Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/ou_press/root-respiratory-burst-oxidase-homologue-dependent-h2o2-production-lkCzOzoKxs
- Publisher
- Oxford University Press
- Copyright
- Copyright © 2022 Society for Experimental Biology
- ISSN
- 0022-0957
- eISSN
- 1460-2431
- DOI
- 10.1093/jxb/erx386
- Publisher site
- See Article on Publisher Site
Abstract
Plant salt tolerance can be improved by grafting onto salt-tolerant rootstocks. However, the underlying signaling mechanisms behind this phenomenon remain largely unknown. To address this issue, we used a range of physiologi- cal and molecular techniques to study responses of self-grafted and pumpkin-grafted cucumber plants exposed to 75 mM NaCl stress. Pumpkin grafting significantly increased the salt tolerance of cucumber plants, as revealed by higher plant dry weight, chlorophyll content and photochemical efficiency ( F /F ), and lower leaf Na content. Salinity v m stress resulted in a sharp increase in H O production, reaching a peak 3 h after salt treatment in the pumpkin- 2 2 grafted cucumber. This enhancement was accompanied by elevated relative expression of respiratory burst oxidase homologue (RBOH) genes RbohD and RbohF and a higher NADPH oxidase activity. However, this increase was much delayed in the self-grafted plants, and the difference between the two grafting combinations disappeared after 24 h. + + The decreased leaf Na content of pumpkin-grafted plants was achieved by higher Na exclusion in roots, which was + + + driven by the Na /H antiporter energized by the plasma membrane H -ATPase, as evidenced by the higher plasma membrane H -ATPase activity and higher transcript levels for PMA and SOS1. In addition, early stomatal closure was also observed in the pumpkin-grafted cucumber plants, reducing water loss and maintaining the plant’s hydration status. When pumpkin-grafted plants were pretreated with an NADPH oxidase inhibitor, diphenylene iodonium (DPI), the H O level decreased significantly, to the level found in self-grafted plants, resulting in the loss of the salt toler - 2 2 ance. Inhibition of the NADPH oxidase-mediated H O signaling in the root also abolished a rapid stomatal closure in 2 2 the pumpkin-grafted plants. We concluded that the pumpkin-grafted cucumber plants increase their salt tolerance via a mechanism involving the root-sourced respiratory burst oxidase homologue-dependent H O production, which 2 2 enhances Na exclusion from the root and promotes an early stomatal closure. + + Keywords: Grafting, H -ATPase, Na exclusion, ROS, salinity, signaling, stomatal closure. Introduction Soil salinity is a global challenge affecting agricultural pro- Among all types of salinity, the most soluble and widespread duction worldwide. More than 800 million hectares of agri- salt is NaCl, and Na toxicity therefore prevails in most nat- cultural land suffers from soil salinity (Rengasamy, 2010). ural habitats restricting plant growth. For most glycophytes, © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Downloaded from https://academic.oup.com/jxb/article/69/14/3465/4626780 by DeepDyve user on 15 July 2022 3466 | Niu et al. the ability of a plant to minimize accumulation of the toxic taken from a more tolerant genotype or species. Plants of the Na in the sensitive shoot is a crucial feature of salinity tol- Cucurbitaceae such as melon, watermelon, and cucumber are erance. However, as most of the Na delivered to the shoot glycophytes of high economic importance, but all of them are remains in the shoot, and only a small portion can be recir- sensitive to Na (Zhu et al., 2008). At the same time pump- culated back to the root via the phloem (Munns and Tester, kin, which belongs to the same family, is considerably more 2008), the salt tolerance largely depends on the capacity of tolerant under saline conditions (Lee et al., 2010; Rouphael plants to limit the net transport of Na from the root to the et al., 2012). Grafting cucumber scion onto pumpkin root- shoot. This process relies on several key mechanisms; one of stock can therefore potentially lead to higher salt tolerance them is the efficient Na efflux from the root to the external in this species. Previous studies have suggested that pump- medium. kin exhibited a higher capacity in limiting the transport of + + Active Na extrusion is mediated by the plasma membrane Na from root to shoot than melon and cucumber (Edelstein + + (PM) Na /H antiporter (Shi et al., 2002). Here, energy- et al., 2011; Huang et al., 2013). Electrophysiological studies + + dependent Na transport is coupled to the H electrochemi- have also demonstrated that pumpkin roots exhibited a high + + cal potential difference established by H translocation efficiency in extruding Na (Lei et al., 2014). As this increased pumps (Hasegawa et al., 2003). The NaCl-induced activation extrusion was concurrent with an increased H influx under + + + of the PM Na /H antiporter has been reported in various NaCl stress, this suggested that Na exclusion in salt stressed + + plant species, such as tomato (Wilson and Shannon, 1995), pumpkin roots was the result of an active Na /H antiporter Arabidopsis (Qiu et al., 2002) and rice (Martínez-Atienza and across the PM fueled by the plasma membrane H -ATPase + + Quintero, 2007). encoded by PMA (Li et al., 2015). Na /H exchange in the + + Salt stress also induces the production of reactive oxy- root was inhibited by amiloride (a Na /H antiporter inhibi- gen species (ROS) (Zhen et al., 2011). When accumulated tor) and vanadate (a PM H -ATPase inhibitor) indicating + + + in excessive quantities, ROS may react with various cellular that the H -ATPase-driven Na /H antiport plays an impor- targets such as nucleic acids, proteins, lipids and chlorophyll, tant role in dealing with salt stress (Sun et al., 2009). causing serious damage (Niu and Liao, 2016). At the same In the present study, we have compared the accumulation time, besides their harmful effects, ROS can also act as sign- patterns of H O and Na between two grafted combinations 2 2 aling molecules that regulate plant development, and biotic (self-grafted and pumpkin-grafted cucumber seedlings). The and abiotic stress responses (Mittler et al., 2004; Bose et al., ion fluxes in root and hypocotyl were evaluated by the non- 2014; Li et al., 2014; Li et al., 2016). More and more evidence invasive micro-test technology (NMT). Linked with phar- has accumulated suggesting that ROS play an important role macological experiments, these results demonstrate that root in plant salinity tolerance (Wang et al., 2013; Hossain and respiratory burst oxidase homologue (RBOH)-dependent Dietz, 2016). For example, Arabidopsis AtrbohF knockout H O production confers salt tolerance on grafted cucum- 2 2 mutants, which lack the respiratory burst oxidase proteins ber by controlling Na exclusion and stomatal closure, thus (NADPH oxidases that catalyse the production of ROS in the optimizing plant ionic and water balance under hostile saline apoplast), showed an increased salt sensitivity and impaired conditions. + + Na /K homeostasis (Ma et al., 2012; Jiang et al., 2013). Among all the ROS, H O has a comparatively long lifespan 2 2 and a small size, which permits it to traverse the cellular mem- Materials and methods branes to different cellular compartments. Some recent find - Grafting method and growth conditions ings