biochem  2016; 51: 578– 88. Google Scholar CrossRef Search ADS   Moukadiri I, Armero J, Abad A et al.   Identification of a mannoprotein present in the inner layer of the cell wall of Saccharomyces cerevisiae. J Bacteriol  1997; 179: 2154– 62. Google Scholar CrossRef Search ADS PubMed  Mrsa V, Ecker M, Strahl-Bolsinger S et al.   Deletion of new covalently linked cell wall glycoproteins alters the electrophoretic mobility of phosphorylated wall components of Saccharomyces cerevisiae. J Bacteriol  1999; 181: 3076– 86. Google Scholar PubMed  Peinado RA, Mauricio JC. Biologically aged wines. In: Moreno-Arribas MV, Polo MC (eds). Wine Chemistry and Biochemistry . New York: Springer, 2009, 81– 103. Google Scholar CrossRef Search ADS   Purevdorj-Gage B, Orr ME, Stoodley P et al.   The role of FLO11 in Saccharomyces cerevisiae biofilm development in a laboratory based flow-cell system. FEMS Yeast Res  2007; 7: 372– 9. Google Scholar CrossRef Search ADS PubMed  Reynolds TB, Fink GR. Bakers' yeast, a model for fungal biofilm formation. Science  2001; 291: 878– 81. Google Scholar CrossRef Search ADS PubMed  Saccharomyces Genome Database. https://www.yeastgenome.org/ (2 September 2017, date last accessed). Uniprot. http://www.uniprot.org/ (2 September 2017, date last accessed). Váchová L, Št́ovíček V, Hlaváček O et al.   Flo11p, drug efflux pumps, and the extracellular matrix cooperate to form biofilm yeast colonies. J Cell Biol  2011; 29: 1– 9. Yin QY, de Groot PW, Dekker HL et al.   Comprehensive proteomic analysis of Saccharomyces cerevisiae cell walls. J Biol Chem  2005; 280: 20894– 901. Google Scholar CrossRef Search ADS PubMed  Yofe I, Weill U, Meurer M et al.   One library to make them all: streamlining the creation of yeast libraries via a SWAp-Tag strategy. Nat Methods  2016; 13: 371– 8. Google Scholar CrossRef Search ADS PubMed  Zara G, Zara S, Pinna C et al.   FLO11 gene length and transcriptional level affect biofilm-forming ability of wild flor strains of Saccharomyces cerevisiae. Microbiology  2009; 155: 3838– 46. Google Scholar CrossRef Search ADS PubMed  Zara G, Budroni M, Mannazzu I et al.   Air-liquid biofilm formation is dependent on ammonium depletion in a Saccharomyces cerevisiae flor strain. Yeast  2011; 28: 809– 14. Google Scholar CrossRef Search ADS PubMed  Zara S, Bakalinsky AT, Zara G et al.   FLO11-based model for air-liquid interfacial biofilm formation by Saccharomyces cerevisiae. Appl Environ Microbiol  2005; 71: 2934– 9. Google Scholar CrossRef Search ADS PubMed  Zara S, Farris AG, Budroni M et al.   HSP12 is essential for biofilm formation by a Sardinian wine strain of S. cerevisiae. Yeast  2002; 19: 269– 76. Google Scholar CrossRef Search ADS PubMed  Zara S, Gross MK, Zara G et al.   Ethanol-independent biofilm formation by a flor wine yeast strain of Saccharomyces cerevisiae. Appl Environ Microbiol  2010; 76: 4089– 91. Google Scholar CrossRef Search ADS PubMed  © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png FEMS Yeast Research Oxford University Press

Study of the role of the covalently linked cell wall protein (Ccw14p) and yeast glycoprotein (Ygp1p) within biofilm formation in a flor yeast strain

Loading next page...
 
/lp/ou_press/study-of-the-role-of-the-covalently-linked-cell-wall-protein-ccw14p-7OPvSSV1gY
Publisher
Blackwell
Copyright
© FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
1567-1356
eISSN
1567-1364
D.O.I.
