Skeletal Muscle Interleukin-6 Regulates Hepatic Cytochrome P450 Expression: Effects of 16-Week High-Fat Diet and Exercise

Skeletal Muscle Interleukin-6 Regulates Hepatic Cytochrome P450 Expression: Effects of 16-Week... Abstract High-fat diet (HFD) induces several changes to the pathways regulating energy homeostasis and changes the expression of the hepatic cytochrome p450 (Cyp) enzyme-system. Despite these pervious findings, it is still unclear how the effects of HFD and especially HFD in combination with treadmill running affect hepatic Cyp expression. In this study, we investigated the mRNA and protein expression of selected Cyp’s in mice subjected to 16 weeks of HFD and treadmill running. To understand the regulatory mechanisms behind the exercise-induced reversion of the HFD-induced changes in Cyp expression, we used a model in which the exercise-induced myokine and known regulator of hepatic Cyp’s, interleukin-6 (IL-6), were knocked out specifically in skeletal muscle. We found that HFD increased the mRNA expression of Cyp1a1 and Cyp4a10, and decreased the expression of Cyp2a4, Cyp2b10, Cyp2e1, and Cyp3a11. HFD in combination with treadmill running reversed the HFD increase in Cyp4a10 mRNA expression. In addition, we observed increased Cyp1a and Cyp3a protein expression as an effect of exercise, whereas Cyp2b expression was lowered as an effect of HFD. IL-6 effected the response in Cyp3a11 and Cyp1a expression. We observed no changes in the content of the aryl hydrocarbon receptor, constitutive androstane receptor, pregnane X receptor, or peroxisome proliferation activator receptor alpha. In conclusion, we show that both HFD and exercise in HFD-fed animals can regulate hepatic Cyp expression and that changes in Cyp3a in response to HFD and exercise are dependent on skeletal muscular IL-6. detoxification, endurance training, IL-6, nuclear receptors, drug metabolism The liver is the main organ for the biotransformation of xenobiotics, presenting high expression and activity of the cytochrome P450 (CYP) system. In general, biotransformation is conducted in two phases, where the CYPs belonging to family 1–3 are part of phase I, usually adding reactive groups to the parent compound. Accordingly, the regulation and expression of the CYP system is very important for the wellbeing of the individual and has gain a lot of attention during the last decades especially from the pharmaceutical industry. In humans, at least 57 genes coding for CYPs have been identified (Lewis, 2004). In the liver, CYP3A4 is the most predominant isoform taking care of >50% of all prescribed drugs (Guengerich, 2008). The transcriptional regulation of CYP is mediated by a number of transcription factors, including nuclear receptors (NR). It is generally accepted that the CYP subfamily 1A is regulated by aryl hydrocarbon receptor (AhR), 2A and 2B by constitutive androstane receptor (CAR), 3A by pregnane X receptor (PXR), and 4A by peroxisome proliferation activator receptor alpha (PPARα) (Berger and Moller, 2002; Li and Wang, 2010; Timsit and Negishi, 2007; Tolson and Wang, 2010). The classical activation of the NRs includes ligand binding and subsequent translocation to the nucleus where the receptor interacts with promotor regions in the DNA, initiating gene-transcription. Numerous endogenous and exogenous compounds have been identified, as modulators of NR activity, among them are the cytokines (Gerbal-Chaloin et al., 2013). During inflammation, impairment of CYPs expression and activities are often observed (Christensen and Hermann, 2012). The concentration of several cytokines is increased during inflammation and has been suggested to be responsible for the CYP impairment, among them is interleukin-6 (IL-6). Hence, following injection of IL-6 into mice a decrease in Cyp3a11 mRNA has been observed (Teng and Piquette-Miller, 2005). Using PXR knockout mice, this decrease was shown to be dependent on the presence of PXR. The same was later shown using human primary hepatocytes (Yang et al., 2010). Beside the increase in IL-6 associated with inflammation, release of IL-6 into the plasma also occurs during muscular exercise, declining during recovery (Fischer, 2006; Steensberg et al., 2001). In healthy human males conducting one-leg knee extensor exercise for 5 h an approximately 20-fold increase in arterial plasma IL-6 concentration was observed, as well as increased arterial-vein difference over the exercising leg (Steensberg et al., 2000), indicating that muscular derived IL-6 can account for the increase in circulating concentration. High-fat diet (HFD) is associated with gain in body-weight and increased levels of body fat. Additionally, obesity is associated with inflammation, resulting in increased cytokine levels, including IL-6 (Gregor and Hotamisligil, 2011). Basal plasma levels of IL-6 have been shown to be positively correlated to the percentage of body fat (Vozarova et al., 2001). Several studies in mice have investigated the expression of CYPs as a function of HFD with contradicting results (Ghose et al., 2011; Kim et al., 2004; Ning and Jeong, 2017; Spruiell et al., 2014; Tajima et al., 2013; Yoshinari et al., 2006). For example, the study by Ghose et al, (2011) demonstrated decreased Cyp3a11 expression in CD1 mice fed a HFD containing 60% energy from fat for 14 weeks. In contrast, the study by Kim et al. (2004), demonstrated increased Cyp3a11 in C57B1/J6 mice fed HFD with 36% energy for 12 weeks. Hence, there seemes to be a discrepancy about the effect of HFD existing in the literature, that needs to be clarified. The study was undertaken to investigate the hypotheses that (1) HFD affects Cyp gene expression and (2) that exercise affects HFD-induced changes in Cyp expression in a skeletal muscle IL-6 dependent manner. To investigate that, both control mice and muscle-specific IL-6 knockout mice (IL-6 MKO) were divided into groups being either fed high-fat or control diet in combination with 16 weeks of treadmill running or not. Following the treatment period, liver tissue was collected and expression of selected nuclear receptors and Cyp isoforms were analyzed. MATERIALS AND METHODS Animals and intervention Mice with skeletal muscle specific knockout of the IL-6 gene (IL-6 MKO) were generated by crossing C57Bl/6 mice with a LoxP site surrounding the second exon of the IL-6 gene with mice expressing CRE recombinase under the control of the myogenin promoter as previously described in Ferrer et al. (2014) and Knudsen et al. (2015). At the age of 12 weeks, IL-6 MKO and control (Floxed; control) mice were divided into 3 groups, with 10 in each, receiving either (1) standard rodent chow (Chow), (2) HFD, or (3) HFD combined with exercise for 16 weeks (HFD ExTr). The exercise regimen consisted of voluntary wheel running for the first 12 weeks of the intervention and voluntary wheel running combined with 3 h of weekly treadmill running for the last 4 weeks as previously described in Knudsen et al. (2015). The mice were given ad libitum access to food and water in a 12:12-h light:dark environment at a constant temperature of 22 °C. At the end of the experiment, mice were euthanized by cervical dislocation and the liver removed and snap frozen in liquid nitrogen. Details about the mice have been published before in Knudsen et al. (2015, 2016). RNA isolation and reverse transcription Total RNA were isolated using TriReagent, according to the manufactures protocol (Sigma-Aldrich, Schnelldorf, Germany). Equal amounts of RNA were converted into cDNA using iScript, according to the manufactures protocol (Bio-Rad, Solna, Sweden). Real-time PCR For the analysis of the expression of the specific mRNA primers and TaqMan probes were designed using Primer Express (Version 2, Applied Biosystems, Californien, USA) and mouse-specific gene sequences obtained from Ensembl (http://www.ensembl.org/Mus_musculus/Info/Index). All primers and probe pair were designed to expand exon-exon junctions and target specificity verified using BLAST searching. Primers and probe sequences are given in Table 1. The RT-PCR reaction were performed using the StepOne Plus thermocycler executing the following temperature profile: 50 °C for 2 min, 95 °C for 10 min and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. All samples were analyzed in duplicates. The relative gene expression was normalized to the expression of GAPDH. There were no difference in the obtained Ct-values for GAPDH values between the different experimental groups. Table 1. Primer and TaqMan Probes for Real-Time PCR Name  Forward (5′-3′)  Reverse (5′-3′)  TaqMan Probe (5′-3′)  CYP1A1  GACCTTCCGGCATTCATCCT  GCCATTCAGACTTGTATCTCTTGTG  CGTCCCCTTCACCATCCCCCA  CYP1A2  TGGAGCTGGCTTTGACACAG  CGTTAGGCCATGTCACAAGTAGC  CACCACAGCCATCACCTGGAGCATTT  CYP2A4  TCGAGGAGCGCATCCAA  AATGAAAGCACCGTTCGTCTTC  AGGCGGGCTTTCTCATCGATTCATTTC  CYP2B10  CCAGCCAGATGTTTGAGCTCTT  GGAGTTCCTGCAGGTTTTTGG  TTCCTGAAGTACTTTCCTGGTGCCCACA  CYP2E1  TTTCCCTAAGTATCCTCCGTGACT  GCTGGCCTTTGGTCTTTTTG  CCCGCATCCAAAGAGAGGCACACT  CYP3A11  AACTGCAGGATGAGATCGATGAG  TTCATTAAGCACCATATCCAGGTATT  CAACAAGGCACCTCCCACGTATGATACTG  CYP4A10  TCCAGGTTTGCACCAGACTCT  AGTTCCTGGCTCCTCCTGAGA  CGACACAGCCACTCATTCCTGCCC  AhR  GCGGCGCCAACATCA  GTCGCTTAGAAGGATTTGACTTAATTC  CAGAAAACAGTAAAGCCCATCCCCGC  CAR  TCAACACGTTTATGGTGCAACA  CAGCCGCTCCCTTGAGAAG  ATCAAGTTCACCAAGGATCTGCCGCTC  PXR  CACCTGGCCGATGTGTCA  AATAGGCAGGTCCCTAAAGTAGGATAT  CAAGGGCGTCATCAACTTCGCCAA  PPARα  CGCTGCCGCCAAGTTG  GAACTTGACCAGCCACAAACG  AGGCCCTGCCTTCCCTGTGAACTG  β-actin  GCTTCTTTGCAGCTCCTTCGT  GCGCAGCGATATCGTCATC  CCGGTCCACACCCGCCACC  Name  Forward (5′-3′)  Reverse (5′-3′)  TaqMan Probe (5′-3′)  CYP1A1  GACCTTCCGGCATTCATCCT  GCCATTCAGACTTGTATCTCTTGTG  CGTCCCCTTCACCATCCCCCA  CYP1A2  TGGAGCTGGCTTTGACACAG  CGTTAGGCCATGTCACAAGTAGC  CACCACAGCCATCACCTGGAGCATTT  CYP2A4  TCGAGGAGCGCATCCAA  AATGAAAGCACCGTTCGTCTTC  AGGCGGGCTTTCTCATCGATTCATTTC  CYP2B10  CCAGCCAGATGTTTGAGCTCTT  GGAGTTCCTGCAGGTTTTTGG  TTCCTGAAGTACTTTCCTGGTGCCCACA  CYP2E1  TTTCCCTAAGTATCCTCCGTGACT  GCTGGCCTTTGGTCTTTTTG  CCCGCATCCAAAGAGAGGCACACT  CYP3A11  AACTGCAGGATGAGATCGATGAG  TTCATTAAGCACCATATCCAGGTATT  CAACAAGGCACCTCCCACGTATGATACTG  CYP4A10  TCCAGGTTTGCACCAGACTCT  AGTTCCTGGCTCCTCCTGAGA  CGACACAGCCACTCATTCCTGCCC  AhR  GCGGCGCCAACATCA  GTCGCTTAGAAGGATTTGACTTAATTC  CAGAAAACAGTAAAGCCCATCCCCGC  CAR  TCAACACGTTTATGGTGCAACA  CAGCCGCTCCCTTGAGAAG  ATCAAGTTCACCAAGGATCTGCCGCTC  PXR  CACCTGGCCGATGTGTCA  