Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Sex-specific markers developed by next-generation sequencing confirmed an XX/XY sex determination system in bighead carp (Hypophthalmichthys nobilis) and silver carp (Hypophthalmichthys molitrix)

Sex-specific markers developed by next-generation sequencing confirmed an XX/XY sex determination... Sex-specific markers are powerful tools for identifying sex-determination system in various ani- mals. Bighead carp (Hypophthalmichthys nobilis) and silver carp (Hypophthalmichthys molitrix) are two of the most important edible fish in Asia, which have a long juvenility period that can lasts for 4–5years. In this study, we found one sex-specific marker by next-generation sequencing together with bioinformatics analysis in bighead carp. The male-specific markers were used to per- form molecular sexing in the progenies of artificial gynogenetic diploids and found all progenies (n¼ 160) were females. Meanwhile, around 1 : 1 sex ratio was observed in a total of 579 juvenile offspring from three other families. To further extend the male-specific region, we performed genome walking and got a male-specific sequence of 8,661 bp. Five pairs of primers were designed and could be used to efficiently distinguish males from females in bighead carp and sil- ver carp. The development of these male-specific markers and results of their molecular sexing in different populations provide strong evidence for a sex determination system of female homoga- metry or male heterogametry (XX/XY) in bighead carp and silver carp. To the best of our knowl- edge, this is the first report of effective sex-specific markers in these two large carp species. Key words: sex-specific markers, XX/XY sex determination system, bighead carp and silver carp 1. Introduction determination systems have showed to be highly diverse and com- 2–4 The mechanism of sex determination in fish has attracted a lot of plex. Different sex determination systems have been reported in biologist’s attention, as this mechanism has great implications both some closely related species or even within the same fish genus. in theory and practice. Fish are species of original vertebrate Studies of sex determination in fish provided insights into the genetic evolved from parthenogenesis to sexual reproduction, and their sex mechanisms of sex determination and origin and evolution of sex V C The Author(s) 2018. Published by Oxford University Press on behalf of Kazusa DNA Research Institute. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] 257 Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 258 Sex-specific markers in bighead carp 6,7 chromosomes. Many farmed fish exhibit significant sexual In total, 160 young progenies from three diploid gynogenetic families dimorphism in body size, growth rate and first time of sexual were sampled after 6-month culture in a pond for the detection of 2,8 maturation. Therefore, understanding the genetic basis of sex genetic sexes in the gynogenesis of bighead carp. In addition, 579 determination is critical for the implementation of breeding and pro- young progenies from three full-sib families were sampled after duction programs and sex control, and it can greatly add value by 6-month culture for the detection of sex ratio. The 16 silver carp 6,10 culturing monosex populations in some fish species. To date, sex samples used to verify the markers were sampled from Shishou Fish determination genes have been identified in few farmed fish species, Farm (Shishou, China), and they were caught from the Yangtze such as rainbow trout (Oncorhynchus mykiss), medaka (Oryzias River when they were young and then reared in the farm until 12 13 latipes), tiger pufferfish (Takifugu rubripes), half-smooth tongue sexually mature. The sex of these fish was confirmed by collecting sole (Cynoglossus semilaevis) and Nile tilapia (Oreochromis gametes released. Fin clips from each of the above mature or young niloticus). carp were collected and preserved in 95% alcohol at 4 C. Genomic Sex-specific markers are prerequisite for understanding the mech- DNA were extracted from alcohol-preserved fin tissues following anisms of sex determination, identification of sex-determining genes a standard phenol–chloroform protocol. The quality and quantity 2,16–18 and uncovering genetic architecture related to sex differences. of extracted DNA were checked by NanoDrop2000 spectrophotom- During the past few decades, different approaches have been used to eter (Thermo Scientific, USA) and 1% agarose gel electrophoresis. find sex-specific DNA sequences in aquaculture fishes. Traditional methods such as amplified fragment length polymorphism (AFLP) 2.2. 2b-RAD sequencing and male-specific tags filtering have been successfully used for the identification of sex-specific To identify potential male-specific sequences in a bighead carp 10,19–24 markers in more than 20 aquaculture fishes. With the devel- genome, we used a modified 2b-RAD genotyping method to find opment of next-generation sequencing (NGS) technologies, many putative SNP loci that may be associated with each sex. In this study, new methods have been developed for screening genes or sex- we constructed 2b-RAD libraries for five sires and five dams of big- associated DNA fragments. For example, sex-specifically expressed head carp with known sex phenotypes (brood fish). A total of 250 ng 25–29 genes by RNA-seq, QTL mapping for sex-linked single nucleo- of genomic DNA from each fish was digested with BcgI restriction tide polymorphism (SNP) markers using high-density SNP linkage enzyme (New England Biolabs, USA) at 37 C for 4 h. The digestion maps through restriction site-associated DNA sequencing (RAD- products were heat-inactivated for 20 min at 65 C, and then linked 30–34 Seq), identification of sex-related markers between several sexed to adapter 1 and adapter 2 at 16 C overnight. The linked fragments 35–38 individuals using RAD-Seq without generating linkage maps, and were amplified with Phusion High-Fidelity DNA Polymerase 14,39–41 detecting sex-specific sequences by whole genome sequencing. (Thermo Scientific, USA) using a set of four primers by which Bighead carp and silver carp not only are important freshwater sample-specific barcode and sequencing primers were introduced. edible fish native to East Asia but also have been introduced into After 14 cycles of amplification, the library was obtained by purify- many other countries for improving water quality and human con- 42,43 ing the products at 170 bp via retrieval from 8% polyacrylamide sumption. The global production of bighead carp and silver carp gels. Each library was pooled with an equal amount to make a final reached 3.4 and 4.9 million tons in 2015, respectively (FAO). The library that was sequenced in a lane of the Illumina HiSeq 2500 age of first maturation in bighead carp and silver carp normally takes SE50 platform (Illumina, USA). Rawdata were deposited in NCBI 4 to 5 years or more in central and south China and the incapability SRA PRJNA401338. of determining the gender before sex maturation has brought trou- Reads with low-quality bases were removed before the following bles for aquaculture. Thus, a sex-specific marker is desirable to dis- analyses were carried out. Consensus tags were constructed for each criminate male and female samples at an early life stage of the two sample with Stacks 1.31 with parameter ‘-m 4 -p 6 -M 1 -N 2 -d –r’. carps. The aim of this study is to identify sex-specific markers in the After that, with Perl scripts, we extracted male-specific tags present in two carps and then apply these sex markers to perform molecular all five sires but not in any of the five dams. The male-specific tags sexing and verification in large number of samples including mature were then mapped to a female bighead carp genome (Shunping He, and young fish and progenies from gynogenetic and full-sib families. unpublished data), and those tags failing to align to the female refer- ence genome were considered as putative male-specific tags. 2. Materials and methods 2.3. Re-sequencing and screening of male-specific 2.1. Experimental fish genomic scaffolds All experimental procedures about dealing with the fish in this study Because the male-specific tags obtained from 2b-RAD sequencing were approved by the Committee for Animal Experiments of the method were only 32 bp in length, which are too short to design pri- Institute of Hydrobiology of the Chinese Academy of Sciences, mers for PCR experiment, we sequenced a whole genome of a male China. The methods used in this study were carried out in accord- bighead carp, Arp7, which was one of the five dams used in the ance with the Laboratory Animal Management Principles of China. screening of male-specific tags. The sequencing library was con- The rearing activities of bighead carp in Wuhan, Hubei were structed with small insert fragments (300–500 bp), and sequenced by approved by the owner of the pond. Illumina HiSeq 4000 sequencing platform using 150 bp paired-end A total of 136 sexually matured bighead carp (brood fish) were sampled from the Zhangdu Lake Fish Farm (Wuhan, China), all of reads. The raw reads were filtered by removing adaptor sequences, which were harvested from the middle Yangtze River and sampled at contamination and low-quality reads. Then those filtered reads least 6 years old. The sex phenotype of each sire and dam was indi- were mapped to a female bighead carp genome (Shunping He, unpublished data), and SOAPdenovo2 (version 2.04) was used to vidually confirmed by collecting its gametes (sperm or eggs) released in artificial reproduction in May 2014. Artificial gynogenesis was assembly these unmapped reads to male-specific regions. The male- performed in bighead carp according to a previous method. specific 2b-RAD reads were aligned to the male-specific regions, and Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 H. Liu et al. 259 the targeted scaffolds were regarded as putative male-specific several rounds of genome walking experiments were carried out to scaffolds. gain flanking sequences of the male-specific contigs. Genome walking was performed using Universal GenomeWalker 2.0 kit (Clontech) in accordance with the user’s manual. The primers used in genome 2.4. Development and validation of male-specific walking were summarized in Table 3. SCAR markers Three sequence characterized amplified region (SCAR) markers were designed based on each male-specific scaffolds using Primer Premier 5 3. Results (Premier Biosoft International, Palo Alto, CA, USA). Then PCR was 3.1. Male-specific 2b-RAD tags used to validate the sex specificity of male-specific SCAR markers. To find sex-specific markers in bighead carp, we used 2b-RAD sequenc- PCR reactions were carried with a total volume of 25 ll, containing ing to genotype five male and five female samples, which were within 50 ng of template DNA, 2.5 llof 10 reaction buffer, 0.75 U of Taq the 136 brood fish. In total, 30,941,847 raw reads and 26,732,738 polymerase (TaKaRa, Japan), 0.8 ll of dNTP (2.5 mmol/l), 0.8 llof high-quality reads were obtained after filtering low-quality reads forward and reverse primer mixture (2.5 lmol/l each) and water to (Table 1). A total of 16,137,193 high-quality reads were obtained from the final volume. PCR programs were as follows: an initial denatura- five female samples and 10,595,545 high-quality reads from five male tion step of 94 C for 5 min; then 36 cycles of 94 C for 35 s, 50 C samples. Each individual gets 1,367,315 to 5,162,352 high-quality annealing for 35 s, and 72 C for 40 s; and finally an extension step of reads, and the average amount of data is 2,673,274 reads per sample. 