10.1093/femsyr/foy005
Publisher site
See Article on Publisher Site

Abstract

Abstract Flor yeasts are Saccharomyces cerevisiae strains noted by their ability to create a type of biofilm in the air–liquid interface of some wines, known as ‘flor’ or ‘velum’, for which certain proteins play an essential role. Following a proteomic study of a flor yeast strain, we deleted the CCW14 (covalently linked cell wall protein) and YGP1 (yeast glycoprotein) genes—codifying for two cell surface glycoproteins—in a haploid flor yeast strain and we reported that both influence the weight of the biofilm as well as cell adherence (CCW14). flor yeast, flor biofilm, Ccw14p, Ygp1p, cell adherence, cell surface hydrophobicity INTRODUCTION Flor yeasts are Saccharomyces cerevisiae strains known in the enological field due to their ability to form a type of biofilm in the wine–air interface, known as ‘flor’ or ‘velum’, which confers sensorial properties during the elaboration of Sherry-like wines (López-Alejandre 2005; Peinado and Mauricio 2009; Legras et al.2016). During the wine elaboration process, the lack of sugars that have been consumed during the previous fermentation triggers flor yeast to develop the flor in the wine–air interface that allows them to reach an oxygen-rich zone where it is possible to oxidatively catabolize the remaining carbon sources from the fermentation, ethanol or glycerol (Zara et al.2010, 2011; Alexandre 2013). This feature is significantly attributed to a high cell surface hydrophobicity (Martínez, Perez-Rodriguez and Benitez 1997), increased cell buoyancy, yeast lipid content/composition (Zara et al.2009) and the presence of certain proteins such as Flocculin-11 (Flo11p), Batten disease protein 2 (Btn2p), 12 kDa heat shock protein (Hsp12p) and Transcriptional regulator NRG1 (Nrg1p) (Zara et al.2002; Ishigami et al.2004; Espinazo-Romeu et al.2008). Among them, Flo11p plays an essential role. This is a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that contributes to the cell rising and hydrophobicity (Reynolds and Fink 2001; Ishigami et al.2004; Zara et al.2005; Fidalgo et al.2006; Purevdorj-Gage et al.2007). Although several traits of the flor formation have been revealed, other aspects like the composition of an extracellular matrix reported by Zara et al. (2009) or the existence of other parietal proteins besides Flo11p involved in the flor formation persist unknown. Moreno-García et al. (2016) investigated the proteome of a flor yeast, and they identified two extensively glycosylated cell surface proteins, Ccw14p (Covalently linked Cell Wall protein) and Ygp1p (Yeast GlycoProtein), that may have a crucial function in the flor formation process. In this work, we evaluated the contribution of proteins Ccw14 and Ygp1 to the biofilm ability of a flor strain using a haploid strain in which the relative ORFs have been deleted, and phenotypes related to the flor biofilm formation were analyzed. MATERIAL AND METHODS Saccharomyces cerevisiae P3-D5 MAT α strain CLIB 1772 (Jura, France), a haploid flor yeast strain was used for the genotypic/phenotypic studies (Coi et al.2016, 2017). Ccw14p and Ygp1p were selected for their ORFs deletion, according to the following election criteria: high concentration under a flor biofilm formation condition (Moreno-García et al.2016) and similarity with Flo11p on the base of hydrophobic character and cell surface location (Fig. 1). Protein hydrophobicity was determined in silico by using the Saccharomyces Genome Database (SGD) and Uniprot databases taking into account the protein