led to speculation that H O may act as a stress signal 2 2 The experiment was carried out in the growth chambers at Huazhong + + that regulates the PM Na /H antiport system under saline Agricultural University, Central China. A salt-sensitive cucumber conditions and alters SOS1 mRNA stability in Arabidopsis (Cucumis sativus L.) cv. Jinchun No. 2 (abbreviated here as ‘C’) was + + which is fundamental to maintaining cellular K /Na homeo- used, either as a scion or a rootstock, and a salt-tolerant pumpkin (Cucurbita moschata Duch.) cv. Chaojiquanwang (abbreviated as stasis (Zhang et al., 2007). ‘P’) was used as a rootstock. Two grafted combinations were used in H O has also been demonstrated to mediate rapid systemic 2 2 this study: cucumber self-grafted plants (C/C) and pumpkin-grafted signaling stimulated by a root-derived ABA triggered by high plants (C/P). We did not use ungrafted plants as additional controls, temperature stress (Li et al., 2014). However, the role and spe- since our previous studies showed that the response of ungrafted cific mechanisms of H O -induced root-to-shoot communi- and self-grafted cucumber/pumpkin to salt stress was similar 2 2 (Huang et al., 2013); this included plant growth reduction, Na con- cation are largely unknown for salinity stress. Several papers centration, and stomatal conductance under salt stress. Thus, it was demonstrated that H O functions in the regulation of stoma- 2 2 concluded that the advantage of grafted cucumber plants is attribut- tal aperture (Desikan et al., 2005; Danquah et al., 2014; Niu able to the rootstock, not the grafting process itself (Lei et al., 2014). and Liao, 2016). Silencing RBOH1 led to an impaired capac- The seeds were soaked in tap water for 6 h and incubated in the ity for stomatal closure in tomato (Zhou et al., 2014; Yi et al., dark at 30 °C until germination. Rootstocks were sown 4 d earlier than cucumber scions. When the rootstock seedlings had developed 2015). However, all these reports dealt with H O produced in 2 2 one true leaf, the cucumber seedlings were grafted onto them by (or applied to) the shoot and, to the best of our knowledge, using the ‘hole insertion grafting’ method described by Lee (1994). no reports are available linking root-originating ROS signals Briefly, the first true leaf of the rootstock was removed and the with stomatal operation in salt-grown plants. apex of the rootstock was perforated. The scion was prepared with Grafting is a widely used agronomic practice that improves two cuts giving a sharp edge of about 10 mm of hypocotyl. The scion was then inserted into the rootstock hole from the top. After a plant’s salt tolerance by replacing the sensitive root with one Downloaded from https://academic.oup.com/jxb/article/69/14/3465/4626780 by DeepDyve user on 15 July 2022 H O mediates salt tolerance of grafted cucumber | 3467 2 2 grafting, the seedlings were placed in a ‘healing chamber’ in which the method described by Zhou and Leul (1998). The washed leaves the relative humidity was kept at ≥95% for the first 3 d and then (0.1 g) were cut into 1 cm pieces and placed in a 50 ml test tube gradually decreased to 75%. The air temperature was kept 28–30 °C, containing 30 ml deionized water. The leaf samples were immersed and plants were kept in the darkness for the first 48 h, and then and vibrated for 3 h, and then the conductivity of the solution was exposed to a 14/10 h light/dark cycle, 28/18 °C, with photosynthetic measured using a conductivity meter (SG78, Mettler Toledo). After –2 –1 photon fl ux density 600 μmol m s . After 7 d the grafted plants boiling the samples for 15 min, their conductivity was measured were transferred to plastic containers (six seedlings per container) again when the solution was cooled to room temperature. The rela- containing 8 liters of full-strength Hoagland’s solution. The nutrient tive electrical conductivity (REC) was calculated as follows: solution was refreshed at 3 d intervals and continuously aerated. At the four-leaf stage, grafted combinations were used for subsequent REC1 %/ = CC × 00 () () experiments. where C and C are the electrolyte conductivities measured before 1 2 and after boiling, respectively. Salt treatment and NADPH oxidase inhibitor application To study the Na and H O accumulation patterns in two grafted 2 2 Determination of H O concentration in roots and leaves 2 2 combinations, NaCl was added into the growth media to obtain a H O was extracted from 0.5 g fresh leaf or root samples ground final concentration of 75 mM. The choice of this specific concen - 2 2 in 3 ml of 1 M HClO . After centrifugation, the supernatant was tration was determined by the fact that we aimed to investigate the 4 adjusted to pH 6.0–7.0 and filtered through a Sep-Pak C18 cartridge signaling role of H O and thus tried to select the concentration that 2 2 (Millipore, Milford, MA, USA). After elution with 4 ml distilled was strong enough to reveal the phenotypic difference but could be water, an aliquot of the sample (800 μl) was mixed with 400 μl reac- considered ‘safe’ in terms of damage to the root. The time courses of tion buffer containing 4 mM 2,2′-azino-di(3-ethylbenzthiazoline- malonyldialdehyde (MDA), relative electrical conductivity (REC), 6-sulfonic acid) and 100 mM potassium acetate at pH 4.4, and Na and H O contents were monitored by plant sampling at 0, 1, 2 2 400 μl deionized water. The reaction was started by the addition of 3, 12, 24, 48, and 120 h after commencement of salt treatment. The 3 μl (0.5 U) of horseradish peroxidase. H O content was measured biomass, relative chlorophyll content (measured with a SPAD meter) 2 2 spectrophotometrically at the optical density at 412 nm (Willekens and chlorophyll fluorescence ( F /F ) were measured 120 h after salt v m et al., 1997). treatment. It was true that 100 mM NaCl treatment led to a more obvious difference of the phenotype (see Supplementary Fig. S1 at JXB Determination of Na content in roots and leaves online), but high concentrations of NaCl (100 mM or higher) inevi- Dried roots and leaves of two grafted combinations were ground tably caused serious damage in the root of C/C with an enhanced using a mortar and pestle; 0.1 g of powder was then digested with H O level (Supplementary Fig. S2). This increased H O level was 2 2 2 2 + 5 ml of nitric acid for 3 h, and then Na concentrations were ana- detected after 5 d of NaCl treatment, which might be a result of lysed using an atomic absorption spectrophotometer (Varian spectra an impaired redox system rather than a signal. The purpose of this AA 220, Varian, Palo Alto, CA, USA). study was to evaluate the function of root-sourced H O as a molec- 2 2 ular signal, so we use 75 mM NaCl to distinguish the salt tolerance between two grafted combinations. Measurement of ion fluxes in roots and hypocotyls with NMT In some experiments, the NADPH oxidase inhibitor diphenylene A so-called ‘recovery protocol’ (Cuin et al., 2011) was used to quan- iodonium (DPI) was added to the medium to a final concentration tify the activity of the Na efflux system in plant root and hypocotyls. of 20 μM. The plants were pretreated with DPI for 6 h, and then + + For this, net Na and H fluxes were measured using the non-inva - transferred to Hoagland’s solution containing 75 mM NaCl. The sive micro-test technology (NMT) technique (YoungerUSA LLC, treatments without