72 C for 8 min. The amplified products were separated by 1% agar- ose or 8% polyacrylamide gel electrophoresis. After clustering, the tags per sample ranged from 59,506 to 70,463 with Eight male and eight female matured fish with known sexes were an average of 63,699. Average coverage depth per tag among samples first used to verify the authenticity of SCAR markers by PCR/gel elec- varied from 22.28 to 86.75 (mean 42.69). The high-sequencing trophoresis assay. Then PCR products were sequenced via direct coverage depth guarantees the high reliability of sex-specific sequences generated in this study. With Perl scripts, we extracted those male- Sanger sequencing method to confirm the identity of the nucleotide sequences of sex markers with the sequences of male-specific scaf- specific tags presented in all five males but not in any of five females. folds. To further validate that those SCAR markers are truly male- Finally, we got 13 tags presented in all five male fish but not in any of specific, and not simply specific to only several individuals, 120 five female fish. Reads supporting the 13 tags in all male samples were matured fish (broodstock population) with known phenotypic sexes summarized in Table 2. were used to verify the detection efficiency (accuracy) of those SCAR markers. Moreover, SCAR markers were also verified by 160 gyno- Table 1. Summary of 2b-RAD data for 10 bighead carp parents genetic diploid progenies of bighead carp from three dams. Parents Sex Raw reads High-quality reads Tags Sequencing depth 2.5. Analysis of sex ratio in full-sib families Arp1 $ 1,528,656 1,433,493 63,696 22.51 Arp2 $ 5,951,567 4,867,677 61,397 79.28 The male-specific markers were used to assess sex ratio (female to Arp3 $ 2,512,315 2,323,809 70,463 32.98 male) in three full-sib families of bighead carp (6 months old), which Arp4 $ 2,564,547 2,349,862 70,263 33.44 contained 90, 166, 324 young offspring, respectively. Chi-square Arp5 $ 6,344,744 5,162,352 59,506 86.75 tests were performed to determine the fitness of sex ratio (female/ Arp6 # 1,578,254 1,479,263 64,451 22.95 male) to the expected 1 : 1. Arp7 # 5,911,337 4,852,376 60,226 80.57 Arp8 # 1,552,576 1,436,797 63,093 22.77 Arp9 # 1,450,791 1,367,315 61,362 22.28 2.6. Genome walking Arp10 # 1,547,060 1,459,794 62,534 23.34 The male-specific contigs did not have corresponding regions in Average # 3,094,185 2,673,274 63,699 42.69 female bighead carp genome (Shunping He, unpublished data), so Table 2. Information of 13 male-specific tags Name Tag Sequence Existence in the Scaffold of the female genome male genome 1 ref-22847 AGTAAACAGACGAGCAAACTGCAGCAAAAGAA No scaffold37502 2 ref-18178 AAATTGGCAACGAAAAAACTGCAGCGCGTATG No scaffold8218 3 ref-804 ACTCCTTTAACGATGAAGATGCAATTTTCGCC No — 4 ref-14673 CTGTTGAAGACGATGGAGGTGCGGATGACGTT Yes — 5 ref-18221 TGTCTTTTTACGAGACAGATGCTCCAGCATCA Yes — 6 ref-20508 ACCAAAGACACGATCACTGTGCTATAGCGTGC Yes — 7 ref-44705 CACATGAACCCGAGGGCAATGCATTCTGAATC Yes — 8 ref-45942 TCATCAGCATCGAGACTCCTGCCATTTCATTC Yes — 9 ref-46385 TGCATATGTCCGATAGGATTGCAACATTCAAA Yes — 10 ref-47639 TTATTTTCATCGACAAACTTGCCATTCGAGTC Yes — 11 ref-58079 TCTTGGATCCCGAAATAGCTGCCCGGAGGCGT Yes — 12 ref-63125 AGATGAGCTCCGAGTTCTGTGCCATCATTGCC Yes — 13 ref-68081 GCAACAATCTCGACCGCATTGCCGAAGAGGCC Yes — Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 260 Sex-specific markers in bighead carp We mapped these 13 potential male-specific tags to the female Table 3. Male-specific primers used for SCAR markers bighead carp genome sequence (Shunping He, unpublished data), 0 0 Name Reference sequences Primers (5 -3 ) and found 10 of them were mapped to a female genome. Among them, five had SNPs in the BcgI digestion recognition site ArS-9-1 scaffold37502 F: GCTCCTTACTCAGCAACT (N CGAN TGCN ) of the female genome, and other five tags R: TCAGTAAACAGACGAGCA 10 6 10 ArS-9-2 scaffold37502 F: GGTGCAGGATTTCCAGTT remained the same sequences as their corresponding female sequen- R: CCATTGATGTTGTCGCTCT ces. Therefore, only three tags without any mapping were male- ArS-9-3 scaffold37502 F: CAAAGACCGCAATAGGAG specific 2b-RAD tags (Table 2). R: GAGCATGTGAAATTAGTGAAG ArS-9-10 Genome walking F: GGCTATCTAAGTTTGGGC 3.2. Mapping male-specific tags to male-specific R: GGATGAGCATTGAAGGTG ArS-9-11 Genome walking F: GTAAGTTGAGTTTGTGGC genomic regions R: GATGAGCATTGAAGGTG Since male-specific 2b-RAD tags were too short to design primers for ArS-9-13 Genome walking F: CAAAGACCGCAATAGGAG PCR amplification, one of the male individuals was subject to short- R: CCAGGACAAGGTGACATACT reads de novo sequencing. We got 48,157,939 pairs of 150 bp ArS-9-14 Genome walking F: TCGGCAAACAGAAAAGAC Illumina pair-end reads for this sample. After filtering low-quality R: AATGGTGAATAGGGAGCG reads, 42,830,738 pair-end reads were left and mapped to a female ArS-9-15 Genome walking F: AGCAACTTTTGTCTGGTG bighead carp genome. As mapped reads were located in regions iden- R: AATGAATGGTGAATAGGG tical between the male and female genome, we only kept 4,417,710 pairs of unmapped reads for de novo assembly of male-specific regions of bighead carp. Finally, we got 298,474 scaffolds with a total size of 79.0 Mb. To get the flanking sequences of the three tags, we mapped them to assembled male-specific scaffolds. For the tag ref-22847, it was mapped to scaffold37502 (907 bp) with 100% identity. For the tag ref-18178, it was mapped to scaffold8218 (602 bp) of identical sequences. For the tag ref-804, we could not find any mapping results in the scaffolds of the male genome. Therefore, scaffold37502 and scaffold8218 were candidate male-specific sequences in the big- head carp. 3.3. Development and validation of male-specific markers Three primers were designed for each male-specific scaffolds, and then their authenticity was verified by PCR between mature males and females (Table 3, Supplementary File S2). Three markers from scaffold37502 showed consistent amplification of fragments in all eight mature males, while none of the eight mature females amplified Figure 1. PCR detection and genetic sexing in eight females and eight males those bands (Fig. 1). For scaffold8218, the PCR products from all of bighead carp by male-specific primer pairs designed based on male scaf- three primers showed no difference between male and female sam- fold37502. The DL 2000 DNA marker is shown on the left. ples (Supplementary Fig. S3). In order to detect universality of the male-specific markers, the three markers from scaffold37502 were The earlier results indicated that these sequences from male-specific tested in another 120 mature bighead carp fish, and the authenticity region are unique to the bighead carp male genome. of these sexing tests was 100% (Supplementary Fig. S1). These results strongly support high reliability of the male-specific markers 3.4. Genetic sex identification in full-sib families in other larger bighead carp samples, which confirmed that these loci After verifying the authenticity of male-specific markers, they were are truly male-specific. These male-specific markers were also vali- used to analyse the ratio of females to males in three full-sib families of dated in 160 offspring from three diploid gynogenetic families, and young bighead carp containing 579 offspring, and the total segrega- all fish were identified as females (Supplementary Fig. S2). The male tion ratio of females to males was 295 : 284 (1.04 : 1) (Table 4)inall PCR products were Sanger sequenced, and the nucleotide sequences three families. The female-to-male segregation ratio of these three fam- were consistent with the male genomic sequences in scaffold37502. ilies were 46 : 44 (1.05 : 1), 82 : 84 (0.98 : 1) and 295 : 284 (1.04 : 1), However, three markers from scaffold8218 showed no difference respectively. Chi-square testing showed that the female-to-male ratio when amplified between female and male individuals. Therefore, of all three families did not have significant differences with the 1 : 1 only scaffold37502 was confirmed as a male-specific sequence in big- separation ratio (P¼ 1). head carp. We blasted the male-specific sequences of scaffold37502 against 3.5. Genome walking and more sex-specific markers the female genome of bighead carp, but no homologous sequences were found. Then we blasted the male-specific sequences of the scaf- After five rounds of genome walking (two for the upstream and three fold37502 against the NCBI NT database, and we could not find for the downstream sequences), the corresponding male genomic sequence alignment of this region to any other vertebrate genomes. fragments were extended. The designed walking primers and the Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 H. Liu et al. 261 Table 4. The male and female ratio for three full-sib families of bighead carp Family Number of Number of Number of Ratio offspring females males 1 90 46 44 1.05 Figure 3. PCR detection and genetic sexing in eight females and eight males 2 166 82 84 0.98 of silver carp by male-specific primer pairs designed in bighead carp. The DL 3 323 167 156 1.07 2000 DNA marker is shown on the left. Total 579 295 284 1.04 4. Discussion Sex-associated markers’ identification can facilitate the discovery of sex-determining region or even sex-determining genes. The results can also help us understand the sex-determination systems as well as origin and evolution of sex chromosomes. However, unlike the mammals or birds with significant difference in sex chromosomes, large differentiated genomic regions are uncommon in fish. Thus, it is always difficult to screen these sex-specific regions successfully. Traditional molecular marker technologies such as RAPD and AFLP have proved to be simple and effective ways to find sex markers in 21–24,49 fish, but in some species they failed to detect any sex-specific 50–52 markers. In the last decade, the development of NGS technology allowed researchers to quickly and conveniently obtain millions of sequences at the genomic level, and it rendered new opportunities for sex differ- 37,53 ence analysis between males and females. With the combination of NGS and restriction digestion enzymes, RAD-Seq offers the possi- bility for generating thousands of SNPs in a short time, which could be used for identification