AATAGGCAGGTCCCTAAAGTAGGATAT  CAAGGGCGTCATCAACTTCGCCAA  PPARα  CGCTGCCGCCAAGTTG  GAACTTGACCAGCCACAAACG  AGGCCCTGCCTTCCCTGTGAACTG  β-actin  GCTTCTTTGCAGCTCCTTCGT  GCGCAGCGATATCGTCATC  CCGGTCCACACCCGCCACC  Abbreviations: AhR, Aryl hydrocarbon receptor; CAR, constitutive androstane receptor; PXR, pregnane X receptor; PPARα, peroxisome proliferator-activated receptor α. Western blotting Protein lysate for western blotting were prepared as described elsewhere (Knudsen et al., 2015). Western blotting was done according to Rasmussen et al. (2016b). The used antibodies are given in Supplementary data 1. The relative protein expression of the analyzed Cyp’s were normalised to the protein expression of β-actin. Statistics Data are presented as the mean ± SEM. Two-way ANOVA was used to evaluate the effect of intervention (Chow, HFD, or HFD ExTr) and genotype (Floxed and IL-6 MKO). The data were log10 transformed if they failed an equal variance test. If an overall effect was observed, Tukey’s post hoc test was used to identify differences between groups. For all tests, p < .05 was regarded as significant. RESULTS Impact of HFD, Exercise Training and Skeletal Muscle IL-6 on Hepatic CYP The mRNA expression of Cyp1a1 were significantly increased in the mice fed HFD compared with the Chow fed ones (Figure 1A). The HFD-induced increase was not affected by 16 weeks of exercise running or skeletal muscle specific knockout of IL-6. In contrast, HFD and exercise training as well as genotype had no effect on Cyp1a2 mRNA expression (Figure 1B). Cyp2a4 and Cyp2e1 mRNA expression was significantly reduced by HFD in both genotypes and were not affected by additional exercise training or loss of skeletal muscle IL-6 (Figs. 1C and E). For Cyp2b10, HFD and exercise training seemed to lower the mRNA expression in both genotypes, even though statistical significance was not reached with HFD in the control group (Figure 1D). Genotype had no effect on Cyp2b10 expression. For all IL-6 MKO groups, Cyp3a11 mRNA expression was increased compared to control. (Figure 1F). Moreover, Cyp3a11 mRNA expression was reduced in the HFD group compared with control in both genotypes. This reduction was exacerbated in the HFD ExTr group. As expected, Cyp4a10 mRNA expression was strongly increased following HFD regimen compared with control in both genotypes. This increase was not observed in the HFD ExTr groups (Figure 1G). Figure 1. View large Download slide View large Download slide HFD in combination or not with exercise training modify hepatic Cyp mRNA content in mice. mRNA content of (A) Cyp1a1, (B) Cyp1a2, (C) Cyp2a4, (D) Cyp2b10, (E) Cyp2e1, (F) Cyp3a11, and (G) Cyp4a10 in liver samples from control and muscle specific IL-6 knockout (MKO IL-6) mice (n = 9–10) subjected to 16 weeks of standard chow (chow), HFD and HFD in combination with exercise (HFD ExTr). Values are the mean ± SEM. *Different from Chow within genotype (p < .05); §different from HFD within genotype (p < .05); #differences between genotypes within treatment (p < .05). Figure 1. View large Download slide View large Download slide HFD in combination or not with exercise training modify hepatic Cyp mRNA content in mice. mRNA content of (A) Cyp1a1, (B) Cyp1a2, (C) Cyp2a4, (D) Cyp2b10, (E) Cyp2e1, (F) Cyp3a11, and (G) Cyp4a10 in liver samples from control and muscle specific IL-6 knockout (MKO IL-6) mice (n = 9–10) subjected to 16 weeks of standard chow (chow), HFD and HFD in combination with exercise (HFD ExTr). Values are the mean ± SEM. *Different from Chow within genotype (p < .05); §different from HFD within genotype (p < .05); #differences between genotypes within treatment (p < .05). Protein expression levels of Cyp1a, Cyp2b, Cyp2e1, Cyp3a, and Cyp4a were also analyzed. Cyp1a protein content increased in HFD ExTr mice compared with all other groups (Figs. 2A and F). This increase was not observed in the IL-6 MKO mice. The protein expression of Cyp2b in the HFD and HFD ExTr mice were lower compared with the Chow fed group, within the control group (Figs. 2B and F). There was no differences in Cyp2e1 protein expression. (Figs. 2C and F). HFD and exercise had no effect on the expression on Cyp3a protein in the control group. In contrast HFD reduced Cyp3a protein expression in the IL-6 MKO group, and this effect was not observed following exercise training (Figure 2D). Cyp4a protein expression was lower in the IL-6 MKO group compared with control in the chow fed group (Figs. 2E and F). Figure 2. View largeDownload slide HFD in combination or not with exercise training modify hepatic Cyp protein content in mice. Protein content of (A) Cyp1a, (B) Cyp2b, (C) Cyp2e1, (D) Cyp3a and E) Cyp4a in liver samples from control and MKO IL-6 mice (n = 9–10) subjected to 16 weeks of standard chow (chow), HFD, and HFD in combination with exercise (HFD ExTr). (F) Representative protein blots. Values are the mean ± SEM. *Different from Chow within genotype (p < .05); §different from HFD within genotype (p < .05); #differences between genotypes within treatment (p < .05). Figure 2. View largeDownload slide HFD in combination or not with exercise training modify hepatic Cyp protein content in mice. Protein content of (A) Cyp1a, (B) Cyp2b, (C) Cyp2e1, (D) Cyp3a and E) Cyp4a in liver samples from control and MKO IL-6 mice (n = 9–10) subjected to 16 weeks of standard chow (chow), HFD, and HFD in combination with exercise (HFD ExTr). (F) Representative protein blots. Values are the mean ± SEM. *Different from Chow within genotype (p < .05); §different from HFD within genotype (p < .05); #differences between genotypes within treatment (p < .05). Impact of HFD, Exercise Training and Skeletal Muscle IL-6 on Ahr, CAR, PXR, and PPARα The mRNA levels of the nuclear receptors controlling the expression of the investigated Cyp’s were also investigated. The expression levels of AhR, CAR, PXR, and PPARα were not different between the different groups (Figs. 3A–D), except for a small decrease in the expression of AhR in the HFD control group compared with the IL-6 MKO HFD group (Figure 3A). Figure 3. View largeDownload slide HFD in combination or not with exercise training has no effect on the hepatic mRNA content of selected transcription factors in mice. mRNA content of (A) AhR, (B) CAR, (C) PXR, and (D) PPARα in liver samples from control and MKO IL-6 mice (n = 9–10) subjected to 16 weeks of standard chow (chow), HFD and HFD in combination with exercise (HFD ExTr). Values are the mean ± SEM. #Differences between genotypes within treatment (p < .05). Figure 3. View largeDownload slide HFD in combination or not with exercise training has no effect on the hepatic mRNA content of selected transcription factors in mice. mRNA content of (A) AhR, (B) CAR, (C) PXR, and (D) PPARα in liver samples from control and MKO IL-6 mice (n = 9–10) subjected to 16 weeks of standard chow (chow), HFD and HFD in combination with exercise (HFD ExTr). Values are the mean ± SEM. #Differences between genotypes within treatment (p < .05). DISCUSSION The major finding of this study was that HFD increased the expression of Cyp1a1 mRNA, while decreasing the mRNA expression of the other investigated Cyp isoforms. Interestingly, it was demonstrated the HFD in combination with exercise training increased the protein expression of Cyp1a, an effect observed to be dependent on the muscular release of IL-6. At the same time HFD lowered the protein expression of Cyp2b, while HFD in combination with exercise training increased the protein expression of Cyp3a compared with HFD alone. To our knowledge, this is the first study to investigate the combined effect of HFD and exercise training on hepatic Cyp expression, but also to implicate skeletal muscle derived IL-6 in the regulation of hepatic CYP. To investigate the regulation of the major hepatic Cyp families by HFD and HFD in combination with exercise training, mice were subjected to 16 weeks of high-fat feeding and treadmill running, as previously described in Knudsen et al. (2015, 2016). As reported for the same mice, there were no changes in total body weight following high-fat feeding in either genotype, but both groups had a significant increase in their fat mass (% of total body mass) in response to high-fat feeding as well as higher triglyceride content in the liver (Knudsen et al., 2016). It is important to notice that HFD in combination with exercise training decreased whole body fat mass compared with HFD alone; suggesting that exercise counteracted some of the HFD induced changes in energy metabolism (Knudsen et al., 2015). In the liver, HFD decreased the protein content of phosphoenolpyruvate Carboxykinase (PEPCK) in control mice and increased the PEPCK protein content in IL-6 MKO mice; however, this effect was abrogated by 16 weeks of exercise training (Knudsen et al., 2016). Taken together, this suggests that HFD induced expected changes in body composition and energy metabolism and that the model is valid for investigating HFD induced changes in Cyp expression. Effect of HFD It is a well-documented consequence of HFD that the mRNA expression of Cyp4a is increased. For example, Patsouris et al. (2006) fed mice either low-fat or HFD for 26 weeks and observed an increased mRNA expression of hepatic Cyp4a10 and Cyp4a14. The same study also used PPARα knockout mice to show that the HFD induced Cyp4a expression was via a PPARα dependent pathway. In contrast to the observed increase in Cyp4a mRNA expression several studies have shown decreased protein expression of Cyp4a following HFD (Chang et al., 2011; Sugatani et al., 2006). It should be noticed that the latter results were obtained in rats; hence, species differences in the response to HFD might be the cause for this discrepancy. In the present study we observed increased mRNA expression of Cyp4a10 following HFD, while we did not observe any changes at the protein level. Interestingly the HFD induced increase in Cyp4a10 mRNA was abolished by exercise training. It could be speculated that this was caused by the increase energy expenditure and metabolism of fatty acids, as fatty acids has been shown to cause increased Cyp4a expression (Nakamura et al., 2004). Apart from the increase in Cyp4a10 mRNA expression, the only observed increase in mRNA levels with HFD was for Cyp1a1. Surprisingly, we did not observe a similar increase in Cyp1a2, which otherwise could have been expected due to their common