DPI or NaCl were set as controls. H O content, 2 2 Amherst, MA, USA) and ASET 2.0 (Sciencewares, Falmouth, MA, transpiration rate, stomatal conductance, NADPH oxidase activity, USA) and iFluxes 1.0 (YoungerUSA) software (Kochian et al., 1992). H -ATPase activity, and related gene (RbohD, RbohF, PMA, SOS1) Grafted plants were treated with 75 mM NaCl for 24 h, leading to sig- expression levels were determined 3 h after salt treatment. The tissue + + + nificant accumulation of Na in roots and hypocotyls and activation Na content and Na and H fluxes in roots and hypocotyls were of the Na efflux system. The roots and hypocotyls from control and determined 24 h after salt treatment. salt-treated plants were then rinsed with distilled water and trans- ferred to the measuring solution containing very little salt (0.1 mM KCl, 0.1 mM CaCl , 0.1 mM MgSO , 0.1 mM NaCl, 0.3 mM MES, Relative chlorophyll content (SPAD) and chlorophyll fluorescence 2 4 pH 6.0). Plant specimens were immobilized in the middle of poly-L- measurements lysine-coated coverslips (2 cm×2 cm) in the measuring chamber. Net Relative chlorophyll content was measured with a chlorophyll meter fluxes were measured after 30 min (for roots) and 15 min (for hypoco - (SPAD-502, Minolta Corp., Ltd, Osaka, Japan) from the fully + tyls) equilibration in low-Na solution. The measuring sites in hypoc- expanded functional leaves (the third from the apex). Measurements otyl were 1 cm above or below the grafting union. Before testing, the were made at a central point on the leaflet between the midrib and upper part of the seedling was removed by a razor blade to expose the leaf margin. Chlorophyll fluorescence was determined with the xylem vessel (deep colored area indicated in Supplementary Fig. an imaging-PAM chlorophyll fluorometer (Heinz Walz, GmbH, S3). The measuring site in root was 400 μm from the root tip (see Effeltrich, Germany). Plants were dark-adapted for 30 min to meas- Supplementary Fig. S3), which corresponds to the elongation zone ure the maximum photochemical efficiency of PSII ( F /F ) at the + v m and in which a vigorous efflux of Na has been observed in our previ- same position as chlorophyll content. ous study (Lei et al., 2014). The magnitude of steady-state ion fluxes was calculated by data recorded over a 240 s period (Supplementary Fig. S4). The glass micropipettes and measuring solutions were pre- Analysis of lipid peroxidation and membrane permeability pared as previously described (Lei et al., 2014). in leaves The level of lipid peroxidation in leaves was assessed by measuring Determination of transpiration rate and stomatal conductance the content of malondialdehyde (MDA) using the thiobarbituric acid reaction (Heath and Packer, 1968). Membrane permeability of the The second recently expanded leaves were selected for the determi- leaf was measured as the relative electrical conductivity according to nation of transpiration rate and stomatal conductance with an open Downloaded from https://academic.oup.com/jxb/article/69/14/3465/4626780 by DeepDyve user on 15 July 2022 3468 | Niu et al. gas exchange system (Li-6400, Li-Cor, Inc., Lincoln, NE, USA). using the ABI 7000 machine (Applied Biosystems), and the cycling The assimilatory chamber was controlled to maintain the leaf tem- conditions consisted of denaturation at 94 °C for 30 s, followed by −1 perature at 28 °C, CO concentration at 360 μmol mol , and pho- 40 cycles of denaturation at 95 °C for 5 s, annealing at 55 °C for 15 s, −2 −1 tosynthetic photon-flux density at 600 μmol m s . Five replicate and extension at 72 °C for 15 s. The specific primers ( Table 1) were plants per treatment were measured between 8:30 and 11:30 AM. designed based on published mRNA of Cucurbita moschata on the Cucurbit Genomics Database (http://cucurbitgenomics.org) using Primer 5 software. The relative gene expression was determined as Determination of relative water content previously described by Livak and Schmittgen (2001). The relative water content (RWC) of leaves and roots was calculated as described by Weatherley (1950). Results Visualization of H O in root using fluorescent dye 2 2 Pumpkin-grafted cucumber was more tolerant than Confocal laser scanning microscopy (Leica TCS-SP2, Leica self-grafted cucumber Microsystems GmbH, Wetzlar, Germany) was used to visualize H O accumulation in plant roots in vivo. Roots from two grafted 2 2 Salt-induced biomass reduction was significantly stronger in combinations were incubated in the reaction buffer containing 10 the self-grafted (C/C) than in pumpkin-grafted (C/P) cucum- mM Hepes–NaOH (pH 7.5) and 10 μM 2′,7′-dichlorodihydro- ber (Fig. 1A, B) after 5 d of salt treatment. Salt treatment fluorescein diacetate (H DCF-DA; Invitrogen) for 20 min at 30 °C. Thereafter, the roots were washed with the HEPES–NaOH buffer had also caused a significant reduction in relative chlorophyll (pH 7.5) and fluorescence measurements conducted. The dye excita - content (SPAD) and chlorophyll fluorescence in leaves of tion was at 488 nm; emitted light was detected at 522 nm. C/C (Fig. 1C, D). To confirm that the salt tolerance of C/P was higher than C/C, the level of MDA and relative electri- Isolation of the plasma membrane vesicles and determination of cal conductivity (REC) were measured in C/C and C/P. Salt NADPH oxidase and H -ATPase activities stress increased MDA content and REC in C/C after 48 h, whereas in C/P plants, the increase in MDA content and REC Root plasma membrane vesicles were isolated using a two-phase aqueous polymer partition system (Xia et al., 2009). The NADPH- was only observed after a prolonged treatment until 120 h dependent O -generating activity in isolated plasma membrane (Fig. 2B), suggesting that C/P is indeed more tolerant of salt vesicles was determined by the protocol described previously (Zhou stress than C/C. et al., 2014). The H -ATPase activity was determined by measuring the release of inorganic phosphate (P ) (Kłobus and Janicka-Russak, 2004) and expressed as the difference between the activities meas- Time-dependent kinetics of Na and H O 2 2 ured in the absence and presence of Na VO . 3 4 accumulation in salt-treated plants Na content in roots of both grafted combinations reached Total RNA extraction and gene expression analysis a plateau after about 12 h and then remained more or less Total RNA was isolated from the seedling roots using TransZol rea- constant (Fig. 3A, C), with C/P roots accumulating more Na gent (TransGen Biotech, Inc., Beijing, China) in accordance with compared with C/C roots (significant at P<0.05). In shoots, the manufacturer’s protocol. After extraction, the total RNA was dissolved in the diethylpyrocarbonate-treated water. The cDNA Na increased sharply in the self-grafted cucumber while template for the quantitative real-time PCR (qRT-PCR) was syn- in the pumpkin-grafted cucumber Na accumulation in the thesized from 1 μg of total RNA using HiScript II Q Select RT shoot became noticeable only after 48 h of salinity treatment. SuperMix for qPCR (Vazyme, Piscataway, NJ, USA). At the end of experiment, the Na concentration in leaves of For qRT-PCR analysis, we amplified the PCR products in triplicate −1 C/C plants reached 18.2 mg g DW, which was nearly 4 times by using 1×Top Green qPCR SuperMix (TransGen Biotech, Inc., Beijing, China) in 10 μl qRT-PCR assays. The PCR was performed higher than