of sex-linked SNP markers or sex-specific DNA sequences and for the construction of high-density linkage 32,36,38,53 maps and sex QTL mapping. RAD-Seq has been success- fully used for sex-specific marker identification in a variety of species using only multiple male and female individuals, which proved to be 35–38,53 an efficient way for screening of sex-specific markers. But RAD-Seq always misses some of the digestion sites, which can cause Figure 2. PCR detection and genetic sexing in eight females and eight males the failure of identification of sex-specific markers. of bighead carp by different male-specific primer pairs designed based on Compared to other RAD-Seq methods, the 2b-RAD method used genome walking sequences. The DL 2000 DNA marker is shown on the left. in this study has more advantages compared to traditional RAD-Seq. First, it can screen nearly every restriction site at the whole genome adapter primers were summarized in Table 3. Based on the amplified level whereas other RAD-Seq methods can only get a subset of total fragments from males, an 8,661 bp of male-specific sequences sites due to the multiple time size selection for efficient PCR amplifi- were assembled from the male-amplified fragments (Supplementary 54,55 cation and sequencing. The average sequence coverage for each File S1), and the whole sequence was submitted to NCBI at accession site in 2b-RAD is usually more than 40 coverage, which provided MG668998. According to the male-specific sequences, more sex- accuracy of 2b-RAD genotyping and high reliability of generated specific markers were designed, such as ArS-9-10, ArS-9-11, ArS-9- tags. Second, the sequences of 2b-RAD are easy for sex-specific 2b- 13, ArS-9-14 and ArS-9-15. The PCR results from different sex with RAD reads identification, which is very convenient for PCR verifica- these primers further identified that this region is male-specific region tion. With all of these positive attributes, the 2b-RAD method is very in the bighead carp genome (Fig. 2, Table 3). We blasted the genome suitable for sex-specific markers and sex-determining regions identifi- walking sequence against the female genome, but no corresponding cation. Here, for the first time, we utilize the 2b-RAD and genome homologous sequence was found. re-sequencing to efficiently and accurately identify the sex-specific markers in genomes of two closely related species, bighead carp and 3.6. Genetic sex identification in silver carp silver carp. Our study proved that combining 2b-RAD genotyping In order to verify the presence of the sex markers in other species of and genome re-sequencing is a very powerful and promising tool for the genus Hypophthalmichthys, the designed SCAR primers were sex-specific markers’ identification. This strategy of SCAR-based also amplified in eight female and eight male silver carp and showed PCR detection in this study is the first protocol successfully amplify- the same results with bighead carp (Fig. 3). We also found that the ing the Y-specific fragment in bighead carp and silver carp. PCR results matched with phenotype with a 100% overall accuracy. The studies of sex-determination in fish would contribute to the 1,3 The same amplification results were found both on males and understanding of the origin and evolution of sex chromosomes. females of these two species, and sequences of PCR products of silver Although most fish species lack visually heteromorphic sex chromo- carp were also similar with that of bighead carp. somes, some species have evolved sex-determining regions (genes) Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 262 Sex-specific markers in bighead carp 12,23,30,32,34,38 and even nascent sex chromosome. Based on the 2b- carp showed a 1 : 1 best orthologues relationship based on compara- RAD sequencing and male fish re-sequencing, we got a scaffold span- tive genome mapping, meaning a low level of genetic diversity. In ning over 900 bp, which is totally associated with Y-specific frag- this study, bighead carp, silver carp and grass carp shared the same ments of bighead carp, suggesting that this scaffold is located on the sex-specific markers and sex-determining DNA sequence, suggesting Y chromosome or nascent Y-linked region. We extend this scaffold that they may have a homologous nascent Y chromosome and the to 8,661 bp by genome walking, but no homologous sequences cor- same pathways involved in sex determination systems. Therefore, the responding to this region was found in the female genome. This three carp should share the most recent common ancestor and the might be a significant difference in male and female sex-determining sex determination systems probably arose before speciation. regions in bighead carp. The diversity between male and female fish We presented an approach that identifies and validates sex- in this sex-related region may lead to recombination suppression as specific markers using 2b-RAD sequencing and genome re- an early stage of sex chromosome evolution. Our results and pre- sequencing from multiple male and female individuals in bighead vious karyotyping studies demonstrated that bighead carp has carp and silver carp. A male-specific scaffold was identified and three evolved a sex-determining region, but has not yet formed distinguish- sex-specific primers were designed first according the male-specific able (heteromorphic) sex chromosomes. scaffold. The sex-specific markers could be used in genetic sexing To study whether Cyprinidae fish shared the same sex- with 100% accuracy in brood fish and a large number of young fish determination system, we blasted the 8,661 bp sequences to the from full-sib families. In addition, all gynogenetic progenies were male-specific region in grass carp (Ctenopharyngodon idellus) genetically sexed as female by these sex-specific markers, confirming genome, and found that most of the 4,148 bp of male-specific the female homogamety sex determination system in bighead carp. sequences in grass carp were presented in bighead carp male-specific Taken together, all these results confirm that bighead carp and silver regions with 94% identify. Furthermore, one male-specific marker carp have a genetic mechanism of sex determination with an XX/XY has been found in common carp (Cyprinus carpio) from the Yellow sex determination system. The sex-specific markers developed in this River, but we found that sequence presented in gynogenetic study would be powerful and effective tools to uncover the sex deter- Songpu common carp genome. This demonstrates that this sequence mination system and identify potential genomic regions in bighead might be a strain-specific sex marker in common carp. And we found carp and silver carp. no similarity between it and male-specific marker in bighead carp. Unlike the big carp, the sex-determination of zebrafish has been Acknowledgements found to be both genetic and environmental. Several markers have been found in the zebrafish genome. Chromosome 4 are closely- This study was supported by grants from the NSFC (31472268 and related to its sex, but we found the male-specific region in bighead 31502153), FEBL (2016FBZ05) and DAC (2009045). We would like to thank carp cannot mapped to that region in zebrafish genome. The reason Xinhua Wang, Baojiang Gan and Xueli Liu for sample collection and labora- tory technical assistance. We would like to thank Prof. Shunping He for offer- for above phenomena might be the ancestor of zebrafish divided ing the bighead carp genome sequences. with the ancestor of Endemic Clad of East Asia Cyprinidae (ECEAC) fish at about 30 Mya, which is much older than specification of fish within ECEAC (about 59 Mya). Based on this information, the Accession numbers bighead carp male-specific sequence was not only shared in silver PRJNA401338 and MG668998 carp but also in grass carp, and we predict that this male-specific sequence might emerge in the ancestor of ECEAC fish and was kept in all extent diploid fish in this group. As to the common carp, which Conflict of interest is a tetraploid fish, it might have formed its own sex-determination region or genes in its speciation process. None declared. Sex-specific markers have been successfully used to identify 18,24,35–38 the sex determination systems in many species, and it Supplementary data is especially valuable in species that lack heteromorphic sex chromosomes. In this study, the presence of male-specific markers Supplementary data are available at DNARES online. indicates an XX/XY sex determination system in bighead carp and silver carp. A larger sample size of bighead carp was used to further References verify the accuracy of the male-specific markers, and the verification efficiency was 100% in all mature individuals. Besides, the female- 1. Devlin, R. H. and Nagahama, Y. 2002, Sex determination and sex differ- to-male segregation ratio in three full-sib families was 1 : 1. All those entiation in fish: an overview of genetic, physiological, and environmental results strongly indicated that bighead carp and silver carp have a influences, Aquaculture, 208, 191–364. genetic XX/XY sex determination system, which is similar to the 2. Kobayashi, Y., Nagahama, Y. and Nakamura, M. 2013, Diversity and plasticity of sex determination and differentiation in fishes, Sex Dev., 7, grass carp’s XX/XY sex determination system. Based on these 115–25. results and the phylogenetic position of fishes discussed earlier, we 3. Kikuchi, K. and Hamaguchi, S. 2013, Novel sex-determining genes in fish predicted that the ancestor of the whole Cyprinidae might have a and sex chromosome evolution, Dev. Dyn., 242, 339–53. XX/XY sex determination system. And this system might persist in 4. Mank, J. E. and Avise, J. C. 2009, Evolutionary diversity and turn-over of all extent species in Cyprinidae and facilitate the hybrid between dif- sex determination in teleost fishes, Sex Dev., 3, 60–7. ferent species within this group. 5. Volff, J. N. 2005, Genome evolution and biodiversity in teleost fish, Bighead carp and silver carp are two of the most closely related Heredity (Edinb), 94, 280–94. species of the Cyprinidae family, cytogenetic analyses revealed that 6. Mei, J. and Gui, J. F. 2015, Genetic basis and biotechnological manipula- they have similar karyotypes and lack visually heteromorphic sex tion of sexual dimorphism and sex determination in fish, Sci. China Life 56,61 chromosomes. The linkage groups of bighead carp and silver Sci., 58, 124–36. Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 H. Liu et al. 263 7. Ellegren, H. 2011, Sex-chromosome evolution: recent progress and the 28. Chen, X., Mei, J., Wu, J., et al. 2015, A comprehensive transcriptome pro- vides candidate genes for sex determination/differentiation and SSR/SNP influence of male and female heterogamety, Nat. Rev. Genet., 12, markers in yellow catfish, Mar. Biotechnol., 17, 190–8. 157–66. 