Sequencing and Expression Characterization of Antifreeze Protein Maxi-Like in Apis cerana cerana

Sequencing and Expression Characterization of Antifreeze Protein Maxi-Like in Apis cerana cerana Antifreeze proteins (AFPs) are biological cryoprotectants with unique properties that play a crucial role in regulating the molecular mechanisms governing cold resistance in insects. To identify and characterize Apis cerana cerana AFP (AcerAFP), we cloned the full-length cDNA of AcerAFP and examined its expression patterns in A.  cerana cerana. A nucleotide alignment analysis showed that the entire coding region of AcerAFP is 1095 bp and encodes a polypeptide of 365 amino acids. The amino acid sequence of this protein exhibits 63–96% homology with AFP homologs from other hymenopterans. α-helices form the main secondary and tertiary structures of AcerAFP , which is similar to the molecular structure of fish AFP type-I. The expression profiles of AcerAFP revealed that expression was tissue, sex, and developmentally specific. In response to cold stress, the mRNA and protein expression of AcerAFP were both induced by low temperatures, and were also related to the concentrations of several cryoprotectants, including glucose, glycerin, glutamic acid, cysteine, histidine, alanine, and methionine. In addition, we found that the knockdown of AcerAFP by RNA interference remarkably increased the total freezing temperature of hemolymph in A. cerana cerana, where levels of AcerAFP mRNA were correlated with the expression of most antifreeze-related proteins. Taken together, these results suggest that AcerAFP plays an essential role as a biological cryoprotectant in honeybees, and is in turn regulated by small cryoprotectants and antifreeze-related proteins. Key words: antifreeze protein, Apis cerana cerana, cold stress, expression patterns, RNA interference unique characteristics and special properties (Bang et al. 2013, King Introduction and MacRae 2015). Among these proteins, AFPs have gained much Insects living at high latitudes or altitudes are exposed to fluctuating attention because they are known to protect organisms from freezing thermal environments. For survival, the majority of freeze-tolerant by lowering the freezing temperature (T ) (Wen et al. 2016). insects (which can survive freezing) have to hide in local shelters AFPs have been identified in marine organisms, including fishes, to escape the low temperatures and must bear some of the brunt and also in insects, microalgae, bacteria, and fungi (Doucet et al. 2009). of low temperature exposure (Doucet et al. 2009). To counter these AFPs were first discovered in fishes in the Arctic and Antarctic regions, adverse conditions, insects have evolved a suite of physiological and have been classified into four types (types I, II, III, and IV). The four and molecular adaptations, which mainly include the synthesis of types of AFPs are fundamentally different in terms of their primary low-molecular-weight compounds and cryoprotective proteins (Bale sequences and three-dimensional (3D) structures, but show correspond- 2002). These small compounds primarily consist of hydrocarbons, ing properties in binding ice and lowering the freezing points (Davies amino acids, and polyols, which are involved in energy metabolism et al. 2002, Venketesh and Dayananda 2008). In contrast to fish AFPs, and accumulation of cryoprotectants (Holden and Storey 1994). insect AFPs possess very high thermal hysteresis (TH) activity, where The antifreeze proteins (AFPs), antifreeze glycoproteins, heat shock some isoforms exhibit a specific activity up to 100 greater than that of proteins (HSPs), serine/threonine kinases (STKs), ice-nucleating pro- teins, membrane protectants, and other similar but less well-char- fish AFPs (Liou et al. 1999). The TH, a measure of antifreeze activity, acterized proteins serve as prominent cryoprotective agents with refers to the difference between the melting and freezing points of a © The Author(s) 2018. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 2 Journal of Insect Science, 2018, Vol. 10, No. 1 solution. At present, insect AFP research is focused on the coleopteran for 0, 2, 4, 6, and 8 hr. Postemergence 10-d-old drones were collected species Tenebrio molitor and Dendroides canadensis, and on the lep- in the same manner which was used to collect the workers. All bee idopteran species Choristoneura fumiferana, where insect AFPs have specimens were immediately frozen in liquid nitrogen at the indi- been shown to exhibit similarities in the heterogeneity of structure, cated time points and stored at −80°C. patterns of amino acid repeats, and â-helix structures (Li et al. 1998, Graether et al. 2000, Liou et al. 2000). The special characteristics and Measurement of TH Activity structures of AFPs are responsible for their specific orientations and Two samples of hemolymph collected from 50 Chinese honeybees functions. Owing to the distinctive overwintering methods of different before and after RNA interference and purification of the heterologous insects, the relationships between the presence and expression levels expression of AFPs were selected to measure TH activity (THA). Bovine of AFPs and photoperiods, environmental temperatures, development serum albumin (BSA) solution was used as a control. THA was deter- stages, and the sexes of insects have been investigated (Horwath et al. mined using a differential scanning calorimeter (DSC Q20) (DSC Q20, 1996, Graham et al. 2000). The results of such multifaceted analyses TA Instruments, New Castle, DE, USA). After sampling, the temperature indicate that insect AFPs contribute significantly to protecting insects of samples was lowered from room temperature to −30°C, and then against low temperatures in a variety of ways (Qin et al. 2006). warmed to 15°C. Subsequently, samples were continuously cooled to Honeybees, one of the most common eusocial insects, are −30°C and then warmed to −1°C (holding temperature, T ), held at T h h extremely sensitive to fluctuations in climate. Low temperatures not for 3 min, and lowered to −30°C again. The rate of temperature variation only delay larval and pupal development but also significantly influ- was 1°C/min. The T was the temperature at which samples crystallized ence the physiological activities of the adults. In the winter, when after the holding temperature. The THA  =  T − T . The total freezing h f the ambient temperature is very low, the overwintering workers and temperature was the temperature at which the samples froze completely. the queen are clustered inside the hive, living on the honey reserves that were accumulated before the onset of winter. Workers maintain Cloning AcerAFP cDNA a temperature of about 20°C inside the colony by contracting their The extraction of total RNA and the isolation of the full-length flight muscles, where the energy for heat production is supplied by cDNA sequence of AcerAFP were performed following previously the stored honey (Winston 1992). Individual honeybees are poikilo- described methods (Zhao et al. 2014). The primers used in this study thermic and maintain their body temperatures at or near a constant are listed in Supp Table  1 (online only). Total RNA was isolated by burning calories during flight (Coelho 1991). When body temper - from 10 worker bees using TRIzol reagent (Invitrogen, Carlsbad, atures decrease below 10°C, honeybees fall into cold-induced state of CA). Conditions for PCR amplifications were as follows: 4 min at torpor (i.e., chill-coma) from which they cannot voluntarily recover 94°C; followed by 38 cycles at 94°C for 30 s, 58°C for 1 min, 72°C without external warming (Heinrich 1980). As such, honeybees for 1  min 30  s, and a final extension at 72°C for 8  min. Purified should be classified as freeze-avoiding insects (i.e., they die if frozen). PCR products of the correct sizes were ligated into the pGM-T The Chinese honeybee (Apis cerana cerana) is an important en- vector (Tiangen Biotech, Beijing, China), and transformed into demic species in China that can be used as an effective model organism DH5α-competent cells. Positive colonies were identified by PCR and for studying cold resistance in honeybees (Xu et al. 2017). Most of sequenced by the Huada Gene Research Center (Beijing, China). the current studies on insect AFPs are focused on solitary species of freeze-tolerant insects, while reports regarding social Hymenoptera Bioinformatic and Phylogenetic Analyses are scant. In the present study, we cloned the full-length cDNA of Protparam (http://web.expasy.org/protparam/) was used to predict the A. cerana cerana AFP Maxi-like gene (henceforth AcerAFP) and the physicochemical properties of AcerAFP. Putative signal peptides analyzed the structure and functions of the corresponding protein were predicted using the SignalP 3.0 Server (Bendtsen et al. 2004). using bioinformatics. The expression of AcerAFP was determined by The PredictProtein web-resource (https://www.predictprotein.org/) real-time polymerase chain reaction (PCR) and western blot analysis. was used to predict secondary structures. The Swiss model homol- Moreover, RNAi was used to validate the function of AcerAFP and ogy-modeling server (http://swissmodel.expasy.org/interactive) was the correlation of AFP with antifreeze-related proteins. Through these queried to locate 3D structure models of AcerAFP. Phylogenetic and in-depth studies, we have attempted to augment the existing level of molecular evolutionary analyses were performed with Molecular knowledge regarding the sequence and function of honeybee AFPs Evolutionary Genetics Analysis (MEGA version 4.1), software using and to provide a theoretical basis for understanding the mechanisms the neighbor-joining method. Homology searches were conducted of the evolution of cold resistance in eusocial Hymenoptera. on the NCBI platform (www.ncbi.nlm.nih.gov). The promoter was predicted using the BDGP web resource (http://www.fruitfly.org/ Materials and Methods seq_tools/promoter.html). The online tool PROMO (http://alggen. lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3) Insects and Treatments was used to predict putative cis-acting elements. A.  cerana cerana were collected from the colony maintained by the apiculture laboratory at Shanxi Agriculture University, Shanxi, China. Heterologous Expression and Purification of AFP Newly emerged adult worker bees (n = 300) were sampled 1, 5, 10, 15, 20, 25, and 30 d after emergence, and labeled with paint. These bees The AcerAFP sequence was subcloned into the pEASY-Blunt vec- represented seven different age groups—adu1, adu5, adu10, adu15, tor for expression in Escherichia coli BL21b cells (Novagen, San adu20, adu25, and adu30, respectively. For tissue-specific expression Diego, CA). The primers for the pMAL-C5X-6His recombinant vec- analyses, the antennae, head, thorax, abdomen, legs, and wings of newly tors are listed in Supp Table  1 (online only). The expression of AFP emerged bees (n = 100) were dissected on ice, and the tissues and whole was induced by isopropyl thiogalactoside (0.5  mmol/liter) (Sangon, body were frozen immediately in liquid nitrogen, and stored at −80°C. Shanghai, China) at 11°C for 8  hr. The heterologous expression of Adult bees (post-emergence age 20 d) were equally divided into AcerAFP was examined via western blot analyses using anti-6×His tag two groups (n = 60/group), which were maintained at constant tem- antibodies. The AcerAFP in the supernatant was collected and purified peratures of 0 and 10°C, and 50% relative humidity, in incubators using an anti-6×His tag antibody. The purified AcerAFP was dissolved Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 10, No. 1 3 in phosphate-buffered saline (pH 7.4, 2.0 mg/mL) and its concentra- Subsequently, ‘normal’ individuals (levels of physiological activity tion was determined using the Bradford method (Yu et al. 2016). similar to those of the control group) were sampled for 5 d.  