hydropathicity index (positively rated proteins being more hydrophobic) and the number of glycosylation sites in the amino acid sequence. FIGURE 1. View largeDownload slide Criteria for the selection of the proteins. FIGURE 1. View largeDownload slide Criteria for the selection of the proteins. Phleomycin markers flanked by sequences homologous to the genes CCW14 and YGP1 were amplified by PCR using oligos shown in Table 1 to construct the deletion cassettes called Ble. The PCR reaction mix (50 μl) contained: 5 μl 10X PCR Buffer-MgCl2 Invitrogen (Carlsbad, California), 2 mM dNTP Mix, 50 mM MgCl2, 10 mM of each construction primer (Table 1), 25 ng pUG66 template DNA, 2.5 U Taq DNA Polymerase Invitrogen. PCR conditions were 94°C for 3 min, 94°C for 45 sec, 55°C for 30 sec, 72°C for 1 min 30 sec (30 cycles), 72°C for 10 min. The PCR product was purified (Qiagen, Inc., Hilden, Germany) and used to transform the strains P3-D5 MAT α using the protocol described by Güldener et al. (1996). Selection of transformants was performed on YPD (1% yeast extract, 2% peptone, 2% glucose and 2% agar) plates containing 150 μg/mL phleomycin. Confirmation of allele deletion was made by PCR using primers indicated in the Table 1 and consisting in a 12.5 μL PCR reaction mix: 1.25 μl 10X PCR Buffer-MgCl2 Invitrogen, 2 mM dNTP Mix, 50 mM MgCl2, 10 mM of each verification primer and 10 μM for Ble1 and Ble 2 (Table 1) (VerFw-VerRv for the first PCR verification, VerFw-Ble1 for the second and VerRv-Ble2 for the third), 15 μg template DNA, 0.625 U Taq DNA Polymerase Invitrogen. PCR conditions were the same as in the cassette construction. The proper insertion of deletion cassettes in place of CCW14 or YGP1 was verified also by Sanger sequencing (GATC-Biotech, Konstanz, Germany sequencing service) using their respective verification primers, after PCR amplification and purification (Qiagen PCR purification kit) of the corresponding regions. DNA homology searches were performed using the Basic Local Alignment Search Tool (BLAST) algorithm through the National Center for Biotechnology Information (NCBI) and SGD. TABLE 1. DNA primers. Primer  Sequence  Purpose  CCW14PhleFw  5΄ CAGCACTACTAGACTCGTTCAACACTCGTTATATA TTATCGTACGCTGCAGGTCGACAAC 3΄  Construction of the CCW14::PHLEO cassette from pUG66  CCW14PhleRv  5΄ GATAGATACCTTAACCCATTAGAAATAAAGTGATAGATAAACTATAGGGAGACCGGCAGA 3΄  Construction of the CCW14::PHLEO cassette from pUG66  CCW14VerFw  5΄ CCAGAATACGACGAGGACGG 3΄  Verification of insertion of CCW14::PHLEO cassette  CCW14VerRv  5΄ CCCAGATATGTACCGCCACC 3΄  Verification of insertion of CCW14::PHLEO cassette  YGP1PhleFw  5΄ TCTACTGGATTAATCGTCAGTTAAGTAATACAGTAAT AGAAAGTACGCTGCAGGTCGACAAC 3΄  Construction of the YGP1::PHLEO cassette from pUG66  YGP1PhleRv  5΄ AAAGAATCTCTATGCTTCGCTAGATTTAATATCTATCAGTACTATAGGGAGACCGGCAGA 3΄  Construction of the YGP1::PHLEO cassette from pUG66  YGP1VerFw  5΄ CGGCTTCTCGATGCTACAGT 3΄  Verification of insertion of YGP1::PHLEO cassette  YGP1VerRv  5΄ AGAAGGGGGTGAGATCCCTT 3΄  Verification of insertion of YGP1::PHLEO cassette  Ble1  5΄ GTGGGCGAAGAACTCCAG 3΄  Verification of insertion of PHLEO cassette  Ble2  5΄ GTTCTACCGGCAGTGCAAAT 3΄  Verification of insertion of PHLEO cassette  Primer  Sequence  Purpose  CCW14PhleFw  5΄ CAGCACTACTAGACTCGTTCAACACTCGTTATATA TTATCGTACGCTGCAGGTCGACAAC 3΄  Construction of the CCW14::PHLEO cassette from pUG66  CCW14PhleRv  5΄ GATAGATACCTTAACCCATTAGAAATAAAGTGATAGATAAACTATAGGGAGACCGGCAGA 3΄  Construction of the CCW14::PHLEO cassette from pUG66  CCW14VerFw  5΄ CCAGAATACGACGAGGACGG 3΄  Verification of insertion