29. Tao, W. J., Yuan, J., Zhou, L., et al. 2013, Characterization of gonadal 8. Cnaani, A. and Levavi-Sivan, B. 2009, Sexual development in fish, practi- transcriptomes from Nile tilapia (Oreochromis niloticus) reveals differen- cal applications for aquaculture, Sex Dev., 3, 164–75. tially expressed genes, PLoS One, 8. DOI: 10.1371/journal.pone. 9. Martı´nez, P., Vinas, ~ A. M., Sa ´ nchez, L., et al. 2014, Genetic architecture of sex determination in fish: applications to sex ratio control in aquacul- 30. Palaiokostas, C., Bekaert, M., Khan, M. G. Q., et al. 2015, A novel ture, Front. Genet., 5, 340. sex-determining QTL in Nile tilapia (Oreochromis niloticus), BMC 10. Wang, D., Mao, H. L., Chen, H. X., Liu, H. Q. and Gui, J. F. 2009, Genomics, 16. DOI: 10.1186/S12864-015-1383-X. Isolation of Y- and X-linked SCAR markers in yellow catfish and applica- 31. Palaiokostas, C., Bekaert, M., Taggart, J. B., et al. 2015, A new tion in the production of all-male populations, Anim. Genet., 40, 978–81. SNP-based vision of the genetics of sex determination in European sea 11. Yano, A., Guyomard, R., Nicol, B., et al. 2012, An immune-related gene bass (Dicentrarchus labrax), Genet. Sel. Evol., 47. DOI: 10.1186/s12711- evolved into the master sex-determining gene in rainbow trout, 015-0148-y. Oncorhynchus mykiss, Curr. Biol., 22, 1423–8. 32. Palaiokostas, C., Bekaert, M., Davie, A., et al. 2013, Mapping the sex 12. Matsuda, M., Nagahama, Y., Shinomiya, A., et al. 2002, DMY is a determination locus in the Atlantic halibut (Hippoglossus hippoglossus) Y-specific DM-domain gene required for male development in the medaka using RAD sequencing, BMC Genomics, 14. DOI: 10.1186/1471-2164- fish, Nature, 417, 559–63. 14-566. 13. Kamiya, T., Wataru, K., Satoshi, T., et al. 2012, A trans-species missense 33. Anderson, J. L., Marı´, A. R., Braash, I., et al. 2012, Multiple SNP in Amhr2 is associated with sex determination in the tiger pufferfish, sex-associated regions and a putative sex chromosome in zebrafish Takifugu rubripes (Fugu), PLoS Genet., 8. DOI: 10.1371/journal.pgen. revealed by RAD mapping and population genomics, PLoS One, 7. DOI: 10.1371/journal.pone.0040701. 14. Chen, S. L., Zhang, G., Shao, C., et al. 2014, Whole-genome sequence of 34. Palaiokostas, C., Bekaert, M., Khan, M. G. Q., et al. 2013, Mapping and a flatfish provides insights into ZW sex chromosome evolution and adap- validation of the major sex-determining region in Nile tilapia tation to a benthic lifestyle, Nat. Genet., 46, 253–þ. (Oreochromis niloticus L.) using RAD sequencing, PLoS One, 8. DOI: 15. Li, M. H., Yunlv, S., Jiue, Z., et al. 2015, A tandem duplicate of 10.1371/journal.pone.0068389. anti-mullerian hormone with a missense SNP on the Y chromosome is 35. Carmichael, S. N., Bekaert, M., Taggart, J. B., et al. 2013, Identification essential for male sex determination in Nile tilapia, Oreochromis niloti- of a sex-linked SNP marker in the salmon louse (Lepeophtheirus salmo- cus, PLoS Genet., 11. DOI: 10.1371/journal.pgen.1005678. nis) using RAD sequencing, PLoS One, 8. DOI: 10.1371/journal.pone. 16. Gui, J. F. and Zhu, Z. Y. 2012, Molecular basis and genetic improvement of economically important traits in aquaculture animals, Chinese Sci. 36. Kafkas, S., Khodaeiaminjan, M., Guney, M. and Kafkas, E. 2015, Bull, 57, 1751–60. Identification of sex-linked SNP markers using RAD sequencing suggests 17. Gui, J., Zhou, L. and Wu, Q. 2007, Genetic Basis and Artificial Control ZW/ZZ sex determination in Pistacia vera L., BMC Genomics, 16. DOI: of Sexuality and Reproduction in Fish. Science Press: Beijing. 10.1186/s12864-015-1326-6. 18. Charlesworth, D. and Mank, J. E. 2010, The birds and the bees and the 37. Gamble, T. and Zarkower, D. 2014, Identification of sex-specific molecu- lar markers using restriction site-associated DNA sequencing, Mol. Ecol. flowers and the trees: lessons from genetic mapping of sex determination Resour., 14, 902–13. in plants and animals, Genetics, 186, 9–31. 38. Fowler, B. L. and Buonaccorsi, V. P. 2016, Genomic characterization of 19. Kovacs, B., Egedi, S., Bartfai, R. and Orban, L. 2000, Male-specific DNA sex-identification markers in Sebastes carnatus and S. chrysomelas rock- markers from African catfish (Clarias gariepinus), Genetica, 110, 267–76. fishes, Mol. Ecol., 25, 2165–75. 20. Vale, L., Dieguez, R., Sa ´ nchez, L., Martı´nez, P. and Vinas, ~ A. 2014, A 39. Wang, Y. P., et al. 2015, The draft genome of the grass carp sex-associated sequence identified by RAPD screening in gynogenetic indi- (Ctenopharyngodon idellus) provides insights into its evolution and vege- viduals of turbot (Scophthalmus maximus), Mol. Biol. Rep., 41, 1501–9. tarian adaptation, Nat. Genet., 47, 625–31. 21. Felip, A., Martinez-Rodriguez, G., Piferrer, F., Carrillo, M. and Zanuy, S. 40. Green, J. E., Dalikova, M., Sahara, K., Marec, F. and Akam, M. 2016, 2000, AFLP analysis confirms exclusive maternal genomic contribution of XX/XY system of sex determination in the geophilomorph centipede meiogynogenetic sea bass (Dicentrarchus labrax L.), Mar. Biotechnol., 2, Strigamia maritima, PLoS One, 11. DOI: 10.1371/journal.pone.0150292. 301–6. 41. Koerich, L. B., Dupim, E. G., Faria, L. L., et al. 2016, First report of 22. Felip, A., Young, W. P., Wheeler, P. A. and Thorgaard, G. H. 2005, An Y-linked genes in the kissing bug Rhodnius prolixus, BMC Genomics, AFLP-based approach for the identification of sex-linked markers in rain- 17,1. bow trout (Oncorhynchus mykiss), Aquaculture, 247, 35–43. 42. Kolar, C. S., et al. Asian carps of the genus Hypophthalmichthys (Pisces, 23. Dan, C., Mei, J., Wang, D. and Gui, J. F. 2013, Genetic differentiation Cyprinidae)-a biological synopsis and environmental risk assessment. and efficient sex-specific marker development of a pair of Y- and X-linked markers in yellow catfish, Int. J. Biol. Sci., 9, 1043–9. 43. Chen, J., Xie, P., Zhang, D. W. and Lei, H. H. 2007, In situ studies on the 24. Pan, Z. J., Li, X. Y., Zhou, F. J., Qiang, X. G. and Gui, J. F. 2015, distribution patterns and dynamics of microcystins in a biomanipulation Identification of sex-specific markers reveals male heterogametic sex deter- fish-bighead carp (Aristichthys nobilis), Environ. Pollut., 147, 150–7. mination in Pseudobagrus ussuriensis, Mar. Biotechnol., 17, 441–51. 44. Zhu, C. K., Sun, Y. H., Yu, X. M. and Tong, J. G. 2013, Centromere 25. Lamatsch, D. K., Adolfsson, S., Senior, A. M., et al. 2015, A transcrip- localization for bighead carp (Aristichthys nobilis) through half-tetrad tome derived female-specific marker from the invasive western mosquito- analysis in diploid gynogenetic families, PLoS One, 8. DOI: 10.1371/jour fish (Gambusia affinis), PLoS One, 10. DOI: 10.1371/journal.pone. nal.pone.0082950. 45. Chong, L. 2001, Molecular cloning: a laboratory manual, 3rd edition, 26. Lu, J. G., Zheng, M., Zheng, J., et al. 2015, Transcriptomic analyses Science, 292, 446. reveal novel genes with sexually dimorphic expression in yellow catfish 46. Catchen, J., Hohenlohe, P. A., Bassham, S., Amores, A. and Cresko, W. (Pelteobagrus fulvidraco) brain, Mar Biotechnol, 17, 613–23. A. 2013, Stacks: an analysis tool set for population genomics, Mol. Ecol., 27. Diaz, N. and Piferrer, F. 2015, Lasting effects of early exposure to temper- 22, 3124–40. ature on the gonadal transcriptome at the time of sex differentiation in the 47. Luo, R. B., et al. 2012, SOAPdenovo2: an empirically improved European sea bass, a fish with mixed genetic and environmental sex deter- memory-efficient short-read de novo assembler, Gigascience, 1. DOI: 10. mination, BMC Genomics, 16. DOI: 10.1186/S12864-015-1862-0. 1186/2047-217x-1-18. Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 264 Sex-specific markers in bighead carp 48. Piferrer, F., Ribas, L. and Diaz, N. 2012, Genomic approaches to study 55. Wang, S., Meyer, E., McKay, J. K. and Matz, M. V. 2012, 2b-RAD: a genetic and environmental influences on fish sex determination and differ- simple and flexible method for genome-wide genotyping, Nat. Methods, entiation, Mar. Biotechnol., 14, 591–604. 9, 808–10. 49. Wang, D. W., Li, Y. and Li, Z. Q. 2011, Identification of a male-specific 56. Kong, Q. L., LI, Z. Y., Fu, M. L., Wang, Q. and WANG, H. Y. 2006, amplified fragment length polymorphism (AFLP) and a sequence charac- Analysis of DAPI karyotype of bighead carp (Aristichthys nobilis) chro- terized amplified region (SCAR) marker in Eucommia ulmoides Oliv, Int. mosomes, Sichuan J. Zool., 25, 64–7. J. Mol. Sci., 12, 857–64. 57. Chen, J., Wang, Y., Yue, Y., et al. 2009, A novel male-specific DNA 50. Gao, Z. X., Wang, H. P., Yao, H., Tiu, L. and Wang, W. M. 2010, No sequence in the common carp, Cyprinus carpio, Mol. Cell. Probes, 23, sex-specific markers detected in bluegill sunfish Lepomis macrochirus by 235–9. AFLP, J. Fish Biol., 76, 408–14. 58. Howe, K., Clark, M. D., Torroja, C. F., et al. 2013, The zebrafish refer- 51. Yarmohammadi, M., Pourkazemi, M., Ghasemi, A., Hassanzadeh, M. ence genome sequence and its relationship to the human genome, Nature. and Chakmehdouz, F. 2011, AFLP reveals no sex-specific markers in 496, 498–503. Persian sturgeon (Acipenser persicus) or beluga sturgeon (Huso huso) 59. Tao, W., Zou, M., Wang, X., et al. 2010, Phylogenomic analysis resolves from the southern Caspian Sea, Iran, Progr. Biol. Sci., 1, 55–114. the formerly intractable adaptive diversification of the endemic clade of 52. Sriphairoj, K., Na-Nakorn, U., Brunelli, J. P. and Thorgaard, G. H. 2007, east Asian Cyprinidae (Cypriniformes), PLoS One, 5, e13508. No AFLP sex-specific markers detected in Pangasianodon gigas and P. 60. Xu, P., Zhang, X., Wang, X., et al. 2014, Genome sequence and hypophthalmus, Aquaculture, 273, 739–743. genetic diversity of the common carp, Cyprinus carpio, Nat. Genet. 46, 53. Gamble, T., Coryell, J., Ezaz, T., et al. 2015, Restriction site-associated 1212–19. DNA sequencing (RAD-seq) reveals an extraordinary number of transi- 61. Su, Z. G., Xu, K. S., Chen, S. P. and Bai, G. D. 1984, Studies on triploid tions among gecko sex-determining systems, Mol. Biol. Evol., 32, silver carp and its karyotype, Zool. Res. 1984(S2), 15–20. 1296–1309. 62. Zhu, C. K., Tong, J. O., Yu, X. M. and Guo, W. J. 2015, Comparative 54. Baird, N. A., et al. 2008, Rapid SNP discovery and genetic mapping using mapping for bighead carp (Aristichthys nobilis) against model and sequenced RAD markers, PLoS One, 3. DOI: 10.1371/journal.pone. non-model fishes provides insights into the genomic evolution of cypri- 0003376 nids, Mol. Genet. Genomics, 290, 1313–26. Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png DNA Research Oxford University Press

Sex-specific markers developed by next-generation sequencing confirmed an XX/XY sex determination system in bighead carp (Hypophthalmichthys nobilis) and silver carp (Hypophthalmichthys molitrix)

Liu, Haiyang; Pang, Meixia; Yu, Xiaomu; Zhou, Ying; Tong, Jingou; Fu, Beide
DNA Research , Volume Advance Article (3) – Jan 5, 2018
Download PDF
8 pages

Loading next page...