regulation via an AhR dependent pathway (Rasmussen et al., 2016a; Ueda et al., 2006). However, in accordance one previous study reported no effect of HFD for 14 weeks on hepatic Cyp1a2 mRNA in mice (Ghose et al., 2011). This divergence between the expression of Cyp1a1 and Cyp1a2 could be explained by the fact that Cyp1a1 expression responds to lower concentrations of AhR agonists compared with Cyp1A2 expression, as demonstrated in rat and human hepatocytes (Santostefano et al., 1997; Zhang et al., 2006). At the protein level we observed no effect of HFD alone on the expression of Cyp1a, which could be expected given that Cyp1a2 is the major hepatic isoform of the Cyp1a’s (Monostory et al., 2009) and as we observed no effect of HFD on the mRNA level of this isoform. Moreover, a recent study in humans demonstrated no effect of short-term HFD on caffeine metabolism, suggesting no effect in CYP1A2 dependant activity (Achterbergh et al., 2016). It should be noticed that a recent study showed decreased Cyp1a2 mRNA expression following 18 weeks of HFD in a CYP2D6 humanized transgenic mice (Ning and Jeong, 2017). If the presence of human CYP2D6 in the mice causes this controversy needs to be clarified in future studies. For the other investigated Cyp’s (Cyp2a4, Cyp2b10, Cyp2e1, and Cyp3a11) we demonstrated decreased mRNA expression following HFD. This is in accordance with the observations made by Ghose et al. (2011), who also demonstrated decreased mRNA expression of Cyp2a4, Cyp2a10, and Cyp3a11 following HFD. Although a corresponding decrease in protein expression of Cyp2e1 was not demonstrated, we demonstrated decreased Cyp2b protein expression, but only in the control mice. As a decrease in Cyp2b10 protein expression was not demonstrated for the IL-6 MKO genotype, this could suggest that IL-6 is involved in the response observed with HFD. In a study by Pascussi et al. (2000) using primary human hepatocytes it was shown that exposure to IL-6 diminished the basal expression of CYP2B6 mRNA by 60%. Moreover, the study suggested that this was caused by a decreased expression of CAR and PXR. In contrary, we did not observe difference in the mRNA expression of CAR or PXR with the given interventions and genotypes. As Cyp2b is partly regulated by both PXR and CAR, a similar decrease in the expression of Cyp3a11 could have been expected. This was also apparent on the mRNA level, while not on protein expression. Taken together this could indicate that the regulation of Cyp2b10 during HFD and exercise is more trough CAR dependent mechanisms than PXR. Hence, cAMP levels and phosphorylation of AMPK, which are lowered with HFD and at the same time suggested to regulate CAR activity (Rencurel et al., 2005; Sidhu and Omiecinski, 1995) could be involved in the HFD-induced regulation of Cyp2b10. In addition, dietary fatty acids has also be shown as CAR activators (Finn et al., 2009). It is worth noticing that other studies has shown decreased protein expression and activity of Cyp3a following HFD (Achterbergh et al., 2016; Ghose et al., 2011; Yoshinari et al., 2006). Exercise Training Data available in the scientific literature on the effect of exercise on the hepatic expression of CYP is limited. During exercise, numerous compounds within the body change in concentration, e.g., is there an increase in the plasma concentration of IL-6. At the same time it has been shown that IL-6 and other cytokines can decrease the expression of the CYP enzyme system, hence, it can be suggested that exercise could modify the expression of the CYPs via IL-6 origination from the skeletal muscles. A previous study demonstrated that a single bout of cycling exercise had no effect on CYP1A2 dependent metabolism of caffeine in humans (McLean and Graham, 2002). In contrast it has been shown that 30 days of exercise consisting of 8–11 h of military training pr. day increased the CYP1A2 dependent activity by 70% (Vistisen et al., 1992). Animal studies has demonstrated no effect of prolonged exercise training on both total CYP content and specific CYP expression (Michaud et al., 1994; Saborido et al., 1993). Moreover, other studies has demonstrated increase or decrease in overall CYP content following exercise (Day et al., 1992; Day and Weiner, 1991; Frenkl et al., 1980; Kim et al., 2002). In this study, we observed decreased Cyp3a11 and Cyp4a10 mRNA levels following exercise, compared with HFD feeding alone, which was not observed for the other investigated Cyp isoforms. Hence, there may be a specific regulatory effect of exercise training on Cyp transcription during HFD. However, the effect for Cyp4a was not observed on the protein level. For Cyp3a was, as opposite to the effect on the mRNA level, observed increased protein expression in the HFD ExTr group compared with HFD alone. As this was only observed in the IL-6 MKO group, it could be suggested that some agonistic factor is lowered by exercise training in the HFD state, an effect that is otherwise abrogated by the muscular release of IL-6. Remarkably, despite similar mRNA expression levels in the HFD and HFD ExTr groups, Cyp1a protein expression was increase in the HFD ExTr group compared with the HFD group. This suggests that pathways regulating Cyp1a transcription and translation may be responsive to exercise. As Cyp1a is the only investigated gene that is controlled by AhR, it could be suggested that the exercise induced response is via a AhR controlled pathway. Interestingly, the effect of exercise training was not apparent in the IL-6 MKO group, suggesting that muscular IL-6 is involved in the regulation of the AhR dependent pathway, maybe on the translational level. As stated earlier, we observed increased Cyp1a and Cyp3a protein expression following exercise training compared with mice only fed HFD. The increase in both Cyp1a and Cyp3a was in both cases approximately 50%, which could have an impact on the hepatic detoxification and drug metabolism, particular as protein expression of CYPs are usually highly correlated to activity (Sy et al., 2002; Watanabe et al., 2004; Yan et al., 2015). However, this needs to be investigated in more details. Likewise, the causes in terms of mechanistic events needs to be elucidated in future studies. In conclusion, we demonstrated that HFD decreased mRNA expression of Cyp2a4, Cyp2b10, Cyp2e1, and Cyp3a11, while increasing Cyp1a1 and Cyp4a10 mRNA. We also show that HFD in combination with exercise training increased the protein expression of Cyp1a, and that this is dependent on the muscular release of IL-6. Taken together it suggests that long-term exercise training had limited ability to modify the HFD-induced decrease in Cyp protein expression. But that the limited effects of exercise training on HFD induced changes, do depend on release of muscular IL-6. SUPPLEMENTARY DATA Supplementary data are available at Toxicological Sciences online. ACKNOWLEDGMENTS The authors greatly acknowledge the excellent technical assistance of Ea stoltze Andersen, Department of Food Science, Aarhus University, Denmark. IL-6 Lox mice were kindly donated by Professor Juan Hidalgo, Universidad de autonoma, Barcelona, Spain. The authors would like to express our gratitude towards Professor Henriette Pilegaard, University of Copenhagen, Denmark, for constructive suggestions during the preparation of the article. FUNDING The study was supported by the Carlsberg Foundation, The Danish Research Foundation, and Agustinus Foundation. REFERENCES Achterbergh R., Lammers L. A., van Nierop S., Klumpen H. J., Soeters M. R., Mathot R. A., Romijn J. A. ( 2016). A short-term high fat diet increases exposure to midazolam and omeprazole in healthy subjects. Expert Opin. Drug Metab. Toxicol.  12, 715– 720. Google Scholar CrossRef Search ADS PubMed  Berger J., Moller D. E. ( 2002). The mechanisms of action of PPARs. Annu. Rev. Med.  53, 409– 435. http://dx.doi.org/10.1146/annurev.med.53.082901.104018 Google Scholar CrossRef Search ADS PubMed  Chang C. J., Tzeng T. F., Liou S. S., Chang Y. S., Liu I. M. ( 2011). Kaempferol regulates the lipid-profile in high-fat diet-fed rats through an increase in hepatic PPARalpha levels. Planta Med . 77, 1876– 1882. Google Scholar CrossRef Search ADS PubMed  Christensen H., Hermann M. ( 2012). Immunological response as a source to variability in drug metabolism and transport. Front. Pharmacol . 3, 8. Google Scholar CrossRef Search ADS PubMed  Day W. W., Chesky J. A., Weiner M. ( 1992). Differential effects of swimming and running on microsomal metabolism in middle-aged and aged Fischer 344 rats. Mech. Ageing Dev . 63, 275– 286. http://dx.doi.org/10.1016/0047-6374(92)90005-X Google Scholar CrossRef Search ADS PubMed  Day W. W., Weiner M. ( 1991). Inhibition of hepatic drug metabolism and carbon tetrachloride toxicity in Fischer-344 rats by exercise. Biochem. Pharmacol.  42, 181– 184. http://dx.doi.org/10.1016/0006-2952(91)90697-4 Google Scholar CrossRef Search ADS PubMed  Ferrer B., Navia B., Giralt M., Comes G., Carrasco J., Molinero A., Quintana A., Señarís R. M., Hidalgo J. ( 2014). Muscle-specific interleukin-6 deletion influences body weight and body fat in a sex-dependent manner. Brain Behav. Immun.  40, 121– 130. Google Scholar CrossRef Search ADS PubMed  Finn R. D., Henderson C. J., Scott C. L., Wolf C. R. ( 2009). Unsaturated fatty acid regulation of cytochrome P450 expression via a CAR-dependent pathway. Biochem. J.  417, 43– 54. Google Scholar CrossRef Search ADS PubMed  Fischer C. P. ( 2006). Interleukin-6 in acute exercise and training: What is the biological relevance? Exerc. Immunol. Rev . 12, 6– 33. Google Scholar PubMed  Frenkl R., Gyore A., Szeberenyi S. ( 1980). The effect of muscular exercise on the microsomal enzyme system of the rat liver. Eur. J. Appl. Physiol. Occup. Physiol . 44, 135– 140. http://dx.doi.org/10.1007/BF00421091 Google Scholar CrossRef Search ADS PubMed  Gerbal-Chaloin S., Iankova I., Maurel P., Daujat-Chavanieu M. ( 2013). Nuclear receptors in the cross-talk of drug metabolism and inflammation. Drug Metab. Rev.  45, 122– 144. Google Scholar CrossRef Search ADS PubMed  Ghose R., Omoluabi O., Gandhi A., Shah P., Strohacker K., Carpenter K. C., McFarlin B., Guo T. ( 2011). Role of high-fat diet in regulation of gene expression of drug metabolizing enzymes and transporters. Life Sci.  89, 57– 64. http://dx.doi.org/10.1016/j.lfs.2011.05.005 Google Scholar CrossRef Search ADS PubMed  Gregor M. F., Hotamisligil G. S. ( 2011). Inflammatory mechanisms in obesity. Annu. Rev. Immunol . 