of CCW14::PHLEO cassette  CCW14VerRv  5΄ CCCAGATATGTACCGCCACC 3΄  Verification of insertion of CCW14::PHLEO cassette  YGP1PhleFw  5΄ TCTACTGGATTAATCGTCAGTTAAGTAATACAGTAAT AGAAAGTACGCTGCAGGTCGACAAC 3΄  Construction of the YGP1::PHLEO cassette from pUG66  YGP1PhleRv  5΄ AAAGAATCTCTATGCTTCGCTAGATTTAATATCTATCAGTACTATAGGGAGACCGGCAGA 3΄  Construction of the YGP1::PHLEO cassette from pUG66  YGP1VerFw  5΄ CGGCTTCTCGATGCTACAGT 3΄  Verification of insertion of YGP1::PHLEO cassette  YGP1VerRv  5΄ AGAAGGGGGTGAGATCCCTT 3΄  Verification of insertion of YGP1::PHLEO cassette  Ble1  5΄ GTGGGCGAAGAACTCCAG 3΄  Verification of insertion of PHLEO cassette  Ble2  5΄ GTTCTACCGGCAGTGCAAAT 3΄  Verification of insertion of PHLEO cassette  View Large Flo11p-related phenotypes were analyzed in different media. Biofilm formation was observed when yeasts (107 cells/mL) were grown after 5 days under static conditions at 30°C in 24-wells polystyrene microplates with 2 mL 0.67% (w/v) YNB without amino acids and 4% (v/v) ethanol (called YNB 4% ETOH medium); a diluted standard red wine with 4% (v/v) ethanol (red wine 4% ETOH) and a synthetic flor medium (Coi et al.2016) with 4% (v/v) ethanol (SFM 4% ETOH). Flor biofilms were photographed at day 5. For the flor dry weight measurement, 50 mL of medium containing 0.67% (w/v) YNB without amino acids and 3% (v/v) ETOH adjusted to pH 3.5 (YNB 3% ETOH pH 3.5) was inoculated with 6 × 107 cells/mL (Ishigami et al.2004)—to attain a high biomass—and cultivated under static conditions for 7 days at 21°C. Flor biofilm was collected by aspiration and remaining yeasts (non-biofilm forming yeasts) were collected by centrifugation and dry weight was measured. Lastly, for the adherence test, yeasts were grown overnight in SC (0.67% (w/v) YNB without amino acids) with 2% (w/v) glucose, and then in SC + 0.1% glucose and aliquoted in 96-wells microplates during 3 hr under static conditions at 25°C. Cells that adhered to plastic were colored with 100 μL crystal violet (1% w/v). After 30 min wells were washed with sterile water and 100 μL 10% SDS was added to each well. After 30 min, 100 μL of sterile water was added, and plates were photographed and adherence was quantified by measuring absorbance at 570 nm. RESULTS Our analyses show that both P3-D5 Δccw14 and P3-D5 Δygp1 flor biofilms were less visible than that of the wild type P3-D5 when cultured in YNB 4% ETOH (Fig. 2). In the other two studied conditions, differences among mutants and wild-type strain were less pronounced. It should be noted that these two conditions were less similar to the flor velum formation condition used for the proteome analyses (0.67% (w/v) YNB without amino acids, 1% w/v glycerol, 10 mM of glutamic acid and 10% (v/v) ETOH) by Moreno-García et al. (2016). FIGURE 2. View largeDownload slide Test for flor velum formation. Cells were resuspended in 2 mL of medium. The wells were photographed after 3 days of static incubation at 30°C. FIGURE 2. View largeDownload slide Test for flor velum formation. Cells were resuspended in 2 mL of medium. The wells were photographed after 3 days of static incubation at 30°C. Biofilm weight and percentage of total biomass (flor forming/flor forming + non-flor forming yeast weight) measurements indicates significant differences depending on the strain as well (F-test P-value < 0.05) (Fig. 3a and c). The two mutants formed less flor than the wild-type strain. Interestingly, the weight of yeast cells that were not forming flor (Fig. 3b) as well as the total weight (flor + non-flor cells) was higher in the case of the