 
/lp/ou_press/sex-specific-markers-developed-by-next-generation-sequencing-confirmed-qPvOyd90Lw

References (66)

Publisher
Oxford University Press
Copyright
© The Author(s) 2018. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
ISSN
1340-2838
eISSN
1756-1663
DOI
10.1093/dnares/dsx054
Publisher site
See Article on Publisher Site

Abstract

Sex-specific markers are powerful tools for identifying sex-determination system in various ani- mals. Bighead carp (Hypophthalmichthys nobilis) and silver carp (Hypophthalmichthys molitrix) are two of the most important edible fish in Asia, which have a long juvenility period that can lasts for 4–5years. In this study, we found one sex-specific marker by next-generation sequencing together with bioinformatics analysis in bighead carp. The male-specific markers were used to per- form molecular sexing in the progenies of artificial gynogenetic diploids and found all progenies (n¼ 160) were females. Meanwhile, around 1 : 1 sex ratio was observed in a total of 579 juvenile offspring from three other families. To further extend the male-specific region, we performed genome walking and got a male-specific sequence of 8,661 bp. Five pairs of primers were designed and could be used to efficiently distinguish males from females in bighead carp and sil- ver carp. The development of these male-specific markers and results of their molecular sexing in different populations provide strong evidence for a sex determination system of female homoga- metry or male heterogametry (XX/XY) in bighead carp and silver carp. To the best of our knowl- edge, this is the first report of effective sex-specific markers in these two large carp species. Key words: sex-specific markers, XX/XY sex determination system, bighead carp and silver carp 1. Introduction determination systems have showed to be highly diverse and com- 2–4 The mechanism of sex determination in fish has attracted a lot of plex. Different sex determination systems have been reported in biologist’s attention, as this mechanism has great implications both some closely related species or even within the same fish genus. in theory and practice. Fish are species of original vertebrate Studies of sex determination in fish provided insights into the genetic evolved from parthenogenesis to sexual reproduction, and their sex mechanisms of sex determination and origin and evolution of sex V C The Author(s) 2018. Published by Oxford University Press on behalf of Kazusa DNA Research Institute. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] 257 Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 258 Sex-specific markers in bighead carp 6,7 chromosomes. Many farmed fish exhibit significant sexual In total, 160 young progenies from three diploid gynogenetic families dimorphism in body size, growth rate and first time of sexual were sampled after 6-month culture in a pond for the detection of 2,8 maturation. Therefore, understanding the genetic basis of sex genetic sexes in the gynogenesis of bighead carp. In addition, 579 determination is critical for the implementation of breeding and pro- young progenies from three full-sib families were sampled after duction programs and sex control, and it can greatly add value by 6-month culture for the detection of sex ratio. The 16 silver carp 6,10 culturing monosex populations in some fish species. To date, sex samples used to verify the markers were sampled from Shishou Fish determination genes have been identified in few farmed fish species, Farm (Shishou, China), and they were caught from the Yangtze such as rainbow trout (Oncorhynchus mykiss), medaka (Oryzias River when they were young and then reared in the farm until 12 13 latipes), tiger pufferfish (Takifugu rubripes), half-smooth tongue sexually mature. The sex of these fish was confirmed by collecting sole (Cynoglossus semilaevis) and Nile tilapia (Oreochromis gametes released. Fin clips from each of the above mature or young niloticus). carp were collected and preserved in 95% alcohol at 4 C. Genomic Sex-specific markers are prerequisite for understanding the mech- DNA were extracted from alcohol-preserved fin tissues following anisms of sex determination, identification of sex-determining genes a standard phenol–chloroform protocol. The quality and quantity 2,16–18 and uncovering genetic architecture related to sex differences. of extracted DNA were checked by NanoDrop2000 spectrophotom- During the past few decades, different approaches have been used to eter (Thermo Scientific, USA) and 1% agarose gel electrophoresis. find sex-specific DNA sequences in aquaculture fishes. Traditional methods such as amplified fragment length polymorphism (AFLP) 2.2. 2b-RAD sequencing and male-specific tags filtering have been successfully used for the identification of sex-specific To identify potential male-specific sequences in a bighead carp 10,19–24 markers in more than 20 aquaculture fishes. With the devel- genome, we used a modified 2b-RAD genotyping method to find opment of next-generation sequencing (NGS) technologies, many putative SNP loci that may be associated with each sex. In this study, new methods have been developed for screening genes or sex- we constructed 2b-RAD libraries for five sires and five dams of big- associated DNA fragments. For example, sex-specifically expressed head carp with known sex phenotypes (brood fish). A total of 250 ng 25–29 genes by RNA-seq, QTL mapping for sex-linked single nucleo- of genomic DNA from each fish was digested with BcgI restriction tide polymorphism (SNP) markers using high-density SNP linkage enzyme (New England Biolabs, USA) at 37 C for 4 h. The digestion maps through restriction site-associated DNA sequencing (RAD- products were heat-inactivated for 20 min at 65 C, and then linked 30–34 Seq), identification of sex-related markers between several sexed to adapter 1 and adapter 2 at 16 C overnight. The linked fragments 35–38 individuals using RAD-Seq without generating linkage maps, and were amplified with Phusion High-Fidelity DNA Polymerase 14,39–41 detecting sex-specific sequences by whole genome sequencing. (Thermo Scientific, USA) using a set of four primers by which Bighead carp and silver carp not only are important freshwater sample-specific barcode and sequencing primers were introduced. edible fish native to East Asia but also have been introduced into After 14 cycles of amplification, the library was obtained by purify- many other countries for improving water quality and human con- 42,43 ing the products at 170 bp via retrieval from 8% polyacrylamide sumption. The global production of bighead carp and silver carp gels. Each library was pooled with an equal amount to make a final reached 3.4 and 4.9 million tons in 2015, respectively (FAO). The library that was sequenced in a lane of the Illumina HiSeq 2500 age of first maturation in bighead carp and silver carp normally takes SE50 platform (Illumina, USA). Rawdata were deposited in NCBI 4 to 5 years or more in central and south China and the incapability SRA PRJNA401338. of determining the gender before sex maturation has brought trou- Reads with low-quality bases were removed before the following bles for aquaculture. Thus, a sex-specific marker is desirable to dis- analyses were carried out. Consensus tags were constructed for each criminate male and female samples at an early life stage of the two sample with Stacks 1.31 with parameter ‘-m 4 -p 6 -M 1 -N 2 -d –r’. carps. The aim of this study is to identify sex-specific markers in the After that, with Perl scripts, we extracted male-specific tags present in two carps and then apply these sex markers to perform molecular all five sires but not in any of the five dams. The male-specific tags sexing and verification in large number of samples including mature were then mapped to a female bighead carp genome (Shunping He, and young fish and progenies from gynogenetic and full-sib families. unpublished data), and those tags failing to align to the female refer- ence genome were considered as putative male-specific tags. 2. Materials and methods 2.3. Re-sequencing and screening of male-specific 2.1. Experimental fish genomic scaffolds All experimental procedures about dealing with the fish in this study Because the male-specific tags obtained from 2b-RAD sequencing were approved by the Committee for Animal Experiments of the method were only 32 bp in length, which are too short to design pri- Institute of Hydrobiology of the Chinese Academy of Sciences, mers for PCR experiment, we sequenced a whole genome of a male China. The methods used in this study were carried out in accord- bighead carp, Arp7, which was one of the five dams used in the ance with the Laboratory Animal Management Principles of China. screening of male-specific tags. The sequencing library was con- The rearing activities of bighead carp in Wuhan, Hubei were structed with small insert fragments (300–500 bp), and sequenced by approved by the owner of the pond. Illumina HiSeq 4000 sequencing platform using 150 bp paired-end A total of 136 sexually matured bighead carp (brood fish) were sampled from the Zhangdu Lake Fish Farm (Wuhan, China), all of reads. The raw reads were filtered by removing adaptor sequences, which were harvested from the middle Yangtze River and sampled at contamination and low-quality reads. Then those filtered reads least 6 years old. The sex phenotype of each sire and dam was indi- were mapped to a female bighead carp genome (Shunping He, unpublished data), and SOAPdenovo2 (version 2.04) was used to vidually confirmed by collecting its gametes (sperm or eggs) released in artificial reproduction in May 2014. Artificial gynogenesis was assembly these unmapped reads to male-specific regions. The male- performed in bighead carp according to a previous method. specific 2b-RAD reads were aligned to the male-specific regions, and Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 H. Liu et al. 259 the targeted scaffolds were regarded as putative male-specific several rounds of genome walking experiments were carried out to scaffolds. gain flanking sequences of the male-specific contigs. Genome walking was performed using Universal GenomeWalker 2.0 kit (Clontech) in accordance with the user’s manual. The primers used in genome 2.4. Development and validation of male-specific walking were summarized in Table 3. SCAR markers Three sequence characterized amplified region (SCAR) markers were designed based on each male-specific scaffolds using Primer Premier 5 3. Results (Premier Biosoft International, Palo Alto, CA, USA). Then PCR was 3.1. Male-specific 2b-RAD tags used to validate the sex specificity of male-specific SCAR markers. To find sex-specific markers in bighead carp, we used 2b-RAD sequenc- PCR reactions were carried with a total volume of 25 ll, containing ing to genotype five male and five female samples, which were within 50 ng of template DNA, 2.5 llof 10 reaction buffer, 0.75 U of Taq the 136 brood fish. In total, 30,941,847 raw reads and 26,732,738 polymerase (TaKaRa, Japan), 0.8 ll of dNTP (2.5 mmol/l), 0.8 llof high-quality reads were obtained after filtering low-quality reads forward and reverse primer mixture (2.5 lmol/l each) and water to (Table 1). A total of 16,137,193 high-quality reads were obtained from the final volume. PCR programs were as follows: an initial denatura- five female samples and 10,595,545 high-quality reads from five male tion step of 94 C for 5 min; then 36 cycles of 94 C for 35 s, 50 C samples. Each individual gets 1,367,315 to 5,162,352 high-quality annealing for 35 s, and 72 C for 40 s; and finally an extension step of reads, and the average amount of data is 2,673,274 reads per sample. 