29, 415– 445. http://dx.doi.org/10.1146/annurev-immunol-031210-101322 Google Scholar CrossRef Search ADS PubMed  Guengerich F. P. ( 2008). Cytochrome P450 and chemical toxicology. Chem. Res. Toxicol.  21, 70– 83. http://dx.doi.org/10.1021/tx700079z Google Scholar CrossRef Search ADS PubMed  Kim H. J., Lee A. K., Kim Y. G., Bu S. C., Kim S. H., Yang C. H., Suh O. K., Kim S. G., Lee M. G. ( 2002). Influence of 4-week and 8-week exercise training on the pharmacokinetics and pharmacodynamics of intravenous and oral azosemide in rats. Life Sci.  70, 2299– 2319. Google Scholar CrossRef Search ADS PubMed  Kim S., Sohn I., Ahn J. I., Lee K. H., Lee Y. S., Lee Y. S. ( 2004). Hepatic gene expression profiles in a long-term high-fat diet-induced obesity mouse model. Gene  340, 99– 109. Google Scholar CrossRef Search ADS PubMed  Knudsen J. G., Bertholdt L., Joensen E., Lassen S. B., Hidalgo J., Pilegaard H. ( 2015). Skeletal muscle interleukin-6 regulates metabolic factors in iWAT during HFD and exercise training. Obesity  23, 1616– 1624. Google Scholar CrossRef Search ADS PubMed  Knudsen J. G., Joensen E., Bertholdt L., Jessen H., van Hauen L., Hidalgo J., Pilegaard H. ( 2016). Skeletal muscle IL-6 and regulation of liver metabolism during high-fat diet and exercise training. Physiol. Rep.  4, e12788. Google Scholar CrossRef Search ADS PubMed  Lewis D. F. ( 2004). 57 varieties: The human cytochromes P450. Pharmacogenomics  5, 305– 318. http://dx.doi.org/10.1517/phgs.5.3.305.29827 Google Scholar CrossRef Search ADS PubMed  Li H., Wang H. ( 2010). Activation of xenobiotic receptors: Driving into the nucleus. Expert Opin. Drug Metab. Toxicol.  6, 409– 426. http://dx.doi.org/10.1517/17425251003598886 Google Scholar CrossRef Search ADS PubMed  McLean C., Graham T. E. ( 2002). Effects of exercise and thermal stress on caffeine pharmacokinetics in men and eumenorrheic women. J. Appl. Physiol.  93, 1471– 1478. http://dx.doi.org/10.1152/japplphysiol.00762.2000 Google Scholar CrossRef Search ADS PubMed  Michaud T. J., Bachmann K. A., Andres F. F., Flynn M. G., Sherman G. P., Rodriguez-zayas J. ( 1994). Exercise training does not alter cytochrome P-450 content and microsomal metabolism. Med. Sci. Sports Exerc . 26, 978-982. Google Scholar CrossRef Search ADS   Monostory K., Pascussi J. M., Kobori L., Dvorak Z. ( 2009). Hormonal regulation of CYP1A expression. Drug Metab. Rev.  41, 547– 572. http://dx.doi.org/10.1080/03602530903112284 Google Scholar CrossRef Search ADS PubMed  Nakamura M. T., Cheon Y., Li Y., Nara T. Y. ( 2004). Mechanisms of regulation of gene expression by fatty acids. Lipids  39, 1077– 1083. http://dx.doi.org/10.1007/s11745-004-1333-0 Google Scholar CrossRef Search ADS PubMed  Ning M., Jeong H. ( 2017). High-fat diet feeding alters expression of hepatic drug-metabolizing enzymes in mice. Drug Metab. Dispos.  45, 707– 711. http://dx.doi.org/10.1124/dmd.117.075655 Google Scholar CrossRef Search ADS PubMed  Pascussi J. M., Gerbal-Chaloin S., Pichard-Garcia L., Daujat M., Fabre J. M., Maurel P., Vilarem M. J. ( 2000). Interleukin-6 negatively regulates the expression of pregnane X receptor and constitutively activated receptor in primary human hepatocytes. Biochem. Biophys. Res. Commun . 274, 707– 713. Google Scholar CrossRef Search ADS PubMed  Patsouris D., Reddy J. K., Muller M., Kersten S. ( 2006). Peroxisome proliferator-activated receptor alpha mediates the effects of high-fat diet on hepatic gene expression. Endocrinology  147, 1508– 1516. 10.1210/en.2005-1132. http://dx.doi.org/10.1210/en.2005-1132 Google Scholar CrossRef Search ADS PubMed  Rasmussen M. K., Balaguer P., Ekstrand B., Daujat-Chavanieu M., Gerbal-Chaloin S. ( 2016a). Skatole (3-Methylindole) is a partial aryl hydrocarbon receptor agonist and induces CYP1A1/2 and CYP1B1 expression in primary human hepatocytes. PLoS One  11, e0154629. Google Scholar CrossRef Search ADS   Rasmussen M. K., Theil P. K., Oksbjerg N. ( 2016b). Constitutive expression of cytochrome P450 in foetal and adult porcine livers - Effects of body weight. Toxicol. Lett . 258, 87– 92. Google Scholar CrossRef Search ADS   Rencurel F., Stenhouse A., Hawley S. A., Friedberg T., Hardie D. G., Sutherland C., Wolf C. R. ( 2005). AMP-activated protein kinase mediates phenobarbital induction of CYP2B gene expression in hepatocytes and a newly derived human hepatoma cell line. J. Biol. Chem . 280, 4367– 4373. Google Scholar CrossRef Search ADS PubMed  Saborido A., Molano F., Megias A. ( 1993). Effect of training and anabolic-androgenic steroids on drug metabolism in rat liver. Med. Sci. Sports Exerc . 25, 815– 822. http://dx.doi.org/10.1249/00005768-199307000-00010 Google Scholar CrossRef Search ADS PubMed  Santostefano M. J., Ross D. G., Savas U., Jefcoate C. R., Birnbaum L. S. ( 1997). Differential time-course and dose-response relationships of TCDD-induced CYP1B1, CYP1A1, and CYP1A2 proteins in rats. Biochem. Biophys. Res. Commun . 233, 20– 24. Google Scholar CrossRef Search ADS PubMed  Sidhu J. S., Omiecinski C. J. ( 1995). cAMP-associated inhibition of phenobarbital-inducible cytochrome P450 gene expression in primary rat hepatocyte cultures. J. Biol. Chem . 270, 12762– 12773. http://dx.doi.org/10.1074/jbc.270.21.12762 Google Scholar CrossRef Search ADS PubMed  Spruiell K., Jones D. Z., Cullen J. M., Awumey E. M., Gonzalez F. J., Gyamfi M. A. ( 2014). Role of human pregnane X receptor in high fat diet-induced obesity in pre-menopausal female mice. Biochem. Pharmacol.  89, 399– 412. Google Scholar CrossRef Search ADS PubMed  Steensberg A., Febbraio M. A., Osada T., Schjerling P., van Hall G., Saltin B., Pedersen B. K. ( 2001). Interleukin-6 production in contracting human skeletal muscle is influenced by pre-exercise muscle glycogen content. J. Physiol.  537, 633– 639. Google Scholar CrossRef Search ADS PubMed  Steensberg A., van Hall G., Osada T., Sacchetti M., Saltin B., Pedersen B. K. ( 2000). Production of interleukin-6 in contracting human skeletal muscles can account for the exercise-induced increase in plasma interleukin-6. J. Physiol.  529, 237– 242. Google Scholar CrossRef Search ADS PubMed  Sugatani J., Wada T., Osabe M., Yamakawa K., Yoshinari K., Miwa M. ( 2006). Dietary inulin alleviates hepatic steatosis and xenobiotics-induced liver injury in rats fed a high-fat and high-sucrose diet: Association with the suppression of hepatic cytochrome P450 and hepatocyte nuclear factor 4alpha expression. Drug Metab. Dispos.  34, 1677– 1687. Google Scholar CrossRef Search ADS PubMed  Sy S. K., Ciaccia A., Li W., Roberts E. A., Okey A., Kalow W., Tang B. K. ( 2002). Modeling of human hepatic CYP3A4 enzyme kinetics, protein, and mRNA indicates deviation from log-normal distribution in CYP3A4 gene expression. Eur. J. Clin. Pharmacol . 58, 357– 365. Google Scholar CrossRef Search ADS PubMed  Tajima M., Ikarashi N., Igeta S., Toda T., Ishii M., Tanaka Y., Machida Y., Ochiai W., Yamada H., Sugiyama K. ( 2013). Different diets cause alterations in the enteric environment and trigger changes in the expression of hepatic cytochrome P450 3A, a drug-metabolizing enzyme. Biol. Pharm. Bull . 36, 624– 634. Google Scholar CrossRef Search ADS PubMed  Teng S., Piquette-Miller M. ( 2005). The involvement of the pregnane X receptor in hepatic gene regulation during inflammation in mice. J. Pharmacol. Exp. Ther.  312, 841– 848. Google Scholar CrossRef Search ADS PubMed  Timsit Y. E., Negishi M. ( 2007). CAR and PXR: The xenobiotic-sensing receptors. Steroids  72, 231– 246. http://dx.doi.org/10.1016/j.steroids.2006.12.006 Google Scholar CrossRef Search ADS PubMed  Tolson A. H., Wang H. ( 2010). Regulation of drug-metabolizing enzymes by xenobiotic receptors: PXR and CAR. Adv. Drug Deliv. Rev.  62, 1238– 1249. http://dx.doi.org/10.1016/j.addr.2010.08.006 Google Scholar CrossRef Search ADS PubMed  Ueda R., Iketaki H., Nagata K., Kimura S., Gonzalez F. J., Kusano K., Yoshimura T., Yamazoe Y. ( 2006). A common regulatory region functions bidirectionally in transcriptional activation of the human CYP1A1 and CYP1A2 genes. Mol. Pharmacol.  69, 1924– 1930. http://dx.doi.org/10.1124/mol.105.021220 Google Scholar CrossRef Search ADS PubMed  Vistisen K., Poulsen H. E., Loft S. ( 1992). Foreign compound metabolism capacity in man measured from metabolites of dietary caffeine. Carcinogenesis  13, 1561– 1568. http://dx.doi.org/10.1093/carcin/13.9.1561 Google Scholar CrossRef Search ADS PubMed  Vozarova B., Weyer C., Hanson K., Tataranni P. A., Bogardus C., Pratley R. E. ( 2001). Circulating interleukin-6 in relation to adiposity, insulin action, and insulin secretion. Obes. Res . 9, 414– 417. Google Scholar CrossRef Search ADS PubMed  Watanabe M., Kumai T., Matsumoto N., Tanaka M., Suzuki S., Satoh T., Kobayashi S. ( 2004). Expression of CYP3A4 mRNA is correlated with CYP3A4 protein level and metabolic activity in human liver. J. Pharmacol. Sci . 94, 459– 462. Google Scholar CrossRef Search ADS PubMed  Yan T., Lu L., Xie C., Chen J., Peng X., Zhu L., Wang Y., Li Q., Shi J., Zhou F., et al.   ( 2015). Severely impaired and dysregulated cytochrome p450 expression and activities in hepatocellular carcinoma: Implications for personalized treatment in patients. Mol. Cancer Ther . 14, 2874– 2886. Google Scholar CrossRef Search ADS PubMed  Yang J., Hao C., Yang D., Shi D., Song X., Luan X., Hu G., Yan B. ( 2010). Pregnane X receptor is required for interleukin-6-mediated down-regulation of cytochrome P450 3A4 in human hepatocytes. Toxicol. Lett.  197, 219– 226. Google Scholar CrossRef Search ADS PubMed  Yoshinari K., Takagi S., Yoshimasa T., Sugatani J., Miwa M. ( 2006). Hepatic CYP3A expression is attenuated in obese mice fed a high-fat diet. Pharm. Res . 23, 1188– 1200. Google Scholar CrossRef Search ADS PubMed  Zhang Z. Y., Pelletier R. D., Wong Y. N., Sugawara M., Zhao N., Littlefield B. A. ( 2006). Preferential inducibility of CYP1A1 and CYP1A2 by TCDD: Differential regulation in primary human hepatocytes versus transformed human cells. Biochem. Biophys. Res. Commun . 341, 399– 407. Google Scholar CrossRef Search ADS PubMed  © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Toxicological Sciences Oxford University Press

Skeletal Muscle Interleukin-6 Regulates Hepatic Cytochrome P450 Expression: Effects of 16-Week High-Fat Diet and Exercise

Loading next page...