mutants. These results are compatible with the hypothesis that the deletion of the CCW14 and YGP1 did not affect yeast growth while determining a significant decrease of flor formation. FIGURE 3. View largeDownload slide Weight of flor biofilm (a) non-flor forming yeast or free yeast (b) and flor weight/free yeast percentage (c) and yeast adherence measured for yeast strains P3-D5 wild type, P3-D5 Δccw14 and P3-D5 Δygp1. Adherence was quantified by absorbance at 570 nm obtained from the adherence to polystyrene tests. Different letters indicate different homogeneous groups among the three strains with significant differences at 0.05 level according to the F-test. The alphabetical order indicates an increasing value. FIGURE 3. View largeDownload slide Weight of flor biofilm (a) non-flor forming yeast or free yeast (b) and flor weight/free yeast percentage (c) and yeast adherence measured for yeast strains P3-D5 wild type, P3-D5 Δccw14 and P3-D5 Δygp1. Adherence was quantified by absorbance at 570 nm obtained from the adherence to polystyrene tests. Different letters indicate different homogeneous groups among the three strains with significant differences at 0.05 level according to the F-test. The alphabetical order indicates an increasing value. The distinct appearance of flor biofilms and the weight values indicate that both, Ccw14p and Ygp1p, have a role in the process of forming flor. Fig. 3b shows the adherence to plastic of the mutant Δccw14 was significantly lower than in the parental strain (F-test P-value < 0.05). Therefore, Ccw14p is needed to achieve a strong adherence to surfaces. DISCUSSION Cell adhesion is defined as the attachment of a cell, either to another cell or to an underlying substrate such as the extracellular matrix, via cell adhesion molecules. In flor yeasts, adhesion to other cells and other inert surfaces makes the biofilm stable. Flo11p, Btn2p and Hsp12p were also reported to have a role in cell adhesion, more specifically in cell to cell adhesion (Zara et al.2002; Espinazo-Romeu et al.2008; Váchová et al.2011). On the contrary, CCW14 has never been annotated with the cell adhesion phenotype in S. cerevisiae. Covalently linked cell wall protein or Ccw14p shares several traits with the biofilm formation-related protein Flo11p: GPI-anchoring, extensively O-glycosylated mannoprotein and cell surface location (Moukadiri et al.1997; Mrsa et al.1999; Yin et al.2005; Yofe et al.2016). The deletion of CCW14 gene resulted in the decrease of the weight of biofilm formed as well as the cell adherence to polystyrene (Fig. 3). The glycosylated nature of Ccw14p, which contributes to the cell surface hydrophobicity (SGD 2017), together with adherence properties, suggest that this protein could regulate flor biofilm formation on flor yeast in a Flo11p similar fashion. Furthermore, as this protein has been reported to have a role in the cell wall organization (Moukadiri et al.1997), it can be speculated as well that Ccw14p promotes flor formation through the arrangement of constituent parts, assembly or disassembly of the cell wall. Ygp1p, on the other hand, is a cell wall-related secretory extensively N-glycosylated glycoprotein that deletion of its codifying gene revealed a significant decrease in the flor dry weight. However, the presence of this protein did not show influence on the adherence of the cells. As Ygp1p has only been localized in the extracellular region (Curwin, Fairn and McMaster 2009), we hypothesize that this protein may form a portion of the composition of an extracellular matrix not described although