in the leaves of C/P. Table 1. Gene-specific primers designed for qRT-PCR Grafted Gene Forward primer Reverse primer Genomics Database combinations accession C/C PMA GGCTGGTGTAGTTTGGA CATAGTCTTTCTTGGTCGTA Csa1G423270 SOS1 CCAACGGAGTGGTAAA AACAACGGAATCTGTAATC Csa5G098980 RbohD AACAACATCAAGGACCAG TCACCCAGTAGAAGTAAGC Csa3G845500 RbohF AGCCAGAACATACAGGG TTAGCCGTTAGGAGACAG Csa4G050170 EF1a ACTGTGCTGTCCTCATTATTG AGGGTGAAAGCAAGAAGAGC Csa2G139820 C/P PMA TAGAGTGAAGCCATCTCC CAAGCATAACGCCAGT CmoCh11G003690 SOS1 GGAGCCATTGGTTCGTC GGTGCCTCGCAGTAAGT CmoCh04G022490 RbohD ATGCCGAATACGAACC ATTAGCACCACCATCACA CmoCh14G010850 RbohF GTCATCTAACGAAACCTACA TCCCATCCCTTAACCA CmoCh04G007610 EF1a GCCTCAAACTCCAAGGATGA GGCTCCTTCTCGAGTTCCTT CmoCh08G009890 All primers were designed based on a published mRNA of Cucurbita moschata on the Cucurbit Genomics Database (http://cucurbitgenomics. org) using Primer 5 software. EF1a is the reference gene. Downloaded from https://academic.oup.com/jxb/article/69/14/3465/4626780 by DeepDyve user on 15 July 2022 H O mediates salt tolerance of grafted cucumber | 3469 2 2 Fig. 1. Effects of NaCl on the growth (A), dry weight (B), chlorophyll content (C) and photochemical efficiency ( F /F ) (D) of two grafted combinations, v m namely pumpkin-grafted cucumber (C/P) and self-grafted cucumber (C/C). Data are mean±SE (n=5). Columns with different letters are significantly different at P<0.05. Scale bar: 10 cm. To determine the possible involvement of the H O signal in roots and shoots. At the whole-plant level, the DPI pretreat- 2 2 stress tolerance, the levels of H O in the self-grafted cucum- ment increased Na concentration in leaves of C/P by 71% 2 2 ber and the pumpkin-grafted cucumber were measured. The (Fig. 5F) after 120 h of salinity treatment, compared with result indicated that the H O content was rapidly elevated non-inhibitor treatment. At the same time, inhibition of the 2 2 in roots of both grafted combinations and reached a peak at NADPH oxidase resulted in no significant change in Na 3 h. Then H O levels decreased during the period between accumulation in leaves of C/C plants (Fig. 5F). 2 2 3 and 12 h but remained elevated for at least 48 h after com- We next assayed the role of NADPH oxidase-produced mencement of the treatment (Fig. 3D). While the final H O H O in regulation of ionic relations in root (Fig. 5A, C) and 2 2 2 2 concentrations were not different between two grafting com- stem (Fig. 5B, D) at the cellular level, by measuring effect of binations, the NaCl-induced peak in H O production was DPI on net ion fluxes in these tissues using the NMT tech - 2 2 twice as high in C/P roots compared with their C/C coun- nique. In the apical regions of the roots, a massive efflux terparts (Fig. 3D). Similar results were reported when H O of Na from roots was recorded in two grafting combina- 2 2 content in root was visualized using the H DCF-DA fluores - tions following the transfer of salt-treated roots to low-Na cence probe (Fig. 4). Here, NaCl treatment caused a rapid (0.1 mM) solution (Fig. 5A). The mean rates were 555 and –2 –1 increase in H DCF-DA-dependent fluorescence in the roots 198 pmol cm s for C/C and C/P, respectively. Notably, of C/P, but not in C/C (Fig. 4). In leaves, stress-induced H O the DPI-pretreated C/P displayed 45% lower flux than treat - 2 2 increase was observed in C/P after 3 h, whereas in C/C plants, ment without DPI while the reduction was only 22% in roots H O increase was only observed after a prolonged treatment of C/C (Fig. 5A). Salt-treated roots also displayed a net H 2 2 of 24 h (Fig. 3B). influx in both grafting combinations ( Fig. 5C). Higher H influxes have been found in C/P compared with C/C, regard - less of salinity treatment. DPI pretreatment decreased Effects of DPI on Na transport and accumulation in net H fluxes by 61% and 73% in roots of C/C and C/P, grafted plants respectively. A significant positive correlation ( R =0.625; + + An NADPH oxidase inhibitor, DPI, was used to investigate P<0.05) was found between Na efflux and H influx in salt- + + the potential role of the plasmalemma-based H O produc- treated roots (Fig. 5E), suggesting the possibility of Na /H 2 2 tion in regulating Na transport and its accumulation in antiport. Downloaded from https://academic.oup.com/jxb/article/69/14/3465/4626780 by DeepDyve user on 15 July 2022 3470 | Niu et al. As mentioned above, the higher salt tolerance in pumpkin- grafted cucumber was correlated to the restricted transport of + + Na from root to shoot. To clarify the process of Na trans- port from root to shoot, we have used the NMT technique to measure ion flux at two positions along the hypocotyl: above (Fig. 5B) and bellow (Fig. 5D) the graft union. In the tissue + –2 –1 below the graft union, net Na efflux of 1284 pmol cm s was detected in the C/C combination while in C/P it was half –2 –1 + (only 669 pmol cm s ) indicating a reduced Na flux by root - stock of pumpkin. When fluxes were measured above the graft –2 –1 union, the values were 1204 pmol cm s for C/C but only 361 –2 –1 pmol cm s for C/P. Notably, root pretreatment with DPI caused much more Na to be translocated from the root to the shoot in the positions of above and below graft union in C/P. By contrast, the same treatment did not result in any detect- able changes in Na translocation to the shoot in C/C. Effects of DPI on the generation of H O in roots 2 2 To determine the relationship between the NADPH oxidase activity and salt-induced H O signaling, we have measured 2 2 endogenous H O levels in salinized roots from the two grafted 2 2 combinations. A analysis of the H O content supported obser- 2 2 vation made by the confocal imaging (Fig. 4A). Pretreatment with DPI abolished the NaCl-induced H O accumulations. 2 2 Importantly, NaCl-induced NADPH oxidase activity was reduced in the DPI-pretreated plants at all time points meas- ured (e.g. after both 3 h (Fig. 6A) and 24 h (see Supplementary Fig. S5) of salt treatment. The transcript level of RbohD and Fig. 2. Effects of 75 mM NaCl treatments on malondialdehyde (MDA) RbohF involved in the generation of NADPH oxidase were content (A) and relative electric conductivity (REC; B) in the leaves of both rapidly elevated at 3 h in C/P after salt treatment, but only pumpkin-grafted cucumber (C/P) and self-grafted cucumber (C/C). Data are mean±SE (n=3). a small change was observed in C/C (Fig. 6C, E). Fig. 3. Effects of 75 mM NaCl treatments on accumulation patterns of Na and H O in pumpkin-grafted cucumber (C/P) and self-grafted cucumber 2 2 (C/C). Na and H O contents were detected in leaves (A, B) and in roots (C, D). Data are mean±SE (n=3–5). 