 
/lp/ou_press/skeletal-muscle-interleukin-6-regulates-hepatic-cytochrome-p450-tgxTaL467U
Publisher
Oxford University Press
Copyright
© The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
ISSN
1096-6080
eISSN
1096-0929
D.O.I.
10.1093/toxsci/kfx258
Publisher site
See Article on Publisher Site

Abstract

Abstract High-fat diet (HFD) induces several changes to the pathways regulating energy homeostasis and changes the expression of the hepatic cytochrome p450 (Cyp) enzyme-system. Despite these pervious findings, it is still unclear how the effects of HFD and especially HFD in combination with treadmill running affect hepatic Cyp expression. In this study, we investigated the mRNA and protein expression of selected Cyp’s in mice subjected to 16 weeks of HFD and treadmill running. To understand the regulatory mechanisms behind the exercise-induced reversion of the HFD-induced changes in Cyp expression, we used a model in which the exercise-induced myokine and known regulator of hepatic Cyp’s, interleukin-6 (IL-6), were knocked out specifically in skeletal muscle. We found that HFD increased the mRNA expression of Cyp1a1 and Cyp4a10, and decreased the expression of Cyp2a4, Cyp2b10, Cyp2e1, and Cyp3a11. HFD in combination with treadmill running reversed the HFD increase in Cyp4a10 mRNA expression. In addition, we observed increased Cyp1a and Cyp3a protein expression as an effect of exercise, whereas Cyp2b expression was lowered as an effect of HFD. IL-6 effected the response in Cyp3a11 and Cyp1a expression. We observed no changes in the content of the aryl hydrocarbon receptor, constitutive androstane receptor, pregnane X receptor, or peroxisome proliferation activator receptor alpha. In conclusion, we show that both HFD and exercise in HFD-fed animals can regulate hepatic Cyp expression and that changes in Cyp3a in response to HFD and exercise are dependent on skeletal muscular IL-6. detoxification, endurance training, IL-6, nuclear receptors, drug metabolism The liver is the main organ for the biotransformation of xenobiotics, presenting high expression and activity of the cytochrome P450 (CYP) system. In general, biotransformation is conducted in two phases, where the CYPs belonging to family 1–3 are part of phase I, usually adding reactive groups to the parent compound. Accordingly, the regulation and expression of the CYP system is very important for the wellbeing of the individual and has gain a lot of attention during the last decades especially from the pharmaceutical industry. In humans, at least 57 genes coding for CYPs have been identified (Lewis, 2004). In the liver, CYP3A4 is the most predominant isoform taking care of >50% of all prescribed drugs (Guengerich, 2008). The transcriptional regulation of CYP is mediated by a number of transcription factors, including nuclear receptors (NR). It is generally accepted that the CYP subfamily 1A is regulated by aryl hydrocarbon receptor (AhR), 2A and 2B by constitutive androstane receptor (CAR), 3A by pregnane X receptor (PXR), and 4A by peroxisome proliferation activator receptor alpha (PPARα) (Berger and Moller, 2002; Li and Wang, 2010; Timsit and Negishi, 2007; Tolson and Wang, 2010). The classical activation of the NRs includes ligand binding and subsequent translocation to the nucleus where the receptor interacts with promotor regions in the DNA, initiating gene-transcription. Numerous endogenous and exogenous compounds have been identified, as modulators of NR activity, among them are the cytokines (Gerbal-Chaloin et al., 2013). During inflammation, impairment of CYPs expression and activities are often observed (Christensen and Hermann, 2012). The concentration of several cytokines is increased during inflammation and has been suggested to be responsible for the CYP impairment, among them is interleukin-6 (IL-6). Hence, following injection of IL-6 into mice a decrease in Cyp3a11 mRNA has been observed (Teng and Piquette-Miller, 2005). Using PXR knockout mice, this decrease was shown to be dependent on the presence of PXR. The same was later shown using human primary hepatocytes (Yang et al., 2010). Beside the increase in IL-6 associated with inflammation, release of IL-6 into the plasma also occurs during muscular exercise, declining during recovery (Fischer, 2006; Steensberg et al., 2001). In healthy human males conducting one-leg knee extensor exercise for 5 h an approximately 20-fold increase in arterial plasma IL-6 concentration was observed, as well as increased arterial-vein difference over the exercising leg (Steensberg et al., 2000), indicating that muscular derived IL-6 can account for the increase in circulating concentration. High-fat diet (HFD) is associated with gain in body-weight and increased levels of body fat. Additionally, obesity is associated with inflammation, resulting in increased cytokine levels, including IL-6 (Gregor and Hotamisligil, 2011). Basal plasma levels of IL-6 have been shown to be positively correlated to the percentage of body fat (Vozarova et al., 2001). Several studies in mice have investigated the expression of CYPs as a function of HFD with contradicting results (Ghose et al., 2011; Kim et al., 2004; Ning and Jeong, 2017; Spruiell et al., 2014; Tajima et al., 2013; Yoshinari et al., 2006). For example, the study by Ghose et al, (2011) demonstrated decreased Cyp3a11 expression in CD1 mice fed a HFD containing 60% energy from fat for 14 weeks. In contrast, the study by Kim et al. (2004), demonstrated increased Cyp3a11 in C57B1/J6 mice fed HFD with 36% energy for 12 weeks. Hence, there seemes to be a discrepancy about the effect of HFD existing in the literature, that needs to be clarified. The study was undertaken to investigate the hypotheses that (1) HFD affects Cyp gene expression and (2) that exercise affects HFD-induced changes in Cyp expression in a skeletal muscle IL-6 dependent manner. To investigate that, both control mice and muscle-specific IL-6 knockout mice (IL-6 MKO) were divided into groups being either fed high-fat or control diet in combination with 16 weeks of treadmill running or not. Following the treatment period, liver tissue was collected and expression of selected nuclear receptors and Cyp isoforms were analyzed. MATERIALS AND METHODS Animals and intervention Mice with skeletal muscle specific knockout of the IL-6 gene (IL-6 MKO) were generated by crossing C57Bl/6 mice with a LoxP site surrounding the second exon of the IL-6 gene with mice expressing CRE recombinase under the control of the myogenin promoter as previously described in Ferrer et al. (2014) and Knudsen et al. (2015). At the age of 12 weeks, IL-6 MKO and control (Floxed; control) mice were divided into 3 groups, with 10 in each, receiving either (1) standard rodent chow (Chow), (2) HFD, or (3) HFD combined with exercise for 16 weeks (HFD ExTr). The exercise regimen consisted of voluntary wheel running for the first 12 weeks of the intervention and voluntary wheel running combined with 3 h of weekly treadmill running for the last 4 weeks as previously described in Knudsen et al. (2015). The mice were given ad libitum access to food and water in a 12:12-h light:dark environment at a constant temperature of 22 °C. At the end of the experiment, mice were euthanized by cervical dislocation and the liver removed and snap frozen in liquid nitrogen. Details about the mice have been published before in Knudsen et al. (2015, 2016). RNA isolation and reverse transcription Total RNA were isolated using TriReagent, according to the manufactures protocol (Sigma-Aldrich, Schnelldorf, Germany). Equal amounts of RNA were converted into cDNA using iScript, according to the manufactures protocol (Bio-Rad, Solna, Sweden). Real-time PCR For the analysis of the expression of the specific mRNA primers and TaqMan probes were designed using Primer Express (Version 2, Applied Biosystems, Californien, USA) and mouse-specific gene sequences obtained from Ensembl (http://www.ensembl.org/Mus_musculus/Info/Index). All primers and probe pair were designed to expand exon-exon junctions and target specificity verified using BLAST searching. Primers and probe sequences are given in Table 1. The RT-PCR reaction were performed using the StepOne Plus thermocycler executing the following temperature profile: 50 °C for 2 min, 95 °C for 10 min and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. All samples were analyzed in duplicates. The relative gene expression was normalized to the expression of GAPDH. There were no difference in the obtained Ct-values for GAPDH values between the different experimental groups. Table 1. Primer and TaqMan Probes for Real-Time PCR Name  Forward (5′-3′)  Reverse (5′-3′)  TaqMan Probe (5′-3′)  CYP1A1  GACCTTCCGGCATTCATCCT  GCCATTCAGACTTGTATCTCTTGTG  CGTCCCCTTCACCATCCCCCA  CYP1A2  TGGAGCTGGCTTTGACACAG  CGTTAGGCCATGTCACAAGTAGC  CACCACAGCCATCACCTGGAGCATTT  CYP2A4  TCGAGGAGCGCATCCAA  AATGAAAGCACCGTTCGTCTTC  AGGCGGGCTTTCTCATCGATTCATTTC  CYP2B10  CCAGCCAGATGTTTGAGCTCTT  GGAGTTCCTGCAGGTTTTTGG  TTCCTGAAGTACTTTCCTGGTGCCCACA  CYP2E1  TTTCCCTAAGTATCCTCCGTGACT  GCTGGCCTTTGGTCTTTTTG  CCCGCATCCAAAGAGAGGCACACT  CYP3A11  AACTGCAGGATGAGATCGATGAG  TTCATTAAGCACCATATCCAGGTATT  CAACAAGGCACCTCCCACGTATGATACTG  CYP4A10  TCCAGGTTTGCACCAGACTCT  AGTTCCTGGCTCCTCCTGAGA  CGACACAGCCACTCATTCCTGCCC  AhR  GCGGCGCCAACATCA  GTCGCTTAGAAGGATTTGACTTAATTC  CAGAAAACAGTAAAGCCCATCCCCGC  CAR  TCAACACGTTTATGGTGCAACA  CAGCCGCTCCCTTGAGAAG  ATCAAGTTCACCAAGGATCTGCCGCTC  PXR  CACCTGGCCGATGTGTCA  AATAGGCAGGTCCCTAAAGTAGGATAT  CAAGGGCGTCATCAACTTCGCCAA  PPARα  CGCTGCCGCCAAGTTG  GAACTTGACCAGCCACAAACG  AGGCCCTGCCTTCCCTGTGAACTG  β-actin  GCTTCTTTGCAGCTCCTTCGT  GCGCAGCGATATCGTCATC  CCGGTCCACACCCGCCACC  Name  Forward (5′-3′)  Reverse (5′-3′)  TaqMan Probe (5′-3′)  CYP1A1  GACCTTCCGGCATTCATCCT  GCCATTCAGACTTGTATCTCTTGTG  CGTCCCCTTCACCATCCCCCA  CYP1A2  TGGAGCTGGCTTTGACACAG  CGTTAGGCCATGTCACAAGTAGC  CACCACAGCCATCACCTGGAGCATTT  CYP2A4  TCGAGGAGCGCATCCAA  AATGAAAGCACCGTTCGTCTTC  AGGCGGGCTTTCTCATCGATTCATTTC  CYP2B10  CCAGCCAGATGTTTGAGCTCTT  GGAGTTCCTGCAGGTTTTTGG  TTCCTGAAGTACTTTCCTGGTGCCCACA  CYP2E1  TTTCCCTAAGTATCCTCCGTGACT  GCTGGCCTTTGGTCTTTTTG  CCCGCATCCAAAGAGAGGCACACT  CYP3A11  AACTGCAGGATGAGATCGATGAG  TTCATTAAGCACCATATCCAGGTATT  CAACAAGGCACCTCCCACGTATGATACTG  CYP4A10  TCCAGGTTTGCACCAGACTCT  AGTTCCTGGCTCCTCCTGAGA  CGACACAGCCACTCATTCCTGCCC  AhR  GCGGCGCCAACATCA  GTCGCTTAGAAGGATTTGACTTAATTC  CAGAAAACAGTAAAGCCCATCCCCGC  CAR  TCAACACGTTTATGGTGCAACA  CAGCCGCTCCCTTGAGAAG  ATCAAGTTCACCAAGGATCTGCCGCTC  PXR  