This experiment was repeated in triplicate. Expression Analysis of T emporal-Spatial Development and Responses to Low Temperature The Correlation Analyses Between AcerAFP Using Real-Time PCR and Western Blot Analyses Expression Levels and Small Cryoprotectants The real time quantitative reverse transcriptase PCR (qRT-PCR) ana- Concentrations lysis was performed following previously described methods using The concentrations of small cryoprotectants were listed in Supp the SYBR Premix Ex Taq kit (Takara, Dalian, China) (Zhao et  al. Table 3 (online only). The Pearson correlation indices, which calcu- 2014). The A. cerana cerana β-actin gene (HM640276.1) was used lated by SPSS statistics 17.0, were used to evaluate the correlations as an internal control. Transcript levels were evaluated in three inde- between AcerAFP expression levels and small cryoprotectants. pendent biological replicates with three technical repeats for each primer pair. The relative quantification of gene expression was ana- Gene Expression Profiles of Cold-Related Proteins −ΔΔCt lyzed using the comparative 2 method (Livak and Schmittgen Before and After RNAi 2001). The western blot analysis was performed following previously To explore the expression profiles of cold-related protein genes before described methods (Zhao et al. 2015). For western blot analysis, a and after RNAi, we performed qRT-PCR on several cold stress-related peptide corresponding to amino acids 18−31 of AcerAFP was syn- different expression genes (9 HSPs, 7 STKs, and 12 zinc finger proteins thesized in the Huada Protein Research Center (Beijing, China). New [ZFPs]). The mRNA of genes expression of these cold-related proteins Zealand white rabbits were immunized with the synthesized peptide was detected in our previous experiments (Xu et  al. 2017). Primers coupled to keyhole limpet hemocyanin to prepare the antiserum. The used for qRT-PCR analyses on the gene expression of cold-related pro- anti-AcerAFP serum was used as the primary antibody at a dilu- tein genes are listed in Supp Table 1 (online only). The tested samples tion of 1:1,000 (v/v). The BCA Protein Assay Kit (Boster, Wuhan, were collected from the dsAcerAFP and dsGFP groups after 3 d of China) was used to detect the proteins. Peroxidase-conjugated goat treatment. The methods of analyses were the same as in the Expression anti-rabbit IgG (Boster) was used as the secondary antibody at a Analysis of Temporal-Spatial Development and Responses to Low dilution of 1:3,000 (v/v). Subsequently, a super ECL chemilumines- Temperature Using Real-Time PCR and Western Blot Analyses. cence plus (Boster) was used for visualization after membranes were washed. The relative intensities of the aforementioned proteins were analyzed using Image Lab Software (Bio-Rad Laboratories, PA). The Results AcerAFP content was normalized to β-actin level in each lane. THA in the Chinese Honeybee RNA Interference The TH activities of hemolymph and BSA were detected using DSC The dsRNAs were synthesized using the T7RiboMAX Express (Fig.  1). Our results show that a heat-flow peak appeared in the RNAi System (Promega, Madison, WI, USA) following the manufac- hemolymph of the Chinese honeybee when the temperature of sam- turer’s protocol. Primer sequences (RIafp/RIgfp) are listed in Supp ples decreased from −1°C (T ) to −30°C, while the temperature of Table  1 (online only). The newly emerged adult worker bees were the peak (T ) was −1.53°C. In contrast, the control BSA solution divided at random into three groups (n = 50/group) and were used exhibited no heat-flow peak in the cooling process. This indicates in RNAi experiments. Each individual in the two treatment groups that the hemolymph of the Chinese honeybee had a THA of 0.53°C, was fed with 10 μL (10 ng) of either dsAcerAFP or ds green fluores- whereas the control BSA solution exhibited no THA, suggesting the cent protein (dsGFP) and were designated as the dsAcerAFP group presence of AFPs in the hemolymph of Chinese honeybees. The total and the dsGFP group, respectively. The third honeybee group was freezing temperature is the temperature at which the samples froze left untreated and was designated as the control check (CK) group. completely in the process of decreasing from T to −30°C. The total Fig. 1. TH values of Chinese honeybee hemolymph and BSA. (A) Result obtained from the DSC scan of Chinese honeybee hemolymph. T , the hold temperature; T , the total freezing temperature. (1) Result obtained from the DSC scan of the BSA solution. tf Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 4 Journal of Insect Science, 2018, Vol. 10, No. 1 freezing temperature of hemolymph of Chinese honeybee and BSA analyses show that the open reading frame is 1,095 bp long, and were no −9.46 and −9.23°C, respectively. encodes a 365-amino acid protein with an estimated isoelectric point of 6.09. A hydrophobic signal peptide with 16 amino acid Cloning and Sequence Analysis of AcerAFP residues was identified (Fig. 2A). The prediction of secondary pro- The full-length AcerAFP gene sequence (GenBank accession tein structures revealed that 96.43% of the amino acids formed number: KX458243) is 1,200 bp in length and contains a 42-bp helices, and 3.57% formed loops (Fig. 2B). The tertiary structure 5ʹ untranslated region (UTR) and a 63-bp 3ʹ-UTR. Sequence of AcerAFP confirms that α -helices constitute the main structure Fig. 2. Molecular properties of AcerAFP. (A) Full-length cDNA sequence of Apis cerana cerana antifreeze protein (AFP). Start and stop codons are boxed, signal peptide sequence is underscored. (B) The secondary structure of AcerAFP. (C) The tertiary structure of AcerAFP. (D) Alignment of amino acid sequences. Identical amino acid residues are shaded in black. (E) Phylogenetic tree based on amino acid sequence alignment. The branch labels are bootstrap values (%), which are based on 1,000 replicates. The scale bar is 0.05. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 10, No. 1 5 of the protein, whereas random coils constitute only a minor por- Expression of AcerAFP in Response to Low tion of its structure (Fig. 2C). Temperatures An alignment of AcerAFP with homologous proteins from other The relative expression of AcerAFP mRNA and protein at differ- hymenopteran insects using NCBI BLASTp (Fig. 2D) indicates that ent low temperatures and durations of exposure were determined more than 59% of the protein sequences of AcerAFP were com- by qRT-PCR and western blot analyses (Fig.  6). AcerAFP mRNA parable to AFP protein sequences from other insects. AcerAFP expression patterns varied significantly with varying low tem- was highly similar to AmelAFP (96%) from the European honey- perature treatments. When exposed to 10°C, levels of AcerAFP bee Apis mellifera, while it was less similar to the corresponding mRNA continued to increase for 4  hr, when the highest expres- AFP from the more distantly related parasitic wood wasp Orussus sion levels were detected, after which the levels decreased and abietinus (63%). We found that AcerAFP amino acid residues num- were maintained initial levels. When exposed to 0°C, AcerAFP bering 87–269 were relatively well conserved. The phylogenetic mRNA expression levels increased initially and then decreased, tree constructed based on this finding directly reflects the relation- where the highest and lowest expression levels occurred at 4 and ship between the selected insects (Fig.  2E). The tree had two main 8 hr, respectively. By comparing the expression levels of AcerAFP groups: the first group (including A. cerana cerana) consisted of the mRNA at different temperatures for the same durations of expos- superfamily Apoidea, whereas the other group consisted of the three ure, we observed that expression levels at 10°C were higher than hymenopteran families Formicidae, Tenthredinidae, and Orussidae. that at 0°C. Unsurprisingly, there were significant differences in AcerAFP protein expression levels at various low temperatures. At Genomic Structure and Putative cis-Acting 10°C, AcerAFP levels decreased initially (2 hr), and then increased Elements in 5ʹ-UTR of AcerAFP from 4 to 6 hr, followed by a drop to a lower level at 8 hr. Thus, The sequence of 5ʹ-UTR of AcerAFP (results of FASTA in Suppl the highest and lowest expression levels occurred at 6 and 2  hr, Table  2 online only) was obtained from the NCBI database respectively. At 0°C, trends in expression-level changes in AcerAFP (GenBank ID: NW_016019342.1 [369089...  392989]) (Fig.  3). protein fluctuated, where they steadily decreased from 0 to 4  hr, The promoter prediction for AcerAFP shows that the transcription and after a little recovery at 6 hr, decreased further to a lower level. start site is 560 nucleotides upstream from the translation start The highest and lowest expression levels occurred at 6 and 4  hr, site. The promoter region (ATATTATATATATATAAATGAACGAG respectively. In general, the expression level of AcerAFP was higher AATTCTTTCAATATTTGAATAAAAT) extend from nucleotides at 10°C than at 0°C. −44 to +6. The results of the prediction analyses revealed that some The determination of the concentration of different cryoprotect- sequences involved in embryo or tissue development, including ants under different temperature treatments (Supp Table  3 [online CF2-II (n = 9), Dfd (n = 1), BR-C (n = 13), NIT2 (n = 8), and CdxA only]) revealed that the concentrations of glucose, glycerin, and amino (n > 50) listed in Suppl Table 4 (online only). Several important tran- acids varied significantly with different temperature treatments. It is scription factors associated with environmental stress and immune believed that the metabolisms of these materials are involved in devel- responses, such as heat shock factors (n = 14), activating protein-1 oping cold resistance in honeybees. Pearson correlation analysis was (n = 4), nuclear factor kappa B (n = 1), and zinc-finger transcription used to evaluate the interactions between the expression of AcerAFP factors (n = 4) were also identified in 5ʹ-UTR of AcerAFP. and the concentrations of cryoprotectants (Table  1). The results of correlation analyses show that there is a strong relationship between AcerAFP mRNA expression levels and the concentrations of glucose, Heterologous Expression of AFP glycerin, and glutamic acid. The concentrations of the amino acids AcerAFP was heterologously expressed in E. coli (Fig. 4A). Dodecyl cysteine, histidine, alanine, and methionine were also found to be sulfate, sodium salt-polyacrylamide gel electrophoresis (SDS–PAGE) related to the expression of the AcerAFP protein. analysis revealed that the recombinant protein was soluble, and had a molecular mass of ~125 kDa (results of western blot in Supp Figure 1 [online only]), which is consistent with the predicted molec- RNAi of AcerAFP in Honeybees ular mass of 60  kDa (containing MBP-6×His tags of ~64  kDa). The RNAi, mediated by dsRNA, was used to explore the func- These results of DSC in Fig. 4B indicate that the AcerAFP solution tion of AcerAFP. The result of gene silencing is shown in Fig. 7A had a THA of 0.52°C, and exhibited a deeper total freezing tem- and B.  AcerAFP mRNA levels in the CK group decreased at first perature (−14.52°C) than the hemolymph in the Chinese honeybee. and then increased before finally decreasing. Constant levels of These results also indicate that the purified AcerAFP obtained in the AcerAFP mRNA were maintained at two development stages: present study belongs to the AFP family. from 1 to 2 d and from 3 to 5 d. The expression levels of AcerAFP mRNA in the dsGFP group were lower at 1 d and were main- Expression Patterns in Temporal-Spatial tained at a constant level from 2 to 4 d.  There were significant Development of Honeybee differences between the mRNA levels of the dsGFP group and the To determine the temporal and spatial expression patterns of CK group at 1 and 2 d. These differences may be reduced in situ- AcerAFP mRNA, real-time PCR was performed using cDNAs ations of stress by feeding dsRNA. In comparison to the CK and prepared from various developmental stages and tissues (Fig.  5). dsGFP groups, AcerAFP levels in the dsAcerAFP group decreased The results of temporal expression-pattern analysis showed that from 1 to 3 d, then recovered on day 4 and exhibited no differ- AcerAFP mRNA levels continued to drop from 1- to 15-d-old adults ence from the levels expressed in the CK and dsGFP groups on and then remained constant from 20- to 30-d-old adults. The high- day 5.  A  comparison of the inhibitory effect of RNAi from 1 to est and lowest levels of AcerAFP were detected in 1- and 15-d-old 5 d revealed that RNAi mediated by dsAcerAFP on 3 d was the adults, respectively (Fig.  5A). We also found that the highest level most effective, where the gene-silencing efficiency was 77.82%. of AcerAFP mRNA occurred in the legs, followed by the thorax The result of western blot analyses showed that expression levels and wings. The lowest level of expression occurred in the abdomen declined to 43.65% after feeding with dsAcerAFP. Thus, the sam- (Fig. 5B). AcerAFP mRNA expression levels varied among sexes and ples from the dsAcerAFP and dsGFP groups after 3-day treatment were higher in workers than in drones (Fig. 5C). were used for further analyses. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 6 Journal of Insect Science, 2018, Vol. 10, No. 1 Fig. 3. The nucleotide sequence and putative transcription factor binding sites of the 5ʹ-flanking regions of AcerAFP.AP1, activating protein-1; HSF, heat shock factors; NFKB, nuclear factor kappa B; ZIC, zinc finger transcription factor. The TH activities of the hemolymph of the Chinese honeybee the expressions of 19 genes changed significantly, 9 of which were after a 3-d RNAi treatment were detected using DSC (Fig. 7C). The upregulated and 10 of which were downregulated. Two upreg- results showed that the THA of the hemolymph had risen from 0.53 ulated genes (HSC70-3 and HSF2BP) and three downregulated to 0.56°C and that the total freezing temperature was reduced from genes (HSC70-4, HSP60, and HSP90) belonged to the HSP family. −9.46 to −6.77°C before and after RNAi treatments, respectively. Three upregulated genes (ZBED1, ZFP25, and ZIP19) and seven In addition, we detected the expression levels of 28 candi- downregulated genes (ZFP36, ZFP431, ZFP708, ZFPN, ZFPR, date genes involved in cold hardiness (Xu et al. 2017)—belonging ZMPN13, and ZIP13) belonged to the ZFP family. Finally, we only to three protein families (9 HSPs, 12 ZFPs, and 7 STKs)—in the detected four upregulated genes (CG31145, STKA2, mig15, and dsAcerAFP and dsGFP groups (Fig.  7D−F). The results show that PLK1) from the STKs. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 10, No. 1 7 Fig. 4. Dodecyl sulfate, sodium salt-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the expression of AcerAFP and the THA of purified AcerAFP. (A) M: molecular marker (kDa); Lane 1, non-induced expression; Lanes 2, induced overexpression of pMAL-AcerAFP-6×His in cell;Lanes 3, The purity protein after purification with 6×His tag antibody. (B) Result obtained from the DSC scan of the purified AcerAFP.T , the hold temperature; T , the total freezing temperature. h tf Fig.  5. Expression profile of AcerAFP as determined by qPCRs. (A) The relative expression of AcerAFP at different developmental stages. (B) The relative expression of AcerAFP in different tissues. AB, abdomen; AN, antennae; HE, head; LE, legs; TO, thorax; WB, whole body; WI, wings. The different letters above the columns indicate significant differences (P < 0.05) according to Duncan’s multiple range tests. (C) The relative expression of AcerAFP in different sexes. P < 0.01 indicates highly significant difference between the different sexes. Fig. 6. Expression profiles of AcerAFP as determined by qPCR (A) and western blot analysis under low temperature stress (B). The data represent the means ± SEM of three independent experiments. The different letters above the columns indicate significant differences (P < 0.05) according to Duncan’s multiple range tests. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 8 Journal of Insect Science, 2018, Vol. 10, No. 1 Table 1. The results of correlation analyses between AcerAFP expression levels and concentrations of cryoprotectants. Classification Sugar Polyols Amino acids Cryoprotectant Glucose Glycerin Aspartic Glutamic Cysteine Serine Glycine a a a mRNA level −0.956 −0.952 −0.461 −0.798 0.275 −0.561 −4.26 protein level 0.447 −0.410 −0.577 −0.148 −0.970 −0.468 −0.600 Classification Amino acids Cryoprotectant Histidine Arginine Threonine Alanine Proline Tyrosine Valine mRNA level −0.425 −0.268 −0.388 −0.372 −0.36 −0.331 −0.434 b b protein level −0.682 −0.636 −0.602 −0.725 −0.587 −0.644 −0.652 Classification Amino acids Cryoprotectant Methionine Isoleucine Leucine Phenylalanine Lysine mRNA level −0.402 −0.445 −0.482 −0.327 −0.38 protein level −0.672 −0.586 −0.613 −0.578 −0.546 Significant correlations between the expression of AcerAFP and the concentrations of cryoprotectants at 0.01 level. Significant correlations between the expression of AcerAFP and the concentrations of cryoprotectants at 0.05 level. Fig. 7. Effects of AcerAFP RNAi in adults. (A) The mRNA levels of AcerAFP are shown in RNAi tests. (B) The expression level of AcerAFP in the honeybees with RNAi treatment on the third day. P  <  0.01 indicate highly significant difference between the different treatments. (C) Result obtained from the DSC scan of the hemolymph was collected from 50 Chinese honeybees after RNA interference. T , the hold temperature; T , the total freezing temperature. (D) The mRNA h tf expression level of HSPs in dsAcerAFP group and dsGFP group. HSC70-3, heat shock 70 kDa protein cognate 3, 107997049; HSC70-4, heat shock 70 kDa protein cognate 4-like, 107996313; HSP10, heat shock protein 10 kDa, 108000341; HSP60, heat shock protein 60 kDa, 108000480; HSP90, heat shock protein 90, 408928; sHSP22.6, small hock protein 22.6 gene, KF150018.1; sHSP24.2a, small heat shock protein 24.2a gene, KF150019.1; HSF2BP, heat shock factor 2-binding protein- like, 107996546; HSF5, heat shock factor protein 5-like, 102674949. (E) The mRNA expression levels of ZFPs in dsAcerAFP group and dsGFP group. ZMPN13, zinc metalloproteinase nas-13-like, 107994936; ZFP25, zinc finger protein 25-like, 107998072; ZIP13, zinc transporter ZIP13 homolog, 410710; ZBED1, zinc finger BED domain-containing protein 1-like, 108004414; ZFP36, zinc finger protein 36, C3H1 type-like 3, 410758; ZIP9, zinc transporter ZIP9, 107995542; ZFP708, zinc finger protein 708-like, 107997300; ZFPR, zinc finger protein rotund-like, 107998742; ZFP431, zinc finger protein 431-like, 108001041; ZFPN, zinc finger protein Noc-like, 108002202; ZKSCN5, zinc finger protein with KRAB and SCAN domains 5-like, 107993647; ZFP582, zinc finger protein 582, 108002579. (F) The mRNA expression levels of serine/threonine-protein kinases in dsAcerAFP group and dsGFP group. CG31145, extracellular serine/threonine protein CG31145, 107998746; STKA2, serine/threonine-protein kinase Aurora-2-like, 108004128; PAKm, serine/threonine-protein kinase PAK mbt, 108003675; MKNK1, MAP kinase-interacting serine/ threonine-protein kinase 1-like, 108000369; STYX, serine/threonine/tyrosine-interacting protein-like, 107993674; mig15, serine/threonine-protein kinase mig-15, 108003038; PLK1, serine/threonine-protein kinase PLK1-like, 107999607. **There were significant difference among the expression levels of antifreeze-related protein genes in different treatment groups. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 10, No. 1 9 in western blot analyses, which is possibly a result of the differen- Discussion tial expression levels of the different genes. In addition, we noted Insects have a wide distribution across the various cold climatic differences between the levels of mRNA and protein expression. This zones on earth. Insect AFPs show diversity and variability between could be a result of the delayed effect of protein expression, existing varied species, and can even exhibit significant differences within the mechanisms of post-translational control. same species. Insect AFP cDNAs generally encode a group of small There is a great deal of research showing that small cryoprotect- proteins (7–21 kDa) rich in Cys or Thr residues, which together com- ants and large molecular-weight proteins related to cold tolerance prise nearly 40% of the constituent amino acids. These small AFPs work together to improve the adaptability of insects to cold environ- are also composed of varying numbers of tandem 12–15 residue ments (Doucet et al. 2009). Unlike the cold-related proteins, changes repeats. A  model structure, obtained using X-ray crystallographic in the concentrations of small cryoprotectants can directly reflect analysis, indicated that the insect AFPs fold as a β-helix (Doucet an organism’s ability to resist cold. Research on Drosophila mela- et al. 2009). In the present study, we found that AcerAFP encodes a nogaster shows that the reserves of glycogen, triacylglycerols, and 365-amino acid protein with a molecular weight of ~60 kDa that is proline might be important in coping with cold (Chen and Walker rich in Ala and has some (n = 11) repeats of four residues, AAXA, in 1994). The larvae of the cold-hardy gall fly (Eurosta solidaginis) the constituent amino acid arrangement. The secondary and tertiary exhibit high rates of glycerin, sorbitol, glucose, and trehalose bio- structures of the protein were mainly composed of α-helices. From synthesis (Holden and Storey 1994). Studies on other overwintering the perspective of protein structure, AcerAFP did not resemble other insects have shown that glycoproteins and various amino acids are insect AFPs, and was more similar to the fish type-I AFP. In sculpins also related to the cold-stress response (Huang et  al. 1990, Chen and winter flounders, type-I AFP is rich in Ala, and its structure is et al. 2005). On the basis of the aforementioned findings and com- composed entirely of α-helices (Low et al. 1998; Graether and Sykes ponents of fuel for over-wintering, we propose that the synthesis of 2004). The comparability of the protein sequences of AcerAFP with glucose, glycerin, and various amino acids likely plays a key role in the protein sequences of other hymenopteran insects was 63−96%. improving the adaptability of Chinese honeybees to cold (Chen and These results indicate that the AFPs are highly divergent, likely be- Walker 1993, Rochefort et  al. 2011). This hypothesis was proven cause of the differences in the behaviors of individual species. to be likely in the earlier stages of our study (Suppl Table 3 [online There are several factors that have been shown to affect the only]). Previous studies have shown that AFPs and some cryo- expressions of AFPs, such as environment temperature, humidity, protectants are able to influence each other, and that the combin- and the length of photoperiod (Graham et  al. 2000). Other than ation of cryoprotectants and AFPs also provide a novel approach these external environmental factors, many autoregulatory factors to cold protection (Wen et  al. 2016). In our study, the expression are also crucial in affecting the presence of AFP transcripts (Qin and levels of AcerAFP were related to the concentrations of glucose, Walker 2006). For example, in C.  fumiferana, AFP transcripts are glycerin, glutamic acid, cysteine, histidine, alanine, and methionine, most abundant in the second instar of the overwintering larvae, and which corroborate the findings of Wen et al. (2016). Thus, AcerAFP are localized mainly in the fore and midguts of the larval body (Qin may improve energy metabolism to reduce injuries caused by low et al. 2006). In T. molitor, the presence of AFPs has been correlated temperatures. with the stages of development (Graham et al. 2000). In the present RNA interference biotechnology has already proven its useful- study, the expression levels of AcerAFP mRNA in the newly emerged ness in functional genomic research on insects, and will soon prove adult workers continued to drop until they were 15-d-old adults, to be very promising in medicine to control cancers and viral dis- and then remained relatively stable (from 15- to 30-d-old adults). eases (Huvenne and Smagghe 2010). In early studies on insects, This is likely because the newly emerged honeybee is too weak to most of experiments were conducted by directly injecting dsRNA resist cold stress, where elevated levels of AcerAFP help to increase into the organism (Hossain et  al. 2008). Some studies showed the survival to adulthood. Furthermore, before honeybees become old ability of organisms to autonomously take up dsRNA through food enough to engage in foraging activities (~15 d), cold hardiness is and assimilate it in the gut, thereby enabling efficient insect con- well established, and AcerAFP mRNA expression is maintained at a trol (Baum et al. 2007). In this study, we inhibited AcerAFP mRNA lower level. AcerAFP mRNA was found to be expressed in all body by feeding dsRNA to A. cerana cerana. The results showed that the tissues of honeybees, where particularly higher expression levels effect of dsGFP was less obvious, where there were no off-target were detected in the locomotive organs (legs, thorax, and wings), effects, as there is no GFP target in honeybees (Elias-Neto et  al. possibly because locomotive organs have been shown to be sensitive 2010). In contrast to the CK and dsGFP groups, mRNA and protein to changes in environmental temperatures (Tosi et al. 2016). expression of the AcerAFP in the dsAcerAFP group decreased sub- Many species of insects in colder climates survive low tempera- stantially (77.82 and 43.65%, respectively). These results, similar to tures by increasing AFP levels in their bodies. A study on T. molitor previous findings (Zhang et al. 2014), showed that RNA interference showed that exposing small larvae to 4°C for 4 wk increased AFP by feeding dsRNA was a feasible and effective method in Chinese concentrations in the hemolymph by more than 20-fold (Graham honeybees. In comparing the results of DSC before and after RNAi, et al. 2000). In the present study, as the expression of AcerAFP was we found that the silencing AcerAFP considerably increased the total affected by both decreased temperature and the duration of ex- freezing temperature; however, there was no significant change in posure, it is likely that AFP confers cold-resistance in these insects. the THA of hemolymph in A.  cerana cerana. A  probable cause of The significantly higher expression of AcerAFP at 10°C than at 0°C this unexpected result is that there were undetected changes in the could be the result of metabolic torpor at 0°C. The tendency of level(s) of other antifreeze-related protein(s). More research will be AcerAFP expression to increase at the early stages (0–4 hr) indicates needed to further explore this possibility. Combined with the results that honeybees increase concentrations of AFP and improve their obtained from the DSC scan of the purified AcerAFP, we speculate cold hardiness soon after exposure to low temperatures. The lower that AcerAFP increases cold resistance by lowering the total freezing expression levels of AcerAFP after 4 hr suggest that the accumula- temperature of the hemolymph in these honeybees. tion of AcerAFP might be detrimental to the health of honeybees In addition to small cryoprotectants, cold-related proteins play (Kawahara et al. 2009). There was little difference between observed crucial roles in imparting cold resistance via their own unique Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 10 Journal of Insect Science, 2018, Vol. 10, No. 1 properties and structures (Molle and Kremer 2010, Bahar et  al. Chen, Y. J., X. G. Sun, W. G. Zhang, Z. G. Mu, and G. Z. Guo. 2005. Relation between variation of water,fat,glycerol in vivo of over-wintering Diaphania 2013). HSPs are a super family of chaperone proteins that are rap- pyloalis walker larvae and cold-hardiness. Canye Kexue 31: 111–116. idly biosynthesized in response to various environmental stressors Coelho, J. R. 1991. Heat transfer and body temperature in honey bee through translocation, the folding of newly synthesized proteins, (Hymenoptera: Apidae) drones and workers. Environ. Entomol. 