Screening of 2A peptides for polycistronic gene expression in yeast

Screening of 2A peptides for polycistronic gene expression in yeast Abstract A complexity of pathway expression in yeast compared to prokaryotes is the need for separate promoters and terminators for each gene expressed. Single transcript expression and separated protein production is possible via the use of 2A viral peptides, but detailed characterization to assess their suitability and applications is needed. The present work aimed to characterize multiple 2A peptide sequences to determine suitability for metabolic engineering applications in Saccharomyces cerevisiae. We screened 22 peptides placed between fluorescent protein sequences. Cleaving efficiency was calculated by western blot intensity of bands corresponding to the cleaved and uncleaved forms of the reporter. Three out of the 22 sequences showed high cleavage efficiency: 2A peptide from Equine rhinitis B virus (91%), Porcine teschovirus-1 (85%) and Operophtera brumata cypovirus-18 (83%). Furthermore, expression of the released protein was comparable to its monocistronic expression. As a proof-of-concept, the triterpene friedelin was successfully produced in the same yeast strain by expressing its synthase with the truncated form of HMG1 linked by the 2A peptide of ERBV-1, with production titers comparable to monocistronic expression (via separate promoters). These results suggest that these peptides could be suitable for expression and translation of multiple proteins in metabolic engineering applications in S. cerevisiae. Saccharomyces cerevisiae, ERBV-1 2A peptide, yeast metabolic engineering, ‘self-cleavage’, ‘stop-carry on’, multi-gene expression, ‘polycistronic’ INTRODUCTION The production of fine chemicals, therapeutic natural products or biofuels in microbial cell factories has promising industrial applications (Borodina and Nielsen 2014; Krivoruchko and Nielsen 2014; Breitling and Takano 2015). The yeast Saccharomyces cerevisiae is the most common eukaryotic cell factory (Krivoruchko and Nielsen 2014). Its advantages include good tolerance to low pH and fermentation inhibitors, robust industrial performance, reduced susceptibility to phage contaminations, genetic tractability and ability to express functional enzymes with post-translational modifications or membrane anchoring (Borodina and Nielsen 2014; Krivoruchko and Nielsen 2014). Saccharomyces cerevisiae is currently the chosen cell factory for production of biofuels such as Farnesene (commercialized by Amyris) and isobutanol (Gevo and Butamax), biopolymers building blocks such as lactic acid (Cargill) and succinic acid (Bioamber and Corbion), as well as higher value molecules such as plant natural products artemisinic acid (Amyris), resveratrol (Evolva) and nootkatone (Evolva). The production of many industrially interesting compounds in a heterologous host such as S. cerevisiae demands the insertion of whole or partial biosynthetic pathways (Mikkelsen et al.2012; Ongley et al.2013; Krivoruchko and Nielsen 2014). Recent years have seen a rise in the availability of synthetic biology tools aimed at expediting yeast metabolic engineering (Fletcher, Krivoruchko and Nielsen 2016). This includes characterization of new parts such as promoters (Redden and Alper 2015; Rajkumar et al.2016) and terminators (Curran et al.2015), new episomal and integrative expression systems (Mikkelsen et al.2012; Jensen et al.2014) and the emergence of CRISPR/Cas9 for rapid strain modification (Jakočiūnas et al.2015). Still, one disadvantage of engineering yeast compared to prokaryotic systems is the absence of a polycistronic gene expression system. As a result, a separate promoter and terminator are required for each gene, resulting in larger constructs. Furthermore, due to the efficient homologous recombination system of S. cerevisiae, dual-usage of the same promoter and terminator can result in gene loss, while using different promoters/terminators can result in differential expression of pathway genes. This can be especially problematic when assembling complex pathways consisting of many different genes. In the present paper, we aimed to overcome these disadvantages by creating and characterizing a polycistronic-like expression system in yeast using 2A peptides. In addition to significantly reducing construct size, such a system would allow for stoichiometric expression of the different proteins since only one promoter and terminator are used and no cis-acting element is needed for the expression (Ahier and Jarriault 2014; Daniels et al.2014; Liu et al.2017). Furthermore, the small size of 2A peptides allows for easy amplification together with the gene of interest, reducing the number of cloning parts of one cassette and significantly reducing pathway construction time. A high separation efficiency is crucial to effectively use 2A peptides for metabolic engineering applications. Cleavage functionalities of various 2A peptides have been characterized since the 90s (Ryan, King and Thomas 1991; Ryan and Drew 1994; Ryan et al.1999). The so-called mechanism of ‘self-cleavage’ promoted by 2A peptides actually involves ribosomal stalling and peptide bond skipping recoding protein translation in a ‘stop-carry on’ or ‘StopGo’ way (Donnelly et al.2001; Atkins et al.2007). That is possible because of the characteristic C-terminal DXEXNPGP motif (Donnelly et al., 2001; Sharma et al.2012). The ribosome pauses after glycine transfer to the nascent peptide chain and translocation of the glycine and proline codon to P and A sites, respectively. In the predicted model, peptide bond to the prolyl-tRNAPro is hampered by the 2A shifted conformation in the ribosomal exit tunnel and due to the following poor nucleophile proline (Doronina et al.2008; Sharma et al.2012). The situation is solved by releasing the upstream protein linked to the 2A peptide and translation of downstream protein continues with proline as the first residue (Donnelly et al.2001; Atkins et al.2007; Doronina et al.2008). Although the separation of the proteins occurs by a ribosomal recoding, terms such as ‘cleavage’ or ‘self-cleavage’ are still frequently applied to 2A peptides (Liu et al.2017). The cleavage efficiency of 2A peptides with different reporter proteins in the ribosome of in vitro or different in vivo system has been extensively studied (Halpin et al.1999; Provost, Rhee and Leach 2007; Doronina et al.2008; Luke et al.2008; Kim et al.2011; Gao, Jack and O’Neill 2012; Sharma et al.2012; Odon et al.2013; Daniels et al.2014; Geier et al.2015; Roulston et al.2016). 2A peptides have been used for the production of monoclonal antibodies (Fang et al.2005; Chng et al.2015), gene therapy (Szymczak et al.2004) and production of β-carotene in plants (Ha et al.2010). This system has also been shown to work for metabolic engineering applications in yeast (Beekwilder et al.2014; Geier et al.2015). However, it was not extensively characterized in these studies, with limited studies of the cleavage efficiencies of the peptides used or expression and functionality of the resulting proteins compared to monocistronic expression. The aim of the present work was to further characterize the 2A system for metabolic engineering applications in the yeast S. cerevisiae. Since cleavage efficiency tends to differ between different organisms, and because high cleavage efficiency is a key to getting similar expression levels from all proteins in the construct, we evaluated twenty two 2A peptides using two fluorescent proteins. Out of those evaluated, three 2A peptides showed acceptable ‘cleavage’ efficiencies in yeast and potential to be used in the construction of pathways to be inserted/modified in S. cerevisiae. MATERIAL AND METHODS Strains, media and growth conditions Molecular biology procedures and cultivations followed standard literature (Sambrook and Russell 2001). For cloning purpose, we used Escherichia coli DH5α strain (fhuA2Δ (argF-lacZ) U169 phoA glnV44 Φ80Δ (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17) cultivated in Luria-Bertani medium supplemented with ampicillin 100 μg/mL, at 37°C. Saccharomyces cerevisiae strain CEN.PK113-5D (MATaMAL2-8c SUC2 ura3-52; kindly provided by P. Kötter, University of Frankfurt, Germany) was used for in vivo expression and translation system. Yeast pre-inocula were maintained in YPD (1% yeast extract, 2% peptone, 2% dextrose) medium and transformants were selected on synthetic dextrose (SD; 0.67% yeast nitrogen base, 2% dextrose) medium without uracil, at 30°C after lithium acetate/single-stranded DNA heat shock transformation. Experimental cultivations were conducted in the same SD-uracil medium, at 30°C for overnight. Plasmid constructions Plasmids were constructed based on p416 (Mumberg, Müller and Funk 1995), a centromeric plasmid carrying the green fluorescent protein (GFP) under control of TEF1 promoter; CYC1 as terminator and URA3 as selection marker gene. To construct the GFP control plasmid, tCYC1 was exchanged for tADH1 using overlapping primers P13_fwd and P14_rev to amplify tADH1 fragment whereas [p416-PTEF1-GFP] (David, Nielsen and Siewers 2016) was amplified using primers P11_fwd and P12_rev with overlap to GFP and the vector as recommended by Gibson protocol (Gibson et al.2009). Primers used in this work are listed in Table 1 and Table S1, Supporting Information. Vector and fragments were amplified by PrimeSTAR® HS DNA polymerase (Takara Bio Inc, Saint-Germain-en-Laye, France) according to the manufacturer recommendations. Amplicons were purified and combined in a 3:1 insert:vector ratio together to Gibson Assembly® Master mix (New England Biolabs, Ipswich, MA, USA). Red fluorescent protein (RFP) control plasmid was constructed in the same way using primers (P11_fwd and P15_rev) to amplify vector and PTEF1. The fragment RFP-tADH1 was amplified from plasmid template p0394 with overlapping primers (P16_fwd and P14_rev). Table 1. General primers utilized in this work. Primer identification Primer sequence 5'–3' Note P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplification with overlap to p416 (in bold) P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA P11_fwd GGCCGGTACCCAATTCGCCCTATAG p416 amplification without tCYC1 P12_rev CTATTTGTATAGTTCATCCATGCCA P15_rev TTTGTAATTAAAACTTAGATTAGAT Anneals to PTEF1 P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA RFP amplification with overlap to p416 (in bold) P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward used with reverse primers in Table S1. Anneals to p416. Overlaps to tADH1 (in bold) P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverse used with forward primers in Table S1. Anneals to the end of tADH1 Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Used for sequencing and colony PCR with P4_rev Primer identification Primer sequence 5'–3' Note P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplification with overlap to p416 (in bold) P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA P11_fwd GGCCGGTACCCAATTCGCCCTATAG p416 amplification without tCYC1 P12_rev CTATTTGTATAGTTCATCCATGCCA P15_rev TTTGTAATTAAAACTTAGATTAGAT Anneals to PTEF1 P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA RFP amplification with overlap to p416 (in bold) P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward used with reverse primers in Table S1. Anneals to p416. Overlaps to tADH1 (in bold) P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverse used with forward primers in Table S1. Anneals to the end of tADH1 Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Used for sequencing and colony PCR with P4_rev View Large Table 1. General primers utilized in this work. Primer identification Primer sequence 5'–3' Note P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplification with overlap to p416 (in bold) P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA P11_fwd GGCCGGTACCCAATTCGCCCTATAG p416 amplification without tCYC1 P12_rev CTATTTGTATAGTTCATCCATGCCA P15_rev TTTGTAATTAAAACTTAGATTAGAT Anneals to PTEF1 P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA RFP amplification with overlap to p416 (in bold) P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward used with reverse primers in Table S1. Anneals to p416. Overlaps to tADH1 (in bold) P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverse used with forward primers in Table S1. Anneals to the end of tADH1 Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Used for sequencing and colony PCR with P4_rev Primer identification Primer sequence 5'–3' Note P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplification with overlap to p416 (in bold) P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA P11_fwd GGCCGGTACCCAATTCGCCCTATAG p416 amplification without tCYC1 P12_rev CTATTTGTATAGTTCATCCATGCCA P15_rev TTTGTAATTAAAACTTAGATTAGAT Anneals to PTEF1 P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA RFP amplification with overlap to p416 (in bold) P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward used with reverse primers in Table S1. Anneals to p416. Overlaps to tADH1 (in bold) P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverse used with forward primers in Table S1. Anneals to the end of tADH1 Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Used for sequencing and colony PCR with P4_rev View Large All the 2A sequences were constructed between GFP and RFP by adding about 45–50 nucleotides into the reverse primer (Table S1, Supporting Information) for GFP-vector amplification pairing with primer forward P1_fwd (Table 1). Primers overlapping and complementing 2A sequence by 45–50 