72 C for 8 min. The amplified products were separated by 1% agar- ose or 8% polyacrylamide gel electrophoresis. After clustering, the tags per sample ranged from 59,506 to 70,463 with Eight male and eight female matured fish with known sexes were an average of 63,699. Average coverage depth per tag among samples first used to verify the authenticity of SCAR markers by PCR/gel elec- varied from 22.28 to 86.75 (mean 42.69). The high-sequencing trophoresis assay. Then PCR products were sequenced via direct coverage depth guarantees the high reliability of sex-specific sequences generated in this study. With Perl scripts, we extracted those male- Sanger sequencing method to confirm the identity of the nucleotide sequences of sex markers with the sequences of male-specific scaf- specific tags presented in all five males but not in any of five females. folds. To further validate that those SCAR markers are truly male- Finally, we got 13 tags presented in all five male fish but not in any of specific, and not simply specific to only several individuals, 120 five female fish. Reads supporting the 13 tags in all male samples were matured fish (broodstock population) with known phenotypic sexes summarized in Table 2. were used to verify the detection efficiency (accuracy) of those SCAR markers. Moreover, SCAR markers were also verified by 160 gyno- Table 1. Summary of 2b-RAD data for 10 bighead carp parents genetic diploid progenies of bighead carp from three dams. Parents Sex Raw reads High-quality reads Tags Sequencing depth 2.5. Analysis of sex ratio in full-sib families Arp1 $ 1,528,656 1,433,493 63,696 22.51 Arp2 $ 5,951,567 4,867,677 61,397 79.28 The male-specific markers were used to assess sex ratio (female to Arp3 $ 2,512,315 2,323,809 70,463 32.98 male) in three full-sib families of bighead carp (6 months old), which Arp4 $ 2,564,547 2,349,862 70,263 33.44 contained 90, 166, 324 young offspring, respectively. Chi-square Arp5 $ 6,344,744 5,162,352 59,506 86.75 tests were performed to determine the fitness of sex ratio (female/ Arp6 # 1,578,254 1,479,263 64,451 22.95 male) to the expected 1 : 1. Arp7 # 5,911,337 4,852,376 60,226 80.57 Arp8 # 1,552,576 1,436,797 63,093 22.77 Arp9 # 1,450,791 1,367,315 61,362 22.28 2.6. Genome walking Arp10 # 1,547,060 1,459,794 62,534 23.34 The male-specific contigs did not have corresponding regions in Average # 3,094,185 2,673,274 63,699 42.69 female bighead carp genome (Shunping He, unpublished data), so Table 2. Information of 13 male-specific tags Name Tag Sequence Existence in the Scaffold of the female genome male genome 1 ref-22847 AGTAAACAGACGAGCAAACTGCAGCAAAAGAA No scaffold37502 2 ref-18178 AAATTGGCAACGAAAAAACTGCAGCGCGTATG No scaffold8218 3 ref-804 ACTCCTTTAACGATGAAGATGCAATTTTCGCC No — 4 ref-14673 CTGTTGAAGACGATGGAGGTGCGGATGACGTT Yes — 5 ref-18221 TGTCTTTTTACGAGACAGATGCTCCAGCATCA Yes — 6 ref-20508 ACCAAAGACACGATCACTGTGCTATAGCGTGC Yes — 7 ref-44705 CACATGAACCCGAGGGCAATGCATTCTGAATC Yes — 8 ref-45942 TCATCAGCATCGAGACTCCTGCCATTTCATTC Yes — 9 ref-46385 TGCATATGTCCGATAGGATTGCAACATTCAAA Yes — 10 ref-47639 TTATTTTCATCGACAAACTTGCCATTCGAGTC Yes — 11 ref-58079 TCTTGGATCCCGAAATAGCTGCCCGGAGGCGT Yes — 12 ref-63125 AGATGAGCTCCGAGTTCTGTGCCATCATTGCC Yes — 13 ref-68081 GCAACAATCTCGACCGCATTGCCGAAGAGGCC Yes — Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 260 Sex-specific markers in bighead carp We mapped these 13 potential male-specific tags to the female Table 3. Male-specific primers used for SCAR markers bighead carp genome sequence (Shunping He, unpublished data), 0 0 Name Reference sequences Primers (5 -3 ) and found 10 of them were mapped to a female genome. Among them, five had SNPs in the BcgI digestion recognition site ArS-9-1 scaffold37502 F: GCTCCTTACTCAGCAACT (N CGAN TGCN ) of the female genome, and other five tags R: TCAGTAAACAGACGAGCA 10 6 10 ArS-9-2 scaffold37502 F: GGTGCAGGATTTCCAGTT remained the same sequences as their corresponding female sequen- R: CCATTGATGTTGTCGCTCT ces. Therefore, only three tags without any mapping were male- ArS-9-3 scaffold37502 F: CAAAGACCGCAATAGGAG specific 2b-RAD tags (Table 2). R: GAGCATGTGAAATTAGTGAAG ArS-9-10 Genome walking F: GGCTATCTAAGTTTGGGC 3.2. Mapping male-specific tags to male-specific R: GGATGAGCATTGAAGGTG ArS-9-11 Genome walking F: GTAAGTTGAGTTTGTGGC genomic regions R: GATGAGCATTGAAGGTG Since male-specific 2b-RAD tags were too short to design primers for ArS-9-13 Genome walking F: CAAAGACCGCAATAGGAG PCR amplification, one of the male individuals was subject to short- R: CCAGGACAAGGTGACATACT reads de novo sequencing. We got 48,157,939 pairs of 150 bp ArS-9-14 Genome walking F: TCGGCAAACAGAAAAGAC Illumina pair-end reads for this sample. After filtering low-quality R: AATGGTGAATAGGGAGCG reads, 42,830,738 pair-end reads were left and mapped to a female ArS-9-15 Genome walking F: AGCAACTTTTGTCTGGTG bighead carp genome. As mapped reads were located in regions iden- R: AATGAATGGTGAATAGGG tical between the male and female genome, we only kept 4,417,710 pairs of unmapped reads for de novo assembly of male-specific regions of bighead carp. Finally, we got 298,474 scaffolds with a total size of 79.0 Mb. To get the flanking sequences of the three tags, we mapped them to assembled male-specific scaffolds. For the tag ref-22847, it was mapped to scaffold37502 (907 bp) with 100% identity. For the tag ref-18178, it was mapped to scaffold8218 (602 bp) of identical sequences. For the tag ref-804, we could not find any mapping results in the scaffolds of the male genome. Therefore, scaffold37502 and scaffold8218 were candidate male-specific sequences in the big- head carp. 3.3. Development and validation of male-specific markers Three primers were designed for each male-specific scaffolds, and then their authenticity was verified by PCR between mature males and females (Table 3, Supplementary File S2). Three markers from scaffold37502 showed consistent amplification of fragments in all eight mature males, while none of the eight mature females amplified Figure 1. PCR detection and genetic sexing in eight females and eight males those bands (Fig. 1). For scaffold8218, the PCR products from all of bighead carp by male-specific primer pairs designed based on male scaf- three primers showed no difference between male and female sam- fold37502. The DL 2000 DNA marker is shown on the left. ples (Supplementary Fig. S3). In order to detect universality of the male-specific markers, the three markers from scaffold37502 were The earlier results indicated that these sequences from male-specific tested in another 120 mature bighead carp fish, and the authenticity region are unique to the bighead carp male genome. of these sexing tests was 100% (Supplementary Fig. S1). These results strongly support high reliability of the male-specific markers 3.4. Genetic sex identification in full-sib families in other larger bighead carp samples, which confirmed that these loci After verifying the authenticity of male-specific markers, they were are truly male-specific. These male-specific markers were also vali- used to analyse the ratio of females to males in three full-sib families of dated in 160 offspring from three diploid gynogenetic families, and young bighead carp containing 579 offspring, and the total segrega- all fish were identified as females (Supplementary Fig. S2). The male tion ratio of females to males was 295 : 284 (1.04 : 1) (Table 4)inall PCR products were Sanger sequenced, and the nucleotide sequences three families. The female-to-male segregation ratio of these three fam- were consistent with the male genomic sequences in scaffold37502. ilies were 46 : 44 (1.05 : 1), 82 : 84 (0.98 : 1) and 295 : 284 (1.04 : 1), However, three markers from scaffold8218 showed no difference respectively. Chi-square testing showed that the female-to-male ratio when amplified between female and male individuals. Therefore, of all three families did not have significant differences with the 1 : 1 only scaffold37502 was confirmed as a male-specific sequence in big- separation ratio (P¼ 1). head carp. We blasted the male-specific sequences of scaffold37502 against 3.5. Genome walking and more sex-specific markers the female genome of bighead carp, but no homologous sequences were found. Then we blasted the male-specific sequences of the scaf- After five rounds of genome walking (two for the upstream and three fold37502 against the NCBI NT database, and we could not find for the downstream sequences), the corresponding male genomic sequence alignment of this region to any other vertebrate genomes. fragments were extended. The designed walking primers and the Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 H. Liu et al. 261 Table 4. The male and female ratio for three full-sib families of bighead carp Family Number of Number of Number of Ratio offspring females males 1 90 46 44 1.05 Figure 3. PCR detection and genetic sexing in eight females and eight males 2 166 82 84 0.98 of silver carp by male-specific primer pairs designed in bighead carp. The DL 3 323 167 156 1.07 2000 DNA marker is shown on the left. Total 579 295 284 1.04 4. Discussion Sex-associated markers’ identification can facilitate the discovery of sex-determining region or even sex-determining genes. The results can also help us understand the sex-determination systems as well as origin and evolution of sex chromosomes. However, unlike the mammals or birds with significant difference in sex chromosomes, large differentiated genomic regions are uncommon in fish. Thus, it is always difficult to screen these sex-specific regions successfully. Traditional molecular marker technologies such as RAPD and AFLP have proved to be simple and effective ways to find sex markers in 21–24,49 fish, but in some species they failed to detect any sex-specific 50–52 markers. In the last decade, the development of NGS technology allowed researchers to quickly and conveniently obtain millions of sequences at the genomic level, and it rendered new opportunities for sex differ- 37,53 ence analysis between males and females. With the combination of NGS and restriction digestion enzymes, RAD-Seq offers