2 2 Downloaded from https://academic.oup.com/jxb/article/69/14/3465/4626780 by DeepDyve user on 15 July 2022 H O mediates salt tolerance of grafted cucumber | 3471 2 2 Fig. 4. Effects of NaCl and DPI on the endogenous H O level in the roots of pumpkin-grafted cucumber (C/P) and self-grafted cucumber (C/C). The 2 2 plants were pretreated with DPI for 6 h and then transferred to Hoagland’s solution without DPI for 75 mM NaCl treatment. H O levels were measured by 2 2 using confocal fluorescence imaging from roots stained with H DCF-DA. Scale bar: 100 μm. Data are mean±SE (n=3–5). Columns labeled with different letters are significantly different at P<0.05. + + + Fig. 5. Net Na and H fluxes measured from root and shoot tissues of grafted plants using the non-invasive micro-test technology (NMT). (A, C) Net Na + + and H fluxes measured from the apical region of plant roots. (B, D) Net Na fluxes measured from the position 1 cm above (B) or below (D) graft union. Data are mean±SE (n=5 biological replicates). (F) Na content in leaf of two grafted combinations. Columns with different letters are significantly different at + + P<0.05. (E) The correlation between Na flux and H fluxes in roots. Each point represents an individual root measured under salinity conditions. + + DPI reduced Na /H antiporter operation via has been a downstream target of the salt-induced H O signal 2 2 + + depressing H -ATPase activity in roots. The change in the elevated PM H -ATPase activi- + + As DPI application had a concurrent effect on Na and H ties matched the change in the up-regulated expression of + + + + fluxes in roots, we hypothesized that a Na /H antiport system PMA in C/P, which might contribute to the H -driven Na Downloaded from https://academic.oup.com/jxb/article/69/14/3465/4626780 by DeepDyve user on 15 July 2022 3472 | Niu et al. + + Fig. 6. Effects of NaCl and DPI on the NADPH oxidase-based H O generation (A, C, E) and Na /H antiport system (B, D, F) in roots of pumpkin- 2 2 grafted cucumber (C/P) and self-grafted cucumber (C/C) after 3 h of treatment. Data are mean±SE (n=3–5). Columns with different letters are significantly different at P<0.05. exclusion pathway (Fig. 5B, D, F). The inhibition of NADPH (Fig. 7B). Interestingly, compared with non-DPI treatment, oxidase activity by DPI markedly decreased the PM H - pretreatment with DPI caused higher H O levels in both 2 2 ATPase activities in C/C and C/P (Fig. 6B). grafted combinations after 24 h of salt treatment (Fig. 7B). Effects of DPI on shoot transpiration and H O level in 2 2 leaves Discussion The root-to-shoot delivery of Na is affected not only by the Grafting is an effective way to increase salt tolerance of rate of xylem Na loading but also by the transpiration lift plants. While previous studies investigated the underlying that is conferred by the opening of stomata. In this study, mechanisms behind the beneficial effects of grafting from NaCl treatment resulted in a rapid stomatal closure in both the point of view of altered ion homeostasis (Edelstein et al., grafted combinations in the first 3 h. This closure was more 2011), root-derived hormones (Albacete et al., 2009) and the pronounced in C/P than in C/C (80% versus 65% reduction, antioxidant system (He et al., 2009), the signal transduction respectively). The observed trend for the transpiration rate was aspects of grafting (and, specifically, the role of root-derived similar to the trend for the stomatal conductance (Fig. 7C, E). H O signals) have never been put in the spotlight. Hydrogen 2 2 After 24 h of salt treatment, stomatal conductance (G ) and peroxide signaling is known to be important for the acclima- leaf transpiration rate (T ) recovered in both grafting com- tion to salt stress conditions (Wang et al., 2013; Hossain and binations but were still lower than those in control (Fig. 7D, Dietz, 2016). In addition, hydrogen peroxide is one of the F), and the C/P maintained higher G and T values than C/C. known signaling molecules that has an ability to travel long s r After 3 h of salt treatment, significantly elevated H O levels distances (Baxter et al., 2014; Gilroy et al., 2014) and may 2 2 were only found in the leaves of C/P, and this increase in the potentially enable communication between remote plant tis- leaf H O could be inhibited by DPI pretreatment in the roots sues and organs (Mittler and Blumwald, 2015). Therefore, the 2 2 (Fig. 7A). In contrast, a significant increase in the H O level grafted plant is a good model for understanding ROS func- 2 2 was observed in the leaves of C/C only after 24 h of salt stress tion between root and shoot. Here, two grafted combinations Downloaded from https://academic.oup.com/jxb/article/69/14/3465/4626780 by DeepDyve user on 15 July 2022 H O mediates salt tolerance of grafted cucumber | 3473 2 2 Fig. 7. Effects of NaCl and DPI on the leaf H O contents, leaf transpiration rate (T ) and stomatal conductance (G ) in pumpkin-grafted cucumber 2 2 r s (C/P) and self-grafted cucumber (C/C) after 3 h (A, C, E) or 24 h (B, D, F) of treatment. Data are mean±SE (n=3–5). Columns with different letters are significantly different at P<0.05. were used to clarify the role of the root-sourced H O in plant of the measured Na efflux to amiloride ( Cuin et al., 2011) 2 2 response to salt stress. The results indicate that NADPH- suggest that the Na exclusion in the salt-stressed plants roots + + generated root H O signals control at least two processes is likely the result of an active Na /H antiport across the 2 2 that are essential for plants to handle the salt load. One of PM. This result is consistent with the earlier findings from them is regulation of Na exclusion from roots and the other non-grafted cucumber and pumpkin (Lei et al., 2014) that is rapid stomatal closure upon stress onset (Figs 5 and 7). indicated higher Na exclusion capacity in pumpkin roots. Many reports have demonstrated that H O is a key signal- 2 2 + ing molecule involved in regulation of Na transport under H O signal involved in the Na exclusion process in 2 2 salt stress. Among other sources, H O is generated by the 2 2 pumpkin-grafted plants plasma membrane-located NADPH oxidase that is encoded As only a small proportion of Na can be retrieved from the by RbohD and RbohF (Xie et al., 2011; Hossain and Dietz, shoot and moved back to the root via the phloem in plants 2016). DPI blocked salinity-induced H O production and 2 2 (Munns and Tester, 2008; Lei et al., 2014), the key factor reduced salinity tolerance in Arabidopsis (Leshem and Seri, that determine the Na accumulated in scion is the restrictive 2007), Oryza sativa (Wang et al., 2013) and Populus euphrat- ability of rootstock to load Na , as evident from the com- ica (Sun et al., 2010). Here we found a pronouncedly decrease parison of different grafting combinations (Zhu et al., 2008; in Na efflux that has mirrored a reduced H O content and 2 2 Huang et al., 2010; Edelstein et al., 2011). This notion was NADPH oxidase activity in C/P roots when pretreated with further supported in this study. Exposure to salt stress results DPI (Fig. 6A, C, E). in increased expression of both SOS1 transcripts (Shi et al., The relationship between the SOS pathway and NADPH + + 2000) and SOS1-mediated Na /H exchanger activity in root oxidase-mediated H O signaling has remained elusive 2 2 epidermis (Sun et al., 2009). Here we showed that C/P grafted until now. It has been suggested that the NADPH oxidase 2+ plants were more efficient in effluxing Na from roots com- may operate as a salt sensor in plants in tandem with Ca - pared with C/C plants (Fig. 5A). A strong correlation between permeable channels (Shabala et al., 2015). According to + + H influx and Na efflux ( Fig. 5E) and a reported sensitivity this model, the plant plasma membranes harbor various Downloaded from https://academic.oup.com/jxb/article/69/14/3465/4626780 by DeepDyve user on 15 July 2022 3474 | Niu et al. non-selective cation channels (NSCCs), which are permeable complex kinetics. In Cakile maritima, the H O concentration 2 2 2+ to Ca and may be activated by both ROS and membrane