20: and the degradation of unstable and misfolded proteins (Garrido 1627–1635. et al. 2012, Sun et al. 2016). HSFBP primarily modulates HSF acti- Davies, P. L., J. Baardsnes, M. J. Kuiper, and V. K. Walker. 2002. Structure and vation, and also appears to be the most insensitive to temperature function of antifreeze proteins. Philos. Trans. Royal Soc. B 357: 927–935. changes of the HSPs (Fu et al. 2006). The ZFP family is large and Doucet, D., V. K. Walker, and W. Qin. 2009. The bugs that came in from the widely distributed in plants, animals, and microorganisms (Miller cold: molecular adaptations to low temperatures in insects. Cell. Mol. Life et al. 1985). Zinc fingers can bind to DNA, RNA, and DNA-RNA Sci. 66: 1404–1418. hybrids, and are also involved in protein-protein interactions, reg- Elias-Neto, M., M. P. Soares, Z. L. Simoes, K. Hartfelder, and M. M. Bitondi. 2010. Developmental characterization, function and regulation of a ulating the expression of the target genes of transcriptional and Laccase2 encoding gene in the honey bee, Apis mellifera (Hymenoptera, translational processes (Pavletich and Pabo 1991, Neelyet al. 1999, Apinae). Insect Biochem. Mol. Biol. 40: 241–251. Black et al. 2001). STKs are a major protein kinase group that can Fu, S., P. Rogowsky, L. Nover, and M. J. Scanlon. 2006. The maize heat shock phosphorylate the hydroxyl groups of proteins (Arcas et al. 2013). factor-binding protein paralogs EMP2 and HSBP2 interact non-redun- In our study, some HSPs, ZFPs, and STKs were significantly altered dantly with specific heat shock factors. Planta 224: 42–52. in response to the RNA interference of AFP in Chinese honeybees, Garrido, C., C. Paul, R. Seigneuric, and H. H. Kampinga. 2012. The small heat suggesting that the expression of AcerAFP is involved in the expres- shock proteins family: the long forgotten chaperones. Int. J. Biochem. Cell sion and activity of these cold-related genes. Furthermore, there Biol. 44: 1588–1592. may be a link between putative transcription factor binding sites in Graether, S. P., M. J. Kuiper, S. M. Gagne, V. K. Walker, Z. Jia, B. D. Sykes, the 5′-UTR of AcerAFP, similar to the results of genomic structures. and P. L. Davies. 2000. Beta-helix structure and ice-binding properties of a hyperactive antifreeze protein from an insect. Nature 406: 325–328. Graether, S. P., and B. D.  Sykes. 2004. Cold survival in freeze-intolerant Supplementary Data insects: the structure and function of beta-helical antifreeze proteins. Eur. J. Biochem. 271: 3285–3296. Supplementary data are available at Journal of Insect Science online. Graham, L. A., V. K.  Walker, and P. L.  Davies. 2000. Developmental and environmental regulation of antifreeze proteins in the mealworm beetle Acknowledgments Tenebrio molitor. Eur. J. Biochem. 267: 6452–6458. Heinrich, B. 1980. Mechanisms of body-temperature regulation in honeybees, This work was financially supported through earmarked funds from Apis mellifera. II. Regulation of thoracic temperature at high air tempera- the National Nature Science Foundation of China with a grant (number tures. Phys. Lett. A 29: 551–551. 31372386) and the modern agricultural industry technology system of China Holden, C. P., and K. B.  Storey. 1994. 6-Phosphogluconate dehydrogenase with a grant (number CARS-44-SYZ-4).We would like to thank Shuang Yang, from a freeze tolerant insect: Control of the hexose monophosphate shunt the other member of ourlaboratory, for help with the experiments. We would and NADPH production during cryprotectant synthesis. Insect Biochem. also like to thank Editage for English language editing. Mol. Biol. 24: 167–173. Horwath, K., C. M. Easton, G. J. Poggioli Jr, K. Myers, and I. L. Schnorr. 1996. References Cited Tracking the profile of a specific antifreeze protein and its contribution to the thermal hysteresis activity in cold hardy insects. Eur. J. Entomol. 93: 419–433. Arcas, A., I.  Cases, and A. M.  Rojas. 2013. Serine/threonine kinases and Hossain, M., S. Shimizu, M. Matsuki, M. Imamura, S. Sakurai, and M. Iwami. E2-ubiquitin conjugating enzymes in Planctomycetes: unexpected findings. 2008. Expression of 20-hydroxyecdysone-induced genes in the silkworm Antonie van Leeuwenhoek 104: 509–520. brain and their functional analysis in post-embryonic development. Insect Bahar, M. H., D. Hegedus, J. Soroka, C. Coutu, D. Bekkaoui, and L. Dosdall. Biochem. Mol. Biol. 38: 1001–1007. 2013. Survival and hsp70 gene expression in Plutella xylostella and its Huang, G. Y., Y. C. Wang, and Z. P. You. 1990. Study on cold tolerance func- larval parasitoid Diadegma insulare varied between slowly ramping and tions of Agrotis segetum. J. Zhejiang Forest. Coll. 1990;(2):140–146. abrupt extreme temperature regimes. PLoS One 8: e73901. Huvenne, H., and G. Smagghe. 2010. Mechanisms of dsRNA uptake in insects Bale, J. S. 2002. Insects and low temperatures: from molecular biology to dis- and potential of RNAi for pest control: a review. J Insect Physiol. 56: tributions and abundance. Philos. Trans. Royal Soc. B 357: 849–862. 227–235. Bang, J. K., J. H. Lee, R. N. Murugan, S. G. Lee, H. Do, H. Y. Koh, H. E. Shim, Kawahara, H., S. Higa, H. Tatsukawa, and H. Obata. 2009. Cryoprotection H. C.  Kim, and H. J.  Kim. 2013. Antifreeze peptides and glycopeptides, and cryosterilization effects of type I  antifreeze protein on E.  coli cells. and their derivatives: potential uses in biotechnology. Mar. Drugs 11: Biocontrol sci. 14: 49–54. 2013–2041. King, A. M., and T. H. MacRae. 2015. Insect heat shock proteins during stress Baum, J. A., T.  Bogaert, W.  Clinton, G. R.  Heck, P.  Feldmann, O.  Ilagan, and diapause. Annu. Rev. Entomol. 60: 59–75. S.  Johnson, G.  Plaetinck, T.  Munyikwa, M.  Pleau, T.  Vaughn, and Li, N., B. A.  Chibber, F. J.  Castellino, and J. G.  Duman. 1998. Mapping of J. Roberts. 2007. Control of coleopteran insect pests through RNA inter- disulfide bridges in antifreeze proteins from overwintering larvae of the ference. Nat. Biotechnol. 25: 1322–1326. beetle Dendroides canadensis. Biochemistry 37: 6343–6350. Bendtsen, J. D., L. J. Jensen, N. Blom, G. Von Heijne, and S. Brunak. 2004. Liou, Y. C., P. Thibault, V. K. Walker, P. L. Davies, and L. A. Graham. 1999. Feature-based prediction of non-classical and leaderless protein secretion. A complex family of highly heterogeneous and internally repetitive hyper- Protein Eng. Des. Sel. 17: 349–356. active antifreeze proteins from the beetle Tenebrio molitor. Biochemistry Black, A. R., J. D. Black, and J. Azizkhan-Clifford. 2001. Sp1 and kruppel-like 38: 11415–11424. factor family of transcription factors in cell growth regulation and cancer. Liou, Y. C., A. Tocilj, P. L. Davies, and Z. Jia. 2000. Mimicry of ice structure J. Cell. Physiol. 188: 143–160. by surface hydroxyls and water of a beta-helix antifreeze protein. Nature Chen, C. P., and V. K. Walker. 1993. Increase in cold-shock tolerance by selec- 406: 322–324. tion of cold resistant lines in Drosophila melanogaster. Ecol. Entomol. Livak, K. J., and T. D.  Schmittgen. 2001. Analysis of relative gene expres- 18: 184–190. sion data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Chen, C.-P., and V. K.  Walker. 1994. Cold-shock and chilling tolerance in method. Methods 25: 402–408. Drosophila. J. Insect Physiol. 40: 661–669. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 10, No. 1 11 Low, W. K., M.  Miao, K. V.  Ewart, D. S.  Yang, G. L.  Fletcher, and C. Tosi, S., F. J. Demares, S. W. Nicolson, P. Medrzycki, C. W. Pirk, and H. Human. L.  Hew. 1998. Skin-type antifreeze protein from the shorthorn sculpin, 2016. Effects of a neonicotinoid pesticide on thermoregulation of African Myoxocephalus scorpius. Expression and characterization of a Mr 9, 700 honey bees (Apis mellifera scutellata). J. Insect Physiol. 93–94: 56–63. recombinant protein. J Biol. Chem. 273: 23098–23103. Venketesh, S., and C. Dayananda. 2008. Properties, potentials, and prospects Miller, J., A. D.  McLachlan, and A.  Klug. 1985. Repetitive zinc-binding of antifreeze proteins. Crit. Rev. Biotechnol. 28: 57–82. domains in the protein transcription factor IIIA from Xenopus oocytes. Wen, X., S.  Wang, J. G.  Duman, J. F.  Arifin, V.  Juwita, W. A.  Goddard III, EMBO J 4: 1609–1614. A. Rios, F. Liu, S. K. Kim, R. Abrol, et al. 2016. Antifreeze proteins govern Molle, V., and L. Kremer. 2010. Division and cell envelope regulation by Ser/ the precipitation of trehalose in a freezing-avoiding insect at low tempera- Thr phosphorylation: Mycobacterium shows the way. Mol. Microbiol. 75: ture. Proc. Natl. Acad. Sci. USA 113: 6683–6688. 1064–1077. Winston, M. L. 1992. The honey bee colony: life history, pp. 73–101. In The Neely, L. S., B. M.  Lee, J.  Xu, P. E.  Wright, and J. M.  Gottesfeld. 1999. Hive and the Honey Bee (Sixth Printing 2003), Ch. 3. Dadant and Sons, Identification of a minimal domain of 5 S ribosomal RNA sufficient for Inc., Hamilton, IL. high affinity interactions with the RNA-specific zinc fingers of transcrip- Xu, K., Q. Niu, H. Zhao, Y. Du, and Y. Jiang. 2017. Transcriptomic analysis tion factor IIIA. J. Mol. Biol. 291: 549–560. to uncover genes affecting cold resistance in the Chinese honey bee (Apis Pavletich, N. P., and C. O. Pabo. 1991. Zinc finger-DNA recognition: crystal cerana cerana). PLoS One 12: e0179922. structure of a Zif268-DNA complex at 2.1 A. Science 252: 809–817. Yu, S. H., P. Yang, T. Sun, Q. Qi, X. Q. Wang, X. M. Chen, Y. Feng, and B. Qin, W., M. G. Tyshenko, D. Doucet, and V. K. Walker. 2006. Characterization W. Liu. 2016. Transcriptomic and proteomic analyses on the supercooling of antifreeze protein gene expression in summer spruce budworm larvae. ability and mining of antifreeze proteins of the Chinese white wax scale Insect Biochem. Mol. Biol. 36: 210–218. insect. Insect Sci. 23: 430–437. Qin, W., and V. K.  Walker. 2006. Tenebrio molitor antifreeze protein gene Zhao, H., W.  Zhao, P.  Gao, G.  Zhang, and Y.  Jiang. 2014. Sequence and identification and regulation. Gene 367: 142–149. expression characterization of an OBP1 gene in the Asian honeybee, Rochefort, S., R.  Berthiaume, C.  Hebert, M.  Charest, and E.  Bauce. 2011. Apis cerana cerana (Hymenoptera: Apidae). Appl. Entomol. Zool. 49: Effect of temperature and host tree on cold hardiness of hemlock looper 189–196. eggs along a latitudinal gradient. J. Insect Physiol. 57: 751–759. Zhao, Y., P.  Gao, W.  Li, Y.  Zhang, K.  Xu, X.  Guo, B.  Li, and G.  Cao. Sun, Y., J. Zhao, Y. Sheng, Y. F. Xiao, Y. J. Zhang, L. X. Bai, Y. Tan, L. B. Xiao, 2015. Study on the developmental expression of Lbx1 gene in and G. C. Xu. 2016. Identification of heat shock cognate protein 70 gene Longissimus Dorsi of mashen and large white pigs. Ital. J. Anim. Sci. (Alhsc70) of Apolygus lucorum and its expression in response to different 14: 2081–2087. temperature and pesticide stresses. Insect Sci. 23: 37–49. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Insect Science Oxford University Press

Sequencing and Expression Characterization of Antifreeze Protein Maxi-Like in Apis cerana cerana

Free
11 pages

Loading next page...