nucleotides were designed into the forward primer (Table S1, Supporting Information) for RFP-tADH1 amplification using reverse primer P4_rev (Table 1). Nucleotides coding the 2A sequences were codon optimized for yeast translation. After 30 min the assembly mixture was transformed into E. coli and correct assembly was verified by colony PCR using DreamTaq (Thermo Scientific) according to the manufacturer protocol using primers Fwd_GFP_5seq and P4_rev. DNA sequencing was performed with primer Fwd_GFP_5seq. Reporters were transformed into CEN.PK113-5D and selected in SD–uracil medium. Mutation of ERBV-1 2A site The site-directed mutagenesis was conducted using [p416-PTEF1-GFP-ERBV2A-RFP] plasmid as a template and single primer amplification method (Edelheit, Hanukoglu and Hanukoglu 2009). Primers used to promote the substitution of Pro20 to Ala were AlaF (forward): 5'-GAATTGAATCCAGGTgctATGGCC-TCCTCCGAG-3' and AlaR (reverse): 5'-CTCGGAGGAGGC-CATagcACCTGGATTCAATTC-3', where lowercase indicates the amino acid substitution. Amplifications were performed with Phusion High Fidelity DNA polymerase (2000 U/mL; New England Biolabs). The single-stranded amplification products were mixed and annealed by gradually decreasing the temperature 10°C/min from 98°C to 37°C. Resulting double-strands were treated with DpnI (20 U/μL; New England Biolabs) and transformed into E. coli. DNA sequencing was performed with primer Fwd_GFP_5seq to confirm the presence of the desired mutation. Mutant 2A peptide reporter was transformed into CEN.PK113-5D and selected in SD–uracil medium. Fluorescence microscopy Yeast strains expressing the reporters were pre-cultured overnight and then diluted to an optical density at 600 nm (OD600nm) of 0.1 in 20 mL of SD–uracil medium. Strains were cultivated at 30°C and samples were taken from mid-exponential phase (OD600nm 0.5–0.8) and washed once with phosphate buffered saline (PBS). GFP fluorescence was detected with a 525/30 filter and RFP, with 690/50 filter using a Leica AF 6000 inverted fluorescence microscope (Wetzlar, Germany) with a 100× objective. Images were processed with the Leica Application Suite software. Western blotting Protein extracts were prepared as described previously (Chen and Petranovic, 2015). Quantification was performed using RC DC Protein Assay (Bio Rad, Hercules, USA) against a bovine serum albumin (Sigma-Aldrich) calibration curve. A 4%–12% Bis-Tris gel (Invitrogen) was used to separate 50 μg of protein of each sample for about 2 h at 90 V in running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS, pH 8.3; Bio Rad). Transfer of proteins to Polyvinylidene difluoride (PVDF) membrane (Bio Rad) was performed in a semi-dry transfer system (Bio Rad) using a transfer buffer containing 50 mM Tris, 38 mM glycine, 20% v/v methanol for 1 h at 25 V. Membranes were blocked with blocking buffer (Sigma-Aldrich) for 1 h and then incubated with the primary monoclonal antibody anti-RFP (Life Technologies, Eugene, OR, USA) or anti-GFP (Roche Life Science) for overnight at 4°C. After, membranes were washed 4 times with PBS-0.05% Tween 20, probed with secondary anti-rabbit antibody for 1 h and again washed previous to the detection by luminescence with ECL Prime reagent (GE Healthcare) and ChemiDoc XRS image analyzer (Bio Rad). The band intensities on the membranes were determined using ImageJ software. ‘Cleavage’ efficiency was calculated as follows: cleavage efficiency = 100 × (cleaved RFP form)/(cleaved RFP form + uncleaved form). Evaluation friedelin production using the 2A system Friedelin synthase coding sequence from Maytenus ilicifolia (MiFRS, GenBank accession number KX147270) (Souza-Moreira et al.2016) was synthesized by GenScript with codon optimization for expression in S. cerevisiae. MiFRS sequence was subcloned into the yeast expression pSP-GM1 (Partow et al.2010) under control of the TEF1 promoter using restriction enzymes SacI and SpeI (FastDigest, Thermo Fisher Scientific). The truncated form of HMG1 gene was cloned into the [pSP-PTEF1-MiFRS] plasmid between BamHI and SalI (FastDigest, Thermo Fisher Scientific) restriction sites under PGK1 promoter control. The plasmid [pSP-PTEF1-MiFRS, PPGK1-tHMG1] was used as control of friedelin production level in CEN.PK113-5D strain. To demonstrate the functionality of the 2A peptide for metabolic engineering applications, the friedelin biosynthetic pathway was expressed in yeast using the bicistronic construct [pSP-PPGK1-MiFRS-2A-tHMG1]. To construct the plasmid, fragments of each module (i.e. homologous recombination module for up and down parts of the plasmid, promoter, MiFRS, tHMG1 and ADH1 terminator) were PCR amplified with overlapping primers (described in Table S2, Supporting Information) using PrimeSTAR® HS DNA polymerase. After gel purification, modules were PCR assembled into one fragment (Zhou et al.2012). pSP-GM1 backbone was PCR amplified and gel-purified. Equal molar of assembled modular fragment and pSP-GM1 backbone were chemically transformed into CEN.PK113-5D. Colony PCR was used to screen the presence of assembled plasmid. Plasmids were then recovered from cell lysates, transformed into E. coli and again recovered for sequencing verification of the construct. Quantification of heterologous friedelin production CEN.PK113-5D transformed with empty pSP-GM1, [pSP-PTEF1-MiFRS, PPGK1-tHMG1] or [pSP-PPGK1-MiFRS-2A-tHMG1] were pre-grown in SD-uracil medium. For heterologous friedelin production, cells were diluted to a starting OD600nm of 0.05 in minimal medium (Scalcinati et al.2012) and cultivated for 72 h at 30°C with shaking. Then, cells were collected, dried and about 30 mg of dried cell weight were extracted with chloroform:methanol (2:1, v/v; Khoomrung et al.2013) in an ultrasonic bath (2840D, Odontobrás, Ribeirão Preto, SP, Brazil) for 10 min. The organic phase was collected after addition of 0.73% NaCl and centrifugation. The extract was dried and resuspended in 200 μL acetonitrile to be analyzed by gas chromatography associated to mass spectrometry (QP2020C W/O RP230V, Shimadzu, Kioto, Japan) using a HP-5 column (30 m × 0.25 mm × 0.25 μm; Agilent Technologies, Santa Clara, California, USA). Analysis was performed with inlet temperature of 270°C, heating gradient from 200°C to 290°C (10°C/min), trap temperature of 200°C, interface temperature of 290°C for 18 min, injection volume of 1 μL, split ratio of 1:10, flow gas of 1.0 mL/min, ionization of 70 eV and detection interval of 35–600 m/z. Cholesterol was spiked in as internal standard control at 40 μg/mL before friedelin extraction process. An analytical curve of friedelin standard (Sigma-Aldrich, St. Louis, Missouri, USA) was constructed. The peak of friedelin was observed at retention time of 23.08 min and identity was confirmed by mass spectral detection compared to National Institute of Standards and Technology (NIST) library and standard. Quantification analysis was done in triplicate and statistical significance was analyzed by the Student's t-test (p-value < 0.05). RESULTS AND DISCUSSION Reporter structure Avoiding the use of a separate promoter and terminator for each single gene expressed in yeast cells can make metabolic engineering easier and faster in cases where multiple pathway steps must be expressed. Enabling two, three or more genes to be expressed in one single mRNA molecule would result in stoichiometric co-translation of separate proteins without the need for proteinase cleavage (Ryan et al.1999; Donnelly et al.2001; Lorens et al.2004; Torres et al.2010). As the cleavage efficiency of 2A peptides can vary greatly between different organisms and peptides, we selected 22 different 2A self-cleavage peptides in which the ‘self-cleavage’ had been described previously. When designing the reporters, we used the consensus sequence NPG-P for ‘self-cleavage’ (Donnelly et al.2001) and the flexible linker Gly-Ser-Gly (Holst et al.2006; Gao, Jack and O’Neill 2012). In addition, the size of the peptides was kept at 18–22 residues since these showed to be the smaller lengths that could still have considerable cleavage efficiency (Donnelly et al.2001; Minskaia and Ryan 2013), which makes easier their design within primers. We designed primers with about 48 nucleotides of the peptide sequences in the 5' and 30 nucleotides in 3' annealing to the tested proteins, as shown in Table S1, Supporting Information. One of the possible strategies to assemble all the fragments is to use the Gibson assembling kit, so the overlap between both primers carrying the 2A partial sequences should have a melting temperature ≥48°C. This assembling strategy enables a single-step construction of pathways consisting of multiple proteins. Screening of the best 2A self-cleavage efficiency in Saccharomyces cerevisiae After its discovery and ‘cleavage’ mechanism elucidation, 2A peptides were widely used in biotechnology (Minskaia, Nicholson and Ryan 2013; Minskaia and Luke 2015; Roulston et al.2016). They were employed for polycistronic expression in different cells, for instance in filamentous fungi (Unkles et al.2014), protozoan (Tang et al.2016), worm (Ahier and Jarriault 2014), insect (Daniels et al.2014; Wang et al.2015), plant (Farré et al.2014), zebrafish (Provost, Rhee and Leach 2007; Kim et al.2011) and mammalian (Szymczak et al.2004; Kim et al.2011; Chng et al.2015; Liu et al.2017) cells. However, use in yeast for biotechnological purposes has been limited, and experiments to date have only used two or three of the most known sequences in yeasts Saccharomyces cerevisiae (Sharma et al.2012; Beekwilder et al.2014) and Pichia pastoris (Amorim Araújo et al.2015; Geier et al.2015). However, the 2A ‘cleavage’ efficiency was not carefully determined. To the best of our knowledge, this is the first screening performed among a variety of 2A peptides to determine the sequence with the highest ‘self-cleavage’ efficiency in S. cerevisiae. Our constructs contained GFP in the first position and RFP in the second position. ‘Cleavage’ efficiency determination was based on western blots luminescence values relative to RFP bands, following previously reported methodology (Liu et al.2017), since the presence of the cleaved form of the second protein is a clear evidence of the multi-protein separation from a single transcript. The products quantified were the cleaved form of RFP (the sequence starting with the last proline of the 2A peptide) and uncleaved form of GFP-2A-RFP reporter (Fig. 1A), with calculated molecular weight of 25 and 50 kDa, respectively. The production of GFP linked to the 2A sequence was also confirmed as a band of about 25 kDa by western blot. The ‘self-cleavage’ efficiency of each of the 22 sequences of 2A peptides tested in S. cerevisiae was determined as percentage of the ratio between the intensity of the luminescent band of RFP cleaved form (∼25 kDa) correlated to the uncleaved form of the reporters (∼50 kDa; Fig. 1B). Therefore, the percentage of cleavage efficiency was correlated with the level of the two single fluorescent proteins from just one mRNA. Figure 1. View largeDownload slide Analysis of 2A peptide ‘cleavage’ efficiency. (A) Structure of the plasmid reporters showing ‘cleavage’ site in the 2A sequence. (B) ‘Cleavage’ efficiency, as percentage for the 22 different 2A peptides tested. Data shown represent the intensity average values ± standard deviation of western blotting of three independent biological replicates. Figure 1. View largeDownload slide Analysis of 2A peptide ‘cleavage’ efficiency. (A) Structure of the plasmid reporters showing ‘cleavage’ site in the 2A sequence. (B) ‘Cleavage’ efficiency, as percentage for the 22 different 2A peptides tested. Data shown represent the intensity average values ± standard deviation of western blotting of three independent biological replicates. All the 2A peptide sequences evaluated showed some level of cleavage, ranging from ∼33% to 91% efficiency. From all the 22 peptides, three exhibited efficiencies higher than 80% and six showed about 50% (Fig. 1B). The best performance was achieved using the Equine rhinitis B virus (ERBV-1) in which the uncleaved form GFP-2A-RFP (of 50 kDa) represented less than 10%, followed by the Porcine teschovirus-1 (PTV) (also known as P2A) and Operophtera brumata cypovirus-18 (OpbuCPV18) peptides (Fig. 2A). On the other hand, commonly used sequences such as TaV (or T2A from Thosea asigna virus), ERAV (or E2A from Equine rhinitis A virus) or FMDV (or F2A from Foot-and-mouth disease virus) showed self-cleavage efficiency in CEN.PK113-5D of 56%, 46% and 43%, respectively (Fig. 1B). Furthermore, the level of expression of the RFP cleaved form from the polycistronic construct with the best 2A peptides was comparable with the expression of RFP in the monocistronic construct under control of the same promoter, in the same S. cerevisiae strain under same culture conditions (Fig. 2B), indicating that the use of 2A peptide can lead to the production of more than one protein from one mRNA and result in comparable levels of protein produced as the protein levels from the monocistronic translation. To ensure the 2A peptide of ERBV-1 was responsible for the high efficiency in producing the cleaved proteins, we substituted the last proline in the NPGP site for an alanine residue (ERBV-1Pro20Ala). The loss of ‘self-cleavage’ efficiency by an alanine substitution in that specific position was already reported (Sharma et al.2012) and, as expected, the site-direct mutant decreased the production of the cleaved protein form and accumulated the uncleaved form (Fig. 2A), resulting in 57% of efficiency and RFP detection was half of RFP control (Fig. 2B). Figure 2. View largeDownload slide Western blot of RFP from bicistronic expression and its detected level compared to the monocistronic control. (A) Western blot representing bands of RFP from control plasmid expression and reporters with the most active 2A peptides in S. cerevisiae (ERBV-1, PTV and OpbuCPV18) and reporter mutated ERBV-1Pro20Ala. The presence of byproducts increases as the cleavage efficiency decreases. (B) Fold change of intensity of RFP level detected from expression of the most active 2A peptides and mutated ERBV-1Pro20Ala (average values ± standard deviation), compared to the intensity of RFP level detected from expression of the control plasmid (fold change = 1), showing no significant difference in the expression among the different constructs. (C) Representative western blot of the ‘flipped’ reporter, with RFP in first position and GFP after the 2A peptide sequence of ERBV-1. Bands of RFP and GFP in the reporter have similar intensity than control bands and almost none uncleaved band present. Figure 2. View largeDownload slide Western blot of RFP from bicistronic expression and its detected level compared to the monocistronic control. (A) Western blot representing bands of RFP from control plasmid expression and reporters with the most active 2A peptides in S. cerevisiae (ERBV-1, PTV and OpbuCPV18) and reporter mutated ERBV-1Pro20Ala. The presence of byproducts increases as the cleavage efficiency decreases. (B) Fold change of intensity of RFP level detected from expression of the most active 2A peptides and mutated ERBV-1Pro20Ala (average values ± standard deviation), compared to the intensity of RFP level detected from expression of the control plasmid (fold change = 1), showing no significant difference in the expression among the different constructs. (C) Representative western blot of the ‘flipped’ reporter, with RFP in first position and GFP after the 2A peptide sequence of ERBV-1. Bands of RFP and GFP in the reporter have similar intensity than control bands and almost none uncleaved band present. GFP and RFP did not lose functionality due to the amino acids of the 2A peptide from ERBV-1 in the C-teminus of GFP nor to the proline starting sequence of RFP and that can be seen by their fluorescence detected by microscopy with the cells (Fig. S1, Supporting Information). Besides, it is possible to observe a general reduction mainly in the fluorescence of RFP from the cells containing the mutant ERBV-1Pro20Ala reporter as result of the increased level of uncleaved form of the proteins. GFP in the mutated reporter showed higher fluorescence intensity compared to RFP, indicating that functionality is impaired to the protein downstream 2A peptide when cleavage does not occur (Liu et al.2017). The cleavage efficiency of ERBV-1 was previously tested in vitro using reticulocyte lysate (Luke et al.2008). The sequence had 30 amino acids and exhibited 99% cleavage as other sequences from the Picornaviridae family, such as FMDV and ERAV. Interestingly, among the 22 sequences tested herein, ERBV-1 was the only one to have a leucine residue in position 16, whereas the conserved residue at this position is a serine or other amino acids with polar side chain such as threonine, glutamate or glutamine (Fig. 3). In previous studies (Donnelly et al.2001; Sharma et al.2012), changing the serine at this position to other amino acids reduced drastically the cleavage activity of FMDV sequence to about 40%. However, in S. cerevisiae the variation to the apolar leucine residue in the consensus motif GDVELNPGP (Sharma et al.2012) did not mean loss of efficiency. Figure 3. View largeDownload slide Alignment among 2A peptides used in this work showing conserved residues. There is a high conservation in the motif DXEXNPGP important for ‘cleavage’ efficiency (shown as dark shaded). Figure 3. View largeDownload slide Alignment among 2A peptides used in this work showing conserved residues. There is a high conservation in the motif DXEXNPGP important for ‘cleavage’ efficiency (shown as dark shaded). PTV ‘cleavage’ efficiency was measured in different cellular systems (as shown in Table S3, Supporting Information) and it was employed in some bicistronic constructions assayed in different model cells, such as the yeasts S. cerevisiae (Beekwilder et al.2014) and P. pastoris (Geier et al., 2015), the protozoan Eimeria tenella (Tang et al.2016), the worm Caenorhabditis elegans (Ahier and Jarriault 2014) and human T-cell lines (Yang et al.2008). Remarkably, when PTV sequence was assayed in S. cerevisiae CEN.PK2-1C no cleavage was observed from GFP-P2A and LEU2-HA bicistronic cassettes (Beekwilder et al.2014). However, in the same study, the employment of TaV in the reporter construct did lead to the translation of both cleaved proteins with a slight uncleaved form present (no other 2A peptide was assayed). In our study, PTV showed 85% cleavage efficiency while TaV with 18 or 20 amino acids showed less than 50%, which could be related to some former observations that the upstream context is sometimes important to the ‘cleavage’ efficiency (Donnelly et al.1997). Together with the higher efficiency shown by PTV when employed in other cell systems, it is noteworthy to analyze the more suitable 2A sequence to be used according to the cell system and protein context (Donnelly et al.2001; Kim et al.2011; Kuzmich et al.2013; Minskaia, Nicholson and Ryan 2013). Keeping this in mind, we constructed a reporter with the most efficient 2A sequence from ERBV-1 locating RFP in front of GFP (RFP-ERBV2A-GFP). The ‘cleavage’ efficiency observed was still higher than 90% (Fig. 2C) corroborating with the use of ERBV-1 2A sequence for co-expression and co-translation of different proteins in S. cerevisiae independently, in the present context, of protein position (Rothwell et al.2010). OpbuCPV-18 is an insect cypovirus and its 2A peptide showed 99% of ‘cleavage’ efficiency in an in vitro system of reticulocyte lysate (Luke et al.2008). In the analysis presented in S. cerevisiae, it was as efficient as 2A peptide from PTV (Fig. 1). Whereas the 2A peptide sequence of ERBV-1 and PTV share almost 90% homology differing in a leucine in positions 10 and 16 in the first for two polar side chains in the corresponding residues in PTV (Fig. 2), the sequence of OpbuCPV-18 is less than 70% homologous to both. The FMDV 2A peptide sequence was one of the first 2A/2B protein ‘cleavage’ peptide described and systematically analyzed (Ryan, King and Thomas 1991). Its employment in in vitro and in vivo systems resulted in high ‘cleavage’ efficiency (Table S3, Supporting Information), and S. cerevisiae was already used as a model organism to analyze the ‘cleavage’ mechanism and critical residues for the active peptide (De Felipe et al.2003; Doronina et al.2008; Sharma et al.2012). However, although protein separation by the FMDV 2A peptide was still active, its efficiency in the present study was less than 50%, once more stressing the importance of activity characterization of the 2A sequences in a cell-specific context. It is interesting to compare the ‘cleavage’ efficiency of some of the 2A peptides tested in this work to the works with other systems (as described in Table S3, Supporting Information). The peptide displaying the best cleavage efficiency of all 22 peptides so far was achieved with an in vitro system, i.e. reticulocyte lysate, and notably for the FMDV 2A peptide. However, when compared to mammalian cells, attention should be given to the decreased efficiency of classic 2A peptides such as FMDV, TaV and ERAV, for example, as also shown in the present work. The only 2A peptide to exhibit high cleavage efficiency in all systems was PTV, being the second with good efficiency herein. This is the first time that the activity and efficiency of 2A sequences from IFV, SAF or BmCPV1, among others, were assayed in S. cerevisiae. All of them showed ‘cleavage’ activity but this activity is too low to be suitable for metabolic engineering applications (Fig. 1). Application of the best 2A peptide for heterologous expression in yeast Friedelin is a unique plant pentacyclic triterpene because it has the higher number of rearrangements during 2,3-oxidosquelene cyclization by the friedelin synthase. Pharmacologically, it has shown promising liver and gastroprotective properties (Sunil et al.2013; Antonisamy et al.2015). The compound is also a precursor of the claimed antitumoral quinone methide triterpenoid pristimerin (Corsino et al.2000). The friedelin synthase utilized in the present work was characterized from mRNA from the leaves of Maytenus ilicifolia and therefore named MiFRS (Souza-Moreira et al.2016). Its substrate 2,3-oxidosqualene is produced in yeast and cyclized to lanosterol as part of the ergosterol pathway (Corey, Matsuda and Bartel 1994). To improve the precursor production, a truncated form of the catalytic domain of yeast gene HMG1 coding 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMG-CoA), a rate-controlling enzyme for isoprenoid production, was also expressed. HMG-CoA is a precursor for mevalonate (Fig. 4A), a precursor of isoprenoids. Squalene accumulation was observed with the overexpression of the truncated form HMG1 (Polakowski, Stahl and Lang 1998) and it was successfully used in the production of plant sesquiterpenes and triterpenes in yeast (Kirby et al.2008; Hu et al.2017). Figure 4. View largeDownload slide Mevalonate and ergosterol pathway and friedelin heterologous synthesis. (A) Biosynthesis of mevalonate by expression of tHMG1 and friedelin production by cyclization of 2,3-oxidosqualene by MiFRS, deviating the precursor of yeast endogenous production lanosterol. (B) Production of friedelin is indicated by the bidirectional plasmid [pSP-PTEF1-MiFRS, PPGK1-tHMG1] and the bicistronic [pSP-PPGK1-MiFRS-2A-tHMG1]. Figure 4. View largeDownload slide Mevalonate and ergosterol pathway and friedelin heterologous synthesis. (A) Biosynthesis of mevalonate by expression of tHMG1 and friedelin production by cyclization of 2,3-oxidosqualene by MiFRS, deviating the precursor of yeast endogenous production lanosterol. (B) Production of friedelin is indicated by the bidirectional plasmid [pSP-PTEF1-MiFRS, PPGK1-tHMG1] and the bicistronic [pSP-PPGK1-MiFRS-2A-tHMG1]. Friedelin was produced by expressing the two mentioned genes, first, in a bidirectional plasmid, with MiFRS under control of TEF1 promoter and tHMG1 under PGK1 promoter. Second, ERBV-1 2A peptide ‘cleavage’ was tested by linking MiFRS to tHMG1 under the control of a PGK1 promoter. Expression of the two genes from separate promoters in a bidirectional plasmid resulted in 1.6 mg/L of friedelin, whilst expression via the 2A system led to 1.9 mg/L. While this difference is not statistically significant, these results demonstrate that expression using the 2A system is not detrimental to production, and might even be favorable. This is a proof of the applicability of this peptide in synthetic biology for heterologous production of a compound of interest in S. cerevisiae by functional enzymes using a bicistronic expression. In conclusion, we successfully obtained almost 100% ‘cleavage’ efficiency when using a codon-optimized sequence of ERBV-1 2A peptide, a neglected 2A peptide. 2A peptides could serve as a valuable tool in synthetic biology strategies for co-expressing multiple proteins. However, the cell and protein context should be considered when using such peptides for metabolic engineering applications. We recognized three 2A sequences with high potential to be used in S. cerevisiae among 22 previously described peptides. Friedelin was the first effective heterologous product produced in yeast using ERBV-1 2A peptide as a step forward to improve pathway cloning and metabolic engineering of yeast. The present analysis of best 2A ‘self-cleavage’ peptides in yeast could be especially useful for applications involving expression of complex pathways. SUPPLEMENTARY DATA Supplementary data are available at FEMSYR online. Acknowledgements We are grateful to thank Mariana M. Santoni and Juliana Rodrigues for their technical assistance. FUNDING This work was supported by the Novo Nordisk Foundation and the Knut and Alice Wallenberg Foundation. We also would like to thank the São Paulo Research Foundation (FAPESP) [grant number 2014/25705-0]. Conflict of interest. None declare. REFERENCES Ahier A , Jarriault S . Simultaneous expression of multiple proteins under a single promoter in Caenorhabditis elegans via a versatile 2A-based toolkit . J Am Chem Soc 2014 ; 196 : 3234 – 41 . Amorim Araújo J , Ferreira TC , Rubini MR et al. Coexpression of cellulases in Pichia pastoris as a self-processing protein fusion . AMB Express 2015 ; 5 : 84 . Google Scholar CrossRef Search ADS PubMed Antonisamy P , Duraipandiyan V , Aravinthan A et al. Protective effects of friedelin isolated from Azima tetracantha Lam. against ethanol-induced gastric ulcer in rats and possible underlying mechanisms . Eur J Pharmacol 2015 ; 750 : 167 – 75 . Google Scholar CrossRef Search ADS PubMed Atkins JF , Wills NM , Loughran G et al. A case for “StopGo”: reprogramming translation to augment codon meaning of GGN by promoting unconventional termination (Stop) after addition of glycine and then allowing continued translation (Go) . RNA 2007 ; 13 : 803 – 10 . Google Scholar CrossRef Search ADS PubMed Beekwilder J , van Rossum HM , Koopman F et al. Polycistronic expression of a beta-carotene biosynthetic pathway in Saccharomyces cerevisiae coupled to beta-ionone production . J Biotechnol 2014 ; 192 : 383 – 92 . Google Scholar CrossRef Search ADS PubMed Borodina I , Nielsen J . Advances in metabolic engineering of yeast Saccharomyces cerevisiae for production of chemicals . Biotechnol J 2014 ; 9 : 609 – 20 . Google Scholar CrossRef Search ADS PubMed Breitling R , Takano E . Synthetic biology advances for pharmaceutical production . Curr Opin Biotech 2015 ; 35 : 46 – 51 . Google Scholar CrossRef Search ADS PubMed Chen X , Petranovic D . Amyloid-beta peptide-induced cytotoxicity and mitochondrial dysfunction in yeast . FEMS Yeast Res 2015 ; 15 : 662 – 69 . Google Scholar CrossRef Search ADS Chng J , Wang T , Nian R et al. Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells . MAbs 2015 ; 7 : 403 – 12 . Google Scholar CrossRef Search ADS PubMed Corey EJ , Matsuda SP , Bartel B . Molecular cloning, characterization, and overexpression of ERG7, the Saccharomyces cerevisiae gene encoding lanosterol synthase . P Natl Acad Sci USA 1994 ; 91 : 2211 – 15 . Google Scholar CrossRef Search ADS Corsino J , Carvalho PRF , Kato MJ et al. Biosynthesis of friedelane and quinonemethide triterpenoids is compartmentalized in Maytenus aquifolium and Salacia campestris . Phytochemistry 2000 ; 55 : 741 – 48 . Google Scholar CrossRef Search ADS PubMed Curran KA , Morse NJ , Markham KA et al. Short synthetic terminators for improved heterologous gene expression in yeast . ACS Synth Biol 2015 ; 4 : 824 – 32 . Google Scholar CrossRef Search ADS PubMed Daniels RW , Rossano AJ , Macleod GT et al. Expression of multiple transgenes from a single construct using viral 2A peptides in Drosophila . Plos One 2014 ; 9 : e100637 . Google Scholar CrossRef Search ADS PubMed David F , Nielsen J , Siewers V . Flux control at the Malonyl-CoA node through hierarchical dynamic pathway regulation in Saccharomyces cerevisiae . ACS Synth Biol 2016 ; 5 : 224 – 33 . Google Scholar CrossRef Search ADS PubMed De Felipe P , Hughes LE , Ryan MD et al. Co-translational, intraribosomal cleavage of polypeptides by the foot-and-mouth disease virus 2A peptide . J Biol Chem 2003 ; 278 : 11441 – 8 . Google Scholar CrossRef Search ADS PubMed Donnelly ML , Gani D , Flint M et al. The cleavage activities of aphthovirus and cardiovirus 2A proteins . J Gen Virol 1997 ; 78 : 13 – 21 . Google Scholar CrossRef Search ADS PubMed Donnelly ML , Hughes LE , Luke G et al. The ‘cleavage’ activities of foot-and-mouth disease virus 2A site-directed mutants and naturally occurring ‘2A-like’ sequences. J Gen Virol 2001 ; 82 : 1027 – 41 . Google Scholar CrossRef Search ADS PubMed Donnelly ML , Luke G , Mehrotra A et al. Analysis of the aphthovirus 2A/2B polyprotein ‘cleavage’ mechanism indicates not a proteolytic reaction, but a novel translational effect: a putative ribosomal ‘skip’ . J Gen Virol 2001 ; 82 : 1013 – 25 . Google Scholar CrossRef Search ADS PubMed Doronina VA , Wu C , de Felipe P et al. Site-specific release of nascent chains from ribosomes at a sense codon . Mol Cell Biol 2008 ; 28 : 4227 – 39 . Google Scholar CrossRef Search ADS PubMed Edelheit O , Hanukoglu A , Hanukoglu I . Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies . BMC Biotechnol 2009 ; 9 : 61 . Google Scholar CrossRef Search ADS PubMed Fang J , Qian JJ , Yi S et al. Stable antibody expression at therapeutic levels using the 2A peptide . Nat Biotechnol 2005 ; 23 : 584 – 90 . Google Scholar CrossRef Search ADS PubMed Farré G , Blancquaert D , Capell T et al. Engineering complex metabolic pathways in plants . Annu Rev Plant Biol 2014 ; 65 : 187 – 223 . Google Scholar CrossRef Search ADS PubMed Fletcher E , Krivoruchko A , Nielsen J . Industrial systems biology and its impact on synthetic biology of yeast cell factories . Biotechnol Bioeng 2016 ; 113 : 1164 – 70 . Google Scholar CrossRef Search ADS PubMed Gao SY , Jack MM , O’Neill C . Towards optimising the production of and expression from polycistronic vectors in embryonic stem cells . PLos One 2012 ; 7 : e48668 . Google Scholar CrossRef Search ADS PubMed Geier M , Fauland P , Vogl T et al. Compact multi-enzyme pathways in P. pastoris . Chem Commun (Camb) 2015 ; 51 : 1643 – 6 . Google Scholar CrossRef Search ADS PubMed Gibson DG , Young L , Chuang RY et al. Enzymatic assembly of DNA molecules up to several hundred kilobases . Nat Methods 2009 ; 6 : 343 – 5 . Google Scholar CrossRef Search ADS PubMed Ha SH , Liang YS , Jung H et al. Application of two bicistronic systems involving 2A and IRES sequences to the biosynthesis of carotenoids in rice endosperm . Plant Biotechnol J 2010 ; 8 : 928 – 38 . Google Scholar CrossRef Search ADS PubMed Halpin C , Cooke SE , Barakate A et al. Self-processing 2A-polyproteins–a system for co-ordinate expression of multiple proteins in transgenic plants . Plant J 1999 ; 17 : 453 – 9 . Google Scholar CrossRef Search ADS PubMed Holst J , Szymczak-Workman AL , Vignali KM et al. Generation of T-cell receptor retrogenic mice . Nat Protoc 2006 ; 1 : 406 – 17 . Google Scholar CrossRef Search ADS PubMed Hu Y , Zhou YJ , Bao J et al. Metabolic engineering of Saccharomyces cerevisiae for production of germacrene A, a precursor of beta-elemene . J Ind Microbiol Biot 2017 ; 44 : 1065 – 72 . Google Scholar CrossRef Search ADS Jakočiūnas T , Bonde I , Herrgård M et al. Multiplex metabolic pathway engineering using CRISPR/Cas9 in Saccharomyces cerevisiae . Metab Eng 2015 ; 28 : 213 – 22 . Google Scholar CrossRef Search ADS PubMed Jensen NB , Strucko T , Kildegaard KR et al. EasyClone: method for iterative chromosomal integration of multiple genes Saccharomyces cerevisiae . FEMS Yeast Res 2014 ; 14 : 238 – 48 . Google Scholar CrossRef Search ADS PubMed Khoomrung S , Chumnanpuen P , Jansa-Ard S et al. Rapid quantification of yeast lipid using microwave-assisted total lipid extraction and HPLC-CAD . Anal Chem 2013 ; 85 : 4912 – 19 . Google Scholar CrossRef Search ADS PubMed Kim JH , Lee SR , Li LH et al. High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and Mice . PLoS One 2011 ; 6 : e18556 . Google Scholar CrossRef Search ADS PubMed Kirby J , Romanini DW , Paradise EM et al. Engineering triterpene production in Saccharomyces cerevisiae–β-amyrin synthase from Artemisia annua . FEBS J 2008 ; 275 : 1852 – 9 . Google Scholar CrossRef Search ADS PubMed Krivoruchko A , Nielsen J . Production of natural products through metabolic engineering of Saccharomyces cerevisiae . Curr Opin Biotech 2014 ; 35C : 7 – 15 . Kuzmich AI , Vvedenskii AV , Kopantzev EP et al. Quantitative comparison of gene co-expression in a bicistronic vector harboring IRES or coding sequence of porcine teschovirus 2A peptide . Russ J Bioorg Chem 2013 ; 39 : 406 – 16 . Google Scholar CrossRef Search ADS Liu Z , Chen O , Wall JBJ et al. Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector . Sci Rep 2017 ; 7 . DOI:10.1038/s41598-017-02460-2 . Lorens JB , Pearsall DM , Swift SE et al. Stable, stoichiometric delivery of diverse protein functions . J Biochem Bioph Meth 2004 ; 58 : 101 – 10 . Google Scholar CrossRef Search ADS Luke GA , de Felipe P , Lukashev A et al. Occurrence, function and evolutionary origins of ‘2A-like’ sequences in virus genomes . J Gen Virol 2008 ; 89 : 1036 – 42 . Google Scholar CrossRef Search ADS PubMed Mikkelsen MD , Buron LD , Salomonsen B et al. Microbial production of indolylglucosinolate through engineering of a multi-gene pathway in a versatile yeast expression platform . Metab Eng 2012 ; 14 : 104 – 11 . Google Scholar CrossRef Search ADS PubMed Minskaia E , Luke GA . 2A - the “go-to” technology for transgene co-expression . Single Cell Biol 2015 ; S1 . DOI: 10.4172/2168-9431.S1-004 . Minskaia E , Nicholson J , Ryan MD . Optimisation of the foot-and-mouth disease virus 2A co-expression system for biomedical applications . BMC Biotechnol 2013 ; 13 : 67 . Google Scholar CrossRef Search ADS PubMed Minskaia E , Ryan MD . Protein coexpression using FMDV 2A: effect of ‘‘linker’’ residues . Biomed Res Int 2013 ; 2013 . http://dx.doi.org/10.1155/2013/291730 . Mumberg D , Müller R , Funk M . Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds . Gene 1995 ; 156 : 119 – 22 . Google Scholar CrossRef Search ADS PubMed Odon V , Luke GA , Roulston C et al. APE-type non-LTR retrotransposons of multicellular organisms encode virus-like 2A oligopeptide sequences, which mediate translational recoding during protein synthesis . Mol Biol Evol 2013 ; 30 : 1955 – 65 . Google Scholar CrossRef Search ADS PubMed Ongley SE , Bian X , Neilan BA et al. Recent advances in the heterologous expression of microbial natural product biosynthetic pathways . Nat Prod Rep 2013 ; 30 : 1121 – 38 . Google Scholar CrossRef Search ADS PubMed Partow S , Siewers V , Bjørn S et al. Characterization of different promoters for designing a new expression vector in Saccharomyces cerevisiae . Yeast 2010 ; 27 : 955 – 64 . Google Scholar CrossRef Search ADS PubMed Polakowski T , Stahl U , Lang C . Overexpression of a cytosolic hydroxymethylglutaryl-CoA reductase leads to squalene accumulation in yeast . Appl Microbiol Biot 1998 ; 49 : 66 – 71 . Google Scholar CrossRef Search ADS Provost E , Rhee J , Leach SD . Viral 2A peptides allow expression of multiple proteins from a single ORF in transgenic zebrafish embryos . Genesis 2007 ; 45 : 625 – 9 . Google Scholar CrossRef Search ADS PubMed Rajkumar AS , Liu G , Bergenholm D et al. Engineering of synthetic, stress-responsive yeast promoters . Nucleic Acids Res 2016 ; 44 : e136 . Google Scholar CrossRef Search ADS PubMed Redden H , Alper HS . The development and characterization of synthetic minimal yeast promoters . Nat Commun 2015 ; 6 . DOI: 10.1038/ncomms8810 . Rothwell DG , Crossley R , Bridgeman JS et al. Functional expression of secreted proteins from a bicistronic retroviral cassette based on foot-and-mouth disease virus 2A can be position dependent . Hum Gene Ther 2010 ; 21 : 1631 – 7 . Google Scholar CrossRef Search ADS PubMed Roulston C , Luke GA , de Felipe P et al. ‘2A-Like’ Signal sequences mediating translational recoding: a novel form of dual protein targeting . Traffic 2016 ; 17 : 923 – 39 . Google Scholar CrossRef Search ADS PubMed Ryan MD , Donnelly M , Lewis A et al. A Model for nonstoichiometric, cotranslational protein scission in eukaryotic ribosomes . Bioorg Chem 1999 ; 27 : 55 – 79 . Google Scholar CrossRef Search ADS Ryan MD , Drew J . Foot-and-mouth disease virus 2A oligopeptide mediated cleavage of an artificial polyprotein . EMBO J 1994 ; 13 : 928 – 33 . Google Scholar PubMed Ryan MD , King AM , Thomas GP . Cleavage of foot-and-mouth disease virus polyprotein is mediated by residues located within a 19 amino acid sequence . J Gen Virol 1991 ; 72 : 2727 – 32 . Google Scholar CrossRef Search ADS PubMed Sambrook J , Russell DW . Molecular Cloning: A Laboratory Manual . 3rd edn . New York : Cold Spring Harbor Laboratory Press , 2001 . Scalcinati G , Partow S , Siewers V et al. Combined metabolic engineering of precursor and co-factor supply to increase alpha-santalene production by Saccharomyces cerevisiae . Microb Cell Fact 2012 ; 11 : 117 . Google Scholar CrossRef Search ADS PubMed Sharma P , Yan F , Doronina VA et al. 2A peptides provide distinct solutions to driving stop-carry on translational recoding . Nucleic Acids Res 2012 ; 40 : 3143 – 51 . Google Scholar CrossRef Search ADS PubMed Souza-Moreira TM , Alves TB , Pinheiro KA et al. Friedelin synthase from Maytenus ilicifolia: leucine 482 plays an essential role in the production of the most rearranged pentacyclic triterpene . Sci Rep 2016 ; 6 : 36858 . Google Scholar CrossRef Search ADS PubMed Sunil C , Duraipandiyan V , Ignacimuthu S et al. Antioxidant, free radical scavenging and liver protective effects of friedelin isolated from Azima tetracantha Lam. leaves . Food Chem 2013 ; 139 : 860 – 5 . Google Scholar CrossRef Search ADS PubMed Szymczak AL , Workman CJ , Wang Y et al. Correction of multi-gene deficiency in vivo using a single ‘self-cleaving’ 2A peptide-based retroviral vector . Nat Biotechnol 2004 ; 22 : 589 – 94 . Google Scholar CrossRef Search ADS PubMed Tang X , Liu X , Tao G et al. “Self-cleaving” 2A peptide from porcine teschovirus-1 mediates cleavage of dual fluorescent proteins in transgenic Eimeria tenella . Vet Res 2016 ; 47 : 68 . Google Scholar CrossRef Search ADS PubMed Torres V , Barra L , Garcés F et al. A bicistronic lentiviral vector based on the 1D/2A sequence of foot-and-mouth disease virus expresses proteins stoichiometrically . J Biotechnol 2010 ; 146 : 138 – 42 . Google Scholar CrossRef Search ADS PubMed Unkles SE , Valiante V , Mattern DJ et al. Synthetic biology tools for bioprospecting of natural products in eukaryotes . Chem Biol 2014 ; 21 : 502 – 8 . Google Scholar CrossRef Search ADS PubMed Wang Y , Wang F , Wang R et al. 2A self-cleaving peptide-based multi-gene expression system in the silkworm Bombyx mori . Sci Rep 2015 ; 5 . DOI: 10.1038/srep16273 . Yang S , Cohen CJ , Peng PD et al. Development of optimal bicistronic lentiviral vectors facilitates high-level TCR gene expression and robust tumor cell recognition . Gene Ther 2008 ; 15 : 1411 – 23 . Google Scholar CrossRef Search ADS PubMed Zhou YJ , Gao W , Rong Q et al. Modular pathway engineering of diterpenoid synthases and the mevalonic acid pathway for miltiradiene production . J Am Chem Soc 2012 ; 134 : 3234 – 41 . Google Scholar CrossRef Search ADS PubMed © FEMS 2018. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png FEMS Yeast Research Oxford University Press

Screening of 2A peptides for polycistronic gene expression in yeast

Loading next page...
 
/lp/ou_press/screening-of-2a-peptides-for-polycistronic-gene-expression-in-yeast-o8dIKDTqav
Publisher
Oxford University Press
Copyright
© FEMS 2018.
ISSN
1567-1356
eISSN
1567-1364
D.O.I.