reached a peak within 4 h of salt stress and rapidly declined depolarization (Demidchik and Maathuis, 2007). As a sec- afterwards, while H O continued to rise in Arabidopsis dur- 2 2 2+ ond messenger, Ca could bind to SOS3, which functions in ing the first 72 h after salt treatment ( Ellouzi et al., 2011). Xie 2+ + + the sensing the Ca signal and contributes to PM Na /H et al. (2011) also found that mild salt stress causes a rapid and antiporter (SOS1) activation and regulation of cellular Na transient accumulation of ROS in Arabidopsis peaking after homeostasis. NADPH oxidase-mediated H O accumulation 1 h followed by a second oxidative burst after about 6 h. These 2 2 is also critical to SOS1 mRNA stability (Chung et al., 2008). and similar findings have led to the suggestion that H O ‘sig- 2 2 Sun et al. (2010) found that reduction in H O production natures’ may operate in plant signaling networks (Bose et al., 2 2 + + caused by DPI led to decreased Na efflux and H influx, and 2014), in addition to well-known cytosolic calcium ‘signatures’ 2+ the Ca concentration in the cytoplasm also decreased. Our (Dodd et al., 2010). The current work supports this hypoth- work reported here suggests that another factor contributing esis and demonstrates that early root-derived H O signals are 2 2 to the stronger Na efflux in C/P roots is the higher activity of essential for early stomata closure in grafted C/P combination + + + PM H -ATPase, which sustains an H gradient to drive Na / but is lacking in C/C plants. + + H antiport across the PM (Fig. 6B, D and Supplementary In a longer period, accumulation of large amounts of Na Fig. S6). This is consistent with the previous observations in leaves of C/C (Fig. 3A) forced the plant to close the stomata + + in non-grafted pumpkin roots, where vanadate (a PM H - to reduce the amount of Na delivered from root to shoot ATPase inhibitor) treatment concurrently decreased both via the transpiration flow. In contrast, the pumpkin-grafted + + Na efflux and H influx ( Lei et al., 2014). The possible rea- plants, C/P, gain advantage in restricting a large proportion + + + son for this may be found in the fact that PM H -ATPase of Na to roots and hypocotyls and accumulating less Na in 2+ activation may be also mediated by Ca . It has been reported the leaves (Fig. 3A), making such stomatal closure less essen- + + that the activity of PM H -ATPase was dependent on the tial later on (Fig. 7D, F). DPI-treated C/P impaired the Na / 2+ + Ca concentration in the cytosol (Zhang et al., 2007) and the H antiport system located in C/P roots (Fig. 6), which led to 2+ + interaction of [Ca ] and a calcium-dependent protein kin- an overaccumulation of Na in shoots (Fig. 4) and required a cyt ase regulated the PM H -ATPase in response to fungal elici- more restricted transpiration rate in C/P (Fig. 7D), to protect tors (Lino et al., 1998). As DPI pretreatment decreased both the photosynthetic system from the ionic stress. However, in + + the NADPH oxidase and H -ATPase activity in roots of both the first several hours of salinity, the Na in leaves did not grafting combinations, it appears that the root-derived H O reach a toxic level in either of the two combinations (less than 2 2 −1 signaling pathway is shared by both plants (i.e. cucumber and 5 mg g ; Fig. 3A). Thus, a rapid closure of stomata in the pumpkin), but with a different efficiency. early period in C/P plants is unlikely to be driven by the need + + It is obvious that the Na exclusion mechanism is just one to restrict Na delivery to the shoot but instead may be related of many strategies employed by plants to deal with the salt to an early signal induced by roots to deal with osmotic stress, load. Other mechanisms such as storage of excess Na in reducing water loss and maintaining the plant’s hydration sta- vacuoles and restrictions on Na loading into the root stele tus (see Supplementary Figs S7B and S8). have also been reported in pumpkin roots (Lei et al., 2014). The obvious question arising from this data is, why are These might be the reason why C/P plants possessed a higher C/P plants able to sense and signal salt stress faster than + + Na efflux but still had more Na accumulated in their roots C/C plants? Given that such signaling was causally related compared with C/C (Fig. 3C). Our previous study also found to the root RBOH-dependent H O production, this points 2 2 that some pumpkin genotypes stored a vast amount of Na to NADPH acting as a tentative sodium sensor, and its more in the stems (Niu et al., 2017) and the genes involved in the efficient operation (higher sensitivity) in pumpkin roots. Na compartmentation process (HKT, NHX) exhibited even Our current knowledge of how salt stress is sensed by higher expression levels in the hypocotyl than in the root (data plant tissues is severely limited (Maathuis, 2014; Shabala not published). Using the xylem saps collected from below or et al., 2015), and it is highly likely that more than one of the above the grafting union, a significant decrease in Na con- sensory mechanisms may operate in the same cell at the same centration has been found in pumpkin-grafted cucumber but time, encoding specific information on stress severity, and nearly no difference in the self-grafted cucumber, suggesting sharing some common downstream signaling pathway(s). that the grafting union is a barrier for Na transport when NADPH oxidase has been suggested to be one of these pumpkin is used as a rootstock (Huang et al., 2013). In the (Shabala et al., 2015). NADPH oxidases are activated by salt present study, the NMT data are consistent with our previous stress, at both the transcriptional and the functional level result for the xylem sap (Fig. 5B, D). (Xie et al., 2011), and plants lacking functional AtrbohD and AtrbohF genes showed increased hypersensitivity to sal- inity (Ma et al., 2012), suggested that the NADPH oxidase Root-sourced H O signals trigger rapid stomatal 2 2 may also operate as a salt sensor in plants. The model also closure in the shoot assumes that NSCCs are located in the immediate proximity In recent years, H O has firmly established itself as an import - of the NADPH oxidase, forming a microdomain in a lipid 2 2 ant second messenger mediating the broad range of adaptive raft. The onset of the salt stress will lead to a rapid (within plant responses (Mittler et al., 2011; Baxter et al., 2014). H O seconds) membrane depolarization by 50–80 mV (Shabala 2 2 production is highly tissue-specific and possesses a rather et al., 2005; Jayakannan et al., 2015; Chakraborty et al., Downloaded from https://academic.oup.com/jxb/article/69/14/3465/4626780 by DeepDyve user on 15 July 2022 H O mediates salt tolerance of grafted cucumber | 3475 2 2 2016), resulting in the instantaneous activation of NSCCs Acknowledgements 2+ and causing a rapid elevation in the cytosolic Ca . This ele- This work was supported by National Natural Science Foundation of vation will result in a rapid activation of NADPH oxidase China (31572168, 31372110, 31772357) and the International Science and Technology Cooperation Program of China (2015DFG32310) to ZL.B., and a concurrent increase in ROS accumulation in the apo- China Scholarship Council (CSC) (Grant number 201606765073), the plastic space. These ROS will further activate NSCCs and Youth Chenguang Project of Science and Technology of