 
/lp/ou_press/sequencing-and-expression-characterization-of-antifreeze-protein-maxi-02fU0Lt35j
Publisher
Entomological Society of America
Copyright
© Society of Behavioral Medicine 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
eISSN
1536-2442
D.O.I.
10.1093/jisesa/iex109
Publisher site
See Article on Publisher Site

Abstract

Antifreeze proteins (AFPs) are biological cryoprotectants with unique properties that play a crucial role in regulating the molecular mechanisms governing cold resistance in insects. To identify and characterize Apis cerana cerana AFP (AcerAFP), we cloned the full-length cDNA of AcerAFP and examined its expression patterns in A.  cerana cerana. A nucleotide alignment analysis showed that the entire coding region of AcerAFP is 1095 bp and encodes a polypeptide of 365 amino acids. The amino acid sequence of this protein exhibits 63–96% homology with AFP homologs from other hymenopterans. α-helices form the main secondary and tertiary structures of AcerAFP , which is similar to the molecular structure of fish AFP type-I. The expression profiles of AcerAFP revealed that expression was tissue, sex, and developmentally specific. In response to cold stress, the mRNA and protein expression of AcerAFP were both induced by low temperatures, and were also related to the concentrations of several cryoprotectants, including glucose, glycerin, glutamic acid, cysteine, histidine, alanine, and methionine. In addition, we found that the knockdown of AcerAFP by RNA interference remarkably increased the total freezing temperature of hemolymph in A. cerana cerana, where levels of AcerAFP mRNA were correlated with the expression of most antifreeze-related proteins. Taken together, these results suggest that AcerAFP plays an essential role as a biological cryoprotectant in honeybees, and is in turn regulated by small cryoprotectants and antifreeze-related proteins. Key words: antifreeze protein, Apis cerana cerana, cold stress, expression patterns, RNA interference unique characteristics and special properties (Bang et al. 2013, King Introduction and MacRae 2015). Among these proteins, AFPs have gained much Insects living at high latitudes or altitudes are exposed to fluctuating attention because they are known to protect organisms from freezing thermal environments. For survival, the majority of freeze-tolerant by lowering the freezing temperature (T ) (Wen et al. 2016). insects (which can survive freezing) have to hide in local shelters AFPs have been identified in marine organisms, including fishes, to escape the low temperatures and must bear some of the brunt and also in insects, microalgae, bacteria, and fungi (Doucet et al. 2009). of low temperature exposure (Doucet et al. 2009). To counter these AFPs were first discovered in fishes in the Arctic and Antarctic regions, adverse conditions, insects have evolved a suite of physiological and have been classified into four types (types I, II, III, and IV). The four and molecular adaptations, which mainly include the synthesis of types of AFPs are fundamentally different in terms of their primary low-molecular-weight compounds and cryoprotective proteins (Bale sequences and three-dimensional (3D) structures, but show correspond- 2002). These small compounds primarily consist of hydrocarbons, ing properties in binding ice and lowering the freezing points (Davies amino acids, and polyols, which are involved in energy metabolism et al. 2002, Venketesh and Dayananda 2008). In contrast to fish AFPs, and accumulation of cryoprotectants (Holden and Storey 1994). insect AFPs possess very high thermal hysteresis (TH) activity, where The antifreeze proteins (AFPs), antifreeze glycoproteins, heat shock some isoforms exhibit a specific activity up to 100 greater than that of proteins (HSPs), serine/threonine kinases (STKs), ice-nucleating pro- teins, membrane protectants, and other similar but less well-char- fish AFPs (Liou et al. 1999). The TH, a measure of antifreeze activity, acterized proteins serve as prominent cryoprotective agents with refers to the difference between the melting and freezing points of a © The Author(s) 2018. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 2 Journal of Insect Science, 2018, Vol. 10, No. 1 solution. At present, insect AFP research is focused on the coleopteran for 0, 2, 4, 6, and 8 hr. Postemergence 10-d-old drones were collected species Tenebrio molitor and Dendroides canadensis, and on the lep- in the same manner which was used to collect the workers. All bee idopteran species Choristoneura fumiferana, where insect AFPs have specimens were immediately frozen in liquid nitrogen at the indi- been shown to exhibit similarities in the heterogeneity of structure, cated time points and stored at −80°C. patterns of amino acid repeats, and â-helix structures (Li et al. 1998, Graether et al. 2000, Liou et al. 2000). The special characteristics and Measurement of TH Activity structures of AFPs are responsible for their specific orientations and Two samples of hemolymph collected from 50 Chinese honeybees functions. Owing to the distinctive overwintering methods of different before and after RNA interference and purification of the heterologous insects, the relationships between the presence and expression levels expression of AFPs were selected to measure TH activity (THA). Bovine of AFPs and photoperiods, environmental temperatures, development serum albumin (BSA) solution was used as a control. THA was deter- stages, and the sexes of insects have been investigated (Horwath et al. mined using a differential scanning calorimeter (DSC Q20) (DSC Q20, 1996, Graham et al. 2000). The results of such multifaceted analyses TA Instruments, New Castle, DE, USA). After sampling, the temperature indicate that insect AFPs contribute significantly to protecting insects of samples was lowered from room temperature to −30°C, and then against low temperatures in a variety of ways (Qin et al. 2006). warmed to 15°C. Subsequently, samples were continuously cooled to Honeybees, one of the most common eusocial insects, are −30°C and then warmed to −1°C (holding temperature, T ), held at T h h extremely sensitive to fluctuations in climate. Low temperatures not for 3 min, and lowered to −30°C again. The rate of temperature variation only delay larval and pupal development but also significantly influ- was 1°C/min. The T was the temperature at which samples crystallized ence the physiological activities of the adults. In the winter, when after the holding temperature. The THA  =  T − T . The total freezing h f the ambient temperature is very low, the overwintering workers and temperature was the temperature at which the samples froze completely. the queen are clustered inside the hive, living on the honey reserves that were accumulated before the onset of winter. Workers maintain Cloning AcerAFP cDNA a temperature of about 20°C inside the colony by contracting their The extraction of total RNA and the isolation of the full-length flight muscles, where the energy for heat production is supplied by cDNA sequence of AcerAFP were performed following previously the stored honey (Winston 1992). Individual honeybees are poikilo- described methods (Zhao et al. 2014). The primers used in this study thermic and maintain their body temperatures at or near a constant are listed in Supp Table  1 (online only). Total RNA was isolated by burning calories during flight (Coelho 1991). When body temper - from 10 worker bees using TRIzol reagent (Invitrogen, Carlsbad, atures decrease below 10°C, honeybees fall into cold-induced state of CA). Conditions for PCR amplifications were as follows: 4 min at torpor (i.e., chill-coma) from which they cannot voluntarily recover 94°C; followed by 38 cycles at 94°C for 30 s, 58°C for 1 min, 72°C without external warming (Heinrich 1980). As such, honeybees for 1  min 30  s, and a final extension at 72°C for 8  min. Purified should be classified as freeze-avoiding insects (i.e., they die if frozen). PCR products of the correct sizes were ligated into the pGM-T The Chinese honeybee (Apis cerana cerana) is an important en- vector (Tiangen Biotech, Beijing, China), and transformed into demic species in China that can be used as an effective model organism DH5α-competent cells. Positive colonies were identified by PCR and for studying cold resistance in honeybees (Xu et al. 2017). Most of sequenced by the Huada Gene Research Center (Beijing, China). the current studies on insect AFPs are focused on solitary species of freeze-tolerant insects, while reports regarding social Hymenoptera Bioinformatic and Phylogenetic Analyses are scant. In the present study, we cloned the full-length cDNA of Protparam (http://web.expasy.org/protparam/) was used to predict the A. cerana cerana AFP Maxi-like gene (henceforth AcerAFP) and the physicochemical properties of AcerAFP. Putative signal peptides analyzed the structure and functions of the corresponding protein were predicted using the SignalP 3.0 Server (Bendtsen et al. 2004). using bioinformatics. The expression of AcerAFP was determined by The PredictProtein web-resource (https://www.predictprotein.org/) real-time polymerase chain reaction (PCR) and western blot analysis. was used to predict secondary structures. The Swiss model homol- Moreover, RNAi was used to validate the function of AcerAFP and ogy-modeling server (http://swissmodel.expasy.org/interactive) was the correlation of AFP with antifreeze-related proteins. Through these queried to locate 3D structure models of AcerAFP. Phylogenetic and in-depth studies, we have attempted to augment the existing level of molecular evolutionary analyses were performed with Molecular knowledge regarding the sequence and function of honeybee AFPs Evolutionary Genetics Analysis (MEGA version 4.1), software using and to provide a theoretical basis for understanding the mechanisms the neighbor-joining method. Homology searches were conducted of the evolution of cold resistance in eusocial Hymenoptera. on the NCBI platform (www.ncbi.nlm.nih.gov). The promoter was predicted using the BDGP web resource (http://www.fruitfly.org/ Materials and Methods seq_tools/promoter.html). The online tool PROMO (http://alggen. lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3) Insects and Treatments was used to predict putative cis-acting elements. A.  cerana cerana were collected from the colony maintained by the apiculture laboratory at Shanxi Agriculture University, Shanxi, China. Heterologous Expression and Purification of AFP Newly emerged adult worker bees (n = 300) were sampled 1, 5, 10, 15, 20, 25, and 30 d after emergence, and labeled with paint. These bees The AcerAFP sequence was subcloned into the pEASY-Blunt vec- represented seven different age groups—adu1, adu5, adu10, adu15, tor for expression in Escherichia coli BL21b cells (Novagen, San adu20, adu25, and adu30, respectively. For tissue-specific expression Diego, CA). The primers for the pMAL-C5X-6His recombinant vec- analyses, the antennae, head, thorax, abdomen, legs, and wings of newly tors are listed in Supp Table  1 (online only). The expression of AFP emerged bees (n = 100) were dissected on ice, and the tissues and whole was induced by isopropyl thiogalactoside (0.5  mmol/liter) (Sangon, body were frozen immediately in liquid nitrogen, and stored at −80°C. Shanghai, China) at 11°C for 8  hr. The heterologous expression of Adult bees (post-emergence age 20 d) were equally divided into AcerAFP was examined via western blot analyses using anti-6×His tag two groups (n = 60/group), which were maintained at constant tem- antibodies. The AcerAFP in the supernatant was collected and purified peratures of 0 and 10°C, and 50% relative humidity, in incubators using an anti-6×His tag antibody. The purified AcerAFP was dissolved Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 10, No. 1 3 in phosphate-buffered saline (pH 7.4, 2.0 mg/mL) and its concentra- Subsequently, ‘normal’ individuals (levels of physiological activity tion was determined using the Bradford method (Yu et al. 2016). similar to those of the control group) were sampled for 5 d.  