CACCTGGCCGATGTGTCA  AATAGGCAGGTCCCTAAAGTAGGATAT  CAAGGGCGTCATCAACTTCGCCAA  PPARα  CGCTGCCGCCAAGTTG  GAACTTGACCAGCCACAAACG  AGGCCCTGCCTTCCCTGTGAACTG  β-actin  GCTTCTTTGCAGCTCCTTCGT  GCGCAGCGATATCGTCATC  CCGGTCCACACCCGCCACC  Abbreviations: AhR, Aryl hydrocarbon receptor; CAR, constitutive androstane receptor; PXR, pregnane X receptor; PPARα, peroxisome proliferator-activated receptor α. Western blotting Protein lysate for western blotting were prepared as described elsewhere (Knudsen et al., 2015). Western blotting was done according to Rasmussen et al. (2016b). The used antibodies are given in Supplementary data 1. The relative protein expression of the analyzed Cyp’s were normalised to the protein expression of β-actin. Statistics Data are presented as the mean ± SEM. Two-way ANOVA was used to evaluate the effect of intervention (Chow, HFD, or HFD ExTr) and genotype (Floxed and IL-6 MKO). The data were log10 transformed if they failed an equal variance test. If an overall effect was observed, Tukey’s post hoc test was used to identify differences between groups. For all tests, p < .05 was regarded as significant. RESULTS Impact of HFD, Exercise Training and Skeletal Muscle IL-6 on Hepatic CYP The mRNA expression of Cyp1a1 were significantly increased in the mice fed HFD compared with the Chow fed ones (Figure 1A). The HFD-induced increase was not affected by 16 weeks of exercise running or skeletal muscle specific knockout of IL-6. In contrast, HFD and exercise training as well as genotype had no effect on Cyp1a2 mRNA expression (Figure 1B). Cyp2a4 and Cyp2e1 mRNA expression was significantly reduced by HFD in both genotypes and were not affected by additional exercise training or loss of skeletal muscle IL-6 (Figs. 1C and E). For Cyp2b10, HFD and exercise training seemed to lower the mRNA expression in both genotypes, even though statistical significance was not reached with HFD in the control group (Figure 1D). Genotype had no effect on Cyp2b10 expression. For all IL-6 MKO groups, Cyp3a11 mRNA expression was increased compared to control. (Figure 1F). Moreover, Cyp3a11 mRNA expression was reduced in the HFD group compared with control in both genotypes. This reduction was exacerbated in the HFD ExTr group. As expected, Cyp4a10 mRNA expression was strongly increased following HFD regimen compared with control in both genotypes. This increase was not observed in the HFD ExTr groups (Figure 1G). Figure 1. View large Download slide View large Download slide HFD in combination or not with exercise training modify hepatic Cyp mRNA content in mice. mRNA content of (A) Cyp1a1, (B) Cyp1a2, (C) Cyp2a4, (D) Cyp2b10, (E) Cyp2e1, (F) Cyp3a11, and (G) Cyp4a10 in liver samples from control and muscle specific IL-6 knockout (MKO IL-6) mice (n = 9–10) subjected to 16 weeks of standard chow (chow), HFD and HFD in combination with exercise (HFD ExTr). Values are the mean ± SEM. *Different from Chow within genotype (p < .05); §different from HFD within genotype (p < .05); #differences between genotypes within treatment (p < .05). Figure 1. View large Download slide View large Download slide HFD in combination or not with exercise training modify hepatic Cyp mRNA content in mice. mRNA content of (A) Cyp1a1, (B) Cyp1a2, (C) Cyp2a4, (D) Cyp2b10, (E) Cyp2e1, (F) Cyp3a11, and (G) Cyp4a10 in liver samples from control and muscle specific IL-6 knockout (MKO IL-6) mice (n = 9–10) subjected to 16 weeks of standard chow (chow), HFD and HFD in combination with exercise (HFD ExTr). Values are the mean ± SEM. *Different from Chow within genotype (p < .05); §different from HFD within genotype (p < .05); #differences between genotypes within treatment (p < .05). Protein expression levels of Cyp1a, Cyp2b, Cyp2e1, Cyp3a, and Cyp4a were also analyzed. Cyp1a protein content increased in HFD ExTr mice compared with all other groups (Figs. 2A and F). This increase was not observed in the IL-6 MKO mice. The protein expression of Cyp2b in the HFD and HFD ExTr mice were lower compared with the Chow fed group, within the control group (Figs. 2B and F). There was no differences in Cyp2e1 protein expression. (Figs. 2C and F). HFD and exercise had no effect on the expression on Cyp3a protein in the control group. In contrast HFD reduced Cyp3a protein expression in the IL-6 MKO group, and this effect was not observed following exercise training (Figure 2D). Cyp4a protein expression was lower in the IL-6 MKO group compared with control in the chow fed group (Figs. 2E and F). Figure 2. View largeDownload slide HFD in combination or not with exercise training modify hepatic Cyp protein content in mice. Protein content of (A) Cyp1a, (B) Cyp2b, (C) Cyp2e1, (D) Cyp3a and E) Cyp4a in liver samples from control and MKO IL-6 mice (n = 9–10) subjected to 16 weeks of standard chow (chow), HFD, and HFD in combination with exercise (HFD ExTr). (F) Representative protein blots. Values are the mean ± SEM. *Different from Chow within genotype (p < .05); §different from HFD within genotype (p < .05); #differences between genotypes within treatment (p < .05). Figure 2. View largeDownload slide HFD in combination or not with exercise training modify hepatic Cyp protein content in mice. Protein content of (A) Cyp1a, (B) Cyp2b, (C) Cyp2e1, (D) Cyp3a and E) Cyp4a in liver samples from control and MKO IL-6 mice (n = 9–10) subjected to 16 weeks of standard chow (chow), HFD, and HFD in combination with exercise (HFD ExTr). (F) Representative protein blots. Values are the mean ± SEM. *Different from Chow within genotype (p < .05); §different from HFD within genotype (p < .05); #differences between genotypes within treatment (p < .05). Impact of HFD, Exercise Training and Skeletal Muscle IL-6 on Ahr, CAR, PXR, and PPARα The mRNA levels of the nuclear receptors controlling the expression of the investigated Cyp’s were also investigated. The expression levels of AhR, CAR, PXR, and PPARα were not different between the different groups (Figs. 3A–D), except for a small decrease in the expression of AhR in the HFD control group compared with the IL-6 MKO HFD group (Figure 3A). Figure 3. View largeDownload slide HFD in combination or not with exercise training has no effect on the hepatic mRNA content of selected transcription factors in mice. mRNA content of (A) AhR, (B) CAR, (C) PXR, and (D) PPARα in liver samples from control and MKO IL-6 mice (n = 9–10) subjected to 16 weeks of standard chow (chow), HFD and HFD in combination with exercise (HFD ExTr). Values are the mean ± SEM. #Differences between genotypes within treatment (p < .05). Figure 3. View largeDownload slide HFD in combination or not with exercise training has no effect on the hepatic mRNA content of selected transcription factors in mice. mRNA content of (A) AhR, (B) CAR, (C) PXR, and (D) PPARα in liver samples from control and MKO IL-6 mice (n = 9–10) subjected to 16 weeks of standard chow (chow), HFD and HFD in combination with exercise (HFD ExTr). Values are the mean ± SEM. #Differences between genotypes within treatment (p < .05). DISCUSSION The major finding of this study was that HFD increased the expression of Cyp1a1 mRNA, while decreasing the mRNA expression of the other investigated Cyp isoforms. Interestingly, it was demonstrated the HFD in combination with exercise training increased the protein expression of Cyp1a, an effect observed to be dependent on the muscular release of IL-6. At the same time HFD lowered the protein expression of Cyp2b, while HFD in combination with exercise training increased the protein expression of Cyp3a compared with HFD alone. To our knowledge, this is the first study to investigate the combined effect of HFD and exercise training on hepatic Cyp expression, but also to implicate skeletal muscle derived IL-6 in the regulation of hepatic CYP. To investigate the regulation of the major hepatic Cyp families by HFD and HFD in combination with exercise training, mice were subjected to 16 weeks of high-fat feeding and treadmill running, as previously described in Knudsen et al. (2015, 2016). As reported for the same mice, there were no changes in total body weight following high-fat feeding in either genotype, but both groups had a significant increase in their fat mass (% of total body mass) in response to high-fat feeding as well as higher triglyceride content in the liver (Knudsen et al., 2016). It is important to notice that HFD in combination with exercise training decreased whole body fat mass compared with HFD alone; suggesting that exercise counteracted some of the HFD induced changes in energy metabolism (Knudsen et al., 2015). In the liver, HFD decreased the protein content of phosphoenolpyruvate Carboxykinase (PEPCK) in control mice and increased the PEPCK protein content in IL-6 MKO mice; however, this effect was abrogated by 16 weeks of exercise training (Knudsen et al., 2016). Taken together, this suggests that HFD induced expected changes in body composition and energy metabolism and that the model is valid for investigating HFD induced changes in Cyp expression. Effect of HFD It is a well-documented consequence of HFD that the mRNA expression of Cyp4a is increased. For example, Patsouris et al. (2006) fed mice either low-fat or HFD for 26 weeks and observed an increased mRNA expression of hepatic Cyp4a10 and Cyp4a14. The same study also used PPARα knockout mice to show that the HFD induced Cyp4a expression was via a PPARα dependent pathway. In contrast to the observed increase in Cyp4a mRNA expression several studies have shown decreased protein expression of Cyp4a following HFD (Chang et al., 2011; Sugatani et al., 2006). It should be noticed that the latter results were obtained in rats; hence, species differences in the response to HFD might be the cause for this discrepancy. In the present study we observed increased mRNA expression of Cyp4a10 following HFD, while we did not observe any changes at the protein level. Interestingly the HFD induced increase in Cyp4a10 mRNA was abolished by exercise training. It could be speculated that this was caused by the increase energy expenditure and metabolism of fatty acids, as fatty acids has been shown to cause increased Cyp4a expression (Nakamura et al., 2004). Apart from the increase in Cyp4a10 mRNA expression, the only observed increase in mRNA levels with HFD was for Cyp1a1. Surprisingly, we did not observe a similar increase in Cyp1a2, which otherwise could have been expected due to their common regulation via an AhR dependent pathway (Rasmussen et al., 