Hubei Province of 2+ amplify stress-induced Ca and ROS transients via self- China to Y.H. and the Australian Research Council and Grain Research and Development Corporation to S.S. amplification loops. This self-amplification loop seems to be more efficient in C/P than in C/C grafted plants. Future studies should reveal the molecular mechanisms behind this References regulation, as well as interaction of the root RBOH-derived H O signals with other signals propagating between roots Albacete A, Martínez-Andújar C, Ghanem ME, et al. 2009. Rootstock- 2 2 mediated changes in xylem ionic and hormonal status are correlated with and shoots in salt-stressed plants (Baxter et al., 2014; Gilroy delayed leaf senescence, and increased leaf area and crop productivity in et al., 2014; Shabala et al., 2016). salinized tomato. Plant, Cell & Environment 32, 928–938. Baxter A, Mittler R, Suzuki N. 2014. ROS as key players in plant stress signalling. Journal of Experimental Botany 65, 1229–1240. Bose J, Rodrigo-Moreno A, Shabala S. 2014. ROS homeostasis Conclusion in halophytes in the context of salinity stress tolerance. Journal of Experimental Botany 65, 1241–1257. In summary, we have discovered that the root RBOH- Chakraborty K, Bose J, Shabala L, Shabala S. 2016. Difference in root dependent H O production operates as an early signal to 2 2 + + K retention ability and reduced sensitivity of K -permeable channels to regulate salt tolerance of grafted cucumber through Na reactive oxygen species confer differential salt tolerance in three Brassica exclusion and stomatal closure. This mechanism can alleviate species. Journal of Experimental Botany 67, 4611–4625. the salt-induced damage in the rootstock-grafted cucumber Chung JS, Zhu JK, Bressan RA, Hasegawa PM, Shi H. 2008. Reactive oxygen species mediate Na -induced SOS1 mRNA stability in plants. Arabidopsis. The Plant Journal 53, 554–565. Cuin TA, Bose J, Stefano G, Jha D, Tester M, Mancuso S, Shabala S. 2011. Assessing the role of root plasma membrane and tonoplast + + Na /H exchangers in salinity tolerance in wheat: in planta quantification methods. Plant, Cell & Environment 34, 947–961. Supplementary data Danquah A, De ZA, Colcombet J, Hirt H. 2014. The role of ABA and Supplementary data are available at JXB online. MAPK signaling pathways in plant abiotic stress responses. Biotechnology Advances 32, 40–52. Fig. S1. Effects of various NaCl concentrations on the Demidchik V, Maathuis FJ. 2007. Physiological roles of nonselective growth of the pumpkin-grafted cucumber (C/P) and a self- cation channels in plants: from salt stress to signalling and development. grafted cucumber (C/C). New Phytologist 175, 387–404. Fig. S2. Effects of various NaCl concentrations on H O Desikan R, Hancock JT, Harrison J, Hooley R, Neill SJ. 2005. A Role 2 2 for ETR1 in hydrogen peroxide signaling in stomatal guard cells. Plant accumulation in roots of two grafted combinations, namely Physiology 137, 831–834. the pumpkin-grafted cucumber (C/P) and a self-grafted Dodd AN, Kudla J, Sanders D. 2010. The language of calcium signaling. cucumber (C/C). Annual Review of Plant Biology 61, 593–620. Fig. S3. The sampling positions for ion fluxes test by the Edelstein M, Plaut Z, Ben-Hur M. 2011. Sodium and chloride exclusion and retention by non-grafted and grafted melon and Cucurbita plants. non-invasive micro-test technology (NMT). Journal of Experimental Botany 62, 177–184. Fig. S4. A four-minute continuous flux recording was con - Ellouzi H, Hamed KB, Cela J, Munné-Bosch S, Abdelly C. 2011. Early ducted using NMT from roots of plants from two grafted effects of salt stress on the physiological and oxidative status of Cakile combinations, namely the pumpkin-grafted cucumber (C/P) maritima (halophyte) and Arabidopsis thaliana (glycophyte). Physiologia Plantarum 142, 128–143. and a self-grafted cucumber (C/C). Gilroy S, Suzuki N, Miller G, Choi WG, Toyota M, Devireddy AR, Fig. S5. Effects of NaCl and DPI on the NADPH oxidase- Mittler R. 2014. A tidal wave of signals: calcium and ROS at the forefront + + based H O generation and Na /H antiport system in roots 2 2 of rapid systemic signaling. Trends in Plant Science 19, 623–630. of the pumpkin-grafted cucumber (C/P) and a self-grafted Hasegawa PM, Bressan RA, Zhu JK, Bohnert HJ. 2003. Plant cellular and molecular responses to high salinity. Annual Review of Plant Biology cucumber (C/C) after 24 h of treatment. 51, 463–499. Fig. S6. Effect of 75 mM NaCl treatment on the time He Y, Zhu ZJ, Yang J, Ni XL, Zhu B. 2009. Grafting increases the salt dependence of SOS1 (A) and PMA (B) transcriptions in tolerance of tomato by improvement of photosynthesis and enhancement roots of the pumpkin-grafted cucumber (C/P) and a self- of antioxidant enzymes activity. Environmental and Experimental Botany 66, 270–278. grafted cucumber (C/C). Heath RL, Packer L. 1968. Photoperoxidation in isolated chloroplasts. Fig. S7. Effect of grafting on kinetics of plant wilting Archives of Biochemistry and Biophysics 125, 189–198. and relative water content for the pumpkin-grafted cucum- Hossain MS, Dietz KJ. 2016. Tuning of redox regulatory mechanisms, ber (C/P) and a self-grafted cucumber (C/C) treated with reactive oxygen species and redox homeostasis under salinity stress. Frontiers in Plant Science 7, 548. 75 mM NaCl. Huang Y, Bie ZL, He SP, Hua B, Zhen A, Liu ZX. 2010. Improving Fig. S8. Effect of NaCl and DPI on the stomatal aperture cucumber tolerance to major nutrients induced salinity by grafting onto in the detached abaxial epidermal strips from the pumpkin- Cucurbita ficifolia . Environmental and Experimental Botany 69, 32–38. grafted cucumber (C/P) and a self-grafted cucumber (C/C) Huang Y, Bie ZL, Liu PY, et al. 2013. Reciprocal grafting between after 3 h of treatment. cucumber and pumpkin demonstrates the roles of the rootstock in the Downloaded from https://academic.oup.com/jxb/article/69/14/3465/4626780 by DeepDyve user on 15 July 2022 3476 | Niu et al. determination of cucumber salt tolerance and sodium accumulation. Qiu QS, Guo Y, Dietrich MA, Schumaker KS, Zhu JK. 2002. + + Scientia Horticulturae 149, 47–54. Regulation of SOS1, a plasma membrane Na /H exchanger in Arabidopsis thaliana, by SOS2 and SOS3. Proceedings of the National Jayakannan M, Bose J, Babourina O, Shabala S, Massart A, Academy of Sciences, USA 99, 8436–8441. Poschenrieder C, Rengel Z. 2015. The NPR1-dependent salicylic acid signalling pathway is pivotal for enhanced salt and oxidative stress Rengasamy P. 2010. Soil processes affecting crop production in salt- tolerance in Arabidopsis. Journal of Experimental Botany 66, 1865–1875. affected soils. Functional Plant Biology 37, 613–620. Jiang CF, Belfield EJ, Mithani A, Visscher A, Ragoussis J, Mott R, Rouphael Y, Cardarelli M, Rea E, Colla G. 2012. Improving melon Smith JAC, Harberd NP. 2013. ROS-mediated vascular homeostatic and cucumber photosynthetic activity, mineral composition, and growth control of root-to-shoot soil Na delivery in Arabidopsis. The EMBO Journal performance under salinity stress by grafting onto Cucurbita hybrid 32, 4359–4370. rootstocks. Photosynthetica 50, 180–188. Kłobus G, Janicka-Russak M. 2004. Modulation by cytosolic Shabala L, Cuin TA, Newman IA, Shabala S. 2005. Salinity-induced components of proton pump activities in plasma membrane and tonoplast ion flux patterns from the excised roots of Arabidopsis sos mutants. Planta from Cucumis sativus roots during salt stress. Physiologia Plantarum 121, 222, 1041–1050. 