This experiment was repeated in triplicate. Expression Analysis of T emporal-Spatial Development and Responses to Low Temperature The Correlation Analyses Between AcerAFP Using Real-Time PCR and Western Blot Analyses Expression Levels and Small Cryoprotectants The real time quantitative reverse transcriptase PCR (qRT-PCR) ana- Concentrations lysis was performed following previously described methods using The concentrations of small cryoprotectants were listed in Supp the SYBR Premix Ex Taq kit (Takara, Dalian, China) (Zhao et  al. Table 3 (online only). The Pearson correlation indices, which calcu- 2014). The A. cerana cerana β-actin gene (HM640276.1) was used lated by SPSS statistics 17.0, were used to evaluate the correlations as an internal control. Transcript levels were evaluated in three inde- between AcerAFP expression levels and small cryoprotectants. pendent biological replicates with three technical repeats for each primer pair. The relative quantification of gene expression was ana- Gene Expression Profiles of Cold-Related Proteins −ΔΔCt lyzed using the comparative 2 method (Livak and Schmittgen Before and After RNAi 2001). The western blot analysis was performed following previously To explore the expression profiles of cold-related protein genes before described methods (Zhao et al. 2015). For western blot analysis, a and after RNAi, we performed qRT-PCR on several cold stress-related peptide corresponding to amino acids 18−31 of AcerAFP was syn- different expression genes (9 HSPs, 7 STKs, and 12 zinc finger proteins thesized in the Huada Protein Research Center (Beijing, China). New [ZFPs]). The mRNA of genes expression of these cold-related proteins Zealand white rabbits were immunized with the synthesized peptide was detected in our previous experiments (Xu et  al. 2017). Primers coupled to keyhole limpet hemocyanin to prepare the antiserum. The used for qRT-PCR analyses on the gene expression of cold-related pro- anti-AcerAFP serum was used as the primary antibody at a dilu- tein genes are listed in Supp Table 1 (online only). The tested samples tion of 1:1,000 (v/v). The BCA Protein Assay Kit (Boster, Wuhan, were collected from the dsAcerAFP and dsGFP groups after 3 d of China) was used to detect the proteins. Peroxidase-conjugated goat treatment. The methods of analyses were the same as in the Expression anti-rabbit IgG (Boster) was used as the secondary antibody at a Analysis of Temporal-Spatial Development and Responses to Low dilution of 1:3,000 (v/v). Subsequently, a super ECL chemilumines- Temperature Using Real-Time PCR and Western Blot Analyses. cence plus (Boster) was used for visualization after membranes were washed. The relative intensities of the aforementioned proteins were analyzed using Image Lab Software (Bio-Rad Laboratories, PA). The Results AcerAFP content was normalized to β-actin level in each lane. THA in the Chinese Honeybee RNA Interference The TH activities of hemolymph and BSA were detected using DSC The dsRNAs were synthesized using the T7RiboMAX Express (Fig.  1). Our results show that a heat-flow peak appeared in the RNAi System (Promega, Madison, WI, USA) following the manufac- hemolymph of the Chinese honeybee when the temperature of sam- turer’s protocol. Primer sequences (RIafp/RIgfp) are listed in Supp ples decreased from −1°C (T ) to −30°C, while the temperature of Table  1 (online only). The newly emerged adult worker bees were the peak (T ) was −1.53°C. In contrast, the control BSA solution divided at random into three groups (n = 50/group) and were used exhibited no heat-flow peak in the cooling process. This indicates in RNAi experiments. Each individual in the two treatment groups that the hemolymph of the Chinese honeybee had a THA of 0.53°C, was fed with 10 μL (10 ng) of either dsAcerAFP or ds green fluores- whereas the control BSA solution exhibited no THA, suggesting the cent protein (dsGFP) and were designated as the dsAcerAFP group presence of AFPs in the hemolymph of Chinese honeybees. The total and the dsGFP group, respectively. The third honeybee group was freezing temperature is the temperature at which the samples froze left untreated and was designated as the control check (CK) group. completely in the process of decreasing from T to −30°C. The total Fig. 1. TH values of Chinese honeybee hemolymph and BSA. (A) Result obtained from the DSC scan of Chinese honeybee hemolymph. T , the hold temperature; T , the total freezing temperature. (1) Result obtained from the DSC scan of the BSA solution. tf Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 4 Journal of Insect Science, 2018, Vol. 10, No. 1 freezing temperature of hemolymph of Chinese honeybee and BSA analyses show that the open reading frame is 1,095 bp long, and were no −9.46 and −9.23°C, respectively. encodes a 365-amino acid protein with an estimated isoelectric point of 6.09. A hydrophobic signal peptide with 16 amino acid Cloning and Sequence Analysis of AcerAFP residues was identified (Fig. 2A). The prediction of secondary pro- The full-length AcerAFP gene sequence (GenBank accession tein structures revealed that 96.43% of the amino acids formed number: KX458243) is 1,200 bp in length and contains a 42-bp helices, and 3.57% formed loops (Fig. 2B). The tertiary structure 5ʹ untranslated region (UTR) and a 63-bp 3ʹ-UTR. Sequence of AcerAFP confirms that α -helices constitute the main structure Fig. 2. Molecular properties of AcerAFP. (A) Full-length cDNA sequence of Apis cerana cerana antifreeze protein (AFP). Start and stop codons are boxed, signal peptide sequence is underscored. (B) The secondary structure of AcerAFP. (C) The tertiary structure of AcerAFP. (D) Alignment of amino acid sequences. Identical amino acid residues are shaded in black. (E) Phylogenetic tree based on amino acid sequence alignment. The branch labels are bootstrap values (%), which are based on 1,000 replicates. The scale bar is 0.05. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 10, No. 1 5 of the protein, whereas random coils constitute only a minor por- Expression of AcerAFP in Response to Low tion of its structure (Fig. 2C). Temperatures An alignment of AcerAFP with homologous proteins from other The relative expression of AcerAFP mRNA and protein at differ- hymenopteran insects using NCBI BLASTp (Fig. 2D) indicates that ent low temperatures and durations of exposure were determined more than 59% of the protein sequences of AcerAFP were com- by qRT-PCR and western blot analyses (Fig.  6). AcerAFP mRNA parable to AFP protein sequences from other insects. AcerAFP expression patterns varied significantly with varying low tem- was highly similar to AmelAFP (96%) from the European honey- perature treatments. When exposed to 10°C, levels of AcerAFP bee Apis mellifera, while it was less similar to the corresponding mRNA continued to increase for 4  hr, when the highest expres- AFP from the more distantly related parasitic wood wasp Orussus sion levels were detected, after which the levels decreased and abietinus (63%). We found that AcerAFP amino acid residues num- were maintained initial levels. When exposed to 0°C, AcerAFP bering 87–269 were relatively well conserved. The phylogenetic mRNA expression levels increased initially and then decreased, tree constructed based on this finding directly reflects the relation- where the highest and lowest expression levels occurred at 4 and ship between the selected insects (Fig.  2E). The tree had two main 8 hr, respectively. By comparing the expression levels of AcerAFP groups: the first group (including A. cerana cerana) consisted of the mRNA at different temperatures for the same durations of expos- superfamily Apoidea, whereas the other group consisted of the three ure, we observed that expression levels at 10°C were higher than hymenopteran families Formicidae, Tenthredinidae, and Orussidae. that at 0°C. Unsurprisingly, there were significant differences in AcerAFP protein expression levels at various low temperatures. At Genomic Structure and Putative cis-Acting 10°C, AcerAFP levels decreased initially (2 hr), and then increased Elements in 5ʹ-UTR of AcerAFP from 4 to 6 hr, followed by a drop to a lower level at 8 hr. Thus, The sequence of 5ʹ-UTR of AcerAFP (results of FASTA in Suppl the highest and lowest expression levels occurred at 6 and 2  hr, Table  2 online only) was obtained from the NCBI database respectively. At 0°C, trends in expression-level changes in AcerAFP (GenBank ID: NW_016019342.1 [369089...  392989]) (Fig.  3). protein fluctuated, where they steadily decreased from 0 to 4  hr, The promoter prediction for AcerAFP shows that the transcription and after a little recovery at 6 hr, decreased further to a lower level. start site is 560 nucleotides upstream from the translation start The highest and lowest expression levels occurred at 6 and 4  hr, site. The promoter region (ATATTATATATATATAAATGAACGAG respectively. In general, the expression level of AcerAFP was higher AATTCTTTCAATATTTGAATAAAAT) extend from nucleotides at 10°C than at 0°C. −44 to +6. The results of the prediction analyses revealed that some The determination of the concentration of different cryoprotect- sequences involved in embryo or tissue development, including ants under different temperature treatments (Supp Table  3 [online CF2-II (n = 9), Dfd (n = 1), BR-C (n = 13), NIT2 (n = 8), and CdxA only]) revealed that the concentrations of glucose, glycerin, and amino (n > 50) listed in Suppl Table 4 (online only). Several important tran- acids varied significantly with different temperature treatments. It is scription factors associated with environmental stress and immune believed that the metabolisms of these materials are involved in devel- responses, such as heat shock factors (n = 14), activating protein-1 oping cold resistance in honeybees. Pearson correlation analysis was (n = 4), nuclear factor kappa B (n = 1), and zinc-finger transcription used to evaluate the interactions between the expression of AcerAFP factors (n = 4) were also identified in 5ʹ-UTR of AcerAFP. and the concentrations of cryoprotectants (Table  1). The results of correlation analyses show that there is a strong relationship between AcerAFP mRNA expression levels and the concentrations of glucose, Heterologous Expression of AFP glycerin, and glutamic acid. The concentrations of the amino acids AcerAFP was heterologously expressed in E. coli (Fig. 4A). Dodecyl cysteine, histidine, alanine, and methionine were also found to be sulfate, sodium salt-polyacrylamide gel electrophoresis (SDS–PAGE) related to the expression of the AcerAFP protein. analysis revealed that the recombinant protein was soluble, and had a molecular mass of ~125 kDa (results of western blot in Supp Figure 1 [online only]), which is consistent with the predicted molec- RNAi of AcerAFP in Honeybees ular mass of 60  kDa (containing MBP-6×His tags of ~64  kDa). The RNAi, mediated by dsRNA, was used to explore the func- These results of DSC in Fig. 4B indicate that the AcerAFP solution tion of AcerAFP. The result of gene silencing is shown in Fig. 7A had a THA of 0.52°C, and exhibited a deeper total freezing tem- and B.  AcerAFP mRNA levels in the CK group decreased at first perature (−14.52°C) than the hemolymph in the Chinese honeybee. and then increased before finally decreasing. Constant levels of These results also indicate that the purified AcerAFP obtained in the AcerAFP mRNA were maintained at two development stages: present study belongs to the AFP family. from 1 to 2 d and from 3 to 5 d. The expression levels of AcerAFP mRNA in the dsGFP group were lower at 1 d and were main- Expression Patterns in Temporal-Spatial tained at a constant level from 2 to 4 d.  There were significant Development of Honeybee differences between the mRNA levels of the dsGFP group and the To determine the temporal and spatial expression patterns of CK group at 1 and 2 d. These differences may be reduced in situ- AcerAFP mRNA, real-time PCR was performed using cDNAs ations of stress by feeding dsRNA. In comparison to the CK and prepared from various developmental stages and tissues (Fig.  5). dsGFP groups, AcerAFP levels in the dsAcerAFP group decreased The results of temporal expression-pattern analysis showed that from 1 to 3 d, then recovered on day 4 and exhibited no differ- AcerAFP mRNA levels continued to drop from 1- to 15-d-old adults ence from the levels expressed in the CK and dsGFP groups on and then remained constant from 20- to 30-d-old adults. The high- day 5.  A  comparison of the inhibitory effect of RNAi from 1 to est and lowest levels of AcerAFP were detected in 1- and 15-d-old 5 d revealed that RNAi mediated by dsAcerAFP on 3 d was the adults, respectively (Fig.  5A). We also found that the highest level most effective, where the gene-silencing efficiency was 77.82%. of AcerAFP mRNA occurred in the legs, followed by the thorax The result of western blot analyses showed that expression levels and wings. The lowest level of expression occurred in the abdomen declined to 43.65% after feeding with dsAcerAFP. Thus, the sam- (Fig. 5B). AcerAFP mRNA expression levels varied among sexes and ples from the dsAcerAFP and dsGFP groups after 3-day treatment were higher in workers than in drones (Fig. 5C). were used for further analyses. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 6 Journal of Insect Science, 2018, Vol. 10, No. 1 Fig. 3. The nucleotide sequence and putative transcription factor binding sites of the 5ʹ-flanking regions of AcerAFP.AP1, activating protein-1; HSF, heat shock factors; NFKB, nuclear factor kappa B; ZIC, zinc finger transcription factor. The TH activities of the hemolymph of the Chinese honeybee the expressions of 19 genes changed significantly, 9 of which were after a 3-d RNAi treatment were detected using DSC (Fig. 7C). The upregulated and 10 of which were downregulated. Two upreg- results showed that the THA of the hemolymph had risen from 0.53 ulated genes (HSC70-3 and HSF2BP) and three downregulated to 0.56°C and that the total freezing temperature was reduced from genes (HSC70-4, HSP60, and HSP90) belonged to the HSP family. −9.46 to −6.77°C before and after RNAi treatments, respectively. Three upregulated genes (ZBED1, ZFP25, and ZIP19) and seven In addition, we detected the expression levels of 28 candi- downregulated genes (ZFP36, ZFP431, ZFP708, ZFPN, ZFPR, date genes involved in cold hardiness (Xu et al. 2017)—belonging ZMPN13, and ZIP13) belonged to the ZFP family. Finally, we only to three protein families (9 HSPs, 12 ZFPs, and 7 STKs)—in the detected four upregulated genes (CG31145, STKA2, mig15, and dsAcerAFP and dsGFP groups (Fig.  7D−F). The results show that PLK1) from the STKs. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 10, No. 1 7 Fig. 4. Dodecyl sulfate, sodium salt-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the expression of AcerAFP and the THA of purified AcerAFP. (A) M: molecular marker (kDa); Lane 1, non-induced expression; Lanes 2, induced overexpression of pMAL-AcerAFP-6×His in cell;Lanes 3, The purity protein after purification with 6×His tag antibody. (B) Result obtained from the DSC scan of the purified AcerAFP.T , the hold temperature; T , the total freezing temperature. h tf Fig.  5. Expression profile of AcerAFP as determined by qPCRs. (A) The relative expression of AcerAFP at different developmental stages. (B) The relative expression of AcerAFP in different tissues. AB, abdomen; AN, antennae; HE, head; LE, legs; TO, thorax; WB, whole body; WI, wings. The different letters above the columns indicate significant differences (P < 0.05) according to Duncan’s multiple range tests. (C) The relative expression of AcerAFP in different sexes. P < 0.01 indicates highly significant difference between the different sexes. Fig. 6. Expression profiles of AcerAFP as determined by qPCR (A) and western blot analysis under low temperature stress (B). The data represent the means ± SEM of three independent experiments. The different letters above the columns indicate significant differences (P < 0.05) according to Duncan’s multiple range tests. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 8 Journal of Insect Science, 2018, Vol. 10, No. 1 Table 1. The results of correlation analyses between AcerAFP expression levels and concentrations of cryoprotectants. Classification Sugar Polyols Amino acids Cryoprotectant Glucose Glycerin Aspartic Glutamic Cysteine Serine Glycine a a a mRNA level −0.956 −0.952 −0.461 −0.798 0.275 −0.561 −4.26 protein level 0.447 −0.410 −0.577 −0.148 −0.970 −0.468 −0.600 Classification Amino acids Cryoprotectant Histidine Arginine Threonine Alanine Proline Tyrosine Valine mRNA level −0.425 −0.268 −0.388 −0.372 −0.36 −0.331 −0.434 b b protein level −0.682 −0.636 −0.602 −0.725 −0.587 −0.644 −0.652 Classification Amino acids Cryoprotectant Methionine Isoleucine Leucine Phenylalanine Lysine mRNA level −0.402 −0.445 −0.482 −0.327 −0.38 protein level −0.672 −0.586 −0.613 −0.578 −0.546 Significant correlations between the expression of AcerAFP and the concentrations of cryoprotectants at 0.01 level. Significant correlations between the expression of AcerAFP and the concentrations of cryoprotectants at 0.05 level. Fig. 7. Effects of AcerAFP RNAi in adults. (A) The mRNA levels of AcerAFP are shown in RNAi tests. (B) The expression level of AcerAFP in the honeybees with RNAi treatment on the third day. P  <  0.01 indicate highly significant difference between the different treatments. (C) Result obtained from the DSC scan of the hemolymph was collected from 50 Chinese honeybees after RNA interference. T , the hold temperature; T , the total freezing temperature. (D) The mRNA h tf expression level of HSPs in dsAcerAFP group and dsGFP group. HSC70-3, heat shock 70 kDa protein cognate 3, 107997049; HSC70-4, heat shock 70 kDa protein cognate 4-like, 107996313; HSP10, heat shock protein 10 kDa, 108000341; HSP60, heat shock protein 60 kDa, 108000480; HSP90, heat shock protein 90, 408928; sHSP22.6, small hock protein 22.6 gene, KF150018.1; sHSP24.2a, small heat shock protein 24.2a gene, KF150019.1; HSF2BP, heat shock factor 2-binding protein- like, 107996546; HSF5, heat shock factor protein 5-like, 102674949. (E) The mRNA expression levels of ZFPs in dsAcerAFP group and dsGFP group. ZMPN13, zinc metalloproteinase nas-13-like, 107994936; ZFP25, zinc finger protein 25-like, 107998072; ZIP13, zinc transporter ZIP13 homolog, 410710; ZBED1, zinc finger BED domain-containing protein 1-like, 108004414; ZFP36, zinc finger protein 36, C3H1 type-like 3, 410758; ZIP9, zinc transporter ZIP9, 107995542; ZFP708, zinc finger protein 708-like, 107997300; ZFPR, zinc finger protein rotund-like, 107998742; ZFP431, zinc finger protein 431-like, 108001041; ZFPN, zinc finger protein Noc-like, 108002202; ZKSCN5, zinc finger protein with KRAB and SCAN domains 5-like, 107993647; ZFP582, zinc finger protein 582, 108002579. (F) The mRNA expression levels of serine/threonine-protein kinases in dsAcerAFP group and dsGFP group. CG31145, extracellular serine/threonine protein CG31145, 107998746; STKA2, serine/threonine-protein kinase Aurora-2-like, 108004128; PAKm, serine/threonine-protein kinase PAK mbt, 108003675; MKNK1, MAP kinase-interacting serine/ threonine-protein kinase 1-like, 108000369; STYX, serine/threonine/tyrosine-interacting protein-like, 107993674; mig15, serine/threonine-protein kinase mig-15, 108003038; PLK1, serine/threonine-protein kinase PLK1-like, 107999607. **There were significant difference among the expression levels of antifreeze-related protein genes in different treatment groups. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 10, No. 1 9 in western blot analyses, which is possibly a result of the differen- Discussion tial expression levels of the different genes. In addition, we noted Insects have a wide distribution across the various cold climatic differences between the levels of mRNA and protein expression. This zones on earth. Insect AFPs show diversity and variability between could be a result of the delayed effect of protein expression, existing varied species, and can even exhibit significant differences within the mechanisms of post-translational control. same species. Insect AFP cDNAs generally encode a group of small There is a great deal of research showing that small cryoprotect- proteins (7–21 kDa) rich in Cys or Thr residues, which together com- ants and large molecular-weight proteins related to cold tolerance prise nearly 40% of the constituent amino acids. These small AFPs work together to improve the adaptability of insects to cold environ- are also composed of varying numbers of tandem 12–15 residue ments (Doucet et al. 2009). Unlike the cold-related proteins, changes repeats. A  model structure, obtained using X-ray crystallographic in the concentrations of small cryoprotectants can directly reflect analysis, indicated that the insect AFPs fold as a β-helix (Doucet an organism’s ability to resist cold. Research on Drosophila mela- et al. 2009). In the present study, we found that AcerAFP encodes a nogaster shows that the reserves of glycogen, triacylglycerols, and 365-amino acid protein with a molecular weight of ~60 kDa that is proline might be important in coping with cold (Chen and Walker rich in Ala and has some (n = 11) repeats of four residues, AAXA, in 1994). The larvae of the cold-hardy gall fly (Eurosta solidaginis) the constituent amino acid arrangement. The secondary and tertiary exhibit high rates of glycerin, sorbitol, glucose, and trehalose bio- structures of the protein were mainly composed of α-helices. From synthesis (Holden and Storey 1994). Studies on other overwintering the perspective of protein structure, AcerAFP did not resemble other insects have shown that glycoproteins and various amino acids are insect AFPs, and was more similar to the fish type-I AFP. In sculpins also related to the cold-stress response (Huang et  al. 1990, Chen and winter flounders, type-I AFP is rich in Ala, and its structure is et al. 2005). On the basis of the aforementioned findings and com- composed entirely of α-helices (Low et al. 1998; Graether and Sykes ponents of fuel for over-wintering, we propose that the synthesis of 2004). The comparability of the protein sequences of AcerAFP with glucose, glycerin, and various amino acids likely plays a key role in the protein sequences of other hymenopteran insects was 63−96%. improving the adaptability of Chinese honeybees to cold (Chen and These results indicate that the AFPs are highly divergent, likely be- Walker 1993, Rochefort et  al. 2011). This hypothesis was proven cause of the differences in the behaviors of individual species. to be likely in the earlier stages of our study (Suppl Table 3 [online There are several factors that have been shown to affect the only]). Previous studies have shown that AFPs and some cryo- expressions of AFPs, such as environment temperature, humidity, protectants are able to influence each other, and that the combin- and the length of photoperiod (Graham et  al. 2000). Other than ation of cryoprotectants and AFPs also provide a novel approach these external environmental factors, many autoregulatory factors to cold protection (Wen et  al. 2016). In our study, the expression are also crucial in affecting the presence of AFP transcripts (Qin and levels of AcerAFP were related to the concentrations of glucose, Walker 2006). For example, in C.  fumiferana, AFP transcripts are glycerin, glutamic acid, cysteine, histidine, alanine, and methionine, most abundant in the second instar of the overwintering larvae, and which corroborate the findings of Wen et al. (2016). Thus, AcerAFP are localized mainly in the fore and midguts of the larval body (Qin may improve energy metabolism to reduce injuries caused by low et al. 2006). In T. molitor, the presence of AFPs has been correlated temperatures. with the stages of development (Graham et al. 2000). In the present RNA interference biotechnology has already proven its useful- study, the expression levels of AcerAFP mRNA in the newly emerged ness in functional genomic research on insects, and will soon prove adult workers continued to drop until they were 15-d-old adults, to be very promising in medicine to control cancers and viral dis- and then remained relatively stable (from 15- to 30-d-old adults). eases (Huvenne and Smagghe 2010). In early studies on insects, This is likely because the newly emerged honeybee is too weak to most of experiments were conducted by directly injecting dsRNA resist cold stress, where elevated levels of AcerAFP help to increase into the organism (Hossain et  al. 2008). Some studies showed the survival to adulthood. Furthermore, before honeybees become old ability of organisms to autonomously take up dsRNA through food enough to engage in foraging activities (~15 d), cold hardiness is and assimilate it in the gut, thereby enabling efficient insect con- well established, and AcerAFP mRNA expression is maintained at a trol (Baum et al. 2007). In this study, we inhibited AcerAFP mRNA lower level. AcerAFP mRNA was found to be expressed in all body by feeding dsRNA to A. cerana cerana. The results showed that the tissues of honeybees, where particularly higher expression levels effect of dsGFP was less obvious, where there were no off-target were detected in the locomotive organs (legs, thorax, and wings), effects, as there is no GFP target in honeybees (Elias-Neto et  al. possibly because locomotive organs have been shown to be sensitive 2010). In contrast to the CK and dsGFP groups, mRNA and protein to changes in environmental temperatures (Tosi et al. 2016). expression of the AcerAFP in the dsAcerAFP group decreased sub- Many species of insects in colder climates survive low tempera- stantially (77.82 and 43.65%, respectively). These results, similar to tures by increasing AFP levels in their bodies. A study on T. molitor previous findings (Zhang et al. 2014), showed that RNA interference showed that exposing small larvae to 4°C for 4 wk increased AFP by feeding dsRNA was a feasible and effective method in Chinese concentrations in the hemolymph by more than 20-fold (Graham honeybees. In comparing the results of DSC before and after RNAi, et al. 2000). In the present study, as the expression of AcerAFP was we found that the silencing AcerAFP considerably increased the total affected by both decreased temperature and the duration of ex- freezing temperature; however, there was no significant change in posure, it is likely that AFP confers cold-resistance in these insects. the THA of hemolymph in A.  cerana cerana. A  probable cause of The significantly higher expression of AcerAFP at 10°C than at 0°C this unexpected result is that there were undetected changes in the could be the result of metabolic torpor at 0°C. The tendency of level(s) of other antifreeze-related protein(s). More research will be AcerAFP expression to increase at the early stages (0–4 hr) indicates needed to further explore this possibility. Combined with the results that honeybees increase concentrations of AFP and improve their obtained from the DSC scan of the purified AcerAFP, we speculate cold hardiness soon after exposure to low temperatures. The lower that AcerAFP increases cold resistance by lowering the total freezing expression levels of AcerAFP after 4 hr suggest that the accumula- temperature of the hemolymph in these honeybees. tion of AcerAFP might be detrimental to the health of honeybees In addition to small cryoprotectants, cold-related proteins play (Kawahara et al. 2009). There was little difference between observed crucial roles in imparting cold resistance via their own unique Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 10 Journal of Insect Science, 2018, Vol. 10, No. 1 properties and structures (Molle and Kremer 2010, Bahar et  al. Chen, Y. J., X. G. Sun, W. G. Zhang, Z. G. Mu, and G. Z. Guo. 2005. Relation between variation of water,fat,glycerol in vivo of over-wintering Diaphania 2013). HSPs are a super family of chaperone proteins that are rap- pyloalis walker larvae and cold-hardiness. Canye Kexue 31: 111–116. idly biosynthesized in response to various environmental stressors Coelho, J. R. 1991. Heat transfer and body temperature in honey bee through translocation, the folding of newly synthesized proteins, (Hymenoptera: Apidae) drones and workers. Environ. Entomol. 20: and the degradation of unstable and misfolded proteins (Garrido 1627–1635. et al. 2012, Sun et al. 2016). HSFBP primarily modulates HSF acti- Davies, P. L., J. Baardsnes, M. J. Kuiper, and V. K. Walker. 2002. Structure and vation, and also appears to be the most insensitive to temperature function of antifreeze proteins. Philos. Trans. Royal Soc. B 357: 927–935. changes of the HSPs (Fu et al. 2006). The ZFP family is large and Doucet, D., V. K. Walker, and W. Qin. 2009. The bugs that came in from the widely distributed in plants, animals, and microorganisms (Miller cold: molecular adaptations to low temperatures in insects. Cell. Mol. Life et al. 1985). Zinc fingers can bind to DNA, RNA, and DNA-RNA Sci. 66: 1404–1418. hybrids, and are also involved in protein-protein interactions, reg- Elias-Neto, M., M. P. Soares, Z. L. Simoes, K. Hartfelder, and M. M. Bitondi. 2010. Developmental characterization, function and regulation of a ulating the expression of the target genes of transcriptional and Laccase2 encoding gene in the honey bee, Apis mellifera (Hymenoptera, translational processes (Pavletich and Pabo 1991, Neelyet al. 1999, Apinae). Insect Biochem. Mol. Biol. 40: 241–251. Black et al. 2001). STKs are a major protein kinase group that can Fu, S., P. Rogowsky, L. Nover, and M. J. Scanlon. 2006. The maize heat shock phosphorylate the hydroxyl groups of proteins (Arcas et al. 2013). factor-binding protein paralogs EMP2 and HSBP2 interact non-redun- In our study, some HSPs, ZFPs, and STKs were significantly altered dantly with specific heat shock factors. Planta 224: 42–52. in response to the RNA interference of AFP in Chinese honeybees, Garrido, C., C. Paul, R. Seigneuric, and H. H. Kampinga. 2012. The small heat suggesting that the expression of AcerAFP is involved in the expres- shock proteins family: the long forgotten chaperones. Int. J. Biochem. Cell sion and activity of these cold-related genes. Furthermore, there Biol. 44: 1588–1592. may be a link between putative transcription factor binding sites in Graether, S. P., M. J. Kuiper, S. M. Gagne, V. K. Walker, Z. Jia, B. D. Sykes, the 5′-UTR of AcerAFP, similar to the results of genomic structures. and P. L. Davies. 2000. Beta-helix structure and ice-binding properties of a hyperactive antifreeze protein from an insect. Nature 406: 325–328. Graether, S. P., and B. D.  Sykes. 2004. Cold survival in freeze-intolerant Supplementary Data insects: the structure and function of beta-helical antifreeze proteins. Eur. J. Biochem. 271: 3285–3296. Supplementary data are available at Journal of Insect Science online. Graham, L. A., V. K.  Walker, and P. L.  Davies. 2000. Developmental and environmental regulation of antifreeze proteins in the mealworm beetle Acknowledgments Tenebrio molitor. Eur. J. Biochem. 267: 6452–6458. Heinrich, B. 1980. Mechanisms of body-temperature regulation in honeybees, This work was financially supported through earmarked funds from Apis mellifera. II. Regulation of thoracic temperature at high air tempera- the National Nature Science Foundation of China with a grant (number tures. Phys. Lett. A 29: 551–551. 31372386) and the modern agricultural industry technology system of China Holden, C. P., and K. B.  Storey. 1994. 6-Phosphogluconate dehydrogenase with a grant (number CARS-44-SYZ-4).We would like to thank Shuang Yang, from a freeze tolerant insect: Control of the hexose monophosphate shunt the other member of ourlaboratory, for help with the experiments. We would and NADPH production during cryprotectant synthesis. Insect Biochem. also like to thank Editage for English language editing. Mol. Biol. 24: 167–173. Horwath, K., C. M. Easton, G. J. Poggioli Jr, K. Myers, and I. L. Schnorr. 1996. References Cited Tracking the profile of a specific antifreeze protein and its contribution to the thermal hysteresis activity in cold hardy insects. Eur. J. Entomol. 93: 419–433. Arcas, A., I.  Cases, and A. M.  Rojas. 2013. Serine/threonine kinases and Hossain, M., S. Shimizu, M. Matsuki, M. Imamura, S. Sakurai, and M. Iwami. E2-ubiquitin conjugating enzymes in Planctomycetes: unexpected findings. 2008. Expression of 20-hydroxyecdysone-induced genes in the silkworm Antonie van Leeuwenhoek 104: 509–520. brain and their functional analysis in post-embryonic development. Insect Bahar, M. H., D. Hegedus, J. Soroka, C. Coutu, D. Bekkaoui, and L. Dosdall. Biochem. Mol. Biol. 38: 1001–1007. 2013. Survival and hsp70 gene expression in Plutella xylostella and its Huang, G. Y., Y. C. Wang, and Z. P. You. 1990. Study on cold tolerance func- larval parasitoid Diadegma insulare varied between slowly ramping and tions of Agrotis segetum. J. Zhejiang Forest. Coll. 1990;(2):140–146. abrupt extreme temperature regimes. PLoS One 8: e73901. Huvenne, H., and G. Smagghe. 2010. Mechanisms of dsRNA uptake in insects Bale, J. S. 2002. Insects and low temperatures: from molecular biology to dis- and potential of RNAi for pest control: a review. J Insect Physiol. 56: tributions and abundance. Philos. Trans. Royal Soc. B 357: 849–862. 227–235. Bang, J. K., J. H. Lee, R. N. Murugan, S. G. Lee, H. Do, H. Y. Koh, H. E. Shim, Kawahara, H., S. Higa, H. Tatsukawa, and H. Obata. 2009. Cryoprotection H. C.  Kim, and H. J.  Kim. 2013. Antifreeze peptides and glycopeptides, and cryosterilization effects of type I  antifreeze protein on E.  coli cells. and their derivatives: potential uses in biotechnology. Mar. Drugs 11: Biocontrol sci. 14: 49–54. 2013–2041. King, A. M., and T. H. MacRae. 2015. Insect heat shock proteins during stress Baum, J. A., T.  Bogaert, W.  Clinton, G. R.  Heck, P.  Feldmann, O.  Ilagan, and diapause. Annu. Rev. Entomol. 60: 59–75. S.  Johnson, G.  Plaetinck, T.  Munyikwa, M.  Pleau, T.  Vaughn, and Li, N., B. A.  Chibber, F. J.  Castellino, and J. G.  Duman. 1998. Mapping of J. Roberts. 2007. Control of coleopteran insect pests through RNA inter- disulfide bridges in antifreeze proteins from overwintering larvae of the ference. Nat. Biotechnol. 25: 1322–1326. beetle Dendroides canadensis. Biochemistry 37: 6343–6350. Bendtsen, J. D., L. J. Jensen, N. Blom, G. Von Heijne, and S. Brunak. 2004. Liou, Y. C., P. Thibault, V. K. Walker, P. L. Davies, and L. A. Graham. 1999. Feature-based prediction of non-classical and leaderless protein secretion. A complex family of highly heterogeneous and internally repetitive hyper- Protein Eng. Des. Sel. 17: 349–356. active antifreeze proteins from the beetle Tenebrio molitor. Biochemistry Black, A. R., J. D. Black, and J. Azizkhan-Clifford. 2001. Sp1 and kruppel-like 38: 11415–11424. factor family of transcription factors in cell growth regulation and cancer. Liou, Y. C., A. Tocilj, P. L. Davies, and Z. Jia. 2000. Mimicry of ice structure J. Cell. Physiol. 188: 143–160. by surface hydroxyls and water of a beta-helix antifreeze protein. Nature Chen, C. P., and V. K. Walker. 1993. Increase in cold-shock tolerance by selec- 406: 322–324. tion of cold resistant lines in Drosophila melanogaster. Ecol. Entomol. Livak, K. J., and T. D.  Schmittgen. 2001. Analysis of relative gene expres- 18: 184–190. sion data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Chen, C.-P., and V. K.  Walker. 1994. Cold-shock and chilling tolerance in method. Methods 25: 402–408. Drosophila. J. Insect Physiol. 40: 661–669. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 10, No. 1 11 Low, W. K., M.  Miao, K. V.  Ewart, D. S.  Yang, G. L.  Fletcher, and C. Tosi, S., F. J. Demares, S. W. Nicolson, P. Medrzycki, C. W. Pirk, and H. Human. L.  Hew. 1998. Skin-type antifreeze protein from the shorthorn sculpin, 2016. Effects of a neonicotinoid pesticide on thermoregulation of African Myoxocephalus scorpius. Expression and characterization of a Mr 9, 700 honey bees (Apis mellifera scutellata). J. Insect Physiol. 93–94: 56–63. recombinant protein. J Biol. Chem. 273: 23098–23103. Venketesh, S., and C. Dayananda. 2008. Properties, potentials, and prospects Miller, J., A. D.  McLachlan, and A.  Klug. 1985. Repetitive zinc-binding of antifreeze proteins. Crit. Rev. Biotechnol. 28: 57–82. domains in the protein transcription factor IIIA from Xenopus oocytes. Wen, X., S.  Wang, J. G.  Duman, J. F.  Arifin, V.  Juwita, W. A.  Goddard III, EMBO J 4: 1609–1614. A. Rios, F. Liu, S. K. Kim, R. Abrol, et al. 2016. Antifreeze proteins govern Molle, V., and L. Kremer. 2010. Division and cell envelope regulation by Ser/ the precipitation of trehalose in a freezing-avoiding insect at low tempera- Thr phosphorylation: Mycobacterium shows the way. Mol. Microbiol. 75: ture. Proc. Natl. Acad. Sci. USA 113: 6683–6688. 1064–1077. Winston, M. L. 1992. The honey bee colony: life history, pp. 73–101. In The Neely, L. S., B. M.  Lee, J.  Xu, P. E.  Wright, and J. M.  Gottesfeld. 1999. Hive and the Honey Bee (Sixth Printing 2003), Ch. 3. Dadant and Sons, Identification of a minimal domain of 5 S ribosomal RNA sufficient for Inc., Hamilton, IL. high affinity interactions with the RNA-specific zinc fingers of transcrip- Xu, K., Q. Niu, H. Zhao, Y. Du, and Y. Jiang. 2017. Transcriptomic analysis tion factor IIIA. J. Mol. Biol. 291: 549–560. to uncover genes affecting cold resistance in the Chinese honey bee (Apis Pavletich, N. P., and C. O. Pabo. 1991. Zinc finger-DNA recognition: crystal cerana cerana). PLoS One 12: e0179922. structure of a Zif268-DNA complex at 2.1 A. Science 252: 809–817. Yu, S. H., P. Yang, T. Sun, Q. Qi, X. Q. Wang, X. M. Chen, Y. Feng, and B. Qin, W., M. G. Tyshenko, D. Doucet, and V. K. Walker. 2006. Characterization W. Liu. 2016. Transcriptomic and proteomic analyses on the supercooling of antifreeze protein gene expression in summer spruce budworm larvae. ability and mining of antifreeze proteins of the Chinese white wax scale Insect Biochem. Mol. Biol. 36: 210–218. insect. Insect Sci. 23: 430–437. Qin, W., and V. K.  Walker. 2006. Tenebrio molitor antifreeze protein gene Zhao, H., W.  Zhao, P.  Gao, G.  Zhang, and Y.  Jiang. 2014. Sequence and identification and regulation. Gene 367: 142–149. expression characterization of an OBP1 gene in the Asian honeybee, Rochefort, S., R.  Berthiaume, C.  Hebert, M.  Charest, and E.  Bauce. 2011. Apis cerana cerana (Hymenoptera: Apidae). Appl. Entomol. Zool. 49: Effect of temperature and host tree on cold hardiness of hemlock looper 189–196. eggs along a latitudinal gradient. J. Insect Physiol. 57: 751–759. Zhao, Y., P.  Gao, W.  Li, Y.  Zhang, K.  Xu, X.  Guo, B.  Li, and G.  Cao. Sun, Y., J. Zhao, Y. Sheng, Y. F. Xiao, Y. J. Zhang, L. X. Bai, Y. Tan, L. B. Xiao, 2015. Study on the developmental expression of Lbx1 gene in and G. C. Xu. 2016. Identification of heat shock cognate protein 70 gene Longissimus Dorsi of mashen and large white pigs. Ital. J. Anim. Sci. (Alhsc70) of Apolygus lucorum and its expression in response to different 14: 2081–2087. temperature and pesticide stresses. Insect Sci. 23: 37–49. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/1/11/4842115 by Ed 'DeepDyve' Gillespie user on 16 March 2018

Journal

Journal of Insect ScienceOxford University Press

Published: Jan 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off