the possi- bility for generating thousands of SNPs in a short time, which could be used for identification of sex-linked SNP markers or sex-specific DNA sequences and for the construction of high-density linkage 32,36,38,53 maps and sex QTL mapping. RAD-Seq has been success- fully used for sex-specific marker identification in a variety of species using only multiple male and female individuals, which proved to be 35–38,53 an efficient way for screening of sex-specific markers. But RAD-Seq always misses some of the digestion sites, which can cause Figure 2. PCR detection and genetic sexing in eight females and eight males the failure of identification of sex-specific markers. of bighead carp by different male-specific primer pairs designed based on Compared to other RAD-Seq methods, the 2b-RAD method used genome walking sequences. The DL 2000 DNA marker is shown on the left. in this study has more advantages compared to traditional RAD-Seq. First, it can screen nearly every restriction site at the whole genome adapter primers were summarized in Table 3. Based on the amplified level whereas other RAD-Seq methods can only get a subset of total fragments from males, an 8,661 bp of male-specific sequences sites due to the multiple time size selection for efficient PCR amplifi- were assembled from the male-amplified fragments (Supplementary 54,55 cation and sequencing. The average sequence coverage for each File S1), and the whole sequence was submitted to NCBI at accession site in 2b-RAD is usually more than 40 coverage, which provided MG668998. According to the male-specific sequences, more sex- accuracy of 2b-RAD genotyping and high reliability of generated specific markers were designed, such as ArS-9-10, ArS-9-11, ArS-9- tags. Second, the sequences of 2b-RAD are easy for sex-specific 2b- 13, ArS-9-14 and ArS-9-15. The PCR results from different sex with RAD reads identification, which is very convenient for PCR verifica- these primers further identified that this region is male-specific region tion. With all of these positive attributes, the 2b-RAD method is very in the bighead carp genome (Fig. 2, Table 3). We blasted the genome suitable for sex-specific markers and sex-determining regions identifi- walking sequence against the female genome, but no corresponding cation. Here, for the first time, we utilize the 2b-RAD and genome homologous sequence was found. re-sequencing to efficiently and accurately identify the sex-specific markers in genomes of two closely related species, bighead carp and 3.6. Genetic sex identification in silver carp silver carp. Our study proved that combining 2b-RAD genotyping In order to verify the presence of the sex markers in other species of and genome re-sequencing is a very powerful and promising tool for the genus Hypophthalmichthys, the designed SCAR primers were sex-specific markers’ identification. This strategy of SCAR-based also amplified in eight female and eight male silver carp and showed PCR detection in this study is the first protocol successfully amplify- the same results with bighead carp (Fig. 3). We also found that the ing the Y-specific fragment in bighead carp and silver carp. PCR results matched with phenotype with a 100% overall accuracy. The studies of sex-determination in fish would contribute to the 1,3 The same amplification results were found both on males and understanding of the origin and evolution of sex chromosomes. females of these two species, and sequences of PCR products of silver Although most fish species lack visually heteromorphic sex chromo- carp were also similar with that of bighead carp. somes, some species have evolved sex-determining regions (genes) Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 262 Sex-specific markers in bighead carp 12,23,30,32,34,38 and even nascent sex chromosome. Based on the 2b- carp showed a 1 : 1 best orthologues relationship based on compara- RAD sequencing and male fish re-sequencing, we got a scaffold span- tive genome mapping, meaning a low level of genetic diversity. In ning over 900 bp, which is totally associated with Y-specific frag- this study, bighead carp, silver carp and grass carp shared the same ments of bighead carp, suggesting that this scaffold is located on the sex-specific markers and sex-determining DNA sequence, suggesting Y chromosome or nascent Y-linked region. We extend this scaffold that they may have a homologous nascent Y chromosome and the to 8,661 bp by genome walking, but no homologous sequences cor- same pathways involved in sex determination systems. Therefore, the responding to this region was found in the female genome. This three carp should share the most recent common ancestor and the might be a significant difference in male and female sex-determining sex determination systems probably arose before speciation. regions in bighead carp. The diversity between male and female fish We presented an approach that identifies and validates sex- in this sex-related region may lead to recombination suppression as specific markers using 2b-RAD sequencing and genome re- an early stage of sex chromosome evolution. Our results and pre- sequencing from multiple male and female individuals in bighead vious karyotyping studies demonstrated that bighead carp has carp and silver carp. A male-specific scaffold was identified and three evolved a sex-determining region, but has not yet formed distinguish- sex-specific primers were designed first according the male-specific able (heteromorphic) sex chromosomes. scaffold. The sex-specific markers could be used in genetic sexing To study whether Cyprinidae fish shared the same sex- with 100% accuracy in brood fish and a large number of young fish determination system, we blasted the 8,661 bp sequences to the from full-sib families. In addition, all gynogenetic progenies were male-specific region in grass carp (Ctenopharyngodon idellus) genetically sexed as female by these sex-specific markers, confirming genome, and found that most of the 4,148 bp of male-specific the female homogamety sex determination system in bighead carp. sequences in grass carp were presented in bighead carp male-specific Taken together, all these results confirm that bighead carp and silver regions with 94% identify. Furthermore, one male-specific marker carp have a genetic mechanism of sex determination with an XX/XY has been found in common carp (Cyprinus carpio) from the Yellow sex determination system. The sex-specific markers developed in this River, but we found that sequence presented in gynogenetic study would be powerful and effective tools to uncover the sex deter- Songpu common carp genome. This demonstrates that this sequence mination system and identify potential genomic regions in bighead might be a strain-specific sex marker in common carp. And we found carp and silver carp. no similarity between it and male-specific marker in bighead carp. Unlike the big carp, the sex-determination of zebrafish has been Acknowledgements found to be both genetic and environmental. Several markers have been found in the zebrafish genome. Chromosome 4 are closely- This study was supported by grants from the NSFC (31472268 and related to its sex, but we found the male-specific region in bighead 31502153), FEBL (2016FBZ05) and DAC (2009045). We would like to thank carp cannot mapped to that region in zebrafish genome. The reason Xinhua Wang, Baojiang Gan and Xueli Liu for sample collection and labora- tory technical assistance. We would like to thank Prof. Shunping He for offer- for above phenomena might be the ancestor of zebrafish divided ing the bighead carp genome sequences. with the ancestor of Endemic Clad of East Asia Cyprinidae (ECEAC) fish at about 30 Mya, which is much older than specification of fish within ECEAC (about 59 Mya). Based on this information, the Accession numbers bighead carp male-specific sequence was not only shared in silver PRJNA401338 and MG668998 carp but also in grass carp, and we predict that this male-specific sequence might emerge in the ancestor of ECEAC fish and was kept in all extent diploid fish in this group. As to the common carp, which Conflict of interest is a tetraploid fish, it might have formed its own sex-determination region or genes in its speciation process. None declared. Sex-specific markers have been successfully used to identify 18,24,35–38 the sex determination systems in many species, and it Supplementary data is especially valuable in species that lack heteromorphic sex chromosomes. In this study, the presence of male-specific markers Supplementary data are available at DNARES online. indicates an XX/XY sex determination system in bighead carp and silver carp. A larger sample size of bighead carp was used to further References verify the accuracy of the male-specific markers, and the verification efficiency was 100% in all mature individuals. Besides, the female- 1. Devlin, R. H. and Nagahama, Y. 2002, Sex determination and sex differ- to-male segregation ratio in three full-sib families was 1 : 1. All those entiation in fish: an overview of genetic, physiological, and environmental results strongly indicated that bighead carp and silver carp have a influences, Aquaculture, 208, 191–364. genetic XX/XY sex determination system, which is similar to the 2. Kobayashi, Y., Nagahama, Y. and Nakamura, M. 2013, Diversity and plasticity of sex determination and differentiation in fishes, Sex Dev., 7, grass carp’s XX/XY sex determination system. Based on these 115–25. results and the phylogenetic position of fishes discussed earlier, we 3. Kikuchi, K. and Hamaguchi, S. 2013, Novel sex-determining genes in fish predicted that the ancestor of the whole Cyprinidae might have a and sex chromosome evolution, Dev. Dyn., 242, 339–53. XX/XY sex determination system. And this system might persist in 4. Mank, J. E. and Avise, J. C. 2009, Evolutionary diversity and turn-over of all extent species in Cyprinidae and facilitate the hybrid between dif- sex determination in teleost fishes, Sex Dev., 3, 60–7. ferent species within this group. 5. Volff, J. N. 2005, Genome evolution and biodiversity in teleost fish, Bighead carp and silver carp are two of the most closely related Heredity (Edinb), 94, 280–94. species of the Cyprinidae family, cytogenetic analyses revealed that 6. Mei, J. and Gui, J. F. 2015, Genetic basis and biotechnological manipula- they have similar karyotypes and lack visually heteromorphic sex tion of sexual dimorphism and sex determination in fish, Sci. China Life 56,61 chromosomes. The linkage groups of bighead carp and silver Sci., 58, 124–36. Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 H. Liu et al. 263 7. Ellegren, H. 2011, Sex-chromosome evolution: recent progress and the 28. Chen, X., Mei, J., Wu, J., et al. 2015, A comprehensive transcriptome pro- vides candidate genes for sex determination/differentiation and SSR/SNP influence of male and female heterogamety, Nat. Rev. Genet., 12, markers in yellow catfish, Mar. Biotechnol., 17, 190–8. 