2016a; Ueda et al., 2006). However, in accordance one previous study reported no effect of HFD for 14 weeks on hepatic Cyp1a2 mRNA in mice (Ghose et al., 2011). This divergence between the expression of Cyp1a1 and Cyp1a2 could be explained by the fact that Cyp1a1 expression responds to lower concentrations of AhR agonists compared with Cyp1A2 expression, as demonstrated in rat and human hepatocytes (Santostefano et al., 1997; Zhang et al., 2006). At the protein level we observed no effect of HFD alone on the expression of Cyp1a, which could be expected given that Cyp1a2 is the major hepatic isoform of the Cyp1a’s (Monostory et al., 2009) and as we observed no effect of HFD on the mRNA level of this isoform. Moreover, a recent study in humans demonstrated no effect of short-term HFD on caffeine metabolism, suggesting no effect in CYP1A2 dependant activity (Achterbergh et al., 2016). It should be noticed that a recent study showed decreased Cyp1a2 mRNA expression following 18 weeks of HFD in a CYP2D6 humanized transgenic mice (Ning and Jeong, 2017). If the presence of human CYP2D6 in the mice causes this controversy needs to be clarified in future studies. For the other investigated Cyp’s (Cyp2a4, Cyp2b10, Cyp2e1, and Cyp3a11) we demonstrated decreased mRNA expression following HFD. This is in accordance with the observations made by Ghose et al. (2011), who also demonstrated decreased mRNA expression of Cyp2a4, Cyp2a10, and Cyp3a11 following HFD. Although a corresponding decrease in protein expression of Cyp2e1 was not demonstrated, we demonstrated decreased Cyp2b protein expression, but only in the control mice. As a decrease in Cyp2b10 protein expression was not demonstrated for the IL-6 MKO genotype, this could suggest that IL-6 is involved in the response observed with HFD. In a study by Pascussi et al. (2000) using primary human hepatocytes it was shown that exposure to IL-6 diminished the basal expression of CYP2B6 mRNA by 60%. Moreover, the study suggested that this was caused by a decreased expression of CAR and PXR. In contrary, we did not observe difference in the mRNA expression of CAR or PXR with the given interventions and genotypes. As Cyp2b is partly regulated by both PXR and CAR, a similar decrease in the expression of Cyp3a11 could have been expected. This was also apparent on the mRNA level, while not on protein expression. Taken together this could indicate that the regulation of Cyp2b10 during HFD and exercise is more trough CAR dependent mechanisms than PXR. Hence, cAMP levels and phosphorylation of AMPK, which are lowered with HFD and at the same time suggested to regulate CAR activity (Rencurel et al., 2005; Sidhu and Omiecinski, 1995) could be involved in the HFD-induced regulation of Cyp2b10. In addition, dietary fatty acids has also be shown as CAR activators (Finn et al., 2009). It is worth noticing that other studies has shown decreased protein expression and activity of Cyp3a following HFD (Achterbergh et al., 2016; Ghose et al., 2011; Yoshinari et al., 2006). Exercise Training Data available in the scientific literature on the effect of exercise on the hepatic expression of CYP is limited. During exercise, numerous compounds within the body change in concentration, e.g., is there an increase in the plasma concentration of IL-6. At the same time it has been shown that IL-6 and other cytokines can decrease the expression of the CYP enzyme system, hence, it can be suggested that exercise could modify the expression of the CYPs via IL-6 origination from the skeletal muscles. A previous study demonstrated that a single bout of cycling exercise had no effect on CYP1A2 dependent metabolism of caffeine in humans (McLean and Graham, 2002). In contrast it has been shown that 30 days of exercise consisting of 8–11 h of military training pr. day increased the CYP1A2 dependent activity by 70% (Vistisen et al., 1992). Animal studies has demonstrated no effect of prolonged exercise training on both total CYP content and specific CYP expression (Michaud et al., 1994; Saborido et al., 1993). Moreover, other studies has demonstrated increase or decrease in overall CYP content following exercise (Day et al., 1992; Day and Weiner, 1991; Frenkl et al., 1980; Kim et al., 2002). In this study, we observed decreased Cyp3a11 and Cyp4a10 mRNA levels following exercise, compared with HFD feeding alone, which was not observed for the other investigated Cyp isoforms. Hence, there may be a specific regulatory effect of exercise training on Cyp transcription during HFD. However, the effect for Cyp4a was not observed on the protein level. For Cyp3a was, as opposite to the effect on the mRNA level, observed increased protein expression in the HFD ExTr group compared with HFD alone. As this was only observed in the IL-6 MKO group, it could be suggested that some agonistic factor is lowered by exercise training in the HFD state, an effect that is otherwise abrogated by the muscular release of IL-6. Remarkably, despite similar mRNA expression levels in the HFD and HFD ExTr groups, Cyp1a protein expression was increase in the HFD ExTr group compared with the HFD group. This suggests that pathways regulating Cyp1a transcription and translation may be responsive to exercise. As Cyp1a is the only investigated gene that is controlled by AhR, it could be suggested that the exercise induced response is via a AhR controlled pathway. Interestingly, the effect of exercise training was not apparent in the IL-6 MKO group, suggesting that muscular IL-6 is involved in the regulation of the AhR dependent pathway, maybe on the translational level. As stated earlier, we observed increased Cyp1a and Cyp3a protein expression following exercise training compared with mice only fed HFD. The increase in both Cyp1a and Cyp3a was in both cases approximately 50%, which could have an impact on the hepatic detoxification and drug metabolism, particular as protein expression of CYPs are usually highly correlated to activity (Sy et al., 2002; Watanabe et al., 2004; Yan et al., 2015). However, this needs to be investigated in more details. Likewise, the causes in terms of mechanistic events needs to be elucidated in future studies. In conclusion, we demonstrated that HFD decreased mRNA expression of Cyp2a4, Cyp2b10, Cyp2e1, and Cyp3a11, while increasing Cyp1a1 and Cyp4a10 mRNA. We also show that HFD in combination with exercise training increased the protein expression of Cyp1a, and that this is dependent on the muscular release of IL-6. Taken together it suggests that long-term exercise training had limited ability to modify the HFD-induced decrease in Cyp protein expression. But that the limited effects of exercise training on HFD induced changes, do depend on release of muscular IL-6. SUPPLEMENTARY DATA Supplementary data are available at Toxicological Sciences online. ACKNOWLEDGMENTS The authors greatly acknowledge the excellent technical assistance of Ea stoltze Andersen, Department of Food Science, Aarhus University, Denmark. IL-6 Lox mice were kindly donated by Professor Juan Hidalgo, Universidad de autonoma, Barcelona, Spain. The authors would like to express our gratitude towards Professor Henriette Pilegaard, University of Copenhagen, Denmark, for constructive suggestions during the preparation of the article. FUNDING The study was supported by the Carlsberg Foundation, The Danish Research Foundation, and Agustinus Foundation. REFERENCES Achterbergh R., Lammers L. A., van Nierop S., Klumpen H. J., Soeters M. R., Mathot R. A., Romijn J. A. ( 2016). A short-term high fat diet increases exposure to midazolam and omeprazole in healthy subjects. Expert Opin. Drug Metab. Toxicol.  12, 715– 720. Google Scholar CrossRef Search ADS PubMed  Berger J., Moller D. E. ( 2002). The mechanisms of action of PPARs. Annu. Rev. Med.  53, 409– 435. http://dx.doi.org/10.1146/annurev.med.53.082901.104018 Google Scholar CrossRef Search ADS PubMed  Chang C. J., Tzeng T. F., Liou S. S., Chang Y. S., Liu I. M. ( 2011). Kaempferol regulates the lipid-profile in high-fat diet-fed rats through an increase in hepatic PPARalpha levels. Planta Med . 77, 1876– 1882. Google Scholar CrossRef Search ADS PubMed  Christensen H., Hermann M. ( 2012). Immunological response as a source to variability in drug metabolism and transport. Front. Pharmacol . 3, 8. Google Scholar CrossRef Search ADS PubMed  Day W. W., Chesky J. A., Weiner M. ( 1992). Differential effects of swimming and running on microsomal metabolism in middle-aged and aged Fischer 344 rats. Mech. Ageing Dev . 63, 275– 286. http://dx.doi.org/10.1016/0047-6374(92)90005-X Google Scholar CrossRef Search ADS PubMed  Day W. W., Weiner M. ( 1991). Inhibition of hepatic drug metabolism and carbon tetrachloride toxicity in Fischer-344 rats by exercise. Biochem. Pharmacol.  42, 181– 184. http://dx.doi.org/10.1016/0006-2952(91)90697-4 Google Scholar CrossRef Search ADS PubMed  Ferrer B., Navia B., Giralt M., Comes G., Carrasco J., Molinero A., Quintana A., Señarís R. M., Hidalgo J. ( 2014). Muscle-specific interleukin-6 deletion influences body weight and body fat in a sex-dependent manner. Brain Behav. Immun.  40, 121– 130. Google Scholar CrossRef Search ADS PubMed  Finn R. D., Henderson C. J., Scott C. L., Wolf C. R. ( 2009). Unsaturated fatty acid regulation of cytochrome P450 expression via a CAR-dependent pathway. Biochem. J.  417, 43– 54. Google Scholar CrossRef Search ADS PubMed  Fischer C. P. ( 2006). Interleukin-6 in acute exercise and training: What is the biological relevance? Exerc. Immunol. Rev . 12, 6– 33. Google Scholar PubMed  Frenkl R., Gyore A., Szeberenyi S. ( 1980). The effect of muscular exercise on the microsomal enzyme system of the rat liver. Eur. J. Appl. Physiol. Occup. Physiol . 44, 135– 140. http://dx.doi.org/10.1007/BF00421091 Google Scholar CrossRef Search ADS PubMed  Gerbal-Chaloin S., Iankova I., Maurel P., Daujat-Chavanieu M. ( 2013). Nuclear receptors in the cross-talk of drug metabolism and inflammation. Drug Metab. Rev.  45, 122– 144. Google Scholar CrossRef Search ADS PubMed  Ghose R., Omoluabi O., Gandhi A., Shah P., Strohacker K., Carpenter K. C., McFarlin B., Guo T. ( 2011). Role of high-fat diet in regulation of gene expression of drug metabolizing enzymes and transporters. Life Sci.  89, 57– 64. http://dx.doi.org/10.1016/j.lfs.2011.05.005 Google Scholar CrossRef Search ADS PubMed  Gregor M. F., Hotamisligil G. S. ( 2011). Inflammatory mechanisms in obesity. Annu. Rev. Immunol . 