84–92. Shabala S, White RG, Djordjevic MA, Ruan YL, Mathesius U. 2016. Kochian LV, Shaff JE, Kühtreiber WM, Jaffe LF, Lucas WJ. 1992. Root-to-shoot signalling: integration of diverse molecules, pathways and Use of an extracellular, ion-selective, vibrating microelectrode system for functions. Functional Plant Biology 43, 87–104. + + 2+ the quantification of K , H , and Ca fluxes in maize roots and maize Shabala S, Wu H, Bose J. 2015. Salt stress sensing and early signalling suspension cells. Planta 188, 601–610. events in plant roots: Current knowledge and hypothesis. Plant Science Lee JM. 1994. Cultivation of grafted vegetables I. Current status, grafting 241, 109–119. methods, and benefits. Hortscience 29, 235–239. Shi H, Ishitani M, Kim C, Zhu JK. 2000. The Arabidopsis thaliana salt + + Lee JM, Kubota C, Tsao SJ, Bie ZL, Echevarria PH, Morra L, Oda M. tolerance gene SOS1 encodes a putative Na /H antiporter. Proceedings 2010. Current status of vegetable grafting: Diffusion, grafting techniques, of the National Academy of Sciences, USA 97, 6896–6901. automation. Scientia Horticulturae 127, 93–105. Shi H, Quintero FJ, Pardo JM, Zhu JK. 2002. The putative plasma + + + Lei B, Huang Y, Sun JY, Xie JJ, Niu ML, Liu ZX, Fan ML, Bie ZL. membrane Na /H antiporter SOS1 controls long-distance Na transport in 2014. Scanning ion-selective electrode technique and X-ray microanalysis plants. The Plant Cell 14, 465–477. provide direct evidence of contrasting Na transport ability from root to Sun J, Chen S, Dai S, et al. 2009. NaCl-induced alternations of cellular shoot in salt-sensitive cucumber and salt-tolerant pumpkin under NaCl and tissue ion fluxes in roots of salt-resistant and salt-sensitive poplar stress. Physiologia Plantarum 152, 738–748. species. Plant Physiology 149, 1141–1153. 2+ Leshem Y, Seri LA. 2007. Induction of phosphatidylinositol 3-kinase- Sun J, Wang MJ, Ding MQ, et al. 2010. H O and cytosolic Ca 2 2 + + mediated endocytosis by salt stress leads to intracellular production signals triggered by the PM H -coupled transport system mediate K / of reactive oxygen species and salt tolerance. The Plant Journal 51, Na homeostasis in NaCl-stressed Populus euphratica cells. Plant, Cell & 185–197. Environment 33, 943–958. Li H, Liu SS, Yi CY, Wang F, Zhou J, Xia XJ, Shi K, Zhou YH, Yu Wang XM, Hou C, Liu J, He WL, Nan WB, Gong HL, Bi YR. 2013. JQ. 2014. Hydrogen peroxide mediates abscisic acid-induced HSP70 Hydrogen peroxide is involved in the regulation of rice (Oryza sativa L.) accumulation and heat tolerance in grafted cucumber plants. Plant, Cell & tolerance to salt stress. Acta Physiologiae Plantarum 35, 891–900. Environment 37, 2768–2780. Weatherley PE. 1950. Studies in water relations of cotton plants. I. The Li M, Ahammed GJ, Li C, Bao X, Yu J, Huang C, Yin H, Zhou J. 2016. field measurement of water deficit in leaves. New Phytologist 49, 81–87. Brassinosteroid ameliorates zinc oxide nanoparticles-induced oxidative Willekens H, Chamnongpol S, Davey M, Schraudner M, stress by improving antioxidant potential and redox homeostasis in tomato Langebartels C, Van Montagu M, Inzé D, Van Camp W. 1997. seedling. Frontiers in Plant Science 7, 615. Catalase is a sink for H O and is indispensable for stress defence in C3 2 2 Li S, Pan XX, Berry JO, et al. 2015. OsSEC24, a functional SEC24-like plants. The EMBO Journal 16, 4806–4816. protein in rice, improves tolerance to iron deficiency and high pH by enhancing + + Wilson C, Shannon MC. 1995. Salt-induced Na /H antiport in root + + H secretion mediated by PM-H -ATPase. Plant Science 233, 61–71. plasma membrane of a glycophytic and halophytic species of tomato. Lino B, Baizabal-Aguirre VM, González de la Vara LE. 1998. The Plant Science 107, 147–157. plasma-membrane H -ATPase from beet root is inhibited by a calcium- Xia XJ, Wang YJ, Zhou YH, Tao Y, Mao WH, Shi K, Asami T, Chen dependent phosphorylation. Planta 204, 352–359. Z, Yu JQ. 2009. Reactive oxygen species are involved in brassinosteroid- Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression induced stress tolerance in cucumber. Plant Physiology 150, −ΔΔCT data using real-time quantitative PCR and the 2 method. Methods 25, 801–814. 402–408. Xie YJ, Xu S, Han B, et al. 2011. Evidence of Arabidopsis salt Ma L, Zhang H, Sun L, Jiao Y, Zhang G, Miao C, Hao F. 2012. NADPH acclimation induced by up-regulation of HY1 and the regulatory role of oxidase AtrbohD and AtrbohF function in ROS-dependent regulation RbohD-derived reactive oxygen species synthesis. The Plant Journal 66, of Na⁺/K⁺ homeostasis in Arabidopsis under salt stress. Journal of 280–292. Experimental Botany 63, 305–317. Yi C, Yao K, Cai S, et al. 2015. High atmospheric carbon dioxide- Maathuis FJ. 2014. Sodium in plants: perception, signalling, and dependent alleviation of salt stress is linked to RESPIRATORY BURST regulation of sodium fluxes. Journal of Experimental Botany 65, 849–858. OXIDASE 1 (RBOH1)-dependent H O production in tomato (Solanum 2 2 Martínez-Atienza J, Quintero FJ. 2007. Conservation of the salt overly lycopersicum). Journal of Experimental Botany 66, 7391–7404. sensitive pathway in rice. Plant Physiology 143, 1001–1012. Zhang F, Wang Y, Yang Y, Wu H, Wang D, Liu J. 2007. Involvement of Mittler R, Blumwald E. 2015. The roles of ROS and ABA in systemic hydrogen peroxide and nitric oxide in salt resistance in the calluses from acquired acclimation. The Plant Cell 27, 64–70. Populus euphratica. Plant, Cell & Environment 30, 775–785. Mittler R, Vanderauwera S, Gollery M, Van BF. 2004. Reactive oxygen Zhen A, Bie ZL, Huang Y, Liu ZX, Lei B. 2011. Effects of salt-tolerant gene network of plants. Trends in Plant Science 9, 490–498. rootstock grafting on ultrastructure, photosynthetic capacity, and H O - 2 2 scavenging system in chloroplasts of cucumber seedlings under NaCl Mittler R, Vanderauwera S, Suzuki N, Miller G, Tognetti VB, stress. Acta Physiologiae Plantarum 33, 2311–2319. Vandepoele K, Gollery M, Shulaev V, Van Breusegem F. 2011. ROS signaling: the new wave? Trends in Plant Science 16, 300–309. Zhou J, Xia XJ, Zhou YH, Shi K, Chen Z, Yu JQ. 2014. RBOH1- dependent H O production and subsequent activation of MPK1/2 play an Munns R, Tester M. 2008. Mechanisms of salinity tolerance. Annual 2 2 important role in acclimation-induced cross-tolerance in tomato. Journal of Review of Plant Biology 59, 651–681. Experimental Botany 65, 595–607. Niu L, Liao W. 2016. Hydrogen peroxide signaling in plant development Zhou WJ, Leul M. 1998. Uniconazole-induced alleviation of freezing injury and abiotic responses: crosstalk with nitric oxide and calcium. Frontiers in in relation to changes in hormonal balance, enzyme activities and lipid Plant Science 7, 230. peroxidation in winter rape. Plant Growth Regulation 26, 41–47. Niu ML, Xie JJ, Sun JY, Huang Y, Kong QS, Nawaz MA, Bie ZL. 2017. A shoot based Na tolerance mechanism observed in pumpkin—An Zhu J, Bie ZL, Li YN. 2008. Physiological and growth responses of two important consideration for screening salt tolerant rootstocks. Scientia different salt-sensitive cucumber cultivars to NaCl stress. Soil Science and Horticulturae 218, 38–47. Plant Nutrition 54, 400–407.
Journal
Journal of Experimental Botany – Oxford University Press
Published: Jun 19, 2018