157–66. 29. Tao, W. J., Yuan, J., Zhou, L., et al. 2013, Characterization of gonadal 8. Cnaani, A. and Levavi-Sivan, B. 2009, Sexual development in fish, practi- transcriptomes from Nile tilapia (Oreochromis niloticus) reveals differen- cal applications for aquaculture, Sex Dev., 3, 164–75. tially expressed genes, PLoS One, 8. DOI: 10.1371/journal.pone. 9. Martı´nez, P., Vinas, ~ A. M., Sa ´ nchez, L., et al. 2014, Genetic architecture of sex determination in fish: applications to sex ratio control in aquacul- 30. Palaiokostas, C., Bekaert, M., Khan, M. G. Q., et al. 2015, A novel ture, Front. Genet., 5, 340. sex-determining QTL in Nile tilapia (Oreochromis niloticus), BMC 10. Wang, D., Mao, H. L., Chen, H. X., Liu, H. Q. and Gui, J. F. 2009, Genomics, 16. DOI: 10.1186/S12864-015-1383-X. Isolation of Y- and X-linked SCAR markers in yellow catfish and applica- 31. Palaiokostas, C., Bekaert, M., Taggart, J. B., et al. 2015, A new tion in the production of all-male populations, Anim. Genet., 40, 978–81. SNP-based vision of the genetics of sex determination in European sea 11. Yano, A., Guyomard, R., Nicol, B., et al. 2012, An immune-related gene bass (Dicentrarchus labrax), Genet. Sel. Evol., 47. DOI: 10.1186/s12711- evolved into the master sex-determining gene in rainbow trout, 015-0148-y. Oncorhynchus mykiss, Curr. Biol., 22, 1423–8. 32. Palaiokostas, C., Bekaert, M., Davie, A., et al. 2013, Mapping the sex 12. Matsuda, M., Nagahama, Y., Shinomiya, A., et al. 2002, DMY is a determination locus in the Atlantic halibut (Hippoglossus hippoglossus) Y-specific DM-domain gene required for male development in the medaka using RAD sequencing, BMC Genomics, 14. DOI: 10.1186/1471-2164- fish, Nature, 417, 559–63. 14-566. 13. Kamiya, T., Wataru, K., Satoshi, T., et al. 2012, A trans-species missense 33. Anderson, J. L., Marı´, A. R., Braash, I., et al. 2012, Multiple SNP in Amhr2 is associated with sex determination in the tiger pufferfish, sex-associated regions and a putative sex chromosome in zebrafish Takifugu rubripes (Fugu), PLoS Genet., 8. DOI: 10.1371/journal.pgen. revealed by RAD mapping and population genomics, PLoS One, 7. DOI: 10.1371/journal.pone.0040701. 14. Chen, S. L., Zhang, G., Shao, C., et al. 2014, Whole-genome sequence of 34. Palaiokostas, C., Bekaert, M., Khan, M. G. Q., et al. 2013, Mapping and a flatfish provides insights into ZW sex chromosome evolution and adap- validation of the major sex-determining region in Nile tilapia tation to a benthic lifestyle, Nat. Genet., 46, 253–þ. (Oreochromis niloticus L.) using RAD sequencing, PLoS One, 8. DOI: 15. Li, M. H., Yunlv, S., Jiue, Z., et al. 2015, A tandem duplicate of 10.1371/journal.pone.0068389. anti-mullerian hormone with a missense SNP on the Y chromosome is 35. Carmichael, S. N., Bekaert, M., Taggart, J. B., et al. 2013, Identification essential for male sex determination in Nile tilapia, Oreochromis niloti- of a sex-linked SNP marker in the salmon louse (Lepeophtheirus salmo- cus, PLoS Genet., 11. DOI: 10.1371/journal.pgen.1005678. nis) using RAD sequencing, PLoS One, 8. DOI: 10.1371/journal.pone. 16. Gui, J. F. and Zhu, Z. Y. 2012, Molecular basis and genetic improvement of economically important traits in aquaculture animals, Chinese Sci. 36. Kafkas, S., Khodaeiaminjan, M., Guney, M. and Kafkas, E. 2015, Bull, 57, 1751–60. Identification of sex-linked SNP markers using RAD sequencing suggests 17. Gui, J., Zhou, L. and Wu, Q. 2007, Genetic Basis and Artificial Control ZW/ZZ sex determination in Pistacia vera L., BMC Genomics, 16. DOI: of Sexuality and Reproduction in Fish. Science Press: Beijing. 10.1186/s12864-015-1326-6. 18. Charlesworth, D. and Mank, J. E. 2010, The birds and the bees and the 37. Gamble, T. and Zarkower, D. 2014, Identification of sex-specific molecu- lar markers using restriction site-associated DNA sequencing, Mol. Ecol. flowers and the trees: lessons from genetic mapping of sex determination Resour., 14, 902–13. in plants and animals, Genetics, 186, 9–31. 38. Fowler, B. L. and Buonaccorsi, V. P. 2016, Genomic characterization of 19. Kovacs, B., Egedi, S., Bartfai, R. and Orban, L. 2000, Male-specific DNA sex-identification markers in Sebastes carnatus and S. chrysomelas rock- markers from African catfish (Clarias gariepinus), Genetica, 110, 267–76. fishes, Mol. Ecol., 25, 2165–75. 20. Vale, L., Dieguez, R., Sa ´ nchez, L., Martı´nez, P. and Vinas, ~ A. 2014, A 39. Wang, Y. P., et al. 2015, The draft genome of the grass carp sex-associated sequence identified by RAPD screening in gynogenetic indi- (Ctenopharyngodon idellus) provides insights into its evolution and vege- viduals of turbot (Scophthalmus maximus), Mol. Biol. Rep., 41, 1501–9. tarian adaptation, Nat. Genet., 47, 625–31. 21. Felip, A., Martinez-Rodriguez, G., Piferrer, F., Carrillo, M. and Zanuy, S. 40. Green, J. E., Dalikova, M., Sahara, K., Marec, F. and Akam, M. 2016, 2000, AFLP analysis confirms exclusive maternal genomic contribution of XX/XY system of sex determination in the geophilomorph centipede meiogynogenetic sea bass (Dicentrarchus labrax L.), Mar. Biotechnol., 2, Strigamia maritima, PLoS One, 11. DOI: 10.1371/journal.pone.0150292. 301–6. 41. Koerich, L. B., Dupim, E. G., Faria, L. L., et al. 2016, First report of 22. Felip, A., Young, W. P., Wheeler, P. A. and Thorgaard, G. H. 2005, An Y-linked genes in the kissing bug Rhodnius prolixus, BMC Genomics, AFLP-based approach for the identification of sex-linked markers in rain- 17,1. bow trout (Oncorhynchus mykiss), Aquaculture, 247, 35–43. 42. Kolar, C. S., et al. Asian carps of the genus Hypophthalmichthys (Pisces, 23. Dan, C., Mei, J., Wang, D. and Gui, J. F. 2013, Genetic differentiation Cyprinidae)-a biological synopsis and environmental risk assessment. and efficient sex-specific marker development of a pair of Y- and X-linked markers in yellow catfish, Int. J. Biol. Sci., 9, 1043–9. 43. Chen, J., Xie, P., Zhang, D. W. and Lei, H. H. 2007, In situ studies on the 24. Pan, Z. J., Li, X. Y., Zhou, F. J., Qiang, X. G. and Gui, J. F. 2015, distribution patterns and dynamics of microcystins in a biomanipulation Identification of sex-specific markers reveals male heterogametic sex deter- fish-bighead carp (Aristichthys nobilis), Environ. Pollut., 147, 150–7. mination in Pseudobagrus ussuriensis, Mar. Biotechnol., 17, 441–51. 44. Zhu, C. K., Sun, Y. H., Yu, X. M. and Tong, J. G. 2013, Centromere 25. Lamatsch, D. K., Adolfsson, S., Senior, A. M., et al. 2015, A transcrip- localization for bighead carp (Aristichthys nobilis) through half-tetrad tome derived female-specific marker from the invasive western mosquito- analysis in diploid gynogenetic families, PLoS One, 8. DOI: 10.1371/jour fish (Gambusia affinis), PLoS One, 10. DOI: 10.1371/journal.pone. nal.pone.0082950. 45. Chong, L. 2001, Molecular cloning: a laboratory manual, 3rd edition, 26. Lu, J. G., Zheng, M., Zheng, J., et al. 2015, Transcriptomic analyses Science, 292, 446. reveal novel genes with sexually dimorphic expression in yellow catfish 46. Catchen, J., Hohenlohe, P. A., Bassham, S., Amores, A. and Cresko, W. (Pelteobagrus fulvidraco) brain, Mar Biotechnol, 17, 613–23. A. 2013, Stacks: an analysis tool set for population genomics, Mol. Ecol., 27. Diaz, N. and Piferrer, F. 2015, Lasting effects of early exposure to temper- 22, 3124–40. ature on the gonadal transcriptome at the time of sex differentiation in the 47. Luo, R. B., et al. 2012, SOAPdenovo2: an empirically improved European sea bass, a fish with mixed genetic and environmental sex deter- memory-efficient short-read de novo assembler, Gigascience, 1. DOI: 10. mination, BMC Genomics, 16. DOI: 10.1186/S12864-015-1862-0. 1186/2047-217x-1-18. Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018 264 Sex-specific markers in bighead carp 48. Piferrer, F., Ribas, L. and Diaz, N. 2012, Genomic approaches to study 55. Wang, S., Meyer, E., McKay, J. K. and Matz, M. V. 2012, 2b-RAD: a genetic and environmental influences on fish sex determination and differ- simple and flexible method for genome-wide genotyping, Nat. Methods, entiation, Mar. Biotechnol., 14, 591–604. 9, 808–10. 49. Wang, D. W., Li, Y. and Li, Z. Q. 2011, Identification of a male-specific 56. Kong, Q. L., LI, Z. Y., Fu, M. L., Wang, Q. and WANG, H. Y. 2006, amplified fragment length polymorphism (AFLP) and a sequence charac- Analysis of DAPI karyotype of bighead carp (Aristichthys nobilis) chro- terized amplified region (SCAR) marker in Eucommia ulmoides Oliv, Int. mosomes, Sichuan J. Zool., 25, 64–7. J. Mol. Sci., 12, 857–64. 57. Chen, J., Wang, Y., Yue, Y., et al. 2009, A novel male-specific DNA 50. Gao, Z. X., Wang, H. P., Yao, H., Tiu, L. and Wang, W. M. 2010, No sequence in the common carp, Cyprinus carpio, Mol. Cell. Probes, 23, sex-specific markers detected in bluegill sunfish Lepomis macrochirus by 235–9. AFLP, J. Fish Biol., 76, 408–14. 58. Howe, K., Clark, M. D., Torroja, C. F., et al. 2013, The zebrafish refer- 51. Yarmohammadi, M., Pourkazemi, M., Ghasemi, A., Hassanzadeh, M. ence genome sequence and its relationship to the human genome, Nature. and Chakmehdouz, F. 2011, AFLP reveals no sex-specific markers in 496, 498–503. Persian sturgeon (Acipenser persicus) or beluga sturgeon (Huso huso) 59. Tao, W., Zou, M., Wang, X., et al. 2010, Phylogenomic analysis resolves from the southern Caspian Sea, Iran, Progr. Biol. Sci., 1, 55–114. the formerly intractable adaptive diversification of the endemic clade of 52. Sriphairoj, K., Na-Nakorn, U., Brunelli, J. P. and Thorgaard, G. H. 2007, east Asian Cyprinidae (Cypriniformes), PLoS One, 5, e13508. No AFLP sex-specific markers detected in Pangasianodon gigas and P. 60. Xu, P., Zhang, X., Wang, X., et al. 2014, Genome sequence and hypophthalmus, Aquaculture, 273, 739–743. genetic diversity of the common carp, Cyprinus carpio, Nat. Genet. 46, 53. Gamble, T., Coryell, J., Ezaz, T., et al. 2015, Restriction site-associated 1212–19. DNA sequencing (RAD-seq) reveals an extraordinary number of transi- 61. Su, Z. G., Xu, K. S., Chen, S. P. and Bai, G. D. 1984, Studies on triploid tions among gecko sex-determining systems, Mol. Biol. Evol., 32, silver carp and its karyotype, Zool. Res. 1984(S2), 15–20. 1296–1309. 62. Zhu, C. K., Tong, J. O., Yu, X. M. and Guo, W. J. 2015, Comparative 54. Baird, N. A., et al. 2008, Rapid SNP discovery and genetic mapping using mapping for bighead carp (Aristichthys nobilis) against model and sequenced RAD markers, PLoS One, 3. DOI: 10.1371/journal.pone. non-model fishes provides insights into the genomic evolution of cypri- 0003376 nids, Mol. Genet. Genomics, 290, 1313–26. Downloaded from https://academic.oup.com/dnaresearch/article-abstract/25/3/257/4791395 by Ed 'DeepDyve' Gillespie user on 26 June 2018

Journal

DNA Research – Oxford University Press

Published: Jan 5, 2018

There are no references for this article.