its presence has been revealed in flor yeasts (Zara et al.2009) and flocculent yeasts (Beauvais et al.2009). Ygp1p protein is hydrophobic not only because of the presence of attached carbohydrate groups, but also because of the hydrophobicity of the polypeptide chain itself (Uniprot 2017). If compared with Flo11p, the hydropathicity index shows that Ygp1p amino acid sequence is hydrophobic (0.12), while Flo11p is hydrophilic (−0.37). Moreover, in terms of the attached carbohydrates, Ygp1p has 14 glycosylation sites in their amino acid sequence compared to 2 in Flo11p. CONCLUSION Ccw14p and Ygp1p are two proteins that affect flor formation in a medium that simulated Sherry wine elaboration conditions, and they can be regarded as potential targets to promote the flor formation during the Sherry wine elaboration process. Moreover, these two proteins share homology with other proteins synthesized by other yeasts (with annotated genomes available in databases) such as the biofilm forming-pathogen yeast Candida glabrata (Ccw14p shares 72% and Ygp1p 51%); thus, they can also be considered potential targets to prevent biofilm formation in C. glabrata and other pathogenic biofilm yeasts. FUNDING This work was supported by the Spain's Ministry of Economy and Competitiveness and the European Community (FEDER), Grant RTA2011-00020-C02-02, MINECO-INIA-CCAA; ‘XXI Programa Propio de Fomento de la Investigación 2017’ from University of Cordoba; funding from the University of Córdoba: the scholarship ‘Ayuda para la realización de estancias para la obtención de la mención internacional en el título de doctor’ [Jaime Moreno-García]. Conflict of interest. None declared. REFERENCES Alexandre H. Flor yeasts of Saccharomyces cerevisiae—their ecology, genetics and metabolism. Int J Food Microbiol  2013; 167: 269– 75. Google Scholar CrossRef Search ADS PubMed  Beauvais A, Loussert C, Prevost MC et al.   Characterization of a biofilm-like extracellular matrix in FLO1-expressing Saccharomyces cerevisiae cells. FEMS Yeast Res  2009; 9: 411– 9. Google Scholar CrossRef Search ADS PubMed  Coi AL, Bigey F, Mallet S et al.   Genomic signatures of adaptation to wine biological ageing conditions in biofilm-forming flor yeasts. Mol Ecol  2017; 26: 2150– 66. Google Scholar CrossRef Search ADS PubMed  Coi AL, Legra JL, Zara G et al.   A set of haploid strains available for genetic studies of Saccharomyces cerevisiae flor yeasts. FEMS Yeast Res  2016; 16: 1– 9. Google Scholar CrossRef Search ADS   Curwin AJ, Fairn GD, McMaster CR. Phospholipid transfer protein Sec14 is required for trafficking from endosomes and regulates distinct trans-Golgi export pathways. J Biol Chem  2009; 284: 7364– 75. Google Scholar CrossRef Search ADS PubMed  Espinazo-Romeu M, Cantoral JM, Matallana E et al.   Btn2p is involved in ethanol tolerance and biofilm formation in flor yeast. FEMS Yeast Res  2008; 8: 1127– 36. Google Scholar CrossRef Search ADS PubMed  Fidalgo M, Barrales RR, Ibeas J et al.   Adaptive evolution by mutations in the FLO11 gene. Proc Natl Acad Sci  2006; 103: 11228– 33. Google Scholar CrossRef Search ADS PubMed  Güldener U, Heck S, Fielder T et al.   A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res  1996; 24: 2519– 24. Google Scholar CrossRef Search ADS PubMed  Ishigami M, Nakagawa Y, Hayakawa M et al.   FLO11 is essential for flor formation caused by the C-terminal deletion of NRG1 in Saccharomyces cerevisiae. FEMS Microbiol Lett  2004; 237: 425– 30. Google Scholar PubMed  Legras JL, Moreno-Garcia J, Zara S et al.   