29, 415– 445. http://dx.doi.org/10.1146/annurev-immunol-031210-101322 Google Scholar CrossRef Search ADS PubMed  Guengerich F. P. ( 2008). Cytochrome P450 and chemical toxicology. Chem. Res. Toxicol.  21, 70– 83. http://dx.doi.org/10.1021/tx700079z Google Scholar CrossRef Search ADS PubMed  Kim H. J., Lee A. K., Kim Y. G., Bu S. C., Kim S. H., Yang C. H., Suh O. K., Kim S. G., Lee M. G. ( 2002). Influence of 4-week and 8-week exercise training on the pharmacokinetics and pharmacodynamics of intravenous and oral azosemide in rats. Life Sci.  70, 2299– 2319. Google Scholar CrossRef Search ADS PubMed  Kim S., Sohn I., Ahn J. I., Lee K. H., Lee Y. S., Lee Y. S. ( 2004). Hepatic gene expression profiles in a long-term high-fat diet-induced obesity mouse model. Gene  340, 99– 109. Google Scholar CrossRef Search ADS PubMed  Knudsen J. G., Bertholdt L., Joensen E., Lassen S. B., Hidalgo J., Pilegaard H. ( 2015). Skeletal muscle interleukin-6 regulates metabolic factors in iWAT during HFD and exercise training. Obesity  23, 1616– 1624. Google Scholar CrossRef Search ADS PubMed  Knudsen J. G., Joensen E., Bertholdt L., Jessen H., van Hauen L., Hidalgo J., Pilegaard H. ( 2016). Skeletal muscle IL-6 and regulation of liver metabolism during high-fat diet and exercise training. Physiol. Rep.  4, e12788. Google Scholar CrossRef Search ADS PubMed  Lewis D. F. ( 2004). 57 varieties: The human cytochromes P450. Pharmacogenomics  5, 305– 318. http://dx.doi.org/10.1517/phgs.5.3.305.29827 Google Scholar CrossRef Search ADS PubMed  Li H., Wang H. ( 2010). Activation of xenobiotic receptors: Driving into the nucleus. Expert Opin. Drug Metab. Toxicol.  6, 409– 426. http://dx.doi.org/10.1517/17425251003598886 Google Scholar CrossRef Search ADS PubMed  McLean C., Graham T. E. ( 2002). Effects of exercise and thermal stress on caffeine pharmacokinetics in men and eumenorrheic women. J. Appl. Physiol.  93, 1471– 1478. http://dx.doi.org/10.1152/japplphysiol.00762.2000 Google Scholar CrossRef Search ADS PubMed  Michaud T. J., Bachmann K. A., Andres F. F., Flynn M. G., Sherman G. P., Rodriguez-zayas J. ( 1994). Exercise training does not alter cytochrome P-450 content and microsomal metabolism. Med. Sci. Sports Exerc . 26, 978-982. Google Scholar CrossRef Search ADS   Monostory K., Pascussi J. M., Kobori L., Dvorak Z. ( 2009). Hormonal regulation of CYP1A expression. Drug Metab. Rev.  41, 547– 572. http://dx.doi.org/10.1080/03602530903112284 Google Scholar CrossRef Search ADS PubMed  Nakamura M. T., Cheon Y., Li Y., Nara T. Y. ( 2004). Mechanisms of regulation of gene expression by fatty acids. Lipids  39, 1077– 1083. http://dx.doi.org/10.1007/s11745-004-1333-0 Google Scholar CrossRef Search ADS PubMed  Ning M., Jeong H. ( 2017). High-fat diet feeding alters expression of hepatic drug-metabolizing enzymes in mice. Drug Metab. Dispos.  45, 707– 711. http://dx.doi.org/10.1124/dmd.117.075655 Google Scholar CrossRef Search ADS PubMed  Pascussi J. M., Gerbal-Chaloin S., Pichard-Garcia L., Daujat M., Fabre J. M., Maurel P., Vilarem M. J. ( 2000). Interleukin-6 negatively regulates the expression of pregnane X receptor and constitutively activated receptor in primary human hepatocytes. Biochem. Biophys. Res. Commun . 274, 707– 713. Google Scholar CrossRef Search ADS PubMed  Patsouris D., Reddy J. K., Muller M., Kersten S. ( 2006). Peroxisome proliferator-activated receptor alpha mediates the effects of high-fat diet on hepatic gene expression. Endocrinology  147, 1508– 1516. 10.1210/en.2005-1132. http://dx.doi.org/10.1210/en.2005-1132 Google Scholar CrossRef Search ADS PubMed  Rasmussen M. K., Balaguer P., Ekstrand B., Daujat-Chavanieu M., Gerbal-Chaloin S. ( 2016a). Skatole (3-Methylindole) is a partial aryl hydrocarbon receptor agonist and induces CYP1A1/2 and CYP1B1 expression in primary human hepatocytes. PLoS One  11, e0154629. Google Scholar CrossRef Search ADS   Rasmussen M. K., Theil P. K., Oksbjerg N. ( 2016b). Constitutive expression of cytochrome P450 in foetal and adult porcine livers - Effects of body weight. Toxicol. Lett . 258, 87– 92. Google Scholar CrossRef Search ADS   Rencurel F., Stenhouse A., Hawley S. A., Friedberg T., Hardie D. G., Sutherland C., Wolf C. R. ( 2005). AMP-activated protein kinase mediates phenobarbital induction of CYP2B gene expression in hepatocytes and a newly derived human hepatoma cell line. J. Biol. Chem . 280, 4367– 4373. Google Scholar CrossRef Search ADS PubMed  Saborido A., Molano F., Megias A. ( 1993). Effect of training and anabolic-androgenic steroids on drug metabolism in rat liver. Med. Sci. Sports Exerc . 25, 815– 822. http://dx.doi.org/10.1249/00005768-199307000-00010 Google Scholar CrossRef Search ADS PubMed  Santostefano M. J., Ross D. G., Savas U., Jefcoate C. R., Birnbaum L. S. ( 1997). Differential time-course and dose-response relationships of TCDD-induced CYP1B1, CYP1A1, and CYP1A2 proteins in rats. Biochem. Biophys. Res. Commun . 233, 20– 24. Google Scholar CrossRef Search ADS PubMed  Sidhu J. S., Omiecinski C. J. ( 1995). cAMP-associated inhibition of phenobarbital-inducible cytochrome P450 gene expression in primary rat hepatocyte cultures. J. Biol. Chem . 270, 12762– 12773. http://dx.doi.org/10.1074/jbc.270.21.12762 Google Scholar CrossRef Search ADS PubMed  Spruiell K., Jones D. Z., Cullen J. M., Awumey E. M., Gonzalez F. J., Gyamfi M. A. ( 2014). Role of human pregnane X receptor in high fat diet-induced obesity in pre-menopausal female mice. Biochem. Pharmacol.  89, 399– 412. Google Scholar CrossRef Search ADS PubMed  Steensberg A., Febbraio M. A., Osada T., Schjerling P., van Hall G., Saltin B., Pedersen B. K. ( 2001). Interleukin-6 production in contracting human skeletal muscle is influenced by pre-exercise muscle glycogen content. J. Physiol.  537, 633– 639. Google Scholar CrossRef Search ADS PubMed  Steensberg A., van Hall G., Osada T., Sacchetti M., Saltin B., Pedersen B. K. ( 2000). Production of interleukin-6 in contracting human skeletal muscles can account for the exercise-induced increase in plasma interleukin-6. J. Physiol.  529, 237– 242. Google Scholar CrossRef Search ADS PubMed  Sugatani J., Wada T., Osabe M., Yamakawa K., Yoshinari K., Miwa M. ( 2006). Dietary inulin alleviates hepatic steatosis and xenobiotics-induced liver injury in rats fed a high-fat and high-sucrose diet: Association with the suppression of hepatic cytochrome P450 and hepatocyte nuclear factor 4alpha expression. Drug Metab. Dispos.  34, 1677– 1687. Google Scholar CrossRef Search ADS PubMed  Sy S. K., Ciaccia A., Li W., Roberts E. A., Okey A., Kalow W., Tang B. K. ( 2002). Modeling of human hepatic CYP3A4 enzyme kinetics, protein, and mRNA indicates deviation from log-normal distribution in CYP3A4 gene expression. Eur. J. Clin. Pharmacol . 58, 357– 365. Google Scholar CrossRef Search ADS PubMed  Tajima M., Ikarashi N., Igeta S., Toda T., Ishii M., Tanaka Y., Machida Y., Ochiai W., Yamada H., Sugiyama K. ( 2013). Different diets cause alterations in the enteric environment and trigger changes in the expression of hepatic cytochrome P450 3A, a drug-metabolizing enzyme. Biol. Pharm. Bull . 36, 624– 634. Google Scholar CrossRef Search ADS PubMed  Teng S., Piquette-Miller M. ( 2005). The involvement of the pregnane X receptor in hepatic gene regulation during inflammation in mice. J. Pharmacol. Exp. Ther.  312, 841– 848. Google Scholar CrossRef Search ADS PubMed  Timsit Y. E., Negishi M. ( 2007). CAR and PXR: The xenobiotic-sensing receptors. Steroids  72, 231– 246. http://dx.doi.org/10.1016/j.steroids.2006.12.006 Google Scholar CrossRef Search ADS PubMed  Tolson A. H., Wang H. ( 2010). Regulation of drug-metabolizing enzymes by xenobiotic receptors: PXR and CAR. Adv. Drug Deliv. Rev.  62, 1238– 1249. http://dx.doi.org/10.1016/j.addr.2010.08.006 Google Scholar CrossRef Search ADS PubMed  Ueda R., Iketaki H., Nagata K., Kimura S., Gonzalez F. J., Kusano K., Yoshimura T., Yamazoe Y. ( 2006). A common regulatory region functions bidirectionally in transcriptional activation of the human CYP1A1 and CYP1A2 genes. Mol. Pharmacol.  69, 1924– 1930. http://dx.doi.org/10.1124/mol.105.021220 Google Scholar CrossRef Search ADS PubMed  Vistisen K., Poulsen H. E., Loft S. ( 1992). Foreign compound metabolism capacity in man measured from metabolites of dietary caffeine. Carcinogenesis  13, 1561– 1568. http://dx.doi.org/10.1093/carcin/13.9.1561 Google Scholar CrossRef Search ADS PubMed  Vozarova B., Weyer C., Hanson K., Tataranni P. A., Bogardus C., Pratley R. E. ( 2001). Circulating interleukin-6 in relation to adiposity, insulin action, and insulin secretion. Obes. Res . 9, 414– 417. Google Scholar CrossRef Search ADS PubMed  Watanabe M., Kumai T., Matsumoto N., Tanaka M., Suzuki S., Satoh T., Kobayashi S. ( 2004). Expression of CYP3A4 mRNA is correlated with CYP3A4 protein level and metabolic activity in human liver. J. Pharmacol. Sci . 94, 459– 462. Google Scholar CrossRef Search ADS PubMed  Yan T., Lu L., Xie C., Chen J., Peng X., Zhu L., Wang Y., Li Q., Shi J., Zhou F., et al.   ( 2015). Severely impaired and dysregulated cytochrome p450 expression and activities in hepatocellular carcinoma: Implications for personalized treatment in patients. Mol. Cancer Ther . 14, 2874– 2886. Google Scholar CrossRef Search ADS PubMed  Yang J., Hao C., Yang D., Shi D., Song X., Luan X., Hu G., Yan B. ( 2010). Pregnane X receptor is required for interleukin-6-mediated down-regulation of cytochrome P450 3A4 in human hepatocytes. Toxicol. Lett.  197, 219– 226. Google Scholar CrossRef Search ADS PubMed  Yoshinari K., Takagi S., Yoshimasa T., Sugatani J., Miwa M. ( 2006). Hepatic CYP3A expression is attenuated in obese mice fed a high-fat diet. Pharm. Res . 23, 1188– 1200. Google Scholar CrossRef Search ADS PubMed  Zhang Z. Y., Pelletier R. D., Wong Y. N., Sugawara M., Zhao N., Littlefield B. A. ( 2006). Preferential inducibility of CYP1A1 and CYP1A2 by TCDD: Differential regulation in primary human hepatocytes versus transformed human cells. Biochem. Biophys. Res. Commun . 341, 399– 407. Google Scholar CrossRef Search ADS PubMed  © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Journal

Toxicological SciencesOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve Freelancer

DeepDyve Pro

Price
FREE
$49/month

$360/year
Save searches from Google Scholar, PubMed
Create lists to organize your research
Export lists, citations
Access to DeepDyve database
Abstract access only
Unlimited access to over
18 million full-text articles
Print
20 pages/month
PDF Discount
20% off