10.1093/femsyr/foy036
Publisher site
See Article on Publisher Site

Abstract

Abstract A complexity of pathway expression in yeast compared to prokaryotes is the need for separate promoters and terminators for each gene expressed. Single transcript expression and separated protein production is possible via the use of 2A viral peptides, but detailed characterization to assess their suitability and applications is needed. The present work aimed to characterize multiple 2A peptide sequences to determine suitability for metabolic engineering applications in Saccharomyces cerevisiae. We screened 22 peptides placed between fluorescent protein sequences. Cleaving efficiency was calculated by western blot intensity of bands corresponding to the cleaved and uncleaved forms of the reporter. Three out of the 22 sequences showed high cleavage efficiency: 2A peptide from Equine rhinitis B virus (91%), Porcine teschovirus-1 (85%) and Operophtera brumata cypovirus-18 (83%). Furthermore, expression of the released protein was comparable to its monocistronic expression. As a proof-of-concept, the triterpene friedelin was successfully produced in the same yeast strain by expressing its synthase with the truncated form of HMG1 linked by the 2A peptide of ERBV-1, with production titers comparable to monocistronic expression (via separate promoters). These results suggest that these peptides could be suitable for expression and translation of multiple proteins in metabolic engineering applications in S. cerevisiae. Saccharomyces cerevisiae, ERBV-1 2A peptide, yeast metabolic engineering, ‘self-cleavage’, ‘stop-carry on’, multi-gene expression, ‘polycistronic’ INTRODUCTION The production of fine chemicals, therapeutic natural products or biofuels in microbial cell factories has promising industrial applications (Borodina and Nielsen 2014; Krivoruchko and Nielsen 2014; Breitling and Takano 2015). The yeast Saccharomyces cerevisiae is the most common eukaryotic cell factory (Krivoruchko and Nielsen 2014). Its advantages include good tolerance to low pH and fermentation inhibitors, robust industrial performance, reduced susceptibility to phage contaminations, genetic tractability and ability to express functional enzymes with post-translational modifications or membrane anchoring (Borodina and Nielsen 2014; Krivoruchko and Nielsen 2014). Saccharomyces cerevisiae is currently the chosen cell factory for production of biofuels such as Farnesene (commercialized by Amyris) and isobutanol (Gevo and Butamax), biopolymers building blocks such as lactic acid (Cargill) and succinic acid (Bioamber and Corbion), as well as higher value molecules such as plant natural products artemisinic acid (Amyris), resveratrol (Evolva) and nootkatone (Evolva). The production of many industrially interesting compounds in a heterologous host such as S. cerevisiae demands the insertion of whole or partial biosynthetic pathways (Mikkelsen et al.2012; Ongley et al.2013; Krivoruchko and Nielsen 2014). Recent years have seen a rise in the availability of synthetic biology tools aimed at expediting yeast metabolic engineering (Fletcher, Krivoruchko and Nielsen 2016). This includes characterization of new parts such as promoters (Redden and Alper 2015; Rajkumar et al.2016) and terminators (Curran et al.2015), new episomal and integrative expression systems (Mikkelsen et al.2012; Jensen et al.2014) and the emergence of CRISPR/Cas9 for rapid strain modification (Jakočiūnas et al.2015). Still, one disadvantage of engineering yeast compared to prokaryotic systems is the absence of a polycistronic gene expression system. As a result, a separate promoter and terminator are required for each gene, resulting in larger constructs. Furthermore, due to the efficient homologous recombination system of S. cerevisiae, dual-usage of the same promoter and terminator can result in gene loss, while using different promoters/terminators can result in differential expression of pathway genes. This can be especially problematic when assembling complex pathways consisting of many different genes. In the present paper, we aimed to overcome these disadvantages by creating and characterizing a polycistronic-like expression system in yeast using 2A peptides. In addition to significantly reducing construct size, such a system would allow for stoichiometric expression of the different proteins since only one promoter and terminator are used and no cis-acting element is needed for the expression (Ahier and Jarriault 2014; Daniels et al.2014; Liu et al.2017). Furthermore, the small size of 2A peptides allows for easy amplification together with the gene of interest, reducing the number of cloning parts of one cassette and significantly reducing pathway construction time. A high separation efficiency is crucial to effectively use 2A peptides for metabolic engineering applications. Cleavage functionalities of various 2A peptides have been characterized since the 90s (Ryan, King and Thomas 1991; Ryan and Drew 1994; Ryan et al.1999). The so-called mechanism of ‘self-cleavage’ promoted by 2A peptides actually involves ribosomal stalling and peptide bond skipping recoding protein translation in a ‘stop-carry on’ or ‘StopGo’ way (Donnelly et al.2001; Atkins et al.2007). That is possible because of the characteristic C-terminal DXEXNPGP motif (Donnelly et al., 2001; Sharma et al.2012). The ribosome pauses after glycine transfer to the nascent peptide chain and translocation of the glycine and proline codon to P and A sites, respectively. In the predicted model, peptide bond to the prolyl-tRNAPro is hampered by the 2A shifted conformation in the ribosomal exit tunnel and due to the following poor nucleophile proline (Doronina et al.2008; Sharma et al.2012). The situation is solved by releasing the upstream protein linked to the 2A peptide and translation of downstream protein continues with proline as the first residue (Donnelly et al.2001; Atkins et al.2007; Doronina et al.2008). Although the separation of the proteins occurs by a ribosomal recoding, terms such as ‘cleavage’ or ‘self-cleavage’ are still frequently applied to 2A peptides (Liu et al.2017). The cleavage efficiency of 2A peptides with different reporter proteins in the ribosome of in vitro or different in vivo system has been extensively studied (Halpin et al.1999; Provost, Rhee and Leach 2007; Doronina et al.2008; Luke et al.2008; Kim et al.2011; Gao, Jack and O’Neill 2012; Sharma et al.2012; Odon et al.2013; Daniels et al.2014; Geier et al.2015; Roulston et al.2016). 2A peptides have been used for the production of monoclonal antibodies (Fang et al.2005; Chng et al.2015), gene therapy (Szymczak et al.2004) and production of β-carotene in plants (Ha et al.2010). This system has also been shown to work for metabolic engineering applications in yeast (Beekwilder et al.2014; Geier et al.2015). However, it was not extensively characterized in these studies, with limited studies of the cleavage efficiencies of the peptides used or expression and functionality of the resulting proteins compared to monocistronic expression. The aim of the present work was to further characterize the 2A system for metabolic engineering applications in the yeast S. cerevisiae. Since cleavage efficiency tends to differ between different organisms, and because high cleavage efficiency is a key to getting similar expression levels from all proteins in the construct, we evaluated twenty two 2A peptides using two fluorescent proteins. Out of those evaluated, three 2A peptides showed acceptable ‘cleavage’ efficiencies in yeast and potential to be used in the construction of pathways to be inserted/modified in S. cerevisiae. MATERIAL AND METHODS Strains, media and growth conditions Molecular biology procedures and cultivations followed standard literature (Sambrook and Russell 2001). For cloning purpose, we used Escherichia coli DH5α strain (fhuA2Δ (argF-lacZ) U169 phoA glnV44 Φ80Δ (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17) cultivated in Luria-Bertani medium supplemented with ampicillin 100 μg/mL, at 37°C. Saccharomyces cerevisiae strain CEN.PK113-5D (MATaMAL2-8c SUC2 ura3-52; kindly provided by P. Kötter, University of Frankfurt, Germany) was used for in vivo expression and translation system. Yeast pre-inocula were maintained in YPD (1% yeast extract, 2% peptone, 2% dextrose) medium and transformants were selected on synthetic dextrose (SD; 0.67% yeast nitrogen base, 2% dextrose) medium without uracil, at 30°C after lithium acetate/single-stranded DNA heat shock transformation. Experimental cultivations were conducted in the same SD-uracil medium, at 30°C for overnight. Plasmid constructions Plasmids were constructed based on p416 (Mumberg, Müller and Funk 1995), a centromeric plasmid carrying the green fluorescent protein (GFP) under control of TEF1 promoter; CYC1 as terminator and URA3 as selection marker gene. To construct the GFP control plasmid, tCYC1 was exchanged for tADH1 using overlapping primers P13_fwd and P14_rev to amplify tADH1 fragment whereas [p416-PTEF1-GFP] (David, Nielsen and Siewers 2016) was amplified using primers P11_fwd and P12_rev with overlap to GFP and the vector as recommended by Gibson protocol (Gibson et al.2009). Primers used in this work are listed in Table 1 and Table S1, Supporting Information. Vector and fragments were amplified by PrimeSTAR® HS DNA polymerase (Takara Bio Inc, Saint-Germain-en-Laye, France) according to the manufacturer recommendations. Amplicons were purified and combined in a 3:1 insert:vector ratio together to Gibson Assembly® Master mix (New England Biolabs, Ipswich, MA, USA). Red fluorescent protein (RFP) control plasmid was constructed in the same way using primers (P11_fwd and P15_rev) to amplify vector and PTEF1. The fragment RFP-tADH1 was amplified from plasmid template p0394 with overlapping primers (P16_fwd and P14_rev). Table 1. General primers utilized in this work. Primer identification Primer sequence 5'–3' Note P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplification with overlap to p416 (in bold) P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA P11_fwd GGCCGGTACCCAATTCGCCCTATAG p416 amplification without tCYC1 P12_rev CTATTTGTATAGTTCATCCATGCCA P15_rev TTTGTAATTAAAACTTAGATTAGAT Anneals to PTEF1 P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA RFP amplification with overlap to p416 (in bold) P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward used with reverse primers in Table S1. Anneals to p416. Overlaps to tADH1 (in bold) P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverse used with forward primers in Table S1. Anneals to the end of tADH1 Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Used for sequencing and colony PCR with P4_rev Primer identification Primer sequence 5'–3' Note P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplification with overlap to p416 (in bold) P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA P11_fwd GGCCGGTACCCAATTCGCCCTATAG p416 amplification without tCYC1 P12_rev CTATTTGTATAGTTCATCCATGCCA P15_rev TTTGTAATTAAAACTTAGATTAGAT Anneals to PTEF1 P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA RFP amplification with overlap to p416 (in bold) P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward used with reverse primers in Table S1. Anneals to p416. Overlaps to tADH1 (in bold) P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverse used with forward primers in Table S1. Anneals to the end of tADH1 Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Used for sequencing and colony PCR with P4_rev View Large Table 1. General primers utilized in this work. Primer identification Primer sequence 5'–3' Note P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplification with overlap to p416 (in bold) P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA P11_fwd GGCCGGTACCCAATTCGCCCTATAG p416 amplification without tCYC1 P12_rev CTATTTGTATAGTTCATCCATGCCA P15_rev TTTGTAATTAAAACTTAGATTAGAT Anneals to PTEF1 P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA RFP amplification with overlap to p416 (in bold) P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward used with reverse primers in Table S1. Anneals to p416. Overlaps to tADH1 (in bold) P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverse used with forward primers in Table S1. Anneals to the end of tADH1 Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Used for sequencing and colony PCR with P4_rev Primer identification Primer sequence 5'–3' Note P13_fwd TGGCATGGATGAACTATACAAATAGGTAGATACGTTGTTGACACTTCTAA tADH1 amplification with overlap to p416 (in bold) P14_rev CTATAGGGCGAATTGGGTACCGGCCGAGCGACCTCATGCTATACCTGAGA P11_fwd GGCCGGTACCCAATTCGCCCTATAG p416 amplification without tCYC1 P12_rev CTATTTGTATAGTTCATCCATGCCA P15_rev TTTGTAATTAAAACTTAGATTAGAT Anneals to PTEF1 P16_fwd ATCTAATCTAAGTTTTAATTACAAAATGGCCTCCTCCGAGGACGTCATCA RFP amplification with overlap to p416 (in bold) P1_fwd TGCTTTCTCAGGTATAGCATGAGGTCGCTCGGCCGGTACCCAATTCGCCCTATAG Primer forward used with reverse primers in Table S1. Anneals to p416. Overlaps to tADH1 (in bold) P4_rev GAGCGACCTCATGCTATACCTGAGAAAGCA Primer reverse used with forward primers in Table S1. Anneals to the end of tADH1 Fwd_GFP_5seq GGCAGACAAACAAAAGAATGG Used for sequencing and colony PCR with P4_rev View Large All the 2A sequences were constructed between GFP and RFP by adding about 45–50 nucleotides into the reverse primer (Table S1, Supporting Information) for GFP-vector amplification pairing with primer forward P1_fwd (Table 1). Primers overlapping and complementing 2A sequence by 45–50 nucleotides were designed into the forward primer (Table S1, Supporting Information) for RFP-tADH1 amplification using reverse primer P4_rev (Table 1). Nucleotides coding the 2A sequences were codon optimized for yeast translation. After 30 min the assembly mixture was transformed into E. coli and correct assembly was verified by colony PCR using DreamTaq (Thermo Scientific) according to the manufacturer protocol using primers Fwd_GFP_5seq and P4_rev. DNA sequencing was performed with primer Fwd_GFP_5seq. Reporters were transformed into CEN.PK113-5D and selected in SD–uracil medium. Mutation of ERBV-1 2A site The site-directed mutagenesis was conducted using [p416-PTEF1-GFP-ERBV2A-RFP] plasmid as a template and single primer amplification method (Edelheit, Hanukoglu and Hanukoglu 2009). Primers used to promote the substitution of Pro20 to Ala were AlaF (forward): 5'-GAATTGAATCCAGGTgctATGGCC-TCCTCCGAG-3' and AlaR (reverse): 5'-CTCGGAGGAGGC-CATagcACCTGGATTCAATTC-3', where lowercase indicates the amino acid substitution. Amplifications were performed with Phusion High Fidelity DNA polymerase (2000 U/mL; New England Biolabs). The single-stranded amplification products were mixed and annealed by gradually decreasing the temperature 10°C/min from 98°C to 37°C. Resulting double-strands were treated with DpnI (20 U/μL; New England Biolabs) and transformed into E. coli. DNA sequencing was performed with primer Fwd_GFP_5seq to confirm the presence of the desired mutation. Mutant 2A peptide reporter was transformed into CEN.PK113-5D and selected in SD–uracil medium. Fluorescence microscopy Yeast strains expressing the reporters were pre-cultured overnight and then diluted to an optical density at 600 nm (OD600nm) of 0.1 in 20 mL of SD–uracil medium. Strains were cultivated at 30°C and samples were taken from mid-exponential phase (OD600nm 0.5–0.8) and washed once with phosphate buffered saline (PBS). GFP fluorescence was detected with a 525/30 filter and RFP, with 690/50 filter using a Leica AF 6000 inverted fluorescence microscope (Wetzlar, Germany) with a 100× objective. Images were processed with the Leica Application Suite software. Western blotting Protein extracts were prepared as described previously (Chen and Petranovic, 2015). Quantification was performed using RC DC Protein Assay (Bio Rad, Hercules, USA) against a bovine serum albumin (Sigma-Aldrich) calibration curve. A 4%–12% Bis-Tris gel (Invitrogen) was used to separate 50 μg of protein of each sample for about 2 h at 90 V in running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS, pH 8.3; Bio Rad). Transfer of proteins to Polyvinylidene difluoride (PVDF) membrane (Bio Rad) was performed in a semi-dry transfer system (Bio Rad) using a transfer buffer containing 50 mM Tris, 38 mM glycine, 20% v/v methanol for 1 h at 25 V. Membranes were blocked with blocking buffer (Sigma-Aldrich) for 1 h and then incubated with the primary monoclonal antibody anti-RFP (Life Technologies, Eugene, OR, USA) or anti-GFP (Roche Life Science) for overnight at 4°C. After, membranes were washed 4 times with PBS-0.05% Tween 20, probed with secondary anti-rabbit antibody for 1 h and again washed previous to the detection by luminescence with ECL Prime reagent (GE Healthcare) and ChemiDoc XRS image analyzer (Bio Rad). The band intensities on the membranes were determined using ImageJ software. ‘Cleavage’ efficiency was calculated as follows: cleavage efficiency = 100 × (cleaved RFP form)/(cleaved RFP form + uncleaved form). Evaluation friedelin production using the 2A system Friedelin synthase coding sequence from Maytenus ilicifolia (MiFRS, GenBank accession number KX147270) (Souza-Moreira et al.2016) was synthesized by GenScript with codon optimization for expression in S. cerevisiae. MiFRS sequence was subcloned into the yeast expression pSP-GM1 (Partow et al.2010) under control of the TEF1 promoter using restriction enzymes SacI and SpeI (FastDigest, Thermo Fisher Scientific). The truncated form of HMG1 gene was cloned into the [pSP-PTEF1-MiFRS] plasmid between BamHI and SalI (FastDigest, Thermo Fisher Scientific) restriction sites under PGK1 promoter control. The plasmid [pSP-PTEF1-MiFRS, PPGK1-tHMG1] was used as control of friedelin production level in CEN.PK113-5D strain. To demonstrate the functionality of the 2A peptide for metabolic engineering applications, the friedelin biosynthetic pathway was expressed in yeast using the bicistronic construct [pSP-PPGK1-MiFRS-2A-tHMG1]. To construct the plasmid, fragments of each module (i.e. homologous recombination module for up and down parts of the plasmid, promoter, MiFRS, tHMG1 and ADH1 terminator) were PCR amplified with overlapping primers (described in Table S2, Supporting Information) using PrimeSTAR® HS DNA polymerase. After gel purification, modules were PCR assembled into one fragment (Zhou et al.2012). pSP-GM1 backbone was PCR amplified and gel-purified. Equal molar of assembled modular fragment and pSP-GM1 backbone were chemically transformed into CEN.PK113-5D. Colony PCR was used to screen the presence of assembled plasmid. Plasmids were then recovered from cell lysates, transformed into E. coli and again recovered for sequencing verification of the construct. Quantification of heterologous friedelin production CEN.PK113-5D transformed with empty pSP-GM1, [pSP-PTEF1-MiFRS, PPGK1-tHMG1] or [pSP-PPGK1-MiFRS-2A-tHMG1] were pre-grown in SD-uracil medium. For heterologous friedelin production, cells were diluted to a starting OD600nm of 0.05 in minimal medium (Scalcinati et al.2012) and cultivated for 72 h at 30°C with shaking. Then, cells were collected, dried and about 30 mg of dried cell weight were extracted with chloroform:methanol (2:1, v/v; Khoomrung et al.2013) in an ultrasonic bath (2840D, Odontobrás, Ribeirão Preto, SP, Brazil) for 10 min. The organic phase was collected after addition of 0.73% NaCl and centrifugation. The extract was dried and resuspended in 200 μL acetonitrile to be analyzed by gas chromatography associated to mass spectrometry (QP2020C W/O RP230V, Shimadzu, Kioto, Japan) using a HP-5 column (30 m × 0.25 mm × 0.25 μm; Agilent Technologies, Santa Clara, California, USA). Analysis was performed with inlet temperature of 270°C, heating gradient from 200°C to 290°C (10°C/min), trap temperature of 200°C, interface temperature of 290°C for 18 min, injection volume of 1 μL, split ratio of 1:10, flow gas of 1.0 mL/min, ionization of 70 eV and detection interval of 35–600 m/z. Cholesterol was spiked in as internal standard control at 40 μg/mL before friedelin extraction process. An analytical curve of friedelin standard (Sigma-Aldrich, St. Louis, Missouri, USA) was constructed. The peak of friedelin was observed at retention time of 23.08 min and identity was confirmed by mass spectral detection compared to National Institute of Standards and Technology (NIST) library and standard. Quantification analysis was done in triplicate and statistical significance was analyzed by the Student's t-test (p-value < 0.05). RESULTS AND DISCUSSION Reporter structure Avoiding the use of a separate promoter and terminator for each single gene expressed in yeast cells can make metabolic engineering easier and faster in cases where multiple pathway steps must be expressed. Enabling two, three or more genes to be expressed in one single mRNA molecule would result in stoichiometric co-translation of separate proteins without the need for proteinase cleavage (Ryan et al.1999; Donnelly et al.2001; Lorens et al.2004; Torres et al.2010). As the cleavage efficiency of 2A peptides can vary greatly between different organisms and peptides, we selected 22 different 2A self-cleavage peptides in which the ‘self-cleavage’ had been described previously. When designing the reporters, we used the consensus sequence NPG-P for ‘self-cleavage’ (Donnelly et al.2001) and the flexible linker Gly-Ser-Gly (Holst et al.2006; Gao, Jack and O’Neill 2012). In addition, the size of the peptides was kept at 18–22 residues since these showed to be the smaller lengths that could still have considerable cleavage efficiency (Donnelly et al.2001; Minskaia and Ryan 2013), which makes easier their design within primers. We designed primers with about 48 nucleotides of the peptide sequences in the 5' and 30 nucleotides in 3' annealing to the tested proteins, as shown in Table S1, Supporting Information. One of the possible strategies to assemble all the fragments is to use the Gibson assembling kit, so the overlap between both primers carrying the 2A partial sequences should have a melting temperature ≥48°C. This assembling strategy enables a single-step construction of pathways consisting of multiple proteins. Screening of the best 2A self-cleavage efficiency in Saccharomyces cerevisiae After its discovery and ‘cleavage’ mechanism elucidation, 2A peptides were widely used in biotechnology (Minskaia, Nicholson and Ryan 2013; Minskaia and Luke 2015; Roulston et al.2016). They were employed for polycistronic expression in different cells, for instance in filamentous fungi (Unkles et al.2014), protozoan (Tang et al.2016), worm (Ahier and Jarriault 2014), insect (Daniels et al.2014; Wang et al.2015), plant (Farré et al.2014), zebrafish (Provost, Rhee and Leach 2007; Kim et al.2011) and mammalian (Szymczak et al.2004; Kim et al.2011; Chng et al.2015; Liu et al.2017) cells. However, use in yeast for biotechnological purposes has been limited, and experiments to date have only used two or three of the most known sequences in yeasts Saccharomyces cerevisiae (Sharma et al.2012; Beekwilder et al.2014) and Pichia pastoris (Amorim Araújo et al.2015; Geier et al.2015). However, the 2A ‘cleavage’ efficiency was not carefully determined. To the best of our knowledge, this is the first screening performed among a variety of 2A peptides to determine the sequence with the highest ‘self-cleavage’ efficiency in S. cerevisiae. Our constructs contained GFP in the first position and RFP in the second position. ‘Cleavage’ efficiency determination was based on western blots luminescence values relative to RFP bands, following previously reported methodology (Liu et al.2017), since the presence of the cleaved form of the second protein is a clear evidence of the multi-protein separation from a single transcript. The products quantified were the cleaved form of RFP (the sequence starting with the last proline of the 2A peptide) and uncleaved form of GFP-2A-RFP reporter (Fig. 1A), with calculated molecular weight of 25 and 50 kDa, respectively. The production of GFP linked to the 2A sequence was also confirmed as a band of about 25 kDa by western blot. The ‘self-cleavage’ efficiency of each of the 22 sequences of 2A peptides tested in S. cerevisiae was determined as percentage of the ratio between the intensity of the luminescent band of RFP cleaved form (∼25 kDa) correlated to the uncleaved form of the reporters (∼50 kDa; Fig. 1B). Therefore, the percentage of cleavage efficiency was correlated with the level of the two single fluorescent proteins from just one mRNA. Figure 1. View largeDownload slide Analysis of 2A peptide ‘cleavage’ efficiency. (A) Structure of the plasmid reporters showing ‘cleavage’ site in the 2A sequence. (B) ‘Cleavage’ efficiency, as percentage for the 22 different 2A peptides tested. Data shown represent the intensity average values ± standard deviation of western blotting of three independent biological replicates. Figure 1. View largeDownload slide Analysis of 2A peptide ‘cleavage’ efficiency. (A) Structure of the plasmid reporters showing ‘cleavage’ site in the 2A sequence. (B) ‘Cleavage’ efficiency, as percentage for the 22 different 2A peptides tested. Data shown represent the intensity average values ± standard deviation of western blotting of three independent biological replicates. All the 2A peptide sequences evaluated showed some level of cleavage, ranging from ∼33% to 91% efficiency. From all the 22 peptides, three exhibited efficiencies higher than 80% and six showed about 50% (Fig. 1B). The best performance was achieved using the Equine rhinitis B virus (ERBV-1) in which the uncleaved form GFP-2A-RFP (of 50 kDa) represented less than 10%, followed by the Porcine teschovirus-1 (PTV) (also known as P2A) and Operophtera brumata cypovirus-18 (OpbuCPV18) peptides (Fig. 2A). On the other hand, commonly used sequences such as TaV (or T2A from Thosea asigna virus), ERAV (or E2A from Equine rhinitis A virus) or FMDV (or F2A from Foot-and-mouth disease virus) showed self-cleavage efficiency in CEN.PK113-5D of 56%, 46% and 43%, respectively (Fig. 1B). Furthermore, the level of expression of the RFP cleaved form from the polycistronic construct with the best 2A peptides was comparable with the expression of RFP in the monocistronic construct under control of the same promoter, in the same S. cerevisiae strain under same culture conditions (Fig. 2B), indicating that the use of 2A peptide can lead to the production of more than one protein from one mRNA and result in comparable levels of protein produced as the protein levels from the monocistronic translation. To ensure the 2A peptide of ERBV-1 was responsible for the high efficiency in producing the cleaved proteins, we substituted the last proline in the NPGP site for an alanine residue (ERBV-1Pro20Ala). The loss of ‘self-cleavage’ efficiency by an alanine substitution in that specific position was already reported (Sharma et al.2012) and, as expected, the site-direct mutant decreased the production of the cleaved protein form and accumulated the uncleaved form (Fig. 2A), resulting in 57% of efficiency and RFP detection was half of RFP control (Fig. 2B). Figure 2. View largeDownload slide Western blot of RFP from bicistronic expression and its detected level compared to the monocistronic control. (A) Western blot representing bands of RFP from control plasmid expression and reporters with the most active 2A peptides in S. cerevisiae (ERBV-1, PTV and OpbuCPV18) and reporter mutated ERBV-1Pro20Ala. The presence of byproducts increases as the cleavage efficiency decreases. (B) Fold change of intensity of RFP level detected from expression of the most active 2A peptides and mutated ERBV-1Pro20Ala (average values ± standard deviation), compared to the intensity of RFP level detected from expression of the control plasmid (fold change = 1), showing no significant difference in the expression among the different constructs. (C) Representative western blot of the ‘flipped’ reporter, with RFP in first position and GFP after the 2A peptide sequence of ERBV-1. Bands of RFP and GFP in the reporter have similar intensity than control bands and almost none uncleaved band present. Figure 2. View largeDownload slide Western blot of RFP from bicistronic expression and its detected level compared to the monocistronic control. (A) Western blot representing bands of RFP from control plasmid expression and reporters with the most active 2A peptides in S. cerevisiae (ERBV-1, PTV and OpbuCPV18) and reporter mutated ERBV-1Pro20Ala. The presence of byproducts increases as the cleavage efficiency decreases. (B) Fold change of intensity of RFP level detected from expression of the most active 2A peptides and mutated ERBV-1Pro20Ala (average values ± standard deviation), compared to the intensity of RFP level detected from expression of the control plasmid (fold change = 1), showing no significant difference in the expression among the different constructs. (C) Representative western blot of the ‘flipped’ reporter, with RFP in first position and GFP after the 2A peptide sequence of ERBV-1. Bands of RFP and GFP in the reporter have similar intensity than control bands and almost none uncleaved band present. GFP and RFP did not lose functionality due to the amino acids of the 2A peptide from ERBV-1 in the C-teminus of GFP nor to the proline starting sequence of RFP and that can be seen by their fluorescence detected by microscopy with the cells (Fig. S1, Supporting Information). Besides, it is possible to observe a general reduction mainly in the fluorescence of RFP from the cells containing the mutant ERBV-1Pro20Ala reporter as result of the increased level of uncleaved form of the proteins. GFP in the mutated reporter showed higher fluorescence intensity compared to RFP, indicating that functionality is impaired to the protein downstream 2A peptide when cleavage does not occur (Liu et al.2017). The cleavage efficiency of ERBV-1 was previously tested in vitro using reticulocyte lysate (Luke et al.2008). The sequence had 30 amino acids and exhibited 99% cleavage as other sequences from the Picornaviridae family, such as FMDV and ERAV. Interestingly, among the 22 sequences tested herein, ERBV-1 was the only one to have a leucine residue in position 16, whereas the conserved residue at this position is a serine or other amino acids with polar side chain such as threonine, glutamate or glutamine (Fig. 3). In previous studies (Donnelly et al.2001; Sharma et al.2012), changing the serine at this position to other amino acids reduced drastically the cleavage activity of FMDV sequence to about 40%. However, in S. cerevisiae the variation to the apolar leucine residue in the consensus motif GDVELNPGP (Sharma et al.2012) did not mean loss of efficiency. Figure 3. View largeDownload slide Alignment among 2A peptides used in this work showing conserved residues. There is a high conservation in the motif DXEXNPGP important for ‘cleavage’ efficiency (shown as dark shaded). Figure 3. View largeDownload slide Alignment among 2A peptides used in this work showing conserved residues. There is a high conservation in the motif DXEXNPGP important for ‘cleavage’ efficiency (shown as dark shaded). PTV ‘cleavage’ efficiency was measured in different cellular systems (as shown in Table S3, Supporting Information) and it was employed in some bicistronic constructions assayed in different model cells, such as the yeasts S. cerevisiae (Beekwilder et al.2014) and P. pastoris (Geier et al., 2015), the protozoan Eimeria tenella (Tang et al.2016), the worm Caenorhabditis elegans (Ahier and Jarriault 2014) and human T-cell lines (Yang et al.2008). Remarkably, when PTV sequence was assayed in S. cerevisiae CEN.PK2-1C no cleavage was observed from GFP-P2A and LEU2-HA bicistronic cassettes (Beekwilder et al.2014). However, in the same study, the employment of TaV in the reporter construct did lead to the translation of both cleaved proteins with a slight uncleaved form present (no other 2A peptide was assayed). In our study, PTV showed 85% cleavage efficiency while TaV with 18 or 20 amino acids showed less than 50%, which could be related to some former observations that the upstream context is sometimes important to the ‘cleavage’ efficiency (Donnelly et al.1997). Together with the higher efficiency shown by PTV when employed in other cell systems, it is noteworthy to analyze the more suitable 2A sequence to be used according to the cell system and protein context (Donnelly et al.2001; Kim et al.2011; Kuzmich et al.2013; Minskaia, Nicholson and Ryan 2013). Keeping this in mind, we constructed a reporter with the most efficient 2A sequence from ERBV-1 locating RFP in front of GFP (RFP-ERBV2A-GFP). The ‘cleavage’ efficiency observed was still higher than 90% (Fig. 2C) corroborating with the use of ERBV-1 2A sequence for co-expression and co-translation of different proteins in S. cerevisiae independently, in the present context, of protein position (Rothwell et al.2010). OpbuCPV-18 is an insect cypovirus and its 2A peptide showed 99% of ‘cleavage’ efficiency in an in vitro system of reticulocyte lysate (Luke et al.2008). In the analysis presented in S. cerevisiae, it was as efficient as 2A peptide from PTV (Fig. 1). Whereas the 2A peptide sequence of ERBV-1 and PTV share almost 90% homology differing in a leucine in positions 10 and 16 in the first for two polar side chains in the corresponding residues in PTV (Fig. 2), the sequence of OpbuCPV-18 is less than 70% homologous to both. The FMDV 2A peptide sequence was one of the first 2A/2B protein ‘cleavage’ peptide described and systematically analyzed (Ryan, King and Thomas 1991). Its employment in in vitro and in vivo systems resulted in high ‘cleavage’ efficiency (Table S3, Supporting Information), and S. cerevisiae was already used as a model organism to analyze the ‘cleavage’ mechanism and critical residues for the active peptide (De Felipe et al.2003; Doronina et al.2008; Sharma et al.2012). However, although protein separation by the FMDV 2A peptide was still active, its efficiency in the present study was less than 50%, once more stressing the importance of activity characterization of the 2A sequences in a cell-specific context. It is interesting to compare the ‘cleavage’ efficiency of some of the 2A peptides tested in this work to the works with other systems (as described in Table S3, Supporting Information). The peptide displaying the best cleavage efficiency of all 22 peptides so far was achieved with an in vitro system, i.e. reticulocyte lysate, and notably for the FMDV 2A peptide. However, when compared to mammalian cells, attention should be given to the decreased efficiency of classic 2A peptides such as FMDV, TaV and ERAV, for example, as also shown in the present work. The only 2A peptide to exhibit high cleavage efficiency in all systems was PTV, being the second with good efficiency herein. This is the first time that the activity and efficiency of 2A sequences from IFV, SAF or BmCPV1, among others, were assayed in S. cerevisiae. All of them showed ‘cleavage’ activity but this activity is too low to be suitable for metabolic engineering applications (Fig. 1). Application of the best 2A peptide for heterologous expression in yeast Friedelin is a unique plant pentacyclic triterpene because it has the higher number of rearrangements during 2,3-oxidosquelene cyclization by the friedelin synthase. Pharmacologically, it has shown promising liver and gastroprotective properties (Sunil et al.2013; Antonisamy et al.2015). The compound is also a precursor of the claimed antitumoral quinone methide triterpenoid pristimerin (Corsino et al.2000). The friedelin synthase utilized in the present work was characterized from mRNA from the leaves of Maytenus ilicifolia and therefore named MiFRS (Souza-Moreira et al.2016). Its substrate 2,3-oxidosqualene is produced in yeast and cyclized to lanosterol as part of the ergosterol pathway (Corey, Matsuda and Bartel 1994). To improve the precursor production, a truncated form of the catalytic domain of yeast gene HMG1 coding 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMG-CoA), a rate-controlling enzyme for isoprenoid production, was also expressed. HMG-CoA is a precursor for mevalonate (Fig. 4A), a precursor of isoprenoids. Squalene accumulation was observed with the overexpression of the truncated form HMG1 (Polakowski, Stahl and Lang 1998) and it was successfully used in the production of plant sesquiterpenes and triterpenes in yeast (Kirby et al.2008; Hu et al.2017). Figure 4. View largeDownload slide Mevalonate and ergosterol pathway and friedelin heterologous synthesis. (A) Biosynthesis of mevalonate by expression of tHMG1 and friedelin production by cyclization of 2,3-oxidosqualene by MiFRS, deviating the precursor of yeast endogenous production lanosterol. (B) Production of friedelin is indicated by the bidirectional plasmid [pSP-PTEF1-MiFRS, PPGK1-tHMG1] and the bicistronic [pSP-PPGK1-MiFRS-2A-tHMG1]. Figure 4. View largeDownload slide Mevalonate and ergosterol pathway and friedelin heterologous synthesis. (A) Biosynthesis of mevalonate by expression of tHMG1 and friedelin production by cyclization of 2,3-oxidosqualene by MiFRS, deviating the precursor of yeast endogenous production lanosterol. (B) Production of friedelin is indicated by the bidirectional plasmid [pSP-PTEF1-MiFRS, PPGK1-tHMG1] and the bicistronic [pSP-PPGK1-MiFRS-2A-tHMG1]. Friedelin was produced by expressing the two mentioned genes, first, in a bidirectional plasmid, with MiFRS under control of TEF1 promoter and tHMG1 under PGK1 promoter. Second, ERBV-1 2A peptide ‘cleavage’ was tested by linking MiFRS to tHMG1 under the control of a PGK1 promoter. Expression of the two genes from separate promoters in a bidirectional plasmid resulted in 1.6 mg/L of friedelin, whilst expression via the 2A system led to 1.9 mg/L. While this difference is not statistically significant, these results demonstrate that expression using the 2A system is not detrimental to production, and might even be favorable. This is a proof of the applicability of this peptide in synthetic biology for heterologous production of a compound of interest in S. cerevisiae by functional enzymes using a bicistronic expression. In conclusion, we successfully obtained almost 100% ‘cleavage’ efficiency when using a codon-optimized sequence of ERBV-1 2A peptide, a neglected 2A peptide. 2A peptides could serve as a valuable tool in synthetic biology strategies for co-expressing multiple proteins. However, the cell and protein context should be considered when using such peptides for metabolic engineering applications. We recognized three 2A sequences with high potential to be used in S. cerevisiae among 22 previously described peptides. Friedelin was the first effective heterologous product produced in yeast using ERBV-1 2A peptide as a step forward to improve pathway cloning and metabolic engineering of yeast. The present analysis of best 2A ‘self-cleavage’ peptides in yeast could be especially useful for applications involving expression of complex pathways. SUPPLEMENTARY DATA Supplementary data are available at FEMSYR online. Acknowledgements We are grateful to thank Mariana M. Santoni and Juliana Rodrigues for their technical assistance. FUNDING This work was supported by the Novo Nordisk Foundation and the Knut and Alice Wallenberg Foundation. We also would like to thank the São Paulo Research Foundation (FAPESP) [grant number 2014/25705-0]. Conflict of interest. None declare. REFERENCES Ahier A , Jarriault S . Simultaneous expression of multiple proteins under a single promoter in Caenorhabditis elegans via a versatile 2A-based toolkit . J Am Chem Soc 2014 ; 196 : 3234 – 41 . Amorim Araújo J , Ferreira TC , Rubini MR et al. Coexpression of cellulases in Pichia pastoris as a self-processing protein fusion . AMB Express 2015 ; 5 : 84 . Google Scholar CrossRef Search ADS PubMed Antonisamy P , Duraipandiyan V , Aravinthan A et al. Protective effects of friedelin isolated from Azima tetracantha Lam. against ethanol-induced gastric ulcer in rats and possible underlying mechanisms . Eur J Pharmacol 2015 ; 750 : 167 – 75 . Google Scholar CrossRef Search ADS PubMed Atkins JF , Wills NM , Loughran G et al. A case for “StopGo”: reprogramming translation to augment codon meaning of GGN by promoting unconventional termination (Stop) after addition of glycine and then allowing continued translation (Go) . RNA 2007 ; 13 : 803 – 10 . Google Scholar CrossRef Search ADS PubMed Beekwilder J , van Rossum HM , Koopman F et al. Polycistronic expression of a beta-carotene biosynthetic pathway in Saccharomyces cerevisiae coupled to beta-ionone production . J Biotechnol 2014 ; 192 : 383 – 92 . Google Scholar CrossRef Search ADS PubMed Borodina I , Nielsen J . Advances in metabolic engineering of yeast Saccharomyces cerevisiae for production of chemicals . Biotechnol J 2014 ; 9 : 609 – 20 . Google Scholar CrossRef Search ADS PubMed Breitling R , Takano E . Synthetic biology advances for pharmaceutical production . Curr Opin Biotech 2015 ; 35 : 46 – 51 . Google Scholar CrossRef Search ADS PubMed Chen X , Petranovic D . Amyloid-beta peptide-induced cytotoxicity and mitochondrial dysfunction in yeast . FEMS Yeast Res 2015 ; 15 : 662 – 69 . Google Scholar CrossRef Search ADS Chng J , Wang T , Nian R et al. Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells . MAbs 2015 ; 7 : 403 – 12 . Google Scholar CrossRef Search ADS PubMed Corey EJ , Matsuda SP , Bartel B . Molecular cloning, characterization, and overexpression of ERG7, the Saccharomyces cerevisiae gene encoding lanosterol synthase . P Natl Acad Sci USA 1994 ; 91 : 2211 – 15 . Google Scholar CrossRef Search ADS Corsino J , Carvalho PRF , Kato MJ et al. Biosynthesis of friedelane and quinonemethide triterpenoids is compartmentalized in Maytenus aquifolium and Salacia campestris . Phytochemistry 2000 ; 55 : 741 – 48 . Google Scholar CrossRef Search ADS PubMed Curran KA , Morse NJ , Markham KA et al. Short synthetic terminators for improved heterologous gene expression in yeast . ACS Synth Biol 2015 ; 4 : 824 – 32 . Google Scholar CrossRef Search ADS PubMed Daniels RW , Rossano AJ , Macleod GT et al. Expression of multiple transgenes from a single construct using viral 2A peptides in Drosophila . Plos One 2014 ; 9 : e100637 . Google Scholar CrossRef Search ADS PubMed David F , Nielsen J , Siewers V . Flux control at the Malonyl-CoA node through hierarchical dynamic pathway regulation in Saccharomyces cerevisiae . ACS Synth Biol 2016 ; 5 : 224 – 33 . Google Scholar CrossRef Search ADS PubMed De Felipe P , Hughes LE , Ryan MD et al. Co-translational, intraribosomal cleavage of polypeptides by the foot-and-mouth disease virus 2A peptide . J Biol Chem 2003 ; 278 : 11441 – 8 . Google Scholar CrossRef Search ADS PubMed Donnelly ML , Gani D , Flint M et al. The cleavage activities of aphthovirus and cardiovirus 2A proteins . J Gen Virol 1997 ; 78 : 13 – 21 . Google Scholar CrossRef Search ADS PubMed Donnelly ML , Hughes LE , Luke G et al. The ‘cleavage’ activities of foot-and-mouth disease virus 2A site-directed mutants and naturally occurring ‘2A-like’ sequences. J Gen Virol 2001 ; 82 : 1027 – 41 . Google Scholar CrossRef Search ADS PubMed Donnelly ML , Luke G , Mehrotra A et al. Analysis of the aphthovirus 2A/2B polyprotein ‘cleavage’ mechanism indicates not a proteolytic reaction, but a novel translational effect: a putative ribosomal ‘skip’ . J Gen Virol 2001 ; 82 : 1013 – 25 . Google Scholar CrossRef Search ADS PubMed Doronina VA , Wu C , de Felipe P et al. Site-specific release of nascent chains from ribosomes at a sense codon . Mol Cell Biol 2008 ; 28 : 4227 – 39 . Google Scholar CrossRef Search ADS PubMed Edelheit O , Hanukoglu A , Hanukoglu I . Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies . BMC Biotechnol 2009 ; 9 : 61 . Google Scholar CrossRef Search ADS PubMed Fang J , Qian JJ , Yi S et al. Stable antibody expression at therapeutic levels using the 2A peptide . Nat Biotechnol 2005 ; 23 : 584 – 90 . Google Scholar CrossRef Search ADS PubMed Farré G , Blancquaert D , Capell T et al. Engineering complex metabolic pathways in plants . Annu Rev Plant Biol 2014 ; 65 : 187 – 223 . Google Scholar CrossRef Search ADS PubMed Fletcher E , Krivoruchko A , Nielsen J . Industrial systems biology and its impact on synthetic biology of yeast cell factories . Biotechnol Bioeng 2016 ; 113 : 1164 – 70 . Google Scholar CrossRef Search ADS PubMed Gao SY , Jack MM , O’Neill C . Towards optimising the production of and expression from polycistronic vectors in embryonic stem cells . PLos One 2012 ; 7 : e48668 . Google Scholar CrossRef Search ADS PubMed Geier M , Fauland P , Vogl T et al. Compact multi-enzyme pathways in P. pastoris . Chem Commun (Camb) 2015 ; 51 : 1643 – 6 . Google Scholar CrossRef Search ADS PubMed Gibson DG , Young L , Chuang RY et al. Enzymatic assembly of DNA molecules up to several hundred kilobases . Nat Methods 2009 ; 6 : 343 – 5 . Google Scholar CrossRef Search ADS PubMed Ha SH , Liang YS , Jung H et al. Application of two bicistronic systems involving 2A and IRES sequences to the biosynthesis of carotenoids in rice endosperm . Plant Biotechnol J 2010 ; 8 : 928 – 38 . Google Scholar CrossRef Search ADS PubMed Halpin C , Cooke SE , Barakate A et al. Self-processing 2A-polyproteins–a system for co-ordinate expression of multiple proteins in transgenic plants . Plant J 1999 ; 17 : 453 – 9 . Google Scholar CrossRef Search ADS PubMed Holst J , Szymczak-Workman AL , Vignali KM et al. Generation of T-cell receptor retrogenic mice . Nat Protoc 2006 ; 1 : 406 – 17 . Google Scholar CrossRef Search ADS PubMed Hu Y , Zhou YJ , Bao J et al. Metabolic engineering of Saccharomyces cerevisiae for production of germacrene A, a precursor of beta-elemene . J Ind Microbiol Biot 2017 ; 44 : 1065 – 72 . Google Scholar CrossRef Search ADS Jakočiūnas T , Bonde I , Herrgård M et al. Multiplex metabolic pathway engineering using CRISPR/Cas9 in Saccharomyces cerevisiae . Metab Eng 2015 ; 28 : 213 – 22 . Google Scholar CrossRef Search ADS PubMed Jensen NB , Strucko T , Kildegaard KR et al. EasyClone: method for iterative chromosomal integration of multiple genes Saccharomyces cerevisiae . FEMS Yeast Res 2014 ; 14 : 238 – 48 . Google Scholar CrossRef Search ADS PubMed Khoomrung S , Chumnanpuen P , Jansa-Ard S et al. Rapid quantification of yeast lipid using microwave-assisted total lipid extraction and HPLC-CAD . Anal Chem 2013 ; 85 : 4912 – 19 . Google Scholar CrossRef Search ADS PubMed Kim JH , Lee SR , Li LH et al. High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and Mice . PLoS One 2011 ; 6 : e18556 . Google Scholar CrossRef Search ADS PubMed Kirby J , Romanini DW , Paradise EM et al. Engineering triterpene production in Saccharomyces cerevisiae–β-amyrin synthase from Artemisia annua . FEBS J 2008 ; 275 : 1852 – 9 . Google Scholar CrossRef Search ADS PubMed Krivoruchko A , Nielsen J . Production of natural products through metabolic engineering of Saccharomyces cerevisiae . Curr Opin Biotech 2014 ; 35C : 7 – 15 . Kuzmich AI , Vvedenskii AV , Kopantzev EP et al. Quantitative comparison of gene co-expression in a bicistronic vector harboring IRES or coding sequence of porcine teschovirus 2A peptide . Russ J Bioorg Chem 2013 ; 39 : 406 – 16 . Google Scholar CrossRef Search ADS Liu Z , Chen O , Wall JBJ et al. Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector . Sci Rep 2017 ; 7 . DOI:10.1038/s41598-017-02460-2 . Lorens JB , Pearsall DM , Swift SE et al. Stable, stoichiometric delivery of diverse protein functions . J Biochem Bioph Meth 2004 ; 58 : 101 – 10 . Google Scholar CrossRef Search ADS Luke GA , de Felipe P , Lukashev A et al. Occurrence, function and evolutionary origins of ‘2A-like’ sequences in virus genomes . J Gen Virol 2008 ; 89 : 1036 – 42 . Google Scholar CrossRef Search ADS PubMed Mikkelsen MD , Buron LD , Salomonsen B et al. Microbial production of indolylglucosinolate through engineering of a multi-gene pathway in a versatile yeast expression platform . Metab Eng 2012 ; 14 : 104 – 11 . Google Scholar CrossRef Search ADS PubMed Minskaia E , Luke GA . 2A - the “go-to” technology for transgene co-expression . Single Cell Biol 2015 ; S1 . DOI: 10.4172/2168-9431.S1-004 . Minskaia E , Nicholson J , Ryan MD . Optimisation of the foot-and-mouth disease virus 2A co-expression system for biomedical applications . BMC Biotechnol 2013 ; 13 : 67 . Google Scholar CrossRef Search ADS PubMed Minskaia E , Ryan MD . Protein coexpression using FMDV 2A: effect of ‘‘linker’’ residues . Biomed Res Int 2013 ; 2013 . http://dx.doi.org/10.1155/2013/291730 . Mumberg D , Müller R , Funk M . Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds . Gene 1995 ; 156 : 119 – 22 . Google Scholar CrossRef Search ADS PubMed Odon V , Luke GA , Roulston C et al. APE-type non-LTR retrotransposons of multicellular organisms encode virus-like 2A oligopeptide sequences, which mediate translational recoding during protein synthesis . Mol Biol Evol 2013 ; 30 : 1955 – 65 . Google Scholar CrossRef Search ADS PubMed Ongley SE , Bian X , Neilan BA et al. Recent advances in the heterologous expression of microbial natural product biosynthetic pathways . Nat Prod Rep 2013 ; 30 : 1121 – 38 . Google Scholar CrossRef Search ADS PubMed Partow S , Siewers V , Bjørn S et al. Characterization of different promoters for designing a new expression vector in Saccharomyces cerevisiae . Yeast 2010 ; 27 : 955 – 64 . Google Scholar CrossRef Search ADS PubMed Polakowski T , Stahl U , Lang C . Overexpression of a cytosolic hydroxymethylglutaryl-CoA reductase leads to squalene accumulation in yeast . Appl Microbiol Biot 1998 ; 49 : 66 – 71 . Google Scholar CrossRef Search ADS Provost E , Rhee J , Leach SD . Viral 2A peptides allow expression of multiple proteins from a single ORF in transgenic zebrafish embryos . Genesis 2007 ; 45 : 625 – 9 . Google Scholar CrossRef Search ADS PubMed Rajkumar AS , Liu G , Bergenholm D et al. Engineering of synthetic, stress-responsive yeast promoters . Nucleic Acids Res 2016 ; 44 : e136 . Google Scholar CrossRef Search ADS PubMed Redden H , Alper HS . The development and characterization of synthetic minimal yeast promoters . Nat Commun 2015 ; 6 . DOI: 10.1038/ncomms8810 . Rothwell DG , Crossley R , Bridgeman JS et al. Functional expression of secreted proteins from a bicistronic retroviral cassette based on foot-and-mouth disease virus 2A can be position dependent . Hum Gene Ther 2010 ; 21 : 1631 – 7 . Google Scholar CrossRef Search ADS PubMed Roulston C , Luke GA , de Felipe P et al. ‘2A-Like’ Signal sequences mediating translational recoding: a novel form of dual protein targeting . Traffic 2016 ; 17 : 923 – 39 . Google Scholar CrossRef Search ADS PubMed Ryan MD , Donnelly M , Lewis A et al. A Model for nonstoichiometric, cotranslational protein scission in eukaryotic ribosomes . Bioorg Chem 1999 ; 27 : 55 – 79 . Google Scholar CrossRef Search ADS Ryan MD , Drew J . Foot-and-mouth disease virus 2A oligopeptide mediated cleavage of an artificial polyprotein . EMBO J 1994 ; 13 : 928 – 33 . Google Scholar PubMed Ryan MD , King AM , Thomas GP . Cleavage of foot-and-mouth disease virus polyprotein is mediated by residues located within a 19 amino acid sequence . J Gen Virol 1991 ; 72 : 2727 – 32 . Google Scholar CrossRef Search ADS PubMed Sambrook J , Russell DW . Molecular Cloning: A Laboratory Manual . 3rd edn . New York : Cold Spring Harbor Laboratory Press , 2001 . Scalcinati G , Partow S , Siewers V et al. Combined metabolic engineering of precursor and co-factor supply to increase alpha-santalene production by Saccharomyces cerevisiae . Microb Cell Fact 2012 ; 11 : 117 . Google Scholar CrossRef Search ADS PubMed Sharma P , Yan F , Doronina VA et al. 2A peptides provide distinct solutions to driving stop-carry on translational recoding . Nucleic Acids Res 2012 ; 40 : 3143 – 51 . Google Scholar CrossRef Search ADS PubMed Souza-Moreira TM , Alves TB , Pinheiro KA et al. Friedelin synthase from Maytenus ilicifolia: leucine 482 plays an essential role in the production of the most rearranged pentacyclic triterpene . Sci Rep 2016 ; 6 : 36858 . Google Scholar CrossRef Search ADS PubMed Sunil C , Duraipandiyan V , Ignacimuthu S et al. Antioxidant, free radical scavenging and liver protective effects of friedelin isolated from Azima tetracantha Lam. leaves . Food Chem 2013 ; 139 : 860 – 5 . Google Scholar CrossRef Search ADS PubMed Szymczak AL , Workman CJ , Wang Y et al. Correction of multi-gene deficiency in vivo using a single ‘self-cleaving’ 2A peptide-based retroviral vector . Nat Biotechnol 2004 ; 22 : 589 – 94 . Google Scholar CrossRef Search ADS PubMed Tang X , Liu X , Tao G et al. “Self-cleaving” 2A peptide from porcine teschovirus-1 mediates cleavage of dual fluorescent proteins in transgenic Eimeria tenella . Vet Res 2016 ; 47 : 68 . Google Scholar CrossRef Search ADS PubMed Torres V , Barra L , Garcés F et al. A bicistronic lentiviral vector based on the 1D/2A sequence of foot-and-mouth disease virus expresses proteins stoichiometrically . J Biotechnol 2010 ; 146 : 138 – 42 . Google Scholar CrossRef Search ADS PubMed Unkles SE , Valiante V , Mattern DJ et al. Synthetic biology tools for bioprospecting of natural products in eukaryotes . Chem Biol 2014 ; 21 : 502 – 8 . Google Scholar CrossRef Search ADS PubMed Wang Y , Wang F , Wang R et al. 2A self-cleaving peptide-based multi-gene expression system in the silkworm Bombyx mori . Sci Rep 2015 ; 5 . DOI: 10.1038/srep16273 . Yang S , Cohen CJ , Peng PD et al. Development of optimal bicistronic lentiviral vectors facilitates high-level TCR gene expression and robust tumor cell recognition . Gene Ther 2008 ; 15 : 1411 – 23 . Google Scholar CrossRef Search ADS PubMed Zhou YJ , Gao W , Rong Q et al. Modular pathway engineering of diterpenoid synthases and the mevalonic acid pathway for miltiradiene production . J Am Chem Soc 2012 ; 134 : 3234 – 41 . Google Scholar CrossRef Search ADS PubMed © FEMS 2018. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

FEMS Yeast ResearchOxford University Press

Published: Mar 30, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off