Flor yeast: new perspectives beyond wine aging. Front Microbiol  2016; 7: 1– 11. Google Scholar CrossRef Search ADS PubMed  López-Alejandre MM. Los vinos de Montilla–Moriles . 2nd ed. Sevilla, Spain: Junta de Andalucía, Consejería de Agricultura y Pesca, 2005. Martínez P, Perez-Rodriguez L, Benitez T. Velum formation by flor yeasts isolated from sherry wines. Am J Enol Vitic  1997; 48: 55– 62. Moreno-García J, Mauricio JC, Moreno J et al.   Stress responsive proteins of a flor yeast strain during the early stages of biofilm formation. Process Biochem  2016; 51: 578– 88. Google Scholar CrossRef Search ADS   Moukadiri I, Armero J, Abad A et al.   Identification of a mannoprotein present in the inner layer of the cell wall of Saccharomyces cerevisiae. J Bacteriol  1997; 179: 2154– 62. Google Scholar CrossRef Search ADS PubMed  Mrsa V, Ecker M, Strahl-Bolsinger S et al.   Deletion of new covalently linked cell wall glycoproteins alters the electrophoretic mobility of phosphorylated wall components of Saccharomyces cerevisiae. J Bacteriol  1999; 181: 3076– 86. Google Scholar PubMed  Peinado RA, Mauricio JC. Biologically aged wines. In: Moreno-Arribas MV, Polo MC (eds). Wine Chemistry and Biochemistry . New York: Springer, 2009, 81– 103. Google Scholar CrossRef Search ADS   Purevdorj-Gage B, Orr ME, Stoodley P et al.   The role of FLO11 in Saccharomyces cerevisiae biofilm development in a laboratory based flow-cell system. FEMS Yeast Res  2007; 7: 372– 9. Google Scholar CrossRef Search ADS PubMed  Reynolds TB, Fink GR. Bakers' yeast, a model for fungal biofilm formation. Science  2001; 291: 878– 81. Google Scholar CrossRef Search ADS PubMed  Saccharomyces Genome Database. https://www.yeastgenome.org/ (2 September 2017, date last accessed). Uniprot. http://www.uniprot.org/ (2 September 2017, date last accessed). Váchová L, Št́ovíček V, Hlaváček O et al.   Flo11p, drug efflux pumps, and the extracellular matrix cooperate to form biofilm yeast colonies. J Cell Biol  2011; 29: 1– 9. Yin QY, de Groot PW, Dekker HL et al.   Comprehensive proteomic analysis of Saccharomyces cerevisiae cell walls. J Biol Chem  2005; 280: 20894– 901. Google Scholar CrossRef Search ADS PubMed  Yofe I, Weill U, Meurer M et al.   One library to make them all: streamlining the creation of yeast libraries via a SWAp-Tag strategy. Nat Methods  2016; 13: 371– 8. Google Scholar CrossRef Search ADS PubMed  Zara G, Zara S, Pinna C et al.   FLO11 gene length and transcriptional level affect biofilm-forming ability of wild flor strains of Saccharomyces cerevisiae. Microbiology  2009; 155: 3838– 46. Google Scholar CrossRef Search ADS PubMed  Zara G, Budroni M, Mannazzu I et al.   Air-liquid biofilm formation is dependent on ammonium depletion in a Saccharomyces cerevisiae flor strain. Yeast  2011; 28: 809– 14. Google Scholar CrossRef Search ADS PubMed  Zara S, Bakalinsky AT, Zara G et al.   FLO11-based model for air-liquid interfacial biofilm formation by Saccharomyces cerevisiae. Appl Environ Microbiol  2005; 71: 2934– 9. Google Scholar CrossRef Search ADS PubMed  Zara S, Farris AG, Budroni M et al.   HSP12 is essential for biofilm formation by a Sardinian wine strain of S. cerevisiae. Yeast  2002; 19: 269– 76. Google Scholar CrossRef Search ADS PubMed  Zara S, Gross MK, Zara G et al.   Ethanol-independent biofilm formation by a flor wine yeast strain of Saccharomyces cerevisiae. Appl Environ Microbiol  2010; 76: 4089– 91. Google Scholar CrossRef Search ADS PubMed  © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Journal

FEMS Yeast ResearchOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial