Role of protein phosphomannosylation in the Candida tropicalis–macrophage interaction

Role of protein phosphomannosylation in the Candida tropicalis–macrophage interaction Abstract Candida tropicalis is an opportunistic fungal pathogen responsible for mucosal and systemic infections. The cell wall is the initial contact point between a fungal cell and the host immune system, and mannoproteins are important components that play key roles when interacting with host cells. In Candida albicans, mannans are modified by mannosyl-phosphate moieties, named phosphomannans, which can work as molecular scaffolds to synthesize β1,2-mannooligosaccharides, and MNN4 is a positive regulator of the phosphomannosylation pathway. Here, we showed that C. tropicalis also displays phosphomannans on the cell surface, but the amount of this cell wall component varies depending on the fungal strain. We also identified a functional ortholog of CaMNN4 in C. tropicalis. Disruption of this gene caused depletion of phosphomannan content. The C. tropicalis mnn4Δ did not show defects in the ability to stimulate cytokine production by human mononuclear cells but displayed virulence attenuation in an insect model of candidiasis. When the mnn4Δ-macrophage interaction was analyzed, results showed that presence of cell wall phosphomannan was critical for C. tropicalis phagocytosis. Finally, our results strongly suggest a differential role for phosphomannans during phagocytosis of C. albicans and C. tropicalis. cell wall, phosphomannosylation, Candida tropicalis, Candida albicans, phagocytosis, host–fungus interaction INTRODUCTION Members of the Candida genus are among the most common commensal fungi in healthy individuals but are also responsible for life-threatening systemic infections in immunocompromised patients, such as patients with AIDS, those undergoing bone marrow transplantation or chemotherapeutic schemes to combat neoplastic diseases (Brown et al.2012). Candidemia is regarded as one of the main nosocomial bloodstream infections worldwide, being Candida albicans the most common species found in systemic candidiasis cases, with mortality rates that can be up to 71% (Falagas, Apostolou and Pappas 2006; Mora-Montes et al.2009). However, there are other species of the Candida genus that are as important as C. albicans but less studied. Candida tropicalis is commonly isolated in tropical countries and is responsible for 33% to 48% of systemic infections caused by Candida species (Kothavade et al.2010; Wang, Xu and Hsueh 2016). It is also the most common fungal pathogen isolated from neutropenic patients and in recent years has shown an increased drug resistance to fluconazole (Kothavade et al.2010). The cell wall is the first point of interaction between fungi and host cells, and is critical for the recognition of Candida species by components of the immune system (Díaz-Jiménez et al.2012; Gow and Hube 2012; Hall and Gow 2013; Hall et al.2013; West et al.2013; Estrada-Mata et al.2015; Netea et al.2015; Erwig and Gow 2016; Navarro-Arias et al.2016; Perez-Garcia et al.2016; Hernández-Chávez et al.2017). Although there is little information about the composition of the C. tropicalis cell wall, it is known that contains chitin, β1,6- and β1,3-glucans, and N-linked mannans composed of a canonical core oligosaccharide modified with an outer chain that contains an α1,6-polymannose backbone, and lateral chains composed of α1,2- and β1,2-mannose units (Kobayashi et al.1994; Bizerra et al.2011; Mesa-Arango et al.2016). Moreover, the outer chain of the N-linked mannans also contains mannosyl-phosphate residues, which work as molecular scaffolds for the elaboration of β1,2-oligomannosides (Kobayashi et al.1994). Even though it has not been demonstrated, it is assumed that C. tropicalis also contains O-linked mannans, as demonstrated in other yeast species, including C. albicans (Munro et al.2005; Diaz-Jimenez et al.2012). Both, N-linked and O-linked mannans are important for tissue adhesion, virulence, cell wall integrity, recognition of the pathogen by the host immune system and the establishment of a protective immune response (Bates et al.2005; Munro et al.2005; Bates et al.2006; Mora-Montes et al.2007; Harris et al.2009; Mora-Montes et al.2009; McKenzie et al.2010; Mora-Montes et al.2010; Díaz-Jiménez et al.2012; Gow and Hube 2012; Lewis et al.2012; Bates et al.2013; Hall and Gow 2013; Hall et al.2013; West et al.2013; Bain et al.2014; Martinez-Alvarez et al.2014; Martinez-Duncker, Diaz-Jimenez and Mora-Montes 2014; Courjol et al.2015; Estrada-Mata et al.2015; Netea et al.2015; Erwig and Gow 2016; Navarro-Arias et al.2016; Perez-Garcia et al.2016). The mannosyl-phosphate moiety found in mannan, named phosphomannan, has been related to stress regulation during conditions of drought, high osmolality or nutrient limitation, in the cross-linking of proteins to cell wall glucan, and in the modulation of nucleotide transport across the Golgi membrane (Jigami and Odani 1999). Moreover, these negatively charged cell wall structures allow primary macrophages and macrophage cell lines to properly phagocyte C. albicans cells (McKenzie et al.2010; Lewis et al.2012; Bain et al.2014; Gonzalez-Hernandez et al.2017), and the engagement with antimicrobial cationic peptides with the ability to inhibit C. albicans growth, such as DsS3(1-16; Harris et al.2009). Therefore, phosphomannans, as other cell wall components, are critical for a proper interaction of C. albicans with components of the immune response. The phosphomannan synthesis has been described in most detail in Saccharomyces cerevisiae and C. albicans. In both models, Mnn4, a protein with no enzyme activity associated yet, is regarded as a positive regulator of phosphomannosyltransferases because expression of its encoding gene correlates with the cell wall phosphomannan content (Odani et al.1996; Jigami and Odani 1999; Hobson et al.2004). Paralogs of MNN4 found in both organisms have been also related to the cell wall phosphomannosylation (Gonzalez-Hernandez et al.2017; Kim et al.2017). The Mnn6/Ktr6 is the sole phosphomannosyltransferase found in S. cerevisiae (Wang et al.1997), while C. albicans Mnt3 and Mnt5 are enzymes with redundant activity and responsible for the addition of about 50% of the cell wall phosphomannan (Mora-Montes et al.2010). Since the cell wall phosphomannosylation is an important element of the fungus–immune cell interaction, and we currently have limited information on the relevance of this wall component in the C. tropicalis biology, here we generated a C. tropicalis mnn4Δ null mutant and characterize its phenotype and ability to interact with host cells, with emphasis on the virulence, ability to stimulate cytokine production and phagocytosis by macrophages. MATERIALS AND METHODS Strains and culture conditions The strains used in this study are listed in Table 1. Unless otherwise indicated, cells were maintained and propagated at 28°C in YPD medium [2% (w/v) bacteriological peptone, 1% (w/v) yeast extract, 2% (w/v) glucose]. When solid medium was required, plates were added with 2% (w/v) agar. Cell dimorphism was assessed either on solid Spider medium (Liu, Kohler and Fink 1994) or liquid RPMI 1640 (Sigma, St. Louis, MO, USA) supplemented with 10% (v/v) fetal bovine serum (Sigma, St. Louis, MO, USA). For the latter, 5 × 106 cells mL−1 were incubated for 4 h at 37°C and 200 rpm, and cell preparations were inspected by bright-field microscopy to evaluate the percentage of yeast cells, pseudohyphae, and true hyphae. Three hundred cells were counted per strain. To prepare cells for cell wall analysis, phosphomannan extraction and cytokine assays, cells were grown in 500 mL flasks at 28°C containing 200 mL of YPD broth and reciprocal shaking at 200 rpm, until reaching exponential growth phase. Cell heat killing was performed at 56°C during 60 min (Mora-Montes et al.2007). Loss of cell viability was confirmed by plating heat-killed (HK) cells on solid YPD plates and incubated for 48 h at 28°C. Under these conditions, cells were no viable and did not burst, as determined by the lack of released 260-nm absorbing material in the extracellular space (Martinez-Alvarez et al.2017). For β-elimination assays, cells were resuspended in 0.1 N NaOH and incubated at room temperature for 18 h with slow orbital shaking. The reaction was stopped by neutralizing with 0.1 N HCl, cells were pelleted at 2000 × g for 10 min and the supernatant was recovered and stored –20°C until used (Diaz-Jimenez et al.2012). Phosphomannan trimming was performed by incubating cells with 10 mM HCl at 100°C for 1 h. Then, cells were pelleted at 2000 × g for 15 min, the supernatant was saved, neutralized with 10 mM NaOH and kept at –20°C until used (Kobayashi et al.1990; Han et al.1997). Phosphomannan was quantified using the phenol–sulfuric acid method (DuBois et al.1956). Data were normalized to the sugar content obtained from 3 × 109 cells. Table 1. Strains used in this work. Strain Organism Genotype Reference NGY152 Candida albicans ura3Δ::imm434/ura3Δ::imm434, RPSI/rps1Δ::Clp10 (Brand et al.2004) CDH7 Candida albicans ura3Δ::imm434/ura3Δ::imm434, mnn4Δ:hisG/mnn4Δ::hisG (Hobson et al.2004) CDH15 Candida albicans As CDH7, but RPSI/rps1Δ::CIp10 (Hobson et al.2004) CDH14 Candida albicans As CDH7, but RPSI/rps1Δ::[CIp10-MNN4-URA3]n (Hobson et al.2004) HMY149 Candida albicans As CDH7, but RPSI/rps1Δ::pACT1-CtMNN4 This work ATCC MYA-3404 Candida tropicalis WT ATCC HMY173 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/MNN4 This work HMY175 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1 This work HMY202 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1-MNN4 This work BB427748 Candida tropicalis WT (Tavanti et al.2005) J980162 Candida tropicalis WT (Tavanti et al.2005) AM2004/0089 Candida tropicalis WT (Tavanti et al.2005) GUI720 Candida tropicalis WT (Tavanti et al.2005) L712 Candida tropicalis WT (Tavanti et al.2005) J930943 Candida tropicalis WT (Tavanti et al.2005) BRL701883 Candida tropicalis WT (Tavanti et al.2005) J990297 Candida tropicalis WT (Tavanti et al.2005) AM2005/0289 Candida tropicalis WT (Tavanti et al.2005) AM2004/0069 Candida tropicalis WT (Tavanti et al.2005) Strain Organism Genotype Reference NGY152 Candida albicans ura3Δ::imm434/ura3Δ::imm434, RPSI/rps1Δ::Clp10 (Brand et al.2004) CDH7 Candida albicans ura3Δ::imm434/ura3Δ::imm434, mnn4Δ:hisG/mnn4Δ::hisG (Hobson et al.2004) CDH15 Candida albicans As CDH7, but RPSI/rps1Δ::CIp10 (Hobson et al.2004) CDH14 Candida albicans As CDH7, but RPSI/rps1Δ::[CIp10-MNN4-URA3]n (Hobson et al.2004) HMY149 Candida albicans As CDH7, but RPSI/rps1Δ::pACT1-CtMNN4 This work ATCC MYA-3404 Candida tropicalis WT ATCC HMY173 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/MNN4 This work HMY175 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1 This work HMY202 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1-MNN4 This work BB427748 Candida tropicalis WT (Tavanti et al.2005) J980162 Candida tropicalis WT (Tavanti et al.2005) AM2004/0089 Candida tropicalis WT (Tavanti et al.2005) GUI720 Candida tropicalis WT (Tavanti et al.2005) L712 Candida tropicalis WT (Tavanti et al.2005) J930943 Candida tropicalis WT (Tavanti et al.2005) BRL701883 Candida tropicalis WT (Tavanti et al.2005) J990297 Candida tropicalis WT (Tavanti et al.2005) AM2005/0289 Candida tropicalis WT (Tavanti et al.2005) AM2004/0069 Candida tropicalis WT (Tavanti et al.2005) View Large Table 1. Strains used in this work. Strain Organism Genotype Reference NGY152 Candida albicans ura3Δ::imm434/ura3Δ::imm434, RPSI/rps1Δ::Clp10 (Brand et al.2004) CDH7 Candida albicans ura3Δ::imm434/ura3Δ::imm434, mnn4Δ:hisG/mnn4Δ::hisG (Hobson et al.2004) CDH15 Candida albicans As CDH7, but RPSI/rps1Δ::CIp10 (Hobson et al.2004) CDH14 Candida albicans As CDH7, but RPSI/rps1Δ::[CIp10-MNN4-URA3]n (Hobson et al.2004) HMY149 Candida albicans As CDH7, but RPSI/rps1Δ::pACT1-CtMNN4 This work ATCC MYA-3404 Candida tropicalis WT ATCC HMY173 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/MNN4 This work HMY175 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1 This work HMY202 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1-MNN4 This work BB427748 Candida tropicalis WT (Tavanti et al.2005) J980162 Candida tropicalis WT (Tavanti et al.2005) AM2004/0089 Candida tropicalis WT (Tavanti et al.2005) GUI720 Candida tropicalis WT (Tavanti et al.2005) L712 Candida tropicalis WT (Tavanti et al.2005) J930943 Candida tropicalis WT (Tavanti et al.2005) BRL701883 Candida tropicalis WT (Tavanti et al.2005) J990297 Candida tropicalis WT (Tavanti et al.2005) AM2005/0289 Candida tropicalis WT (Tavanti et al.2005) AM2004/0069 Candida tropicalis WT (Tavanti et al.2005) Strain Organism Genotype Reference NGY152 Candida albicans ura3Δ::imm434/ura3Δ::imm434, RPSI/rps1Δ::Clp10 (Brand et al.2004) CDH7 Candida albicans ura3Δ::imm434/ura3Δ::imm434, mnn4Δ:hisG/mnn4Δ::hisG (Hobson et al.2004) CDH15 Candida albicans As CDH7, but RPSI/rps1Δ::CIp10 (Hobson et al.2004) CDH14 Candida albicans As CDH7, but RPSI/rps1Δ::[CIp10-MNN4-URA3]n (Hobson et al.2004) HMY149 Candida albicans As CDH7, but RPSI/rps1Δ::pACT1-CtMNN4 This work ATCC MYA-3404 Candida tropicalis WT ATCC HMY173 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/MNN4 This work HMY175 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1 This work HMY202 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1-MNN4 This work BB427748 Candida tropicalis WT (Tavanti et al.2005) J980162 Candida tropicalis WT (Tavanti et al.2005) AM2004/0089 Candida tropicalis WT (Tavanti et al.2005) GUI720 Candida tropicalis WT (Tavanti et al.2005) L712 Candida tropicalis WT (Tavanti et al.2005) J930943 Candida tropicalis WT (Tavanti et al.2005) BRL701883 Candida tropicalis WT (Tavanti et al.2005) J990297 Candida tropicalis WT (Tavanti et al.2005) AM2005/0289 Candida tropicalis WT (Tavanti et al.2005) AM2004/0069 Candida tropicalis WT (Tavanti et al.2005) View Large Heterologous complementation in Candida albicans The C. tropicalis MNN4 ORF was amplified using the primer pair 5΄-AAGCTTATGGCTTCGATAATACAAGTA and 5΄-GCTAGC CTATTCTATAGCAAACGGTAAA (underlined sequences were introduced to generate HindIII and NheI sites, respectively). This amplicon was cloned into pCR®-2.1-TOPO® (Invitrogen, Carlsbad CA, United States) and then subcloned into the HindIII and NheI sites of pACT1 (Barelle et al.2004). This construction was then linearized with StuI and used to transform a C. albicans mnn4Δ null mutant (Hobson et al.2004). This plasmid integrates into the RPS1 locus, which was confirmed by PCR using the primer pair 5΄-CACCAGGATTTATTGCCAAC and 5΄-CGAACGGAGTAGGAATGTAC. Generation of a C. tropicalis mnn4Δ null mutant and a reintegrant control strain Deletion of MNN4 was achieved using the SAT1 flipper strategy as previously described (Reuß et al.2004; Porman et al.2013). Fig. 1 summarizes the strategy followed. Primer pairs were used to amplify by PCR the 487 bp and 1500 bp of the 5΄ and 3΄ upstream and downstream regions of the MNN4 ORF. These amplicons were cloned into pCR®-2.1-TOPO® (Invitrogen, Carlsbad CA, United States), and the upstream fragment was subcloned into the ApaI-XhoI sites of pSFS2, while the downstream fragment was subcloned into the NotI-SacI sites of this plasmid, generating a construction where the selection marker is flanked by regions for homologous recombination at the MNN4 locus. The disruption cassette was released using ApaI and SacI and used for cell transformation. Cells were selected in YPD plates added with 200 μg mL−1 nourseothricin (Goldbio, St. Louis, MO, United States), and the correct genomic integration of the disruption cassette into the MNN4 locus was verified by PCR, using the primer pair 5΄-ATGCAACCTGCATTCGGTAT and 5΄-AACCAGATTTCCAGATTTCCAGA, which amplifies a fragment of 3014 bp that contains a 5΄ region out of the recombination region and a 3΄ region inside the disruption cassette (Fig. S1, Supporting Information). A second pair of primers (5΄-GGCTATACAGATTTCCCGGCTC and 5΄-GCTGTAGCAGTTAAACCATCACG) was used to amplify a 1476 bp downstream fragment that consisted of a 5΄ region of the disruption cassette and a 3΄ region out of the recombination site (Fig. S1, Supporting Information). The SAT1 marker was recycled by growing cells for 2 days at 28°C in liquid YEP [2% (w/v) bacteriological peptone and 1% (w/v) yeast extract] added with 2% (w/v) maltose, and then plated in YPD supplemented with 10 μg mL−1 nourseothricin for selection of sensitive strains. Nourseothricin-sensitive transformant colonies were picked up and screened by PCR to amplify a 1650 bp recombination scar fragment and a 3486 bp fragment that corresponds to the remaining copy of MNN4 gene. Both regions were amplified using the primer pair 5΄-ATGCAACCTGCATTCGGTAT and 5΄-GCTGTAGCAGTTAAACCATCACG (Fig. S1, Supporting Information). The second MNN4 allele was deleted performing a second round of transformation with the same construction. A construction to reintegrate MNN4 into the C. tropicalis mnn4Δ null mutant was generated by amplifying a fragment containing the MNN4 ORF plus 1500 bp up and downstream the encoding region, using the primer pair 5΄-gggcccaaggtgtgagtgagtgagtgt and 5΄-ctcgagcagaacaagaactagtcggtgc (underlined sequences indicate adaptors to generate restriction sites for ApaI and XhoI, respectively). This 4643 bp fragment was cloned into the ApaI-XhoI sites of pSFS2. Then, a 700 bp fragment downstream of the disrupted locus was amplified by PCR using the primer pair 5΄-gcggccgcCTTGGTGGCATTTTGTTGTTGA and 5΄-GagctcTGGATCCGGTAAAGTTTCTGAATTT (underlined sequences indicate adaptors to generate restriction sites for NotI and SacI, respectively) and cloned into the NotI-SacI sites of pSFS2. The reintegration cassette was used to transform the C. tropicalis mnn4Δ null mutant, replacing one disrupted allele with MNN4 and the selection marker (Fig. 1). Upon marker recycling, integration of the construction at the MNN4 locus was confirmed by PCR, using the primer pairs 5΄-TTACCACCAGCAGTGACCAAA and 5΄-ATGGGGTACCAATCATCAACTTACA, and 5΄-GCTCTATGAACACAATCACGACA and 5΄-TCTCCAAACGGATTTGTATTTGTCA, which amplified part of the upstream (1009 bp) and downstream (1253 bp) recombination regions, respectively (Fig. S1, Supporting Information). Figure 1. View largeDownload slide Strategy to disrupt C. tropicalis MNN4 and generation of a reintegrant control strain. (A) Disruption cassette in pSFS2 vector, which consists of a nourseothricin resistance marker (CaSAT1) and a CaFLP gene that is induced by maltose. Different restriction sites flank the FRT sites to clone recombination regions to disrupt the target gene via homologous recombination. (B) The cassette to disrupt CtMNN4 consisted of a 487 bp fragment, upstream the MNN4 ORF, cloned into the Apa I (A) and Xho I (X) sites of pSFS2, and a 1500 bp fragment, downstream the MNN4 ORF, cloned into the Not I (N) and Sac I (ScI) sites of the vector.The cassette was released by digesting with Apa I and Sac I. (C) After cell transformation with the released cassette, its correct integration was confirmed by PCR, amplifying a fragment of 3014 bp that contained part of the 5΄ end of the cassette, and a 1476 bp fragment that contained part of the 3΄ end of the disruption cassette. (D) To recycle the cassette, mutant cells were grown in medium containing 2% (w/v) maltose to induce CaFLP expression, which cleaved at FRT sites, leaving a fragment of 1650 bp and a native allele of MNN4. Presence of both alleles was confirmed by PCR. (E) To generate a homozygous mutant, steps C and D were repeated, and loss of the remaining native MNN4 allele was confirmed by PCR. (F) To reintegrate CtMNN4 into the native locus, the ORF plus 1500 bp upstream and 1500 bp downstream were cloned into the Apa I and Xho I sites of pSFS2, and an MNN4 downstream fragment of 700 bp was cloned into the Not I and Sac I sites of the vector. The null mutant strain was transformed with this construction and a 5΄ and 3΄ screening fragments were amplified to corroborate the correct integration of the cassette at the MNN4 locus. The cassette was recycled using the same strategy described in D. Figure 1. View largeDownload slide Strategy to disrupt C. tropicalis MNN4 and generation of a reintegrant control strain. (A) Disruption cassette in pSFS2 vector, which consists of a nourseothricin resistance marker (CaSAT1) and a CaFLP gene that is induced by maltose. Different restriction sites flank the FRT sites to clone recombination regions to disrupt the target gene via homologous recombination. (B) The cassette to disrupt CtMNN4 consisted of a 487 bp fragment, upstream the MNN4 ORF, cloned into the Apa I (A) and Xho I (X) sites of pSFS2, and a 1500 bp fragment, downstream the MNN4 ORF, cloned into the Not I (N) and Sac I (ScI) sites of the vector.The cassette was released by digesting with Apa I and Sac I. (C) After cell transformation with the released cassette, its correct integration was confirmed by PCR, amplifying a fragment of 3014 bp that contained part of the 5΄ end of the cassette, and a 1476 bp fragment that contained part of the 3΄ end of the disruption cassette. (D) To recycle the cassette, mutant cells were grown in medium containing 2% (w/v) maltose to induce CaFLP expression, which cleaved at FRT sites, leaving a fragment of 1650 bp and a native allele of MNN4. Presence of both alleles was confirmed by PCR. (E) To generate a homozygous mutant, steps C and D were repeated, and loss of the remaining native MNN4 allele was confirmed by PCR. (F) To reintegrate CtMNN4 into the native locus, the ORF plus 1500 bp upstream and 1500 bp downstream were cloned into the Apa I and Xho I sites of pSFS2, and an MNN4 downstream fragment of 700 bp was cloned into the Not I and Sac I sites of the vector. The null mutant strain was transformed with this construction and a 5΄ and 3΄ screening fragments were amplified to corroborate the correct integration of the cassette at the MNN4 locus. The cassette was recycled using the same strategy described in D. Analysis of the cell wall composition and porosity Mid-log phase cells were pelleted and mechanically broken using a Precellys-24 homogenizer for 30 min, in cycles of 1 min with 2-min resting periods. Cell lysis was confirmed using bright-field microscopy. The cell homogenate was washed with deionized water and 1 M NaCl for three times. Pellets were recovered, lyophilized and acid-hydrolyzed with 2 M trifluoroacetic acid as described (Mora-Montes et al.2007). The acid-hydrolyzed samples were analyzed using High-Performance Anion-Exchange Chromatography with Pulsed Amperometric Detection as previously reported (Plaine et al.2008). For the analysis of cell wall porosity, cells were washed twice with PBS and aliquots containing 1 × 108 cells were suspended in buffer A (10 mM Tris-HCl, pH 7.4), buffer A plus 30 μg mL−1 poly-L-Lysine (MW 30–70 kDa, Sigma, St. Louis, MO, USA) or buffer A plus 30 μg mL−1 DEAE-dextran (MW 500 kDa, Sigma, St. Louis, MO, USA), and incubated for 30 min at 30°C with constant shaking at 200 rpm. Cells were pelleted, and supernatants were collected and used to measure the absorbance at 260 nm. The relative cell wall porosity to DEAE-Dextran was calculated, using the porosity to poly-L-lysine for data normalization (De Nobel et al.1990). Alcian blue binding assays Mid-log phase cells were pelleted and washed twice with deionized water. Cells were adjusted to an OD600 of 0.2, and aliquots of 1 mL were pelleted and resuspended in 1 mL of Alcian blue (Sigma, St. Louis, MO, USA; 30 μg mL−1 in 0.02 N HCl). Cells were incubated at room temperature for 15 min, centrifuged to pellet cells and the supernatant saved and used to quantify the non-bound dye at 620 nm. This was used to calculate the content of Alcian blue bound to cells as previously reported (Hobson et al.2004). Sensitivity to cell wall perturbing agents Cells were grown overnight in YPD medium and used to inoculate fresh YPD broth, which was incubated for 6 h at 28°C and 150 rpm. After this time, cells were washed twice with deionized water and the concentration adjusted to OD600 of 0.05. Aliquots containing 20 μL of cells were placed into a 96-well plate containing YPD or YPD added with any of the three-different cell wall perturbing agents tested (Congo red, Calcofluor white and Hygromycin B). Plates were incubated for 40 h at 28°C and 100 rpm. After this time, cell growth was assessed by spectrophotometry at 600 nm. Growth curves were generated using doubling dilutions of the tested agents, with the top concentrations set at: 400 μg mL−1 Congo red, 660 μg mL−1 Hygromycin B and 50 μg mL−1 Calcofluor white. The 100% of growth corresponds to cells incubated in YDP alone under the same conditions. Derivatization of phosphomannans and fluorophore-assisted carbohydrate electrophoresis Aliquots containing 20 mg of phosphomannan were derivatized with 0.2 M 2-aminonaphthalene trisulfone (ANTS) resuspended in a solution 1:17 acetic acid–water (v/v) and 20 μL of 1.0 M sodium cyanoborohydride resuspended in DMSO. Reactions were carried out for 16 h at 37°C and then lyophilized. Derivatized phosphomannans were resuspended in 20 μL of sample loading buffer (62.5 mM Tris-HCl, 20% [v/v] glycerol), and 10 μL of derivatized samples were loaded onto a 20% (v/v) polyacrylamide gel and separated as previously reported (Navarro-Arias et al.2016). Carbohydrate mobility was assessed by inspecting the gel under UV light. Images were captured using the ChemiDoc Imaging System (BioRad, Hercules, California, Estados Unidos). As a molecular marker, a ladder of maltooligosaccharides from one to seven glucose units (Sigma, St. Louis, MO, USA) was used. Isolation of human peripheral blood mononuclear cells (PBMCs) The human primary cells were collected from healthy adult volunteers after information of the study was disclosed and the written informed consent was signed. This study was approved by the Ethics Committee from Universidad de Guanajuato (permission number 17082011). The isolation of human PBMNCs was achieved by density centrifugation using EDTA blood samples and Histopaque-1077 (Sigma, St. Louis, MO, USA) as reported (Navarro-Arias et al.2017). Cell concentration was adjusted at 5 × 106 mL−1 in ice-cold RPMI 1640 (Dutch modification; added with 2 mM glutamine, 0.1 mM pyruvate and 0.05 mg mL−1 gentamycin, all reagents from Sigma, St. Louis, MO, USA) and immediately used for cytokine stimulation or cell differentiation to macrophages. Analysis of the human peripheral blood mononuclear cell–C. tropicalis interaction Aliquots of 100 μL containing 5 × 105 human PBMNCs and 100 μL with 1 × 105 yeast cells were incubated in round-bottom 96-well microplates for 24 h at 37°C and 5% (v/v) CO2. Then, plates were centrifuged for 10 min at 3000 × g at 4°C. Supernatants were saved and used to quantify TNFα, IL-6 and IL-10 with ABTS ELISA Development kits from Preprotech. The IL-1β concentration was measured using a DuoSet ELISA Development kit from R&D systems. Differentiation of human peripheral blood mononuclear cell-derived Macrophages Isolated human PBMCs cells were differentiated into macrophages as reported (Perez-Garcia et al.2016). Briefly, aliquots of 1 mL containing 5 × 106 cells in RPMI supplemented with 1% (v/v) penicillin–streptomycin solution (PS, Sigma, St. Louis, MO, USA) were placed in flat bottom 24-well plates and incubated 2 h at 37°C and 5% (v/v) CO2. Wells were washed gently with PBS at 37°C to remove non-adherent cells and cell debris. Then, 1 mL of X-VIVO 15 serum-free medium (Lonza, Basel, Switzerland) supplemented with 1% (v/v) PS and 10 ng mL−1 recombinant human granulocyte–macrophage colony stimulating factor (Sigma, St. Louis, MO, USA) were added to each well and incubated for 7 days at 37°C and 5% (v/v) CO2. Fresh medium was exchanged every 3 days. Phagocytosis assays Yeast cells were grown in YPD at 28°C with reciprocal shaking at 200 rpm until exponential growth phase was reached. Then, cells were washed twice with PBS and labeled with 1 mg mL−1 Acridine orange (Sigma, St. Louis, MO, USA) as described (Abrams, Diamond and Kane 1983). Yeast cells were washed twice with PBS and resuspended at a cell concentration of 3 × 107 yeast cells mL−1. The fungus–immune cell interaction was carried out in 800 μL of DMEM medium (Sigma, St. Louis, MO, USA), in 6-well plates with a macrophage–yeast ratio 1:6, which was incubated for 2 h at 37°C and 5% (v/v) CO2. After the interactions, macrophages were washed twice with cold PBS and suspended in PBS containing 1.25 mg mL−1 Trypan Blue as an external fluorescence quencher, as described (Santos, Azzolini and Lucisano-Valim 2015). Samples were immediately analyzed by flow cytometry in a MoFlo XDP system (Beckman Coulter, Brea, California, USA) collecting 50 000 events gated for macrophage cells. Fluorescence was acquired from the compensated FL1 (green) and FL3 (red) channels using macrophage cells without any labeling. Phagocytosis of yeast cells was assessed from counted events in the green (recently phagocytosed cells) and red (cells within acidified phagolysosomes) fluorescence channels. When required, the monocyte-derived macrophages were pre-incubated for 60 min at 37°C and 5% (v/v) CO2 with laminarin (Sigma, St. Louis, MO, USA) or phosphomannan isolated from C. tropicalis cell walls, prior interaction with yeast cells. Galleria mellonella survival assays The ability of the yeast cells to infect and kill Galleria mellonella larvae was assessed as described (Perez-Garcia et al.2016). Briefly, the last left pro-leg was sanitized with 70% (v/v) ethanol and this area was used to inject 2 × 107 yeast cells mL−1, contained in 10 μL of PBS, using a Hamilton syringe equipped with a 26-gauge needle. Larvae were kept at 37°C and survival monitored daily. The content of CFU was determined by incubating serial dilutions of the hemolymph on YPD plates for 28°C for 72 h. Each experimental group contained 30 larvae, including a control group injected only with PBS. Statistical analysis Statistical analyses were conducted with the GraphPad Prism 6 software. The effect of cell wall perturbing agents on the fungal growth was analyzed by two-way ANOVA. Cytokine stimulation and phagocytosis were performed in duplicate with eight healthy donors, whereas the rest of the in vitro experiments were performed at least thrice in duplicates. Data represent cumulative results of all experiments performed. The Mann–Whitney U test or unpaired t-test was used to establish statistical significance (see figure legends for details), with a significance level set at P < 0.05. Survival experiments with G. mellonella larvae were carried out three times, with a total of 10 larvae per experiment. Data were analyzed using the Log-rank test and presented in Kaplan–Meier survival curves. The statistical significance was set at P < 0.05. RESULTS Cell wall phosphomannosylation and porosity varies in clinical isolates of C. tropicalis We randomly selected 10 clinical isolates previously used to assess the genetic plasticity of C. tropicalis (Tavanti et al.2005) and compared their cell wall composition with the reference strain ATCC MYA-3404, whose genome has been sequenced (Butler et al.2009). Results confirmed that the major wall polysaccharides, chitin, glucan and mannans were present in all the strains analyzed, and no significant changes were observed in their proportions (Table 2). The ability of Candida cells to bind the dye Alcian blue has been directly related to the cell wall phosphomannan content (Hobson et al.2004; Mora-Montes et al.2010; Gonzalez-Hernandez et al.2017). When this parameter was analyzed in the clinical isolates, we could observe different abilities to bind the dye, with strains showing a phenotype similar to the reference strain and isolates binding significantly lower levels of Alcian blue (Table 2). This lower ability to bind the cationic dye correlated with higher wall porosity to DEAE-dextran, a cell wall parameter that tends to increase when defects in the cell wall fitness or composition are present (Table 2; De Nobel et al.1990; Navarro-Arias et al.2016; Perez-Garcia et al.2016). Therefore, these data indicate that cell wall phosphomannan could be a dynamic component of the C. tropicalis cells wall. Table 2. Cell wall analysis of clinical isolates of Candida tropicalis, an mnn4Δ null mutant and control strains. Cell wall abundance Strain Chitin (%) Mannan (%) Glucan (%) Phosphomannan content (μg)a Porosity (%)b BB427748 2.8 ± 0.9 35.2 ± 5.7 61.4 ± 3.8 81.9 ± 2.4 57.9 ± 2.5 J980162 2.9 ± 1.2 39.2 ± 6.6 57.2 ± 5.2 79.5 ± 6.8 58.9 ± 5.6 AM2004/0089 2.3 ± 1.3 33.7 ± 4.6 63.2 ± 4.2 47.1 ± 5.0c 64.5 ± 3.6c GUI720 2.2 ± 1.0 33.9 ± 3.2 63.1 ± 4.4 65.9 ± 5.7c 63.0 ± 2.1c L712 2.3 ± 0.9 34.5 ± 3.9 62.6 ± 3.1 86.4 ± 4.3 56.2 ± 3.8 J930943 2.7 ± 1.1 33.1 ± 6.0 63.7 ± 1.9 83.4 ± 7.3 53.4 ± 6.6 BRL701883 2.9 ± 0.5 34.5 ± 5.9 62.0 ± 4.2 24.8 ± 4.9c 68.8 ± 5.8c J990297 2.3 ± 1.7 37.9 ± 5.4 59.6 ± 3.3 84.5 ± 10.4 53.1 ± 7.4 AM2005/0289 3.1 ± 1.4 32.8 ± 4.4 63.8 ± 2.9 77.5 ± 9.3 55.6 ± 4.6 AM2004/0069 2.5 ± 1.0 38.6 ± 5.8 58.8 ± 3.3 33.8 ± 7.4c 64.3 ± 3.6c ATCC MYA-3404 (parental strain) 2.8 ± 1.6 34.3 ± 7.7 61.6 ± 5.7 84.0 ± 5.8 55.2 ± 5.9 mnn4Δ 2.9 ± 0.5 32.7 ± 2.8 64.3 ± 3.3 3.7 ± 1.9c 67.7 ± 5.6c mnn4Δ + MNN4 2.2 ± 0.9 37.3 ± 4.1 59.3 ± 4.8 56.8 ± 3.7c 56.6 ± 7.6 Cell wall abundance Strain Chitin (%) Mannan (%) Glucan (%) Phosphomannan content (μg)a Porosity (%)b BB427748 2.8 ± 0.9 35.2 ± 5.7 61.4 ± 3.8 81.9 ± 2.4 57.9 ± 2.5 J980162 2.9 ± 1.2 39.2 ± 6.6 57.2 ± 5.2 79.5 ± 6.8 58.9 ± 5.6 AM2004/0089 2.3 ± 1.3 33.7 ± 4.6 63.2 ± 4.2 47.1 ± 5.0c 64.5 ± 3.6c GUI720 2.2 ± 1.0 33.9 ± 3.2 63.1 ± 4.4 65.9 ± 5.7c 63.0 ± 2.1c L712 2.3 ± 0.9 34.5 ± 3.9 62.6 ± 3.1 86.4 ± 4.3 56.2 ± 3.8 J930943 2.7 ± 1.1 33.1 ± 6.0 63.7 ± 1.9 83.4 ± 7.3 53.4 ± 6.6 BRL701883 2.9 ± 0.5 34.5 ± 5.9 62.0 ± 4.2 24.8 ± 4.9c 68.8 ± 5.8c J990297 2.3 ± 1.7 37.9 ± 5.4 59.6 ± 3.3 84.5 ± 10.4 53.1 ± 7.4 AM2005/0289 3.1 ± 1.4 32.8 ± 4.4 63.8 ± 2.9 77.5 ± 9.3 55.6 ± 4.6 AM2004/0069 2.5 ± 1.0 38.6 ± 5.8 58.8 ± 3.3 33.8 ± 7.4c 64.3 ± 3.6c ATCC MYA-3404 (parental strain) 2.8 ± 1.6 34.3 ± 7.7 61.6 ± 5.7 84.0 ± 5.8 55.2 ± 5.9 mnn4Δ 2.9 ± 0.5 32.7 ± 2.8 64.3 ± 3.3 3.7 ± 1.9c 67.7 ± 5.6c mnn4Δ + MNN4 2.2 ± 0.9 37.3 ± 4.1 59.3 ± 4.8 56.8 ± 3.7c 56.6 ± 7.6 aμg of Alcian blue bound/OD600 = 1. bRelative to DEAE-Dextran. cP < 0.05, when compared to ATCC MYA-3404 strain. View Large Table 2. Cell wall analysis of clinical isolates of Candida tropicalis, an mnn4Δ null mutant and control strains. Cell wall abundance Strain Chitin (%) Mannan (%) Glucan (%) Phosphomannan content (μg)a Porosity (%)b BB427748 2.8 ± 0.9 35.2 ± 5.7 61.4 ± 3.8 81.9 ± 2.4 57.9 ± 2.5 J980162 2.9 ± 1.2 39.2 ± 6.6 57.2 ± 5.2 79.5 ± 6.8 58.9 ± 5.6 AM2004/0089 2.3 ± 1.3 33.7 ± 4.6 63.2 ± 4.2 47.1 ± 5.0c 64.5 ± 3.6c GUI720 2.2 ± 1.0 33.9 ± 3.2 63.1 ± 4.4 65.9 ± 5.7c 63.0 ± 2.1c L712 2.3 ± 0.9 34.5 ± 3.9 62.6 ± 3.1 86.4 ± 4.3 56.2 ± 3.8 J930943 2.7 ± 1.1 33.1 ± 6.0 63.7 ± 1.9 83.4 ± 7.3 53.4 ± 6.6 BRL701883 2.9 ± 0.5 34.5 ± 5.9 62.0 ± 4.2 24.8 ± 4.9c 68.8 ± 5.8c J990297 2.3 ± 1.7 37.9 ± 5.4 59.6 ± 3.3 84.5 ± 10.4 53.1 ± 7.4 AM2005/0289 3.1 ± 1.4 32.8 ± 4.4 63.8 ± 2.9 77.5 ± 9.3 55.6 ± 4.6 AM2004/0069 2.5 ± 1.0 38.6 ± 5.8 58.8 ± 3.3 33.8 ± 7.4c 64.3 ± 3.6c ATCC MYA-3404 (parental strain) 2.8 ± 1.6 34.3 ± 7.7 61.6 ± 5.7 84.0 ± 5.8 55.2 ± 5.9 mnn4Δ 2.9 ± 0.5 32.7 ± 2.8 64.3 ± 3.3 3.7 ± 1.9c 67.7 ± 5.6c mnn4Δ + MNN4 2.2 ± 0.9 37.3 ± 4.1 59.3 ± 4.8 56.8 ± 3.7c 56.6 ± 7.6 Cell wall abundance Strain Chitin (%) Mannan (%) Glucan (%) Phosphomannan content (μg)a Porosity (%)b BB427748 2.8 ± 0.9 35.2 ± 5.7 61.4 ± 3.8 81.9 ± 2.4 57.9 ± 2.5 J980162 2.9 ± 1.2 39.2 ± 6.6 57.2 ± 5.2 79.5 ± 6.8 58.9 ± 5.6 AM2004/0089 2.3 ± 1.3 33.7 ± 4.6 63.2 ± 4.2 47.1 ± 5.0c 64.5 ± 3.6c GUI720 2.2 ± 1.0 33.9 ± 3.2 63.1 ± 4.4 65.9 ± 5.7c 63.0 ± 2.1c L712 2.3 ± 0.9 34.5 ± 3.9 62.6 ± 3.1 86.4 ± 4.3 56.2 ± 3.8 J930943 2.7 ± 1.1 33.1 ± 6.0 63.7 ± 1.9 83.4 ± 7.3 53.4 ± 6.6 BRL701883 2.9 ± 0.5 34.5 ± 5.9 62.0 ± 4.2 24.8 ± 4.9c 68.8 ± 5.8c J990297 2.3 ± 1.7 37.9 ± 5.4 59.6 ± 3.3 84.5 ± 10.4 53.1 ± 7.4 AM2005/0289 3.1 ± 1.4 32.8 ± 4.4 63.8 ± 2.9 77.5 ± 9.3 55.6 ± 4.6 AM2004/0069 2.5 ± 1.0 38.6 ± 5.8 58.8 ± 3.3 33.8 ± 7.4c 64.3 ± 3.6c ATCC MYA-3404 (parental strain) 2.8 ± 1.6 34.3 ± 7.7 61.6 ± 5.7 84.0 ± 5.8 55.2 ± 5.9 mnn4Δ 2.9 ± 0.5 32.7 ± 2.8 64.3 ± 3.3 3.7 ± 1.9c 67.7 ± 5.6c mnn4Δ + MNN4 2.2 ± 0.9 37.3 ± 4.1 59.3 ± 4.8 56.8 ± 3.7c 56.6 ± 7.6 aμg of Alcian blue bound/OD600 = 1. bRelative to DEAE-Dextran. cP < 0.05, when compared to ATCC MYA-3404 strain. View Large Identification and disruption of C. tropicalis MNN4 Since the clinical isolates had different ability to bind Alcian blue, and therefore different levels of cell wall phosphomannan, we next decided to investigate the C. tropicalis MNN4, which is a key element in the protein phosphomannosylation pathway in yeast-like organisms (Odani et al.1996; Jigami and Odani 1999; Hobson et al.2004; Gonzalez-Hernandez et al.2017). The putative C. tropicalis MNN4 gene was identified via protein BLAST using the tools available at https://www.ncbi.nlm.nih.gov/. A putative ortholog of C. albicans MNN4 was found within C. tropicalis genome, under the GenBank accession code XP_002549525 (Butler et al.2009). The open reading frame spans 2841 bp and encodes for a putative polypeptide of 946-amino acids, with a putative signal peptide, and both a transmembrane domain and a region rich in lysine/glutamic repeats near the N-terminal end. Moreover, it also contains a motif of the LicD family of proteins, which has been involved in both phosphocholine metabolism and protein phosphomannosylation (Zhang et al.1999; Gonzalez-Hernandez et al.2017). Similar structural traits have been previously described for C. albicans Mnn4, whose sequence spans 997 amino acids (Hobson et al.2004). This polypeptide sequence showed a similarity score of 75% and 58% when compared to Mnn4 from C. albicans and S. cerevisiae, respectively. To demonstrate that this gene was indeed the functional ortholog of C. albicans MMN4, the whole open reading frame was amplified from C. tropicalis genomic DNA and cloned into the pACT1 vector, which contains the promoter region of C. albicans ACT1 and the terminatior sequence of S. cerevisiae CYC1 (Barelle et al.2004). This construction, pACT1-CtMNN4, was used to transform a C. albicans mnn4Δ null mutant, which is unable to bind Alcian blue (Hobson et al.2004). Upon transformation, the strain HMY149 (C. albicans mnn4Δ + pACT1-CtMNN4) could restore the ability to bind Alcian blue to levels similar to those observed with the wild-type (WT) control cells (124.7 ± 19.9 μg Alcian blue bound for WT cells, 21.1 ± 3.7 μg Alcian blue bound for mnn4Δ null mutant, 116.3 ± 11.9 μg Alcian blue bound for mnn4Δ + pACT1-CtMNN4, P = 0.49 when WT and the complemented strain were compared). Therefore, these results suggest that the putative C. tropicalis MNN4 is the functional ortholog of C. albicans MNN4. Next, to generate a C. tropicalis strain lacking MNN4, we used the SatI flipper strategy to delete both alleles (Reuß et al.2004; Figs 1A–D). The disruption cassette contained 497 bp and 1500 bp of homology to the 5΄ and 3΄ regions of MNN4, respectively. Disruption of the first allele was confirmed by PCR, and the selected mutant strains were subjected to marker recycling, which was confirmed by both sensitivity to nourseothricin and PCR (Fig. 1). This heterozygous strain (HMY173) was used in a second round of transformation with the same disruption cassette and the subsequent recycling of the transformation marker, generating an mnn4Δ null mutant strain (HMY175; Fig. 1E). To generate a reintegrant control strain, CtMNN4 was cloned into pSFS2 and this construction used to transform the mnn4Δ null mutant. The integration of this construct into the MNN4 locus was confirmed by PCR and subjected to marker recycling, generating the strains HMY202 (Fig. 1F). The C. tropicalis mnn4Δ null mutant has normal growth and morphology but displays defects in the cell wall phosphomannosylation Disruption of MNN4 did not affect the cell and colony morphologies, as the null mutant cells formed round yeast cells and whitish, soft and round colonies, like the WT control cells (data not shown). Furthermore, these cells underwent dimorphism, generating hyphae at the same rate as the WT cells (data not shown) and showed a growth rate similar to the control strain (0.67 h−1 for WT control cells and 0.65 h−1 for the mnn4Δ null mutant). We next assessed the cell sensitivity to wall perturbing agents, as this parameter is commonly affected when protein glycosylation pathways are disrupted (Bates et al.2005; Munro et al.2005; Bates et al.2006; Mora-Montes et al.2007; Mora-Montes et al.2009; Mora-Montes et al.2010; Hall et al.2013; Navarro-Arias et al.2016; Perez-Garcia et al.2016). The mnn4Δ null mutant, the WT and the reintegrant control strain showed similar sensitivity to hygromycin B and Calcofluor white (Fig. 2). However, the null mutant strain showed reduced resistance to Congo Red when compared to the parental strain (Fig. 2). This phenotype was restored to WT levels after reintroduction of MNN4 in the native locus (Fig. 2). Next, we analyzed the cell wall composition and found that the three main cell wall polysaccharides were present in similar proportions in the WT, null mutant and reintegrant control cells (Table 2), but the mnn4Δ null mutant displayed a significant reduction in the ability to bind Alcian blue and increased cell wall porosity to DEAE-dextran (Table 2). Reintegration of one copy of MNN4 partially restored the defect associated with the Alcian blue binding, whereas the cell wall porosity was similar to that found in the wall of the WT control cells (Table 2). To confirm the reduced ability of the null mutant cells to bind the cationic dye was directly related to a decreased content in wall phosphomannan, cells were incubated with 10 mM HCl at 100°C for 1 h and the acid-labile oligosaccharides were separated by fluorophore-assisted carbohydrate electrophoresis (FACE). The electrophoretic profile of the acid-hydrolyzed material from WT cell walls, which includes phosphomannans (Kobayashi et al.1990; Han et al.1997; Hobson et al.2004), was electrophoretically separated in oligosaccharides that contain up to five sugar residues, with a marked accumulation of molecules of one to four carbohydrate units (Fig. 3). The electrophoretic profile of samples from the mnn4Δ null mutant showed a similar band of monosaccharides and a faint band at the level of the maltobiose marker, but oligosaccharides with a higher number of monosaccharide units were absent (Fig. 3). The samples from the reintegrant control strain showed the same ladder-like pattern of the acid-hydrolyzed material from the WT cells, with a robust accumulation of material of one, two and three sugar units. To compare this electrophoretic profile, we performed a similar experiment with samples from C. albicans strains, and results were consistent to those found with C. tropicalis, i. e. a ladder-like pattern for phosphomannans released from WT and reintegrant control cells, and absence of this material in the sample from the mnn4Δ null mutant (Fig. 3). Collectively, our data indicate that absence of C. tropicalis MNN4 affected the protein phosphomannosylation pathway. Figure 2. View largeDownload slide Susceptibility of C. tropicalis mnn4Δ null mutant to Calcofluor white, Hygromycin B and Congo red. Cells were incubated with different concentrations of either Calcofluor white, Hygromycin B or Congo red, and growth was evaluated after incubation for 40 h at 28°C. Fungal growth in medium with no disturbing agent included was used for data normalization. The mnn4Δ null mutant (closed triangles) exhibited a higher susceptibility to Congo red. Data are means ± SD of three independent experiments performed in duplicates. Strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. Figure 2. View largeDownload slide Susceptibility of C. tropicalis mnn4Δ null mutant to Calcofluor white, Hygromycin B and Congo red. Cells were incubated with different concentrations of either Calcofluor white, Hygromycin B or Congo red, and growth was evaluated after incubation for 40 h at 28°C. Fungal growth in medium with no disturbing agent included was used for data normalization. The mnn4Δ null mutant (closed triangles) exhibited a higher susceptibility to Congo red. Data are means ± SD of three independent experiments performed in duplicates. Strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. Figure 3. View largeDownload slide FACE of acid-hydrolyzed oligosaccharides from C. tropicalis and C. albicans mnn4Δ null mutant and control strains. Cells were acid-hydrolyzed with 10 mM HCl, the released material was saved, derivatized with 0.2 M ANTS and separated on a 20% polyacrylamide gel. The molecular marker used was a ladder of maltooligosaccharides from one (M1) to seven (M7) glucose units. Strains used in the C. tropicalis panel are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. For C. albicans, the strains used are: WT, NGY152; mnn4Δ, CDH15 and mnn4Δ + MNN4, CDH14. In the left panel, the image was digitally manipulated to remove no relevant lines. Figure 3. View largeDownload slide FACE of acid-hydrolyzed oligosaccharides from C. tropicalis and C. albicans mnn4Δ null mutant and control strains. Cells were acid-hydrolyzed with 10 mM HCl, the released material was saved, derivatized with 0.2 M ANTS and separated on a 20% polyacrylamide gel. The molecular marker used was a ladder of maltooligosaccharides from one (M1) to seven (M7) glucose units. Strains used in the C. tropicalis panel are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. For C. albicans, the strains used are: WT, NGY152; mnn4Δ, CDH15 and mnn4Δ + MNN4, CDH14. In the left panel, the image was digitally manipulated to remove no relevant lines. Proper protein phosphomannosylation is required for virulence in the model organism Galleria mellonella To determine whether the loss of MNN4 had an impact on the C. tropicalis–host interaction, we assessed virulence in an invertebrate model of candidiasis, using larvae of G. mellonella, which have been previously reported as a suitable model to study the virulence of C. tropicalis (Mesa-Arango et al.2013). The total of the animal population infected with the WT strain died at the 8th day post-inoculation, whereas 50% of larvae infected with the mnn4Δ null mutant remained alive, with no sign of infection, i.e., no signs of melanization and with active movements (Fig. 4). Reintroduction of one MNN4 allele in the null mutant background restored the ability to kill the whole animal population at the 8th day (Fig. 4). The control group inoculated only with PBS showed 100% survival of the population at the end of the observation period (Fig. 4). Fungal burdens in the inoculated animals indicated a similar ability to colonize the host tissues for the control strains and the null mutant (1.1 × 107 ± 0.2 × 107 cells mL−1, 1.2 × 107 ± 0.2 × 107 and 1.2 × 107 ± 0.3 × 107cells mL−1, for WT, mnn4Δ and the reintegrant control strain, respectively). Therefore, the C. tropicalis mnn4Δ showed virulence attenuation in the model organism G. mellonella. These data are in contrast with those reported for the C. albicans mnn4Δ null mutant, which did not have virulence attenuation in a mouse model of systemic candidiasis (Hobson et al.2004). Since our results could be influenced by the host and its ability to respond against the fungal pathogen, we decided to determine the virulence of the C. albicans mnn4Δ null mutant in G. mellonella larvae. Animals inoculated with PBS remained alive during the observation period, but those infected with the WT strain showed 100% mortality at the 3rd day post-inoculation (Fig. 4). The null mutant showed decreased ability to kill the total population of larvae, with a survival of 10% animals at day 10 post-inoculation (Fig. 4). The reintegrant control strain showed a similar behavior as the WT strain, killing the whole animal population after 4 days (Fig. 4). Fungal burdens were similar in animals infected with the different strains (1.4 × 107 ± 0.5 × 107 cells mL−1, 1.5 × 107 ± 0.3 × 107 and 1.3 × 107 ± 0.5 × 107cells mL−1, for WT, mnn4Δ and the reintegrant control strain, respectively). Therefore, loss of MNN4 affected C. tropicalis and C. albicans virulence in larvae of G. mellonella. Figure 4. View largeDownload slide Loss of MNN4 affects the virulence of both C. tropicalis and C. albicans in the G. mellonella model. Aliquots containing 2 × 107 yeast cells were inoculated directly into the hemocoel of G. mellonella larvae and survival was monitored daily. Experiments were conducted three times, with a total of 30 larvae per group (10 larvae for each experiment). PBS refers to a control group injected only with PBS. For C. tropicalis, the strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. For C. albicans strains used are: WT, NGY152; mnn4Δ, CDH15 and mnn4Δ + MNN4, CDH14. No significant differences were observed between the mortality associated to parental and reintegrant strains (P = 0.84 and 0.63 for C. tropicalis and C. albicans, respectively). The mnn4Δ null mutant strain in both species showed a significant difference in the ability to kill larvae when compared to the parental or reintegrant control strains (P < 0.05 in both cases and for both species). Figure 4. View largeDownload slide Loss of MNN4 affects the virulence of both C. tropicalis and C. albicans in the G. mellonella model. Aliquots containing 2 × 107 yeast cells were inoculated directly into the hemocoel of G. mellonella larvae and survival was monitored daily. Experiments were conducted three times, with a total of 30 larvae per group (10 larvae for each experiment). PBS refers to a control group injected only with PBS. For C. tropicalis, the strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. For C. albicans strains used are: WT, NGY152; mnn4Δ, CDH15 and mnn4Δ + MNN4, CDH14. No significant differences were observed between the mortality associated to parental and reintegrant strains (P = 0.84 and 0.63 for C. tropicalis and C. albicans, respectively). The mnn4Δ null mutant strain in both species showed a significant difference in the ability to kill larvae when compared to the parental or reintegrant control strains (P < 0.05 in both cases and for both species). Cell wall phosphomannans are not required for stimulation of pro- and anti-inflammatory cytokine production by human PBMNCs Next, we assessed the potential role of phosphomannan in the ability of C. tropicalis to stimulate cytokine production by human PBMCs. The human cells incubated with the WT control cells produced low levels of TNFα, IL-6, IL-1β and IL-10 (Fig. 5). Similarly, the mnn4Δ null mutant and the reintegrant control strain stimulated low levels of the four cytokines analyzed (Fig. 5). It has been previously demonstrated in C. albicans, C. guilliermondii and members of the C. parapsilosis complex that a stronger cytokine stimulation is observed after artificial exposure of β1,3-glucan at the cell surface by heat killing (Gow et al.2007; Estrada-Mata et al.2015; Navarro-Arias et al.2016; Perez-Garcia et al.2016); therefore, we next assess whether exposure of β1,3-glucan after killing by heat could unmask a role for phosphomannans during the interaction between C. tropicalis and human PBMCs. The HK WT, mnn4Δ, and the reintegrant control strain stimulated a strong production of the four cytokines analyzed, in a similar manner (Fig. 5), which confirmed the observation done in other Candida species, i.e., HK cells are likely to expose β1,3-glucan and stimulate the production of high levels of both pro- and anti-inflammatory cytokines. Therefore, phosphomannans play a dispensable role in the ability of C. tropicalis to stimulate cytokine production by human PBMCs. Figure 5. View largeDownload slide Loss of phosphomannans does not affect the ability of C. tropicalis to stimulate cytokine production by human PBMCs. Fungal cells were co-incubated with human PBMCs for 24 h, and the supernatants were saved and used to quantify by ELISA the concentration of TNFα, IL-6, IL-1β and IL-10. Results (means ± SD) were obtained using samples from eight healthy donors, each assayed in duplicate wells. *P < 0.05 when the cytokine levels stimulated by live yeast cells (open bars) and HK yeast cells (closed bars) are compared. Strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. Figure 5. View largeDownload slide Loss of phosphomannans does not affect the ability of C. tropicalis to stimulate cytokine production by human PBMCs. Fungal cells were co-incubated with human PBMCs for 24 h, and the supernatants were saved and used to quantify by ELISA the concentration of TNFα, IL-6, IL-1β and IL-10. Results (means ± SD) were obtained using samples from eight healthy donors, each assayed in duplicate wells. *P < 0.05 when the cytokine levels stimulated by live yeast cells (open bars) and HK yeast cells (closed bars) are compared. Strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. Role of cell wall phosphomannan in the phagocytosis of C. tropicalis by human monocyte-derived macrophages We have previously demonstrated that defects in the cell wall phosphomannosylation affect the ability of cell line and primary macrophages to phagocyte C. albicans yeast cells (McKenzie et al.2010; Gonzalez-Hernandez et al.2017). Thus, we analyzed the impact of MNN4 disruption on the interaction of C. tropicalis and human monocyte-derived macrophages. The mnn4Δ null mutant strain was barely phagocytosed by these human primary cells, whose ability to uptake the mutant yeast cells was reduced up to 90% (Fig. 6). Monocyte-derived macrophages showed a similar ability to phagocyte either the WT or the reintegrant control strain (Fig. 6). This result contrasts with our previous observations in C. albicans, where loss of cell wall phosphomannan reduced the yeast phagocytosis in about 50% (McKenzie et al.2010; Gonzalez-Hernandez et al.2017). Therefore, we compared the phagocytosis of C. albicans and C. tropicalis cells in our experimental setting. The C. albicans WT control strain was significantly less phagocytosed than the C. tropicalis WT strain, but the human cells showed about 50% reduction in the ability to phagocyte the C. albicans mnn4Δ null mutant, as reported (McKenzie et al.2010; Gonzalez-Hernandez et al.2017; Fig. 6). Overall, C. tropicalis cells were more phagocytosed than the C. albicans cells (Fig. 6). Similar results were observed when phagocytosis experiments were performed with the RAW 264.7 (ATCC® TIB-71) murine cell line (data not shown). The cytometry approach used here allows us to differentiate the recently phagocytosed cells and those inside mature phagolysosomes. When both yeast cell populations were analyzed by separate we found similar results for both Candida species: most of the cells were already in mature phagolysosomes when the interaction was stopped (89.9 ± 1.4% and 91.2 ± 2.0% for C. tropicalis and C. albicans, respectively, P = 0.54). This ratio was not significantly modified when the mutant cells were used instead of WT cells, or when laminarin or phosphomannan were included in the interaction assays. Therefore, loss of phosphomannosylation affected the phagocytosis of C. tropicalis by macrophages; however, its role in this process seems to be more relevant than that described in C. albicans. Figure 6. View largeDownload slide Phagocytosis of C. tropicalis and C. albicans mnn4Δ null mutants by human monocyte-derived macrophages. Yeast cells were labeled with Acridine orange and incubated with human monocyte-derived macrophages at a macrophage-yeast ratio 1:6, for 2 h at 37°C and 5% (v/v) CO2. Macrophages were gated by FACS and 50 000 cells were counted/sample. Results represent macrophages interacting with at least one fluorescent yeast cell. Open bars indicate data obtained with C. tropicalis strains, whereas the closed bars correspond to those obtained with C. albicans strains. For C. tropicalis, the strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. For C. albicans, strains used are: WT, NGY152; mnn4Δ, CDH15 and mnn4Δ + MNN4, CDH14. These data represent means ± SD from eight donors assayed by duplicate. *P < 0.05 when compared to the WT strain. †P < 0.05 when compared to the C. tropicalis strain with the similar genetic background. Figure 6. View largeDownload slide Phagocytosis of C. tropicalis and C. albicans mnn4Δ null mutants by human monocyte-derived macrophages. Yeast cells were labeled with Acridine orange and incubated with human monocyte-derived macrophages at a macrophage-yeast ratio 1:6, for 2 h at 37°C and 5% (v/v) CO2. Macrophages were gated by FACS and 50 000 cells were counted/sample. Results represent macrophages interacting with at least one fluorescent yeast cell. Open bars indicate data obtained with C. tropicalis strains, whereas the closed bars correspond to those obtained with C. albicans strains. For C. tropicalis, the strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. For C. albicans, strains used are: WT, NGY152; mnn4Δ, CDH15 and mnn4Δ + MNN4, CDH14. These data represent means ± SD from eight donors assayed by duplicate. *P < 0.05 when compared to the WT strain. †P < 0.05 when compared to the C. tropicalis strain with the similar genetic background. To confirm this observation, we isolated phosphomannans from C. tropicalis cells and pre-incubated the human monocyte-derived macrophages with different concentration of the cell wall component, before interaction with yeast cells. Concentrations lower than 500 μg mL−1 did not show any effect on the ability of macrophages to phagocyte C. tropicalis cells. Macrophages pre-incubated with 500 μg mL−1 phosphomannan had a reduced ability to phagocyte C. tropicalis cells (about 30% reduction), but it was not statistically significant (P = 0.059). However, pre-incubation with 750 or 1000 μg mL−1 significantly reduced the ability to phagocyte C. tropicalis (about 70% and 90%, respectively; Fig. 7). When similar experiments were conducted with C. albicans cells, pre-incubation with phosphomannan reduced the phagocytosis to levels closer to the detection threshold, even at a concentration of 500 μg mL−1 (Fig. 7). Therefore, these data confirm the relevance of phosphomannan in the phagocytosis of Candida cells. Figure 7. View largeDownload slide Phagocytosis of C. tropicalis and C. albicans by human monocyte-derived macrophages pre-incubated with either laminarin or phosphomannan. Human monocyte-derived macrophages were pre-incubated with different concentration of laminarin (left panel) or C. tropicalis phosphomannan (right panel) for 60 min at 37°C and 5% (v/v) CO2, and incubated with Acridine orange-labeled yeast cells at a macrophage–yeast ratio 1:6, for 2 h at 37°C and 5% (v/v) CO2. Macrophages were gated by FACS and 50 000 cells were counted/sample. Results represent macrophages interacting with at least one fluorescent yeast cell. The C. tropicalis strain used was ATCC MYA-3404, whereas the C. albicans strain was NGY152. These data represent means ± SD f from eight donors assayed by duplicate. *P < 0.05 when compared against cells pre-incubated with 0 mg mL−1 of laminarin or phosphomannan. Figure 7. View largeDownload slide Phagocytosis of C. tropicalis and C. albicans by human monocyte-derived macrophages pre-incubated with either laminarin or phosphomannan. Human monocyte-derived macrophages were pre-incubated with different concentration of laminarin (left panel) or C. tropicalis phosphomannan (right panel) for 60 min at 37°C and 5% (v/v) CO2, and incubated with Acridine orange-labeled yeast cells at a macrophage–yeast ratio 1:6, for 2 h at 37°C and 5% (v/v) CO2. Macrophages were gated by FACS and 50 000 cells were counted/sample. Results represent macrophages interacting with at least one fluorescent yeast cell. The C. tropicalis strain used was ATCC MYA-3404, whereas the C. albicans strain was NGY152. These data represent means ± SD f from eight donors assayed by duplicate. *P < 0.05 when compared against cells pre-incubated with 0 mg mL−1 of laminarin or phosphomannan. When the cell wall phosphomannan content was quantified in both C. albicans and C. tropicalis cells, we found that the C. tropicalis strain had a higher content of phosphomannan than the C. albicans strain (3.4 ± 0.21 mg mL−1 and 2.8 ± 0.04 mg mL−1, for C. tropicalis and C. albicans, respectively; P < 0.05). Similarly, the cell wall porosity to DEAE-dextran was higher in C. tropicalis than in C. albicans (55.2 ± 5.9% and 24.8 ± 4.3%, respectively; P < 0.05). The role of dectin-1 in the uptake of yeast cells has been previously demonstrated during the C. albicans–macrophage interaction, and recognition of β1,3-glucan via this receptor is essential for proper fungal phagocytosis (Heinsbroek et al.2008). We next assessed whether C. tropicalis cells could be phagocytosed via this receptor. The pre-incubation of human monocyte-derived macrophages with different concentrations of laminarin, an antagonist of dectin-1 (Maneu et al.2011; Huang et al.2012; Cohen-Kedar et al.2014), negatively affected the ability of macrophages to phagocyte C. tropicalis cells, in a dose-dependent manner (Fig. 7). Comparative experiments using C. albicans cells showed a similar trend (Fig. 7), but we observed a full phagocytosis inhibition when cells were pre-incubated with 25 μg mL−1 laminarin, and this concentration only reduced C. tropicalis phagocytosis near 50% (Fig. 7). Therefore, C. albicans and C. tropicalis phagocytosis rely on the engagement of dectin-1 with its ligand, but this process seems to be essential for C. albicans cells, but not for C. tropicalis. Finally, we analyzed whether the role of phosphomannan and β1,3-glucan during C. tropicalis phagocytosis was only additive or synergistic, by preincubating human monocyte-derived macrophages with both laminarin and phosphomannan. We chose 25 μg mL−1 and 500 μg mL−1 of laminarin and phosphomannan, respectively, because these concentrations showed a moderate effect on the phagocytosis of C. tropicalis cells. Our results indicated that pre-incubation with both compounds reduced C. tropicalis phagocytosis in about 70%, which suggest an additive effect when both blocking agents were used in the experimental setting (Fig. 8). Experiments using HK C. tropicalis cells showed similar results (Fig. 8). Even though the results in Fig. 8 indicated an increased ability of macrophages to phagocyte HK C. tropicalis cells when compared to live cells, this was not statistically significant (P = 176). When C. albicans was used to challenge pre-incubated macrophages with both laminarin and phosphomannan, we observed a significant reduction in the phagocytosis (Fig. 8). Figure 8. View largeDownload slide Phagocytosis of C. tropicalis and C. albicans by human monocyte-derived macrophages pre-incubated with both laminarin and phosphomannan. Human monocyte-derived macrophages were pre-incubated with both laminarin and C. tropicalis phosphomannan for 60 min at 37°C and 5% (v/v) CO2, and then incubated with Acridine orange-labeled yeast cells at a macrophage–yeast ratio 1:6, for 2 h at 37°C and 5% (v/v) CO2. Macrophages were gated by FACS and 50 000 cells were counted/sample. Results represent macrophages interacting with at least one fluorescent yeast cell. The C. tropicalis strain used was ATCC MYA-3404, whereas the C. albicans strain was NGY152. These data represent means ± SD from eight donors assayed by duplicate. *P < 0.05 when compared to untreated cells. HK, heat-killed cells. Figure 8. View largeDownload slide Phagocytosis of C. tropicalis and C. albicans by human monocyte-derived macrophages pre-incubated with both laminarin and phosphomannan. Human monocyte-derived macrophages were pre-incubated with both laminarin and C. tropicalis phosphomannan for 60 min at 37°C and 5% (v/v) CO2, and then incubated with Acridine orange-labeled yeast cells at a macrophage–yeast ratio 1:6, for 2 h at 37°C and 5% (v/v) CO2. Macrophages were gated by FACS and 50 000 cells were counted/sample. Results represent macrophages interacting with at least one fluorescent yeast cell. The C. tropicalis strain used was ATCC MYA-3404, whereas the C. albicans strain was NGY152. These data represent means ± SD from eight donors assayed by duplicate. *P < 0.05 when compared to untreated cells. HK, heat-killed cells. DISCUSSION The C. tropicalis genetic manipulation was firstly reported more than 25 years ago (Picataggio, Deanda and Mielenz 1991); and since then, several metabolic routes have been explored in this organism, disrupting genes and analyzing the phenotypes of mutant cells. However, thus far, no genes involved in the synthesis of cell wall components have been studied in C. tropicalis (Zuza-Alves, Silva-Rocha and Chaves 2017). Therefore, the functional characterization of MNN4 and the characterization of a C. tropicalis mnn4Δ null mutant represent one of the first attempt to study this cell component by genetic means. It has been previously demonstrated that the presence of phosphomannan at the C. albicans cell wall is a dynamic parameter across fungal isolates, and strains with high, moderate, low or null content of this wall component have been reported (MacCallum et al.2009). Here, we observed a similar trend with the C. tropicalis isolates included in our study, and we have evidence indicating the same phenomenon in clinical isolates of Candida dubliniensis (our unpublished results). It is noteworthy that we could not find any correlation between lower phosphomannan content and a specific C. tropicalis clade, as the four isolates with low ability to bind Alcian blue are grouped in the three clades thus far described for C. tropicalis (Tavanti et al.2005). The reduced phosphomannan content in some strains is unlikely to be related to lower levels of cell wall mannan, as this parameter was constant in all the analyzed strains, indicating a plasticity only in the levels of cell wall phosphomannan. Since immune recognition of phosphomannan is important for proper fungal phagocytosis (McKenzie et al.2010; Bain et al.2014; Erwig and Gow 2016; Gonzalez-Hernandez et al.2017; Hernández-Chávez et al.2017), it is tempting to speculate that the fungal cell has the ability to modulate the presence of phosphomannan on the cell wall surface, as an adaptive strategy to evade the host immune response (Gonzalez-Hernandez et al.2017; Hernández-Chávez et al.2017). Even though we have gathered important information about the role of phosphomannan during C. albicans–host interaction, the biochemical details of the biosynthetic machinery involved in its elaboration remain yet to be described (Gonzalez-Hernandez et al.2017), and are required to understand the plasticity of Candida species to express different levels of phosphomannan at the cell wall. The MNN4 gene has been described as a central element in the phosphomannosylation pathway in different yeast species (Odani et al.1996; Jigami and Odani 1999; Hobson et al.2004; Miura et al.2004; Singleton, Masuoka and Hazen 2005; Park et al.2011; Gonzalez-Hernandez et al.2017); therefore, this gene was the most attractive target to disrupt when assessing the relevance of cell wall phosphomannans on C. tropicalis biology. The putative MNN4 was confirmed to be the functional ortholog of C. albicans MNN4 and has all the bioinformatics features of this gene, including the LicD motif, which has been regarded as canonical for genes involved in the synthesis of fungal phosphomannan (Gonzalez-Hernandez et al.2017). As in C. albicans (Hobson et al.2004), loss of MNN4 did not affect the growth rate, cell and colony morphology, and ability to undergo dimorphism, and cell wall content of chitin, β-glucan and mannan, suggesting phosphomannans are dispensable for these phenotypical traits. The cell wall porosity was increased in the mnn4Δ null mutant though, which was also positively affected in those clinical isolates with reduced ability to bind Alcian blue. Increased cell wall porosity has been reported in cells with gross defects in the wall composition and structuration (De Nobel et al.1990; Navarro-Arias et al.2016; Perez-Garcia et al.2016), but this is not the case of the C. tropicalis mnn4Δ null mutant. Our hypothesis to explain this observation is that the polycations are partially retained within the cell wall, via the negative charge of phosphomannan, having a lower ability to leak nucleic acids in cells with abundant phosphomannan levels. The absence of phosphomannan would not retain polycations in the wall, with the consequent higher porosity. We do not have a proper explanation to the increased sensitivity to high concentrations of Congo red showed by the mnn4Δ null mutant, as this parameter was reported unaffected in the C. albicans mnn4 null mutant (Hobson et al.2004), and no changes in the content of β-glucan were observed in the C. tropicalis mutant. Further experiments are required to properly address this observation. Loss of phosphomannan upon C. tropicalis MNN4 disruption was confirmed by both reduction of the ability to bind Alcian blue and the absence of most of the glycans released by acid hydrolysis. The latter could have the ability to release other materials from the cell wall, such as products from partial degradation of glucans (Ruiz-Herrera et al.2006), offering an explanation to the material electrophoretically separated and found in all the samples analyzed, including in the null mutant strain. One technical limitation of FACE, when compared to TLC, the methodology previously used to characterize cell wall phosphomannans (Hobson et al.2004), is that the latter was combined with a pulse and chase strategy that involved the use of radioactive mannose, offering the benefit to reveal only mannose-based compounds after the TLC analysis. Here, we derivatized and labeled with ANTS all sugars present in the samples, including those released from other polysaccharides different from mannans. Nonetheless, the methodology was useful to confirm the results generated with Alcian blue. The presence of phosphomannans extended with β1,2-mannose residues has been reported previously in C. tropicalis (Kobayashi et al.1994), which is likely to correspond to the acid-labile material lost in the mnn4Δ null mutant. This observation is reinforced by the fact that the encoding genes for β1,2-mannosyltransferases are likely to be part of the C. tropicalis genome (Butler et al.2009). The virulence attenuation in larvae of G. mellonella was contrary to the observation previously reported in C. albicans, where phosphomannosylation is dispensable for virulence in mice (Hobson et al.2004). Here, we demonstrated that both C. albicans and C. tropicalis mnn4Δ null strains had virulence attenuation. The adaptation to the host milieu is unlikely to account for this observation, as both mutants have normal growth rate and the CFU recovered for infected animals were similar to those obtained from larvae infected with the control strains. In C. albicans, it has been demonstrated that loss of MNN4 lead to increased cell hydrophobicity and changes in the adhesion to fibronectin (Singleton, Masuoka and Hazen 2005) Therefore, it is tempting to speculate that loss of the negative charge of phosphomannan affects the ability of C. albicans and C. tropicalis to properly adhere, and therefore damage, larval tissues. It is well documented that the G. mellonella immunological strategies to control pathogens, including fungi, are melanization, activation of hemocytes and production of antimicrobial peptides. Even though the loss of phosphomannan has been showed to have a negative impact on the ability of cationic antimicrobial peptides to affect C. albicans viability (Harris et al.2009), anionic peptides are important players to control fungal infection in G. mellonella (Cytryńska et al.2007; Mak, Zdybicka-Barabas and Cytrynska 2010; Sowa-Jasiłek et al.2014; Zdybicka-Barabas et al.2014; Wojda 2017). Among them, the anionic peptide 2 has been demonstrated to be relevant to control infections caused by C. albicans (Sowa-Jasiłek et al.2014). Since the MNN4 mutants lack a negatively charged wall component, i.e., phosphomannan, it is likely that the anionic antimicrobial peptides would be more accessible to the fungal surface. The dispensable role of phosphomannan to induce both pro- and anti-inflammatory cytokines was already reported for C. albicans cells lacking this wall component (Cambi et al.2008; Mora-Montes et al.2010; Mukaremera et al.2017), and our results here confirmed its dispensability for cytokine stimulation. Candida tropicalis cells showed more susceptibility to phagocytosis by macrophages than C. albicans cells, and this could be explained by the increased content of phosphomannan at the cell wall when compared to C. albicans cells. This observation does not undermine the contribution of dectin-1 to Candida phagocytosis, on the contrary, our results confirmed the importance of this receptor during Candida uptake. However, for the case of C. tropicalis, concentrations of laminarin that inhibited C. albicans phagocytosis failed to have a similar impact on C. tropicalis phagocytosis because of the higher abundance of phosphomannan and, therefore, the increased probability to be engaged with its receptor, most likely galectin-3, as reported for C. albicans (Netea et al.2008). Although unlikely, we cannot formally rule out the possibility that a different receptor could be involved in the recognition of C. tropicalis phosphomannan. The wall porosity of C. tropicalis cells was higher than in C. albicans, and this has been related to increased accessibility of inner wall components to the surface of the wall, such as β1,3-glucan. This agrees with the observation that even though the receptor for phosphomannan was blocked with this cell wall component during pre-incubation, C. tropicalis cells were more readily phagocytosed than C. albicans cells. In conclusion, our results indicate that cell wall phosphomannosylation is required for C. tropicalis–host interaction and loss of this wall component affects virulence in larvae of G. mellonella, and phagocytosis by human monocyte-derived macrophages. SUPPLEMENTARY DATA Supplementary data are available at FEMSYR online. Acknowledgements We thank Luz A. López-Ramírez (Universidad de Guanajuato) for technical assistance, and Professors Neil A. R. Gow and Donna M. MacCallum (University of Aberdeen) for the donation of the strains used in this study. FUNDING This work was supported by Consejo Nacional de Ciencia y Tecnología [grant numbers CB2011/166860, PDCPN2014-247109, FC 2015-02-834]; Universidad de Guanajuato [grant numbers 000025/11, 0087/13, 1025/2016, Convocatoria Institucional para Fortalecer la Excelencia Académica 2015, CIFOREA 89/2016]; Programa de Mejoramiento de Profesorado [grant number UGTO-PTC-261] and Red Temática Glicociencia en Salud (grant number CONACYT-México 2016-2017). Conflicts of interest. None declare. REFERENCES Abrams WR , Diamond LW , Kane AB . A flow cytometric assay of neutrophil degranulation . J Histochem Cytochem 1983 ; 31 : 737 – 44 . Google Scholar CrossRef Search ADS PubMed Bain JM , Louw J , Lewis LE et al. Candida albicans hypha formation and mannan masking of beta-glucan inhibit macrophage phagosome maturation . mBio 2014 ; 5 : e01874 . Google Scholar CrossRef Search ADS PubMed Barelle CJ , Manson CL , MacCallum DM et al. GFP as a quantitative reporter of gene regulation in Candida albicans . Yeast 2004 ; 21 : 333 – 40 . Google Scholar CrossRef Search ADS PubMed Bates S , Hall RA , Cheetham J et al. Role of the Candida albicans MNN1 gene family in cell wall structure and virulence . BMC Res Notes 2013 ; 6 : 294 . Google Scholar CrossRef Search ADS PubMed Bates S , MacCallum DM , Bertram G et al. Candida albicans Pmr1p, a secretory pathway P-type Ca2+/Mn2+-ATPase, is required for glycosylation and virulence . J Biol Chem 2005 ; 280 : 23408 – 15 . Google Scholar CrossRef Search ADS PubMed Bates S , Hughes HB , Munro CA et al. Outer chain N-glycans are required for cell wall integrity and virulence of Candida albicans . J Biol Chem 2006 ; 281 : 90 – 98 . Google Scholar CrossRef Search ADS PubMed Bizerra FC , Melo ASA , Katchburian E et al. Changes in cell wall synthesis and ultrastructure during paradoxical growth effect of caspofungin on four different Candida species . Antimicrob Agents Ch 2011 ; 55 : 302 – 10 . Google Scholar CrossRef Search ADS Brand A , MacCallum DM , Brown AJ et al. Ectopic expression of URA3 can influence the virulence phenotypes and proteome of Candida albicans but can be overcome by targeted reintegration of URA3 at the RPS10 locus . Eukaryot Cell 2004 ; 3 : 900 – 9 . Google Scholar CrossRef Search ADS PubMed Brown GD , Denning DW , Gow NA et al. Hidden killers: human fungal infections . Sci Transl Med 2012 ; 4 : 165rv13- . Google Scholar CrossRef Search ADS PubMed Butler G , Rasmussen MD , Lin MF et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes . Nature 2009 ; 459 : 657 – 62 . Google Scholar CrossRef Search ADS PubMed Cambi A , Netea MG , Mora-Montes HM et al. Dendritic cell interaction with Candida albicans critically depends on N-linked mannan . J Biol Chem . 2008 ; 283 : 20590 – 9 . Google Scholar CrossRef Search ADS PubMed Cohen-Kedar S , Baram L , Elad H et al. Human intestinal epithelial cells respond to beta-glucans via Dectin-1 and Syk . Eur J Immunol 2014 ; 44 : 3729 – 40 . Google Scholar CrossRef Search ADS PubMed Courjol F , Jouault T , Mille C et al. Beta-1,2-mannosyltransferases 1 and 3 participate in yeast and hyphae O- and N-linked mannosylation and alter Candida albicans fitness during infection . Open Forum Infect Dis 2015 ; 2 : ofv116 . Google Scholar CrossRef Search ADS PubMed Cytryńska M , Mak P , Zdybicka-Barabas A et al. Purification and characterization of eight peptides from Galleria mellonella immune hemolymph . Peptides 2007 ; 28 : 533 – 46 . Google Scholar CrossRef Search ADS PubMed De Nobel JG , Klis FM , Munnik T et al. An assay of relative cell wall porosity in Saccharomyces cerevisiae, Kluyveromyces lactis and Schizosaccharomyces pombe . Yeast 1990 ; 6 : 483 – 90 . Google Scholar CrossRef Search ADS PubMed Diaz-Jimenez DF , Mora-Montes HM , Hernandez-Cervantes A et al. Biochemical characterization of recombinant Candida albicans mannosyltransferases Mnt1, Mnt2 and Mnt5 reveals new functions in O- and N-mannan biosynthesis . Biochem Bioph Res Com 2012 ; 419 : 77 – 82 . Google Scholar CrossRef Search ADS Díaz-Jiménez DF , Pérez-García LA , Martínez-Álvarez JA et al. Role of the fungal cell wall in pathogenesis and antifungal resistance . Curr Fungal Infect Rep 2012 ; 6 : 275 – 82 . Google Scholar CrossRef Search ADS DuBois M , Gilles KA , Hamilton JK et al. Colorimetric method for determination of sugars and related substances . Anal Chem 1956 ; 28 : 350 – 6 . Google Scholar CrossRef Search ADS Erwig LP , Gow NAR . Interactions of fungal pathogens with phagocytes . Nat Rev Micro 2016 ; 14 : 163 – 76 . Google Scholar CrossRef Search ADS Estrada-Mata E , Navarro-Arias MJ , Perez-Garcia LA et al. Members of the Candida parapsilosis complex and Candida albicans are differentially recognized by human peripheral blood mononuclear cells . Front Microbiol 2015 ; 6 : 1527 . Google Scholar PubMed Falagas ME , Apostolou KE , Pappas VD . Attributable mortality of candidemia: a systematic review of matched cohort and case-control studies . Eur J Clin Microbiol Infect Dis 2006 ; 25 : 419 – 25 . Google Scholar CrossRef Search ADS PubMed Gonzalez-Hernandez RJ , Jin K , Hernandez-Chavez MJ et al. Phosphomannosylation and the functional analysis of the extended Candida albicans MNN4-like gene family . Front Microbiol 2017 ; 8 : 2156 . Google Scholar CrossRef Search ADS PubMed Gow NA , Netea MG , Munro CA et al. Immune recognition of Candida albicans beta-glucan by dectin-1 . J Infect Dis 2007 ; 196 : 1565 – 71 . Google Scholar CrossRef Search ADS PubMed Gow NAR , Hube B . Importance of the Candida albicans cell wall during commensalism and infection . Curr Opin Microbiol 2012 ; 15 : 406 – 12 . Google Scholar CrossRef Search ADS PubMed Hall RA , Gow NA . Mannosylation in Candida albicans: role in cell wall function and immune recognition . Mol Microbiol 2013 ; 90 : 1147 – 61 . Google Scholar CrossRef Search ADS PubMed Hall RA , Bates S , Lenardon MD et al. The Mnn2 mannosyltransferase family modulates mannoprotein fibril length, immune recognition and virulence of Candida albicans . PLoS Pathog 2013 ; 9 : e1003276 . Google Scholar CrossRef Search ADS PubMed Han Y , Kanbe T , Cherniak R et al. Biochemical characterization of Candida albicans epitopes that can elicit protective and nonprotective antibodies . Infect Immun 1997 ; 65 : 4100 – 7 . Google Scholar PubMed Harris M , Mora-Montes HM , Gow NA et al. Loss of mannosylphosphate from Candida albicans cell wall proteins results in enhanced resistance to the inhibitory effect of a cationic antimicrobial peptide via reduced peptide binding to the cell surface . Microbiology 2009 ; 155 : 1058 – 70 . Google Scholar CrossRef Search ADS PubMed Heinsbroek SE , Taylor PR , Martinez FO et al. Stage-specific sampling by pattern recognition receptors during Candida albicans phagocytosis . PLoS Pathog 2008 ; 4 : e1000218 . Google Scholar CrossRef Search ADS PubMed Hernández-Chávez M , Pérez-García L , Niño-Vega G et al. Fungal strategies to evade the host immune recognition . J Fungi 2017 ; 3 : 51 . Google Scholar CrossRef Search ADS Hobson RP , Munro CA , Bates S et al. Loss of cell wall mannosylphosphate in Candida albicans does not influence macrophage recognition . J Biol Chem 2004 ; 279 : 39628 – 35 . Google Scholar CrossRef Search ADS PubMed Huang H , Ostroff GR , Lee CK et al. Relative contributions of dectin-1 and complement to immune responses to particulate beta-glucans . J Immunol 2012 ; 189 : 312 – 7 . Google Scholar CrossRef Search ADS PubMed Jigami Y , Odani T . Mannosylphosphate transfer to yeast mannan . Biochim Biophys Acta 1999 ; 1426 : 335 – 45 . Google Scholar CrossRef Search ADS PubMed Kim YH , Kang J-Y , Gil JY et al. Abolishment of N-glycan mannosylphosphorylation in glyco-engineered Saccharomyces cerevisiae by double disruption of MNN4 and MNN14 genes . Appl Microbiol Biot 2017 ; 101 : 2979 – 89 . Google Scholar CrossRef Search ADS Kobayashi H , Shibata N , Nakada M et al. Structural study of cell wall phosphomannan of Candida albicans NIH B-792 (serotype B) strain, with special reference to 1H and 13C NMR analyses of acid-labile oligomannosyl residues . Arch Biochem Biophys 1990 ; 278 : 195 – 204 . Google Scholar CrossRef Search ADS PubMed Kobayashi H , Matsuda K , Ikeda T et al. Structures of cell wall mannans of pathogenic Candida tropicalis IFO 0199 and IFO 1647 yeast strains . Infect Immun 1994 ; 62 : 615 – 22 . Google Scholar PubMed Kothavade RJ , Kura MM , Valand AG et al. Candida tropicalis: its prevalence, pathogenicity and increasing resistance to fluconazole . J Med Microbiol 2010 ; 59 : 873 – 80 . Google Scholar CrossRef Search ADS PubMed Lewis LE , Bain JM , Lowes C et al. Stage specific assessment of Candida albicans phagocytosis by macrophages identifies cell wall composition and morphogenesis as key determinants . PLoS Pathog 2012 ; 8 : e1002578 . Google Scholar CrossRef Search ADS PubMed Liu H , Kohler J , Fink G . Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog . Science 1994 ; 266 : 1723 – 6 . Google Scholar CrossRef Search ADS PubMed MacCallum DM , Castillo L , Nather K et al. Property differences among the four major Candida albicans strain clades . Eukaryot Cell 2009 ; 8 : 373 – 87 . Google Scholar CrossRef Search ADS PubMed Mak P , Zdybicka-Barabas A , Cytrynska M . A different repertoire of Galleria mellonella antimicrobial peptides in larvae challenged with bacteria and fungi . Dev Comp Immunol 2010 ; 34 : 1129 – 36 . Google Scholar CrossRef Search ADS PubMed Maneu V , Yanez A , Murciano C et al. Dectin-1 mediates in vitro phagocytosis of Candida albicans yeast cells by retinal microglia . FEMS Immunol Med Microbiol 2011 ; 63 : 148 – 50 . Google Scholar CrossRef Search ADS PubMed Martinez-Alvarez JA , Perez-Garcia LA , Flores-Carreon A et al. The immune response against Candida spp. and Sporothrix schenckii . Rev Iberoam Micol 2014 ; 31 : 62 – 66 . Google Scholar CrossRef Search ADS PubMed Martinez-Alvarez JA , Perez-Garcia LA , Mellado-Mojica E et al. Sporothrix schenckii sensu stricto and Sporothrix brasiliensis are differentially recognized by human peripheral blood mononuclear cells . Front Microbiol 2017 ; 8 : 843 . Google Scholar CrossRef Search ADS PubMed Martinez-Duncker I , Diaz-Jimenez DF , Mora-Montes HM . Comparative analysis of protein glycosylation pathways in humans and the fungal pathogen Candida albicans . Int J Microbiol 2014 ; 2014 : 267497 . Google Scholar CrossRef Search ADS PubMed McKenzie CG , Koser U , Lewis LE et al. Contribution of Candida albicans cell wall components to recognition by and escape from murine macrophages . Infect Immun 2010 ; 78 : 1650 – 8 . Google Scholar CrossRef Search ADS PubMed Mesa-Arango AC , Forastiero A , Bernal-Martínez L et al. The non-mammalian host Galleria mellonella can be used to study the virulence of the fungal pathogen Candida tropicalis and the efficacy of antifungal drugs during infection by this pathogenic yeast . Med Mycol 2013 ; 51 : 461 – 72 . Google Scholar CrossRef Search ADS PubMed Mesa-Arango AC , Rueda C , Román E et al. Cell wall changes in amphotericin B-resistant strains from Candida tropicalis and relationship with the immune responses elicited by the host . Antimicrob Agents Ch 2016 ; 60 : 2326 – 35 . Google Scholar CrossRef Search ADS Miura M , Hirose M , Miwa T et al. Cloning and characterization in Pichia pastoris of PNO1 gene required for phosphomannosylation of N-linked oligosaccharides . Gene 2004 ; 324 : 129 – 37 . Google Scholar CrossRef Search ADS PubMed Mora-Montes HM , Ponce-Noyola P , Villagómez-Castro JC et al. Protein glycosylation in Candida . Future Microbiol 2009 ; 4 : 1167 – 83 . Google Scholar CrossRef Search ADS PubMed Mora-Montes HM , Bates S , Netea MG et al. A multifunctional mannosyltransferase family in Candida albicans determines cell wall mannan structure and host-fungus interactions . J Biol Chem 2010 ; 285 : 12087 – 95 . Google Scholar CrossRef Search ADS PubMed Mora-Montes HM , Bates S , Netea MG et al. Endoplasmic reticulum alpha-glycosidases of Candida albicans are required for N glycosylation, cell wall integrity, and normal host-fungus interaction . Eukaryot Cell 2007 ; 6 : 2184 – 93 . Google Scholar CrossRef Search ADS PubMed Mukaremera L , Lee KK , Mora-Montes HM et al. Candida albicans yeast, pseudohyphal, and hyphal morphogenesis differentially affects immune recognition . Front Immunol 2017 ; 8 : 629 . Google Scholar CrossRef Search ADS PubMed Munro CA , Bates S , Buurman ET et al. Mnt1p and Mnt2p of Candida albicans are partially redundant alpha-1,2-mannosyltransferases that participate in O-linked mannosylation and are required for adhesion and virulence . J Biol Chem 2005 ; 280 : 1051 – 60 . Google Scholar CrossRef Search ADS PubMed Navarro-Arias MJ , Dementhon K , Defosse TA et al. Group X hybrid histidine kinase Chk1 is dispensable for stress adaptation, host-pathogen interactions and virulence in the opportunistic yeast Candida guilliermondii . Res Microbiol 2017 ; 168 : 644 – 54 . Google Scholar CrossRef Search ADS PubMed Navarro-Arias MJ , Defosse TA , Dementhon K et al. Disruption of protein mannosylation affects Candida guilliermondii cell wall, immune sensing, and virulence . Front Microbiol 2016 ; 7 : 1951 . Google Scholar CrossRef Search ADS PubMed Netea MG , Brown GD , Kullberg BJ et al. An integrated model of the recognition of Candida albicans by the innate immune system . Nat Rev 2008 ; 6 : 67 – 78 . Netea MG , Joosten LA , van der Meer JW et al. Immune defence against Candida fungal infections . Nat Rev Immunol 2015 ; 15 : 630 – 42 . Google Scholar CrossRef Search ADS PubMed Odani T , Shimma Y , Tanaka A et al. Cloning and analysis of the MNN4 gene required for phosphorylation of N-linked oligosaccharides in Saccharomyces cerevisiae . Glycobiology 1996 ; 6 : 805 – 10 . Google Scholar CrossRef Search ADS PubMed Park J-N , Song Y , Cheon SA et al. Essential Role of YlMPO1, a Novel Yarrowia lipolytica Homologue of Saccharomyces cerevisiae MNN4, in Mannosylphosphorylation of N- and O-Linked Glycans . Appl Environ Microb 2011 ; 77 : 1187 – 95 . Google Scholar CrossRef Search ADS Perez-Garcia LA , Csonka K , Flores-Carreon A et al. Role of protein glycosylation in Candida parapsilosis cell wall integrity and host interaction . Front Microbiol 2016 ; 7 : 306 . Google Scholar PubMed Picataggio S , Deanda K , Mielenz J . Determination of Candida tropicalis acyl coenzyme A oxidase isozyme function by sequential gene disruption . Mol Cell Biol 1991 ; 11 : 4333 – 9 . Google Scholar CrossRef Search ADS PubMed Plaine A , Walker L , Da Costa G et al. Functional analysis of Candida albicans GPI-anchored proteins: roles in cell wall integrity and caspofungin sensitivity . Fungal Genet Biol 2008 ; 45 : 1404 – 14 . Google Scholar CrossRef Search ADS PubMed Porman AM , Hirakawa MP , Jones SK et al. MTL–independent phenotypic switching in Candida tropicalis and a dual role for Wor1 in regulating switching and filamentation . PLOS Genet 2013 ; 9 : e1003369 . Google Scholar CrossRef Search ADS PubMed Reuß O , Vik Å , Kolter R et al. The SAT1 flipper, an optimized tool for gene disruption in Candida albicans . Gene 2004 ; 341 : 119 – 27 . Google Scholar CrossRef Search ADS PubMed Ruiz-Herrera J , Victoria Elorza M , Valentín E et al. Molecular organization of the cell wall of Candida albicans and its relation to pathogenicity . FEMS Yeast Res 2006 ; 6 : 14 – 29 . Google Scholar CrossRef Search ADS PubMed Santos EOL , Azzolini AECS , Lucisano-Valim YM . Optimization of a flow cytometric assay to evaluate the human neutrophil ability to phagocytose immune complexes via Fcγ and complement receptors . J Pharmacol Toxicol Meth 2015 ; 72 : 67 – 71 . Google Scholar CrossRef Search ADS Singleton DR , Masuoka J , Hazen KC . Surface hydrophobicity changes of two Candida albicans serotype B mnn4Δ mutants . Eukaryot Cell 2005 ; 4 : 639 – 48 . Google Scholar CrossRef Search ADS PubMed Sowa-Jasiłek A , Zdybicka-Barabas A , Stączek S et al. Studies on the role of insect hemolymph polypeptides: Galleria mellonella anionic peptide 2 and lysozyme . Peptides 2014 ; 53 : 194 – 201 . Google Scholar CrossRef Search ADS PubMed Tavanti A , Davidson AD , Johnson EM et al. Multilocus sequence typing for differentiation of strains of Candida tropicalis . J Clin Microbiol 2005 ; 43 : 5593 – 600 . Google Scholar CrossRef Search ADS PubMed Wang H , Xu YC , Hsueh PR . Epidemiology of candidemia and antifungal susceptibility in invasive Candida species in the Asia-Pacific region . Future Microbiol 2016 ; 11 : 1461 – 77 . Google Scholar CrossRef Search ADS PubMed Wang X-H , Nakayama K-I , Shimma Y-I et al. MNN6, a member of the KRE2/MNT1 family, is the gene for mannosylphosphate transfer in Saccharomyces cerevisiae . J Biol Chem 1997 ; 272 : 18117 – 24 . Google Scholar CrossRef Search ADS PubMed West L , Lowman DW , Mora-Montes HM et al. Differential virulence of Candida glabrata glycosylation mutants . J Biol Chem 2013 ; 288 : 22006 – 18 . Google Scholar CrossRef Search ADS PubMed Wojda I . Immunity of the greater wax moth Galleria mellonella . Insect Sci 2017 ; 24 : 342 – 57 . Google Scholar CrossRef Search ADS PubMed Zdybicka-Barabas A , Mak P , Jakubowicz T et al. Lysozyme and defense peptides as suppressors of phenoloxidase activity in Galleria mellonella . Arch Insect Biochem Physiol 2014 ; 87 : 1 – 12 . Google Scholar CrossRef Search ADS PubMed Zhang J-R , Idanpaan-Heikkila I , Fischer W et al. Pneumococcal licD2 gene is involved in phosphorylcholine metabolism . Mol Microbiol 1999 ; 31 : 1477 – 88 . Google Scholar CrossRef Search ADS PubMed Zuza-Alves DL , Silva-Rocha WP , Chaves GM . An update on Candida tropicalis based on basic and clinical approaches . Front Microbiol 2017 ; 8 : 1927 . Google Scholar CrossRef Search ADS PubMed © FEMS 2018. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png FEMS Yeast Research Oxford University Press

Role of protein phosphomannosylation in the Candida tropicalis–macrophage interaction

Loading next page...
 
/lp/ou_press/role-of-protein-phosphomannosylation-in-the-candida-tropicalis-8cvzTQFTUv
Publisher
Blackwell
Copyright
© FEMS 2018.
ISSN
1567-1356
eISSN
1567-1364
D.O.I.
10.1093/femsyr/foy053
Publisher site
See Article on Publisher Site

Abstract

Abstract Candida tropicalis is an opportunistic fungal pathogen responsible for mucosal and systemic infections. The cell wall is the initial contact point between a fungal cell and the host immune system, and mannoproteins are important components that play key roles when interacting with host cells. In Candida albicans, mannans are modified by mannosyl-phosphate moieties, named phosphomannans, which can work as molecular scaffolds to synthesize β1,2-mannooligosaccharides, and MNN4 is a positive regulator of the phosphomannosylation pathway. Here, we showed that C. tropicalis also displays phosphomannans on the cell surface, but the amount of this cell wall component varies depending on the fungal strain. We also identified a functional ortholog of CaMNN4 in C. tropicalis. Disruption of this gene caused depletion of phosphomannan content. The C. tropicalis mnn4Δ did not show defects in the ability to stimulate cytokine production by human mononuclear cells but displayed virulence attenuation in an insect model of candidiasis. When the mnn4Δ-macrophage interaction was analyzed, results showed that presence of cell wall phosphomannan was critical for C. tropicalis phagocytosis. Finally, our results strongly suggest a differential role for phosphomannans during phagocytosis of C. albicans and C. tropicalis. cell wall, phosphomannosylation, Candida tropicalis, Candida albicans, phagocytosis, host–fungus interaction INTRODUCTION Members of the Candida genus are among the most common commensal fungi in healthy individuals but are also responsible for life-threatening systemic infections in immunocompromised patients, such as patients with AIDS, those undergoing bone marrow transplantation or chemotherapeutic schemes to combat neoplastic diseases (Brown et al.2012). Candidemia is regarded as one of the main nosocomial bloodstream infections worldwide, being Candida albicans the most common species found in systemic candidiasis cases, with mortality rates that can be up to 71% (Falagas, Apostolou and Pappas 2006; Mora-Montes et al.2009). However, there are other species of the Candida genus that are as important as C. albicans but less studied. Candida tropicalis is commonly isolated in tropical countries and is responsible for 33% to 48% of systemic infections caused by Candida species (Kothavade et al.2010; Wang, Xu and Hsueh 2016). It is also the most common fungal pathogen isolated from neutropenic patients and in recent years has shown an increased drug resistance to fluconazole (Kothavade et al.2010). The cell wall is the first point of interaction between fungi and host cells, and is critical for the recognition of Candida species by components of the immune system (Díaz-Jiménez et al.2012; Gow and Hube 2012; Hall and Gow 2013; Hall et al.2013; West et al.2013; Estrada-Mata et al.2015; Netea et al.2015; Erwig and Gow 2016; Navarro-Arias et al.2016; Perez-Garcia et al.2016; Hernández-Chávez et al.2017). Although there is little information about the composition of the C. tropicalis cell wall, it is known that contains chitin, β1,6- and β1,3-glucans, and N-linked mannans composed of a canonical core oligosaccharide modified with an outer chain that contains an α1,6-polymannose backbone, and lateral chains composed of α1,2- and β1,2-mannose units (Kobayashi et al.1994; Bizerra et al.2011; Mesa-Arango et al.2016). Moreover, the outer chain of the N-linked mannans also contains mannosyl-phosphate residues, which work as molecular scaffolds for the elaboration of β1,2-oligomannosides (Kobayashi et al.1994). Even though it has not been demonstrated, it is assumed that C. tropicalis also contains O-linked mannans, as demonstrated in other yeast species, including C. albicans (Munro et al.2005; Diaz-Jimenez et al.2012). Both, N-linked and O-linked mannans are important for tissue adhesion, virulence, cell wall integrity, recognition of the pathogen by the host immune system and the establishment of a protective immune response (Bates et al.2005; Munro et al.2005; Bates et al.2006; Mora-Montes et al.2007; Harris et al.2009; Mora-Montes et al.2009; McKenzie et al.2010; Mora-Montes et al.2010; Díaz-Jiménez et al.2012; Gow and Hube 2012; Lewis et al.2012; Bates et al.2013; Hall and Gow 2013; Hall et al.2013; West et al.2013; Bain et al.2014; Martinez-Alvarez et al.2014; Martinez-Duncker, Diaz-Jimenez and Mora-Montes 2014; Courjol et al.2015; Estrada-Mata et al.2015; Netea et al.2015; Erwig and Gow 2016; Navarro-Arias et al.2016; Perez-Garcia et al.2016). The mannosyl-phosphate moiety found in mannan, named phosphomannan, has been related to stress regulation during conditions of drought, high osmolality or nutrient limitation, in the cross-linking of proteins to cell wall glucan, and in the modulation of nucleotide transport across the Golgi membrane (Jigami and Odani 1999). Moreover, these negatively charged cell wall structures allow primary macrophages and macrophage cell lines to properly phagocyte C. albicans cells (McKenzie et al.2010; Lewis et al.2012; Bain et al.2014; Gonzalez-Hernandez et al.2017), and the engagement with antimicrobial cationic peptides with the ability to inhibit C. albicans growth, such as DsS3(1-16; Harris et al.2009). Therefore, phosphomannans, as other cell wall components, are critical for a proper interaction of C. albicans with components of the immune response. The phosphomannan synthesis has been described in most detail in Saccharomyces cerevisiae and C. albicans. In both models, Mnn4, a protein with no enzyme activity associated yet, is regarded as a positive regulator of phosphomannosyltransferases because expression of its encoding gene correlates with the cell wall phosphomannan content (Odani et al.1996; Jigami and Odani 1999; Hobson et al.2004). Paralogs of MNN4 found in both organisms have been also related to the cell wall phosphomannosylation (Gonzalez-Hernandez et al.2017; Kim et al.2017). The Mnn6/Ktr6 is the sole phosphomannosyltransferase found in S. cerevisiae (Wang et al.1997), while C. albicans Mnt3 and Mnt5 are enzymes with redundant activity and responsible for the addition of about 50% of the cell wall phosphomannan (Mora-Montes et al.2010). Since the cell wall phosphomannosylation is an important element of the fungus–immune cell interaction, and we currently have limited information on the relevance of this wall component in the C. tropicalis biology, here we generated a C. tropicalis mnn4Δ null mutant and characterize its phenotype and ability to interact with host cells, with emphasis on the virulence, ability to stimulate cytokine production and phagocytosis by macrophages. MATERIALS AND METHODS Strains and culture conditions The strains used in this study are listed in Table 1. Unless otherwise indicated, cells were maintained and propagated at 28°C in YPD medium [2% (w/v) bacteriological peptone, 1% (w/v) yeast extract, 2% (w/v) glucose]. When solid medium was required, plates were added with 2% (w/v) agar. Cell dimorphism was assessed either on solid Spider medium (Liu, Kohler and Fink 1994) or liquid RPMI 1640 (Sigma, St. Louis, MO, USA) supplemented with 10% (v/v) fetal bovine serum (Sigma, St. Louis, MO, USA). For the latter, 5 × 106 cells mL−1 were incubated for 4 h at 37°C and 200 rpm, and cell preparations were inspected by bright-field microscopy to evaluate the percentage of yeast cells, pseudohyphae, and true hyphae. Three hundred cells were counted per strain. To prepare cells for cell wall analysis, phosphomannan extraction and cytokine assays, cells were grown in 500 mL flasks at 28°C containing 200 mL of YPD broth and reciprocal shaking at 200 rpm, until reaching exponential growth phase. Cell heat killing was performed at 56°C during 60 min (Mora-Montes et al.2007). Loss of cell viability was confirmed by plating heat-killed (HK) cells on solid YPD plates and incubated for 48 h at 28°C. Under these conditions, cells were no viable and did not burst, as determined by the lack of released 260-nm absorbing material in the extracellular space (Martinez-Alvarez et al.2017). For β-elimination assays, cells were resuspended in 0.1 N NaOH and incubated at room temperature for 18 h with slow orbital shaking. The reaction was stopped by neutralizing with 0.1 N HCl, cells were pelleted at 2000 × g for 10 min and the supernatant was recovered and stored –20°C until used (Diaz-Jimenez et al.2012). Phosphomannan trimming was performed by incubating cells with 10 mM HCl at 100°C for 1 h. Then, cells were pelleted at 2000 × g for 15 min, the supernatant was saved, neutralized with 10 mM NaOH and kept at –20°C until used (Kobayashi et al.1990; Han et al.1997). Phosphomannan was quantified using the phenol–sulfuric acid method (DuBois et al.1956). Data were normalized to the sugar content obtained from 3 × 109 cells. Table 1. Strains used in this work. Strain Organism Genotype Reference NGY152 Candida albicans ura3Δ::imm434/ura3Δ::imm434, RPSI/rps1Δ::Clp10 (Brand et al.2004) CDH7 Candida albicans ura3Δ::imm434/ura3Δ::imm434, mnn4Δ:hisG/mnn4Δ::hisG (Hobson et al.2004) CDH15 Candida albicans As CDH7, but RPSI/rps1Δ::CIp10 (Hobson et al.2004) CDH14 Candida albicans As CDH7, but RPSI/rps1Δ::[CIp10-MNN4-URA3]n (Hobson et al.2004) HMY149 Candida albicans As CDH7, but RPSI/rps1Δ::pACT1-CtMNN4 This work ATCC MYA-3404 Candida tropicalis WT ATCC HMY173 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/MNN4 This work HMY175 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1 This work HMY202 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1-MNN4 This work BB427748 Candida tropicalis WT (Tavanti et al.2005) J980162 Candida tropicalis WT (Tavanti et al.2005) AM2004/0089 Candida tropicalis WT (Tavanti et al.2005) GUI720 Candida tropicalis WT (Tavanti et al.2005) L712 Candida tropicalis WT (Tavanti et al.2005) J930943 Candida tropicalis WT (Tavanti et al.2005) BRL701883 Candida tropicalis WT (Tavanti et al.2005) J990297 Candida tropicalis WT (Tavanti et al.2005) AM2005/0289 Candida tropicalis WT (Tavanti et al.2005) AM2004/0069 Candida tropicalis WT (Tavanti et al.2005) Strain Organism Genotype Reference NGY152 Candida albicans ura3Δ::imm434/ura3Δ::imm434, RPSI/rps1Δ::Clp10 (Brand et al.2004) CDH7 Candida albicans ura3Δ::imm434/ura3Δ::imm434, mnn4Δ:hisG/mnn4Δ::hisG (Hobson et al.2004) CDH15 Candida albicans As CDH7, but RPSI/rps1Δ::CIp10 (Hobson et al.2004) CDH14 Candida albicans As CDH7, but RPSI/rps1Δ::[CIp10-MNN4-URA3]n (Hobson et al.2004) HMY149 Candida albicans As CDH7, but RPSI/rps1Δ::pACT1-CtMNN4 This work ATCC MYA-3404 Candida tropicalis WT ATCC HMY173 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/MNN4 This work HMY175 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1 This work HMY202 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1-MNN4 This work BB427748 Candida tropicalis WT (Tavanti et al.2005) J980162 Candida tropicalis WT (Tavanti et al.2005) AM2004/0089 Candida tropicalis WT (Tavanti et al.2005) GUI720 Candida tropicalis WT (Tavanti et al.2005) L712 Candida tropicalis WT (Tavanti et al.2005) J930943 Candida tropicalis WT (Tavanti et al.2005) BRL701883 Candida tropicalis WT (Tavanti et al.2005) J990297 Candida tropicalis WT (Tavanti et al.2005) AM2005/0289 Candida tropicalis WT (Tavanti et al.2005) AM2004/0069 Candida tropicalis WT (Tavanti et al.2005) View Large Table 1. Strains used in this work. Strain Organism Genotype Reference NGY152 Candida albicans ura3Δ::imm434/ura3Δ::imm434, RPSI/rps1Δ::Clp10 (Brand et al.2004) CDH7 Candida albicans ura3Δ::imm434/ura3Δ::imm434, mnn4Δ:hisG/mnn4Δ::hisG (Hobson et al.2004) CDH15 Candida albicans As CDH7, but RPSI/rps1Δ::CIp10 (Hobson et al.2004) CDH14 Candida albicans As CDH7, but RPSI/rps1Δ::[CIp10-MNN4-URA3]n (Hobson et al.2004) HMY149 Candida albicans As CDH7, but RPSI/rps1Δ::pACT1-CtMNN4 This work ATCC MYA-3404 Candida tropicalis WT ATCC HMY173 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/MNN4 This work HMY175 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1 This work HMY202 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1-MNN4 This work BB427748 Candida tropicalis WT (Tavanti et al.2005) J980162 Candida tropicalis WT (Tavanti et al.2005) AM2004/0089 Candida tropicalis WT (Tavanti et al.2005) GUI720 Candida tropicalis WT (Tavanti et al.2005) L712 Candida tropicalis WT (Tavanti et al.2005) J930943 Candida tropicalis WT (Tavanti et al.2005) BRL701883 Candida tropicalis WT (Tavanti et al.2005) J990297 Candida tropicalis WT (Tavanti et al.2005) AM2005/0289 Candida tropicalis WT (Tavanti et al.2005) AM2004/0069 Candida tropicalis WT (Tavanti et al.2005) Strain Organism Genotype Reference NGY152 Candida albicans ura3Δ::imm434/ura3Δ::imm434, RPSI/rps1Δ::Clp10 (Brand et al.2004) CDH7 Candida albicans ura3Δ::imm434/ura3Δ::imm434, mnn4Δ:hisG/mnn4Δ::hisG (Hobson et al.2004) CDH15 Candida albicans As CDH7, but RPSI/rps1Δ::CIp10 (Hobson et al.2004) CDH14 Candida albicans As CDH7, but RPSI/rps1Δ::[CIp10-MNN4-URA3]n (Hobson et al.2004) HMY149 Candida albicans As CDH7, but RPSI/rps1Δ::pACT1-CtMNN4 This work ATCC MYA-3404 Candida tropicalis WT ATCC HMY173 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/MNN4 This work HMY175 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1 This work HMY202 Candida tropicalis As ATCC MYA-3404, but mnn4Δ::sat1/mnn4Δ::sat1-MNN4 This work BB427748 Candida tropicalis WT (Tavanti et al.2005) J980162 Candida tropicalis WT (Tavanti et al.2005) AM2004/0089 Candida tropicalis WT (Tavanti et al.2005) GUI720 Candida tropicalis WT (Tavanti et al.2005) L712 Candida tropicalis WT (Tavanti et al.2005) J930943 Candida tropicalis WT (Tavanti et al.2005) BRL701883 Candida tropicalis WT (Tavanti et al.2005) J990297 Candida tropicalis WT (Tavanti et al.2005) AM2005/0289 Candida tropicalis WT (Tavanti et al.2005) AM2004/0069 Candida tropicalis WT (Tavanti et al.2005) View Large Heterologous complementation in Candida albicans The C. tropicalis MNN4 ORF was amplified using the primer pair 5΄-AAGCTTATGGCTTCGATAATACAAGTA and 5΄-GCTAGC CTATTCTATAGCAAACGGTAAA (underlined sequences were introduced to generate HindIII and NheI sites, respectively). This amplicon was cloned into pCR®-2.1-TOPO® (Invitrogen, Carlsbad CA, United States) and then subcloned into the HindIII and NheI sites of pACT1 (Barelle et al.2004). This construction was then linearized with StuI and used to transform a C. albicans mnn4Δ null mutant (Hobson et al.2004). This plasmid integrates into the RPS1 locus, which was confirmed by PCR using the primer pair 5΄-CACCAGGATTTATTGCCAAC and 5΄-CGAACGGAGTAGGAATGTAC. Generation of a C. tropicalis mnn4Δ null mutant and a reintegrant control strain Deletion of MNN4 was achieved using the SAT1 flipper strategy as previously described (Reuß et al.2004; Porman et al.2013). Fig. 1 summarizes the strategy followed. Primer pairs were used to amplify by PCR the 487 bp and 1500 bp of the 5΄ and 3΄ upstream and downstream regions of the MNN4 ORF. These amplicons were cloned into pCR®-2.1-TOPO® (Invitrogen, Carlsbad CA, United States), and the upstream fragment was subcloned into the ApaI-XhoI sites of pSFS2, while the downstream fragment was subcloned into the NotI-SacI sites of this plasmid, generating a construction where the selection marker is flanked by regions for homologous recombination at the MNN4 locus. The disruption cassette was released using ApaI and SacI and used for cell transformation. Cells were selected in YPD plates added with 200 μg mL−1 nourseothricin (Goldbio, St. Louis, MO, United States), and the correct genomic integration of the disruption cassette into the MNN4 locus was verified by PCR, using the primer pair 5΄-ATGCAACCTGCATTCGGTAT and 5΄-AACCAGATTTCCAGATTTCCAGA, which amplifies a fragment of 3014 bp that contains a 5΄ region out of the recombination region and a 3΄ region inside the disruption cassette (Fig. S1, Supporting Information). A second pair of primers (5΄-GGCTATACAGATTTCCCGGCTC and 5΄-GCTGTAGCAGTTAAACCATCACG) was used to amplify a 1476 bp downstream fragment that consisted of a 5΄ region of the disruption cassette and a 3΄ region out of the recombination site (Fig. S1, Supporting Information). The SAT1 marker was recycled by growing cells for 2 days at 28°C in liquid YEP [2% (w/v) bacteriological peptone and 1% (w/v) yeast extract] added with 2% (w/v) maltose, and then plated in YPD supplemented with 10 μg mL−1 nourseothricin for selection of sensitive strains. Nourseothricin-sensitive transformant colonies were picked up and screened by PCR to amplify a 1650 bp recombination scar fragment and a 3486 bp fragment that corresponds to the remaining copy of MNN4 gene. Both regions were amplified using the primer pair 5΄-ATGCAACCTGCATTCGGTAT and 5΄-GCTGTAGCAGTTAAACCATCACG (Fig. S1, Supporting Information). The second MNN4 allele was deleted performing a second round of transformation with the same construction. A construction to reintegrate MNN4 into the C. tropicalis mnn4Δ null mutant was generated by amplifying a fragment containing the MNN4 ORF plus 1500 bp up and downstream the encoding region, using the primer pair 5΄-gggcccaaggtgtgagtgagtgagtgt and 5΄-ctcgagcagaacaagaactagtcggtgc (underlined sequences indicate adaptors to generate restriction sites for ApaI and XhoI, respectively). This 4643 bp fragment was cloned into the ApaI-XhoI sites of pSFS2. Then, a 700 bp fragment downstream of the disrupted locus was amplified by PCR using the primer pair 5΄-gcggccgcCTTGGTGGCATTTTGTTGTTGA and 5΄-GagctcTGGATCCGGTAAAGTTTCTGAATTT (underlined sequences indicate adaptors to generate restriction sites for NotI and SacI, respectively) and cloned into the NotI-SacI sites of pSFS2. The reintegration cassette was used to transform the C. tropicalis mnn4Δ null mutant, replacing one disrupted allele with MNN4 and the selection marker (Fig. 1). Upon marker recycling, integration of the construction at the MNN4 locus was confirmed by PCR, using the primer pairs 5΄-TTACCACCAGCAGTGACCAAA and 5΄-ATGGGGTACCAATCATCAACTTACA, and 5΄-GCTCTATGAACACAATCACGACA and 5΄-TCTCCAAACGGATTTGTATTTGTCA, which amplified part of the upstream (1009 bp) and downstream (1253 bp) recombination regions, respectively (Fig. S1, Supporting Information). Figure 1. View largeDownload slide Strategy to disrupt C. tropicalis MNN4 and generation of a reintegrant control strain. (A) Disruption cassette in pSFS2 vector, which consists of a nourseothricin resistance marker (CaSAT1) and a CaFLP gene that is induced by maltose. Different restriction sites flank the FRT sites to clone recombination regions to disrupt the target gene via homologous recombination. (B) The cassette to disrupt CtMNN4 consisted of a 487 bp fragment, upstream the MNN4 ORF, cloned into the Apa I (A) and Xho I (X) sites of pSFS2, and a 1500 bp fragment, downstream the MNN4 ORF, cloned into the Not I (N) and Sac I (ScI) sites of the vector.The cassette was released by digesting with Apa I and Sac I. (C) After cell transformation with the released cassette, its correct integration was confirmed by PCR, amplifying a fragment of 3014 bp that contained part of the 5΄ end of the cassette, and a 1476 bp fragment that contained part of the 3΄ end of the disruption cassette. (D) To recycle the cassette, mutant cells were grown in medium containing 2% (w/v) maltose to induce CaFLP expression, which cleaved at FRT sites, leaving a fragment of 1650 bp and a native allele of MNN4. Presence of both alleles was confirmed by PCR. (E) To generate a homozygous mutant, steps C and D were repeated, and loss of the remaining native MNN4 allele was confirmed by PCR. (F) To reintegrate CtMNN4 into the native locus, the ORF plus 1500 bp upstream and 1500 bp downstream were cloned into the Apa I and Xho I sites of pSFS2, and an MNN4 downstream fragment of 700 bp was cloned into the Not I and Sac I sites of the vector. The null mutant strain was transformed with this construction and a 5΄ and 3΄ screening fragments were amplified to corroborate the correct integration of the cassette at the MNN4 locus. The cassette was recycled using the same strategy described in D. Figure 1. View largeDownload slide Strategy to disrupt C. tropicalis MNN4 and generation of a reintegrant control strain. (A) Disruption cassette in pSFS2 vector, which consists of a nourseothricin resistance marker (CaSAT1) and a CaFLP gene that is induced by maltose. Different restriction sites flank the FRT sites to clone recombination regions to disrupt the target gene via homologous recombination. (B) The cassette to disrupt CtMNN4 consisted of a 487 bp fragment, upstream the MNN4 ORF, cloned into the Apa I (A) and Xho I (X) sites of pSFS2, and a 1500 bp fragment, downstream the MNN4 ORF, cloned into the Not I (N) and Sac I (ScI) sites of the vector.The cassette was released by digesting with Apa I and Sac I. (C) After cell transformation with the released cassette, its correct integration was confirmed by PCR, amplifying a fragment of 3014 bp that contained part of the 5΄ end of the cassette, and a 1476 bp fragment that contained part of the 3΄ end of the disruption cassette. (D) To recycle the cassette, mutant cells were grown in medium containing 2% (w/v) maltose to induce CaFLP expression, which cleaved at FRT sites, leaving a fragment of 1650 bp and a native allele of MNN4. Presence of both alleles was confirmed by PCR. (E) To generate a homozygous mutant, steps C and D were repeated, and loss of the remaining native MNN4 allele was confirmed by PCR. (F) To reintegrate CtMNN4 into the native locus, the ORF plus 1500 bp upstream and 1500 bp downstream were cloned into the Apa I and Xho I sites of pSFS2, and an MNN4 downstream fragment of 700 bp was cloned into the Not I and Sac I sites of the vector. The null mutant strain was transformed with this construction and a 5΄ and 3΄ screening fragments were amplified to corroborate the correct integration of the cassette at the MNN4 locus. The cassette was recycled using the same strategy described in D. Analysis of the cell wall composition and porosity Mid-log phase cells were pelleted and mechanically broken using a Precellys-24 homogenizer for 30 min, in cycles of 1 min with 2-min resting periods. Cell lysis was confirmed using bright-field microscopy. The cell homogenate was washed with deionized water and 1 M NaCl for three times. Pellets were recovered, lyophilized and acid-hydrolyzed with 2 M trifluoroacetic acid as described (Mora-Montes et al.2007). The acid-hydrolyzed samples were analyzed using High-Performance Anion-Exchange Chromatography with Pulsed Amperometric Detection as previously reported (Plaine et al.2008). For the analysis of cell wall porosity, cells were washed twice with PBS and aliquots containing 1 × 108 cells were suspended in buffer A (10 mM Tris-HCl, pH 7.4), buffer A plus 30 μg mL−1 poly-L-Lysine (MW 30–70 kDa, Sigma, St. Louis, MO, USA) or buffer A plus 30 μg mL−1 DEAE-dextran (MW 500 kDa, Sigma, St. Louis, MO, USA), and incubated for 30 min at 30°C with constant shaking at 200 rpm. Cells were pelleted, and supernatants were collected and used to measure the absorbance at 260 nm. The relative cell wall porosity to DEAE-Dextran was calculated, using the porosity to poly-L-lysine for data normalization (De Nobel et al.1990). Alcian blue binding assays Mid-log phase cells were pelleted and washed twice with deionized water. Cells were adjusted to an OD600 of 0.2, and aliquots of 1 mL were pelleted and resuspended in 1 mL of Alcian blue (Sigma, St. Louis, MO, USA; 30 μg mL−1 in 0.02 N HCl). Cells were incubated at room temperature for 15 min, centrifuged to pellet cells and the supernatant saved and used to quantify the non-bound dye at 620 nm. This was used to calculate the content of Alcian blue bound to cells as previously reported (Hobson et al.2004). Sensitivity to cell wall perturbing agents Cells were grown overnight in YPD medium and used to inoculate fresh YPD broth, which was incubated for 6 h at 28°C and 150 rpm. After this time, cells were washed twice with deionized water and the concentration adjusted to OD600 of 0.05. Aliquots containing 20 μL of cells were placed into a 96-well plate containing YPD or YPD added with any of the three-different cell wall perturbing agents tested (Congo red, Calcofluor white and Hygromycin B). Plates were incubated for 40 h at 28°C and 100 rpm. After this time, cell growth was assessed by spectrophotometry at 600 nm. Growth curves were generated using doubling dilutions of the tested agents, with the top concentrations set at: 400 μg mL−1 Congo red, 660 μg mL−1 Hygromycin B and 50 μg mL−1 Calcofluor white. The 100% of growth corresponds to cells incubated in YDP alone under the same conditions. Derivatization of phosphomannans and fluorophore-assisted carbohydrate electrophoresis Aliquots containing 20 mg of phosphomannan were derivatized with 0.2 M 2-aminonaphthalene trisulfone (ANTS) resuspended in a solution 1:17 acetic acid–water (v/v) and 20 μL of 1.0 M sodium cyanoborohydride resuspended in DMSO. Reactions were carried out for 16 h at 37°C and then lyophilized. Derivatized phosphomannans were resuspended in 20 μL of sample loading buffer (62.5 mM Tris-HCl, 20% [v/v] glycerol), and 10 μL of derivatized samples were loaded onto a 20% (v/v) polyacrylamide gel and separated as previously reported (Navarro-Arias et al.2016). Carbohydrate mobility was assessed by inspecting the gel under UV light. Images were captured using the ChemiDoc Imaging System (BioRad, Hercules, California, Estados Unidos). As a molecular marker, a ladder of maltooligosaccharides from one to seven glucose units (Sigma, St. Louis, MO, USA) was used. Isolation of human peripheral blood mononuclear cells (PBMCs) The human primary cells were collected from healthy adult volunteers after information of the study was disclosed and the written informed consent was signed. This study was approved by the Ethics Committee from Universidad de Guanajuato (permission number 17082011). The isolation of human PBMNCs was achieved by density centrifugation using EDTA blood samples and Histopaque-1077 (Sigma, St. Louis, MO, USA) as reported (Navarro-Arias et al.2017). Cell concentration was adjusted at 5 × 106 mL−1 in ice-cold RPMI 1640 (Dutch modification; added with 2 mM glutamine, 0.1 mM pyruvate and 0.05 mg mL−1 gentamycin, all reagents from Sigma, St. Louis, MO, USA) and immediately used for cytokine stimulation or cell differentiation to macrophages. Analysis of the human peripheral blood mononuclear cell–C. tropicalis interaction Aliquots of 100 μL containing 5 × 105 human PBMNCs and 100 μL with 1 × 105 yeast cells were incubated in round-bottom 96-well microplates for 24 h at 37°C and 5% (v/v) CO2. Then, plates were centrifuged for 10 min at 3000 × g at 4°C. Supernatants were saved and used to quantify TNFα, IL-6 and IL-10 with ABTS ELISA Development kits from Preprotech. The IL-1β concentration was measured using a DuoSet ELISA Development kit from R&D systems. Differentiation of human peripheral blood mononuclear cell-derived Macrophages Isolated human PBMCs cells were differentiated into macrophages as reported (Perez-Garcia et al.2016). Briefly, aliquots of 1 mL containing 5 × 106 cells in RPMI supplemented with 1% (v/v) penicillin–streptomycin solution (PS, Sigma, St. Louis, MO, USA) were placed in flat bottom 24-well plates and incubated 2 h at 37°C and 5% (v/v) CO2. Wells were washed gently with PBS at 37°C to remove non-adherent cells and cell debris. Then, 1 mL of X-VIVO 15 serum-free medium (Lonza, Basel, Switzerland) supplemented with 1% (v/v) PS and 10 ng mL−1 recombinant human granulocyte–macrophage colony stimulating factor (Sigma, St. Louis, MO, USA) were added to each well and incubated for 7 days at 37°C and 5% (v/v) CO2. Fresh medium was exchanged every 3 days. Phagocytosis assays Yeast cells were grown in YPD at 28°C with reciprocal shaking at 200 rpm until exponential growth phase was reached. Then, cells were washed twice with PBS and labeled with 1 mg mL−1 Acridine orange (Sigma, St. Louis, MO, USA) as described (Abrams, Diamond and Kane 1983). Yeast cells were washed twice with PBS and resuspended at a cell concentration of 3 × 107 yeast cells mL−1. The fungus–immune cell interaction was carried out in 800 μL of DMEM medium (Sigma, St. Louis, MO, USA), in 6-well plates with a macrophage–yeast ratio 1:6, which was incubated for 2 h at 37°C and 5% (v/v) CO2. After the interactions, macrophages were washed twice with cold PBS and suspended in PBS containing 1.25 mg mL−1 Trypan Blue as an external fluorescence quencher, as described (Santos, Azzolini and Lucisano-Valim 2015). Samples were immediately analyzed by flow cytometry in a MoFlo XDP system (Beckman Coulter, Brea, California, USA) collecting 50 000 events gated for macrophage cells. Fluorescence was acquired from the compensated FL1 (green) and FL3 (red) channels using macrophage cells without any labeling. Phagocytosis of yeast cells was assessed from counted events in the green (recently phagocytosed cells) and red (cells within acidified phagolysosomes) fluorescence channels. When required, the monocyte-derived macrophages were pre-incubated for 60 min at 37°C and 5% (v/v) CO2 with laminarin (Sigma, St. Louis, MO, USA) or phosphomannan isolated from C. tropicalis cell walls, prior interaction with yeast cells. Galleria mellonella survival assays The ability of the yeast cells to infect and kill Galleria mellonella larvae was assessed as described (Perez-Garcia et al.2016). Briefly, the last left pro-leg was sanitized with 70% (v/v) ethanol and this area was used to inject 2 × 107 yeast cells mL−1, contained in 10 μL of PBS, using a Hamilton syringe equipped with a 26-gauge needle. Larvae were kept at 37°C and survival monitored daily. The content of CFU was determined by incubating serial dilutions of the hemolymph on YPD plates for 28°C for 72 h. Each experimental group contained 30 larvae, including a control group injected only with PBS. Statistical analysis Statistical analyses were conducted with the GraphPad Prism 6 software. The effect of cell wall perturbing agents on the fungal growth was analyzed by two-way ANOVA. Cytokine stimulation and phagocytosis were performed in duplicate with eight healthy donors, whereas the rest of the in vitro experiments were performed at least thrice in duplicates. Data represent cumulative results of all experiments performed. The Mann–Whitney U test or unpaired t-test was used to establish statistical significance (see figure legends for details), with a significance level set at P < 0.05. Survival experiments with G. mellonella larvae were carried out three times, with a total of 10 larvae per experiment. Data were analyzed using the Log-rank test and presented in Kaplan–Meier survival curves. The statistical significance was set at P < 0.05. RESULTS Cell wall phosphomannosylation and porosity varies in clinical isolates of C. tropicalis We randomly selected 10 clinical isolates previously used to assess the genetic plasticity of C. tropicalis (Tavanti et al.2005) and compared their cell wall composition with the reference strain ATCC MYA-3404, whose genome has been sequenced (Butler et al.2009). Results confirmed that the major wall polysaccharides, chitin, glucan and mannans were present in all the strains analyzed, and no significant changes were observed in their proportions (Table 2). The ability of Candida cells to bind the dye Alcian blue has been directly related to the cell wall phosphomannan content (Hobson et al.2004; Mora-Montes et al.2010; Gonzalez-Hernandez et al.2017). When this parameter was analyzed in the clinical isolates, we could observe different abilities to bind the dye, with strains showing a phenotype similar to the reference strain and isolates binding significantly lower levels of Alcian blue (Table 2). This lower ability to bind the cationic dye correlated with higher wall porosity to DEAE-dextran, a cell wall parameter that tends to increase when defects in the cell wall fitness or composition are present (Table 2; De Nobel et al.1990; Navarro-Arias et al.2016; Perez-Garcia et al.2016). Therefore, these data indicate that cell wall phosphomannan could be a dynamic component of the C. tropicalis cells wall. Table 2. Cell wall analysis of clinical isolates of Candida tropicalis, an mnn4Δ null mutant and control strains. Cell wall abundance Strain Chitin (%) Mannan (%) Glucan (%) Phosphomannan content (μg)a Porosity (%)b BB427748 2.8 ± 0.9 35.2 ± 5.7 61.4 ± 3.8 81.9 ± 2.4 57.9 ± 2.5 J980162 2.9 ± 1.2 39.2 ± 6.6 57.2 ± 5.2 79.5 ± 6.8 58.9 ± 5.6 AM2004/0089 2.3 ± 1.3 33.7 ± 4.6 63.2 ± 4.2 47.1 ± 5.0c 64.5 ± 3.6c GUI720 2.2 ± 1.0 33.9 ± 3.2 63.1 ± 4.4 65.9 ± 5.7c 63.0 ± 2.1c L712 2.3 ± 0.9 34.5 ± 3.9 62.6 ± 3.1 86.4 ± 4.3 56.2 ± 3.8 J930943 2.7 ± 1.1 33.1 ± 6.0 63.7 ± 1.9 83.4 ± 7.3 53.4 ± 6.6 BRL701883 2.9 ± 0.5 34.5 ± 5.9 62.0 ± 4.2 24.8 ± 4.9c 68.8 ± 5.8c J990297 2.3 ± 1.7 37.9 ± 5.4 59.6 ± 3.3 84.5 ± 10.4 53.1 ± 7.4 AM2005/0289 3.1 ± 1.4 32.8 ± 4.4 63.8 ± 2.9 77.5 ± 9.3 55.6 ± 4.6 AM2004/0069 2.5 ± 1.0 38.6 ± 5.8 58.8 ± 3.3 33.8 ± 7.4c 64.3 ± 3.6c ATCC MYA-3404 (parental strain) 2.8 ± 1.6 34.3 ± 7.7 61.6 ± 5.7 84.0 ± 5.8 55.2 ± 5.9 mnn4Δ 2.9 ± 0.5 32.7 ± 2.8 64.3 ± 3.3 3.7 ± 1.9c 67.7 ± 5.6c mnn4Δ + MNN4 2.2 ± 0.9 37.3 ± 4.1 59.3 ± 4.8 56.8 ± 3.7c 56.6 ± 7.6 Cell wall abundance Strain Chitin (%) Mannan (%) Glucan (%) Phosphomannan content (μg)a Porosity (%)b BB427748 2.8 ± 0.9 35.2 ± 5.7 61.4 ± 3.8 81.9 ± 2.4 57.9 ± 2.5 J980162 2.9 ± 1.2 39.2 ± 6.6 57.2 ± 5.2 79.5 ± 6.8 58.9 ± 5.6 AM2004/0089 2.3 ± 1.3 33.7 ± 4.6 63.2 ± 4.2 47.1 ± 5.0c 64.5 ± 3.6c GUI720 2.2 ± 1.0 33.9 ± 3.2 63.1 ± 4.4 65.9 ± 5.7c 63.0 ± 2.1c L712 2.3 ± 0.9 34.5 ± 3.9 62.6 ± 3.1 86.4 ± 4.3 56.2 ± 3.8 J930943 2.7 ± 1.1 33.1 ± 6.0 63.7 ± 1.9 83.4 ± 7.3 53.4 ± 6.6 BRL701883 2.9 ± 0.5 34.5 ± 5.9 62.0 ± 4.2 24.8 ± 4.9c 68.8 ± 5.8c J990297 2.3 ± 1.7 37.9 ± 5.4 59.6 ± 3.3 84.5 ± 10.4 53.1 ± 7.4 AM2005/0289 3.1 ± 1.4 32.8 ± 4.4 63.8 ± 2.9 77.5 ± 9.3 55.6 ± 4.6 AM2004/0069 2.5 ± 1.0 38.6 ± 5.8 58.8 ± 3.3 33.8 ± 7.4c 64.3 ± 3.6c ATCC MYA-3404 (parental strain) 2.8 ± 1.6 34.3 ± 7.7 61.6 ± 5.7 84.0 ± 5.8 55.2 ± 5.9 mnn4Δ 2.9 ± 0.5 32.7 ± 2.8 64.3 ± 3.3 3.7 ± 1.9c 67.7 ± 5.6c mnn4Δ + MNN4 2.2 ± 0.9 37.3 ± 4.1 59.3 ± 4.8 56.8 ± 3.7c 56.6 ± 7.6 aμg of Alcian blue bound/OD600 = 1. bRelative to DEAE-Dextran. cP < 0.05, when compared to ATCC MYA-3404 strain. View Large Table 2. Cell wall analysis of clinical isolates of Candida tropicalis, an mnn4Δ null mutant and control strains. Cell wall abundance Strain Chitin (%) Mannan (%) Glucan (%) Phosphomannan content (μg)a Porosity (%)b BB427748 2.8 ± 0.9 35.2 ± 5.7 61.4 ± 3.8 81.9 ± 2.4 57.9 ± 2.5 J980162 2.9 ± 1.2 39.2 ± 6.6 57.2 ± 5.2 79.5 ± 6.8 58.9 ± 5.6 AM2004/0089 2.3 ± 1.3 33.7 ± 4.6 63.2 ± 4.2 47.1 ± 5.0c 64.5 ± 3.6c GUI720 2.2 ± 1.0 33.9 ± 3.2 63.1 ± 4.4 65.9 ± 5.7c 63.0 ± 2.1c L712 2.3 ± 0.9 34.5 ± 3.9 62.6 ± 3.1 86.4 ± 4.3 56.2 ± 3.8 J930943 2.7 ± 1.1 33.1 ± 6.0 63.7 ± 1.9 83.4 ± 7.3 53.4 ± 6.6 BRL701883 2.9 ± 0.5 34.5 ± 5.9 62.0 ± 4.2 24.8 ± 4.9c 68.8 ± 5.8c J990297 2.3 ± 1.7 37.9 ± 5.4 59.6 ± 3.3 84.5 ± 10.4 53.1 ± 7.4 AM2005/0289 3.1 ± 1.4 32.8 ± 4.4 63.8 ± 2.9 77.5 ± 9.3 55.6 ± 4.6 AM2004/0069 2.5 ± 1.0 38.6 ± 5.8 58.8 ± 3.3 33.8 ± 7.4c 64.3 ± 3.6c ATCC MYA-3404 (parental strain) 2.8 ± 1.6 34.3 ± 7.7 61.6 ± 5.7 84.0 ± 5.8 55.2 ± 5.9 mnn4Δ 2.9 ± 0.5 32.7 ± 2.8 64.3 ± 3.3 3.7 ± 1.9c 67.7 ± 5.6c mnn4Δ + MNN4 2.2 ± 0.9 37.3 ± 4.1 59.3 ± 4.8 56.8 ± 3.7c 56.6 ± 7.6 Cell wall abundance Strain Chitin (%) Mannan (%) Glucan (%) Phosphomannan content (μg)a Porosity (%)b BB427748 2.8 ± 0.9 35.2 ± 5.7 61.4 ± 3.8 81.9 ± 2.4 57.9 ± 2.5 J980162 2.9 ± 1.2 39.2 ± 6.6 57.2 ± 5.2 79.5 ± 6.8 58.9 ± 5.6 AM2004/0089 2.3 ± 1.3 33.7 ± 4.6 63.2 ± 4.2 47.1 ± 5.0c 64.5 ± 3.6c GUI720 2.2 ± 1.0 33.9 ± 3.2 63.1 ± 4.4 65.9 ± 5.7c 63.0 ± 2.1c L712 2.3 ± 0.9 34.5 ± 3.9 62.6 ± 3.1 86.4 ± 4.3 56.2 ± 3.8 J930943 2.7 ± 1.1 33.1 ± 6.0 63.7 ± 1.9 83.4 ± 7.3 53.4 ± 6.6 BRL701883 2.9 ± 0.5 34.5 ± 5.9 62.0 ± 4.2 24.8 ± 4.9c 68.8 ± 5.8c J990297 2.3 ± 1.7 37.9 ± 5.4 59.6 ± 3.3 84.5 ± 10.4 53.1 ± 7.4 AM2005/0289 3.1 ± 1.4 32.8 ± 4.4 63.8 ± 2.9 77.5 ± 9.3 55.6 ± 4.6 AM2004/0069 2.5 ± 1.0 38.6 ± 5.8 58.8 ± 3.3 33.8 ± 7.4c 64.3 ± 3.6c ATCC MYA-3404 (parental strain) 2.8 ± 1.6 34.3 ± 7.7 61.6 ± 5.7 84.0 ± 5.8 55.2 ± 5.9 mnn4Δ 2.9 ± 0.5 32.7 ± 2.8 64.3 ± 3.3 3.7 ± 1.9c 67.7 ± 5.6c mnn4Δ + MNN4 2.2 ± 0.9 37.3 ± 4.1 59.3 ± 4.8 56.8 ± 3.7c 56.6 ± 7.6 aμg of Alcian blue bound/OD600 = 1. bRelative to DEAE-Dextran. cP < 0.05, when compared to ATCC MYA-3404 strain. View Large Identification and disruption of C. tropicalis MNN4 Since the clinical isolates had different ability to bind Alcian blue, and therefore different levels of cell wall phosphomannan, we next decided to investigate the C. tropicalis MNN4, which is a key element in the protein phosphomannosylation pathway in yeast-like organisms (Odani et al.1996; Jigami and Odani 1999; Hobson et al.2004; Gonzalez-Hernandez et al.2017). The putative C. tropicalis MNN4 gene was identified via protein BLAST using the tools available at https://www.ncbi.nlm.nih.gov/. A putative ortholog of C. albicans MNN4 was found within C. tropicalis genome, under the GenBank accession code XP_002549525 (Butler et al.2009). The open reading frame spans 2841 bp and encodes for a putative polypeptide of 946-amino acids, with a putative signal peptide, and both a transmembrane domain and a region rich in lysine/glutamic repeats near the N-terminal end. Moreover, it also contains a motif of the LicD family of proteins, which has been involved in both phosphocholine metabolism and protein phosphomannosylation (Zhang et al.1999; Gonzalez-Hernandez et al.2017). Similar structural traits have been previously described for C. albicans Mnn4, whose sequence spans 997 amino acids (Hobson et al.2004). This polypeptide sequence showed a similarity score of 75% and 58% when compared to Mnn4 from C. albicans and S. cerevisiae, respectively. To demonstrate that this gene was indeed the functional ortholog of C. albicans MMN4, the whole open reading frame was amplified from C. tropicalis genomic DNA and cloned into the pACT1 vector, which contains the promoter region of C. albicans ACT1 and the terminatior sequence of S. cerevisiae CYC1 (Barelle et al.2004). This construction, pACT1-CtMNN4, was used to transform a C. albicans mnn4Δ null mutant, which is unable to bind Alcian blue (Hobson et al.2004). Upon transformation, the strain HMY149 (C. albicans mnn4Δ + pACT1-CtMNN4) could restore the ability to bind Alcian blue to levels similar to those observed with the wild-type (WT) control cells (124.7 ± 19.9 μg Alcian blue bound for WT cells, 21.1 ± 3.7 μg Alcian blue bound for mnn4Δ null mutant, 116.3 ± 11.9 μg Alcian blue bound for mnn4Δ + pACT1-CtMNN4, P = 0.49 when WT and the complemented strain were compared). Therefore, these results suggest that the putative C. tropicalis MNN4 is the functional ortholog of C. albicans MNN4. Next, to generate a C. tropicalis strain lacking MNN4, we used the SatI flipper strategy to delete both alleles (Reuß et al.2004; Figs 1A–D). The disruption cassette contained 497 bp and 1500 bp of homology to the 5΄ and 3΄ regions of MNN4, respectively. Disruption of the first allele was confirmed by PCR, and the selected mutant strains were subjected to marker recycling, which was confirmed by both sensitivity to nourseothricin and PCR (Fig. 1). This heterozygous strain (HMY173) was used in a second round of transformation with the same disruption cassette and the subsequent recycling of the transformation marker, generating an mnn4Δ null mutant strain (HMY175; Fig. 1E). To generate a reintegrant control strain, CtMNN4 was cloned into pSFS2 and this construction used to transform the mnn4Δ null mutant. The integration of this construct into the MNN4 locus was confirmed by PCR and subjected to marker recycling, generating the strains HMY202 (Fig. 1F). The C. tropicalis mnn4Δ null mutant has normal growth and morphology but displays defects in the cell wall phosphomannosylation Disruption of MNN4 did not affect the cell and colony morphologies, as the null mutant cells formed round yeast cells and whitish, soft and round colonies, like the WT control cells (data not shown). Furthermore, these cells underwent dimorphism, generating hyphae at the same rate as the WT cells (data not shown) and showed a growth rate similar to the control strain (0.67 h−1 for WT control cells and 0.65 h−1 for the mnn4Δ null mutant). We next assessed the cell sensitivity to wall perturbing agents, as this parameter is commonly affected when protein glycosylation pathways are disrupted (Bates et al.2005; Munro et al.2005; Bates et al.2006; Mora-Montes et al.2007; Mora-Montes et al.2009; Mora-Montes et al.2010; Hall et al.2013; Navarro-Arias et al.2016; Perez-Garcia et al.2016). The mnn4Δ null mutant, the WT and the reintegrant control strain showed similar sensitivity to hygromycin B and Calcofluor white (Fig. 2). However, the null mutant strain showed reduced resistance to Congo Red when compared to the parental strain (Fig. 2). This phenotype was restored to WT levels after reintroduction of MNN4 in the native locus (Fig. 2). Next, we analyzed the cell wall composition and found that the three main cell wall polysaccharides were present in similar proportions in the WT, null mutant and reintegrant control cells (Table 2), but the mnn4Δ null mutant displayed a significant reduction in the ability to bind Alcian blue and increased cell wall porosity to DEAE-dextran (Table 2). Reintegration of one copy of MNN4 partially restored the defect associated with the Alcian blue binding, whereas the cell wall porosity was similar to that found in the wall of the WT control cells (Table 2). To confirm the reduced ability of the null mutant cells to bind the cationic dye was directly related to a decreased content in wall phosphomannan, cells were incubated with 10 mM HCl at 100°C for 1 h and the acid-labile oligosaccharides were separated by fluorophore-assisted carbohydrate electrophoresis (FACE). The electrophoretic profile of the acid-hydrolyzed material from WT cell walls, which includes phosphomannans (Kobayashi et al.1990; Han et al.1997; Hobson et al.2004), was electrophoretically separated in oligosaccharides that contain up to five sugar residues, with a marked accumulation of molecules of one to four carbohydrate units (Fig. 3). The electrophoretic profile of samples from the mnn4Δ null mutant showed a similar band of monosaccharides and a faint band at the level of the maltobiose marker, but oligosaccharides with a higher number of monosaccharide units were absent (Fig. 3). The samples from the reintegrant control strain showed the same ladder-like pattern of the acid-hydrolyzed material from the WT cells, with a robust accumulation of material of one, two and three sugar units. To compare this electrophoretic profile, we performed a similar experiment with samples from C. albicans strains, and results were consistent to those found with C. tropicalis, i. e. a ladder-like pattern for phosphomannans released from WT and reintegrant control cells, and absence of this material in the sample from the mnn4Δ null mutant (Fig. 3). Collectively, our data indicate that absence of C. tropicalis MNN4 affected the protein phosphomannosylation pathway. Figure 2. View largeDownload slide Susceptibility of C. tropicalis mnn4Δ null mutant to Calcofluor white, Hygromycin B and Congo red. Cells were incubated with different concentrations of either Calcofluor white, Hygromycin B or Congo red, and growth was evaluated after incubation for 40 h at 28°C. Fungal growth in medium with no disturbing agent included was used for data normalization. The mnn4Δ null mutant (closed triangles) exhibited a higher susceptibility to Congo red. Data are means ± SD of three independent experiments performed in duplicates. Strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. Figure 2. View largeDownload slide Susceptibility of C. tropicalis mnn4Δ null mutant to Calcofluor white, Hygromycin B and Congo red. Cells were incubated with different concentrations of either Calcofluor white, Hygromycin B or Congo red, and growth was evaluated after incubation for 40 h at 28°C. Fungal growth in medium with no disturbing agent included was used for data normalization. The mnn4Δ null mutant (closed triangles) exhibited a higher susceptibility to Congo red. Data are means ± SD of three independent experiments performed in duplicates. Strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. Figure 3. View largeDownload slide FACE of acid-hydrolyzed oligosaccharides from C. tropicalis and C. albicans mnn4Δ null mutant and control strains. Cells were acid-hydrolyzed with 10 mM HCl, the released material was saved, derivatized with 0.2 M ANTS and separated on a 20% polyacrylamide gel. The molecular marker used was a ladder of maltooligosaccharides from one (M1) to seven (M7) glucose units. Strains used in the C. tropicalis panel are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. For C. albicans, the strains used are: WT, NGY152; mnn4Δ, CDH15 and mnn4Δ + MNN4, CDH14. In the left panel, the image was digitally manipulated to remove no relevant lines. Figure 3. View largeDownload slide FACE of acid-hydrolyzed oligosaccharides from C. tropicalis and C. albicans mnn4Δ null mutant and control strains. Cells were acid-hydrolyzed with 10 mM HCl, the released material was saved, derivatized with 0.2 M ANTS and separated on a 20% polyacrylamide gel. The molecular marker used was a ladder of maltooligosaccharides from one (M1) to seven (M7) glucose units. Strains used in the C. tropicalis panel are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. For C. albicans, the strains used are: WT, NGY152; mnn4Δ, CDH15 and mnn4Δ + MNN4, CDH14. In the left panel, the image was digitally manipulated to remove no relevant lines. Proper protein phosphomannosylation is required for virulence in the model organism Galleria mellonella To determine whether the loss of MNN4 had an impact on the C. tropicalis–host interaction, we assessed virulence in an invertebrate model of candidiasis, using larvae of G. mellonella, which have been previously reported as a suitable model to study the virulence of C. tropicalis (Mesa-Arango et al.2013). The total of the animal population infected with the WT strain died at the 8th day post-inoculation, whereas 50% of larvae infected with the mnn4Δ null mutant remained alive, with no sign of infection, i.e., no signs of melanization and with active movements (Fig. 4). Reintroduction of one MNN4 allele in the null mutant background restored the ability to kill the whole animal population at the 8th day (Fig. 4). The control group inoculated only with PBS showed 100% survival of the population at the end of the observation period (Fig. 4). Fungal burdens in the inoculated animals indicated a similar ability to colonize the host tissues for the control strains and the null mutant (1.1 × 107 ± 0.2 × 107 cells mL−1, 1.2 × 107 ± 0.2 × 107 and 1.2 × 107 ± 0.3 × 107cells mL−1, for WT, mnn4Δ and the reintegrant control strain, respectively). Therefore, the C. tropicalis mnn4Δ showed virulence attenuation in the model organism G. mellonella. These data are in contrast with those reported for the C. albicans mnn4Δ null mutant, which did not have virulence attenuation in a mouse model of systemic candidiasis (Hobson et al.2004). Since our results could be influenced by the host and its ability to respond against the fungal pathogen, we decided to determine the virulence of the C. albicans mnn4Δ null mutant in G. mellonella larvae. Animals inoculated with PBS remained alive during the observation period, but those infected with the WT strain showed 100% mortality at the 3rd day post-inoculation (Fig. 4). The null mutant showed decreased ability to kill the total population of larvae, with a survival of 10% animals at day 10 post-inoculation (Fig. 4). The reintegrant control strain showed a similar behavior as the WT strain, killing the whole animal population after 4 days (Fig. 4). Fungal burdens were similar in animals infected with the different strains (1.4 × 107 ± 0.5 × 107 cells mL−1, 1.5 × 107 ± 0.3 × 107 and 1.3 × 107 ± 0.5 × 107cells mL−1, for WT, mnn4Δ and the reintegrant control strain, respectively). Therefore, loss of MNN4 affected C. tropicalis and C. albicans virulence in larvae of G. mellonella. Figure 4. View largeDownload slide Loss of MNN4 affects the virulence of both C. tropicalis and C. albicans in the G. mellonella model. Aliquots containing 2 × 107 yeast cells were inoculated directly into the hemocoel of G. mellonella larvae and survival was monitored daily. Experiments were conducted three times, with a total of 30 larvae per group (10 larvae for each experiment). PBS refers to a control group injected only with PBS. For C. tropicalis, the strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. For C. albicans strains used are: WT, NGY152; mnn4Δ, CDH15 and mnn4Δ + MNN4, CDH14. No significant differences were observed between the mortality associated to parental and reintegrant strains (P = 0.84 and 0.63 for C. tropicalis and C. albicans, respectively). The mnn4Δ null mutant strain in both species showed a significant difference in the ability to kill larvae when compared to the parental or reintegrant control strains (P < 0.05 in both cases and for both species). Figure 4. View largeDownload slide Loss of MNN4 affects the virulence of both C. tropicalis and C. albicans in the G. mellonella model. Aliquots containing 2 × 107 yeast cells were inoculated directly into the hemocoel of G. mellonella larvae and survival was monitored daily. Experiments were conducted three times, with a total of 30 larvae per group (10 larvae for each experiment). PBS refers to a control group injected only with PBS. For C. tropicalis, the strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. For C. albicans strains used are: WT, NGY152; mnn4Δ, CDH15 and mnn4Δ + MNN4, CDH14. No significant differences were observed between the mortality associated to parental and reintegrant strains (P = 0.84 and 0.63 for C. tropicalis and C. albicans, respectively). The mnn4Δ null mutant strain in both species showed a significant difference in the ability to kill larvae when compared to the parental or reintegrant control strains (P < 0.05 in both cases and for both species). Cell wall phosphomannans are not required for stimulation of pro- and anti-inflammatory cytokine production by human PBMNCs Next, we assessed the potential role of phosphomannan in the ability of C. tropicalis to stimulate cytokine production by human PBMCs. The human cells incubated with the WT control cells produced low levels of TNFα, IL-6, IL-1β and IL-10 (Fig. 5). Similarly, the mnn4Δ null mutant and the reintegrant control strain stimulated low levels of the four cytokines analyzed (Fig. 5). It has been previously demonstrated in C. albicans, C. guilliermondii and members of the C. parapsilosis complex that a stronger cytokine stimulation is observed after artificial exposure of β1,3-glucan at the cell surface by heat killing (Gow et al.2007; Estrada-Mata et al.2015; Navarro-Arias et al.2016; Perez-Garcia et al.2016); therefore, we next assess whether exposure of β1,3-glucan after killing by heat could unmask a role for phosphomannans during the interaction between C. tropicalis and human PBMCs. The HK WT, mnn4Δ, and the reintegrant control strain stimulated a strong production of the four cytokines analyzed, in a similar manner (Fig. 5), which confirmed the observation done in other Candida species, i.e., HK cells are likely to expose β1,3-glucan and stimulate the production of high levels of both pro- and anti-inflammatory cytokines. Therefore, phosphomannans play a dispensable role in the ability of C. tropicalis to stimulate cytokine production by human PBMCs. Figure 5. View largeDownload slide Loss of phosphomannans does not affect the ability of C. tropicalis to stimulate cytokine production by human PBMCs. Fungal cells were co-incubated with human PBMCs for 24 h, and the supernatants were saved and used to quantify by ELISA the concentration of TNFα, IL-6, IL-1β and IL-10. Results (means ± SD) were obtained using samples from eight healthy donors, each assayed in duplicate wells. *P < 0.05 when the cytokine levels stimulated by live yeast cells (open bars) and HK yeast cells (closed bars) are compared. Strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. Figure 5. View largeDownload slide Loss of phosphomannans does not affect the ability of C. tropicalis to stimulate cytokine production by human PBMCs. Fungal cells were co-incubated with human PBMCs for 24 h, and the supernatants were saved and used to quantify by ELISA the concentration of TNFα, IL-6, IL-1β and IL-10. Results (means ± SD) were obtained using samples from eight healthy donors, each assayed in duplicate wells. *P < 0.05 when the cytokine levels stimulated by live yeast cells (open bars) and HK yeast cells (closed bars) are compared. Strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. Role of cell wall phosphomannan in the phagocytosis of C. tropicalis by human monocyte-derived macrophages We have previously demonstrated that defects in the cell wall phosphomannosylation affect the ability of cell line and primary macrophages to phagocyte C. albicans yeast cells (McKenzie et al.2010; Gonzalez-Hernandez et al.2017). Thus, we analyzed the impact of MNN4 disruption on the interaction of C. tropicalis and human monocyte-derived macrophages. The mnn4Δ null mutant strain was barely phagocytosed by these human primary cells, whose ability to uptake the mutant yeast cells was reduced up to 90% (Fig. 6). Monocyte-derived macrophages showed a similar ability to phagocyte either the WT or the reintegrant control strain (Fig. 6). This result contrasts with our previous observations in C. albicans, where loss of cell wall phosphomannan reduced the yeast phagocytosis in about 50% (McKenzie et al.2010; Gonzalez-Hernandez et al.2017). Therefore, we compared the phagocytosis of C. albicans and C. tropicalis cells in our experimental setting. The C. albicans WT control strain was significantly less phagocytosed than the C. tropicalis WT strain, but the human cells showed about 50% reduction in the ability to phagocyte the C. albicans mnn4Δ null mutant, as reported (McKenzie et al.2010; Gonzalez-Hernandez et al.2017; Fig. 6). Overall, C. tropicalis cells were more phagocytosed than the C. albicans cells (Fig. 6). Similar results were observed when phagocytosis experiments were performed with the RAW 264.7 (ATCC® TIB-71) murine cell line (data not shown). The cytometry approach used here allows us to differentiate the recently phagocytosed cells and those inside mature phagolysosomes. When both yeast cell populations were analyzed by separate we found similar results for both Candida species: most of the cells were already in mature phagolysosomes when the interaction was stopped (89.9 ± 1.4% and 91.2 ± 2.0% for C. tropicalis and C. albicans, respectively, P = 0.54). This ratio was not significantly modified when the mutant cells were used instead of WT cells, or when laminarin or phosphomannan were included in the interaction assays. Therefore, loss of phosphomannosylation affected the phagocytosis of C. tropicalis by macrophages; however, its role in this process seems to be more relevant than that described in C. albicans. Figure 6. View largeDownload slide Phagocytosis of C. tropicalis and C. albicans mnn4Δ null mutants by human monocyte-derived macrophages. Yeast cells were labeled with Acridine orange and incubated with human monocyte-derived macrophages at a macrophage-yeast ratio 1:6, for 2 h at 37°C and 5% (v/v) CO2. Macrophages were gated by FACS and 50 000 cells were counted/sample. Results represent macrophages interacting with at least one fluorescent yeast cell. Open bars indicate data obtained with C. tropicalis strains, whereas the closed bars correspond to those obtained with C. albicans strains. For C. tropicalis, the strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. For C. albicans, strains used are: WT, NGY152; mnn4Δ, CDH15 and mnn4Δ + MNN4, CDH14. These data represent means ± SD from eight donors assayed by duplicate. *P < 0.05 when compared to the WT strain. †P < 0.05 when compared to the C. tropicalis strain with the similar genetic background. Figure 6. View largeDownload slide Phagocytosis of C. tropicalis and C. albicans mnn4Δ null mutants by human monocyte-derived macrophages. Yeast cells were labeled with Acridine orange and incubated with human monocyte-derived macrophages at a macrophage-yeast ratio 1:6, for 2 h at 37°C and 5% (v/v) CO2. Macrophages were gated by FACS and 50 000 cells were counted/sample. Results represent macrophages interacting with at least one fluorescent yeast cell. Open bars indicate data obtained with C. tropicalis strains, whereas the closed bars correspond to those obtained with C. albicans strains. For C. tropicalis, the strains used are: WT, ATCC MYA-3404; mnn4Δ, HMY175 and mnn4Δ + MNN4, HMY202. For C. albicans, strains used are: WT, NGY152; mnn4Δ, CDH15 and mnn4Δ + MNN4, CDH14. These data represent means ± SD from eight donors assayed by duplicate. *P < 0.05 when compared to the WT strain. †P < 0.05 when compared to the C. tropicalis strain with the similar genetic background. To confirm this observation, we isolated phosphomannans from C. tropicalis cells and pre-incubated the human monocyte-derived macrophages with different concentration of the cell wall component, before interaction with yeast cells. Concentrations lower than 500 μg mL−1 did not show any effect on the ability of macrophages to phagocyte C. tropicalis cells. Macrophages pre-incubated with 500 μg mL−1 phosphomannan had a reduced ability to phagocyte C. tropicalis cells (about 30% reduction), but it was not statistically significant (P = 0.059). However, pre-incubation with 750 or 1000 μg mL−1 significantly reduced the ability to phagocyte C. tropicalis (about 70% and 90%, respectively; Fig. 7). When similar experiments were conducted with C. albicans cells, pre-incubation with phosphomannan reduced the phagocytosis to levels closer to the detection threshold, even at a concentration of 500 μg mL−1 (Fig. 7). Therefore, these data confirm the relevance of phosphomannan in the phagocytosis of Candida cells. Figure 7. View largeDownload slide Phagocytosis of C. tropicalis and C. albicans by human monocyte-derived macrophages pre-incubated with either laminarin or phosphomannan. Human monocyte-derived macrophages were pre-incubated with different concentration of laminarin (left panel) or C. tropicalis phosphomannan (right panel) for 60 min at 37°C and 5% (v/v) CO2, and incubated with Acridine orange-labeled yeast cells at a macrophage–yeast ratio 1:6, for 2 h at 37°C and 5% (v/v) CO2. Macrophages were gated by FACS and 50 000 cells were counted/sample. Results represent macrophages interacting with at least one fluorescent yeast cell. The C. tropicalis strain used was ATCC MYA-3404, whereas the C. albicans strain was NGY152. These data represent means ± SD f from eight donors assayed by duplicate. *P < 0.05 when compared against cells pre-incubated with 0 mg mL−1 of laminarin or phosphomannan. Figure 7. View largeDownload slide Phagocytosis of C. tropicalis and C. albicans by human monocyte-derived macrophages pre-incubated with either laminarin or phosphomannan. Human monocyte-derived macrophages were pre-incubated with different concentration of laminarin (left panel) or C. tropicalis phosphomannan (right panel) for 60 min at 37°C and 5% (v/v) CO2, and incubated with Acridine orange-labeled yeast cells at a macrophage–yeast ratio 1:6, for 2 h at 37°C and 5% (v/v) CO2. Macrophages were gated by FACS and 50 000 cells were counted/sample. Results represent macrophages interacting with at least one fluorescent yeast cell. The C. tropicalis strain used was ATCC MYA-3404, whereas the C. albicans strain was NGY152. These data represent means ± SD f from eight donors assayed by duplicate. *P < 0.05 when compared against cells pre-incubated with 0 mg mL−1 of laminarin or phosphomannan. When the cell wall phosphomannan content was quantified in both C. albicans and C. tropicalis cells, we found that the C. tropicalis strain had a higher content of phosphomannan than the C. albicans strain (3.4 ± 0.21 mg mL−1 and 2.8 ± 0.04 mg mL−1, for C. tropicalis and C. albicans, respectively; P < 0.05). Similarly, the cell wall porosity to DEAE-dextran was higher in C. tropicalis than in C. albicans (55.2 ± 5.9% and 24.8 ± 4.3%, respectively; P < 0.05). The role of dectin-1 in the uptake of yeast cells has been previously demonstrated during the C. albicans–macrophage interaction, and recognition of β1,3-glucan via this receptor is essential for proper fungal phagocytosis (Heinsbroek et al.2008). We next assessed whether C. tropicalis cells could be phagocytosed via this receptor. The pre-incubation of human monocyte-derived macrophages with different concentrations of laminarin, an antagonist of dectin-1 (Maneu et al.2011; Huang et al.2012; Cohen-Kedar et al.2014), negatively affected the ability of macrophages to phagocyte C. tropicalis cells, in a dose-dependent manner (Fig. 7). Comparative experiments using C. albicans cells showed a similar trend (Fig. 7), but we observed a full phagocytosis inhibition when cells were pre-incubated with 25 μg mL−1 laminarin, and this concentration only reduced C. tropicalis phagocytosis near 50% (Fig. 7). Therefore, C. albicans and C. tropicalis phagocytosis rely on the engagement of dectin-1 with its ligand, but this process seems to be essential for C. albicans cells, but not for C. tropicalis. Finally, we analyzed whether the role of phosphomannan and β1,3-glucan during C. tropicalis phagocytosis was only additive or synergistic, by preincubating human monocyte-derived macrophages with both laminarin and phosphomannan. We chose 25 μg mL−1 and 500 μg mL−1 of laminarin and phosphomannan, respectively, because these concentrations showed a moderate effect on the phagocytosis of C. tropicalis cells. Our results indicated that pre-incubation with both compounds reduced C. tropicalis phagocytosis in about 70%, which suggest an additive effect when both blocking agents were used in the experimental setting (Fig. 8). Experiments using HK C. tropicalis cells showed similar results (Fig. 8). Even though the results in Fig. 8 indicated an increased ability of macrophages to phagocyte HK C. tropicalis cells when compared to live cells, this was not statistically significant (P = 176). When C. albicans was used to challenge pre-incubated macrophages with both laminarin and phosphomannan, we observed a significant reduction in the phagocytosis (Fig. 8). Figure 8. View largeDownload slide Phagocytosis of C. tropicalis and C. albicans by human monocyte-derived macrophages pre-incubated with both laminarin and phosphomannan. Human monocyte-derived macrophages were pre-incubated with both laminarin and C. tropicalis phosphomannan for 60 min at 37°C and 5% (v/v) CO2, and then incubated with Acridine orange-labeled yeast cells at a macrophage–yeast ratio 1:6, for 2 h at 37°C and 5% (v/v) CO2. Macrophages were gated by FACS and 50 000 cells were counted/sample. Results represent macrophages interacting with at least one fluorescent yeast cell. The C. tropicalis strain used was ATCC MYA-3404, whereas the C. albicans strain was NGY152. These data represent means ± SD from eight donors assayed by duplicate. *P < 0.05 when compared to untreated cells. HK, heat-killed cells. Figure 8. View largeDownload slide Phagocytosis of C. tropicalis and C. albicans by human monocyte-derived macrophages pre-incubated with both laminarin and phosphomannan. Human monocyte-derived macrophages were pre-incubated with both laminarin and C. tropicalis phosphomannan for 60 min at 37°C and 5% (v/v) CO2, and then incubated with Acridine orange-labeled yeast cells at a macrophage–yeast ratio 1:6, for 2 h at 37°C and 5% (v/v) CO2. Macrophages were gated by FACS and 50 000 cells were counted/sample. Results represent macrophages interacting with at least one fluorescent yeast cell. The C. tropicalis strain used was ATCC MYA-3404, whereas the C. albicans strain was NGY152. These data represent means ± SD from eight donors assayed by duplicate. *P < 0.05 when compared to untreated cells. HK, heat-killed cells. DISCUSSION The C. tropicalis genetic manipulation was firstly reported more than 25 years ago (Picataggio, Deanda and Mielenz 1991); and since then, several metabolic routes have been explored in this organism, disrupting genes and analyzing the phenotypes of mutant cells. However, thus far, no genes involved in the synthesis of cell wall components have been studied in C. tropicalis (Zuza-Alves, Silva-Rocha and Chaves 2017). Therefore, the functional characterization of MNN4 and the characterization of a C. tropicalis mnn4Δ null mutant represent one of the first attempt to study this cell component by genetic means. It has been previously demonstrated that the presence of phosphomannan at the C. albicans cell wall is a dynamic parameter across fungal isolates, and strains with high, moderate, low or null content of this wall component have been reported (MacCallum et al.2009). Here, we observed a similar trend with the C. tropicalis isolates included in our study, and we have evidence indicating the same phenomenon in clinical isolates of Candida dubliniensis (our unpublished results). It is noteworthy that we could not find any correlation between lower phosphomannan content and a specific C. tropicalis clade, as the four isolates with low ability to bind Alcian blue are grouped in the three clades thus far described for C. tropicalis (Tavanti et al.2005). The reduced phosphomannan content in some strains is unlikely to be related to lower levels of cell wall mannan, as this parameter was constant in all the analyzed strains, indicating a plasticity only in the levels of cell wall phosphomannan. Since immune recognition of phosphomannan is important for proper fungal phagocytosis (McKenzie et al.2010; Bain et al.2014; Erwig and Gow 2016; Gonzalez-Hernandez et al.2017; Hernández-Chávez et al.2017), it is tempting to speculate that the fungal cell has the ability to modulate the presence of phosphomannan on the cell wall surface, as an adaptive strategy to evade the host immune response (Gonzalez-Hernandez et al.2017; Hernández-Chávez et al.2017). Even though we have gathered important information about the role of phosphomannan during C. albicans–host interaction, the biochemical details of the biosynthetic machinery involved in its elaboration remain yet to be described (Gonzalez-Hernandez et al.2017), and are required to understand the plasticity of Candida species to express different levels of phosphomannan at the cell wall. The MNN4 gene has been described as a central element in the phosphomannosylation pathway in different yeast species (Odani et al.1996; Jigami and Odani 1999; Hobson et al.2004; Miura et al.2004; Singleton, Masuoka and Hazen 2005; Park et al.2011; Gonzalez-Hernandez et al.2017); therefore, this gene was the most attractive target to disrupt when assessing the relevance of cell wall phosphomannans on C. tropicalis biology. The putative MNN4 was confirmed to be the functional ortholog of C. albicans MNN4 and has all the bioinformatics features of this gene, including the LicD motif, which has been regarded as canonical for genes involved in the synthesis of fungal phosphomannan (Gonzalez-Hernandez et al.2017). As in C. albicans (Hobson et al.2004), loss of MNN4 did not affect the growth rate, cell and colony morphology, and ability to undergo dimorphism, and cell wall content of chitin, β-glucan and mannan, suggesting phosphomannans are dispensable for these phenotypical traits. The cell wall porosity was increased in the mnn4Δ null mutant though, which was also positively affected in those clinical isolates with reduced ability to bind Alcian blue. Increased cell wall porosity has been reported in cells with gross defects in the wall composition and structuration (De Nobel et al.1990; Navarro-Arias et al.2016; Perez-Garcia et al.2016), but this is not the case of the C. tropicalis mnn4Δ null mutant. Our hypothesis to explain this observation is that the polycations are partially retained within the cell wall, via the negative charge of phosphomannan, having a lower ability to leak nucleic acids in cells with abundant phosphomannan levels. The absence of phosphomannan would not retain polycations in the wall, with the consequent higher porosity. We do not have a proper explanation to the increased sensitivity to high concentrations of Congo red showed by the mnn4Δ null mutant, as this parameter was reported unaffected in the C. albicans mnn4 null mutant (Hobson et al.2004), and no changes in the content of β-glucan were observed in the C. tropicalis mutant. Further experiments are required to properly address this observation. Loss of phosphomannan upon C. tropicalis MNN4 disruption was confirmed by both reduction of the ability to bind Alcian blue and the absence of most of the glycans released by acid hydrolysis. The latter could have the ability to release other materials from the cell wall, such as products from partial degradation of glucans (Ruiz-Herrera et al.2006), offering an explanation to the material electrophoretically separated and found in all the samples analyzed, including in the null mutant strain. One technical limitation of FACE, when compared to TLC, the methodology previously used to characterize cell wall phosphomannans (Hobson et al.2004), is that the latter was combined with a pulse and chase strategy that involved the use of radioactive mannose, offering the benefit to reveal only mannose-based compounds after the TLC analysis. Here, we derivatized and labeled with ANTS all sugars present in the samples, including those released from other polysaccharides different from mannans. Nonetheless, the methodology was useful to confirm the results generated with Alcian blue. The presence of phosphomannans extended with β1,2-mannose residues has been reported previously in C. tropicalis (Kobayashi et al.1994), which is likely to correspond to the acid-labile material lost in the mnn4Δ null mutant. This observation is reinforced by the fact that the encoding genes for β1,2-mannosyltransferases are likely to be part of the C. tropicalis genome (Butler et al.2009). The virulence attenuation in larvae of G. mellonella was contrary to the observation previously reported in C. albicans, where phosphomannosylation is dispensable for virulence in mice (Hobson et al.2004). Here, we demonstrated that both C. albicans and C. tropicalis mnn4Δ null strains had virulence attenuation. The adaptation to the host milieu is unlikely to account for this observation, as both mutants have normal growth rate and the CFU recovered for infected animals were similar to those obtained from larvae infected with the control strains. In C. albicans, it has been demonstrated that loss of MNN4 lead to increased cell hydrophobicity and changes in the adhesion to fibronectin (Singleton, Masuoka and Hazen 2005) Therefore, it is tempting to speculate that loss of the negative charge of phosphomannan affects the ability of C. albicans and C. tropicalis to properly adhere, and therefore damage, larval tissues. It is well documented that the G. mellonella immunological strategies to control pathogens, including fungi, are melanization, activation of hemocytes and production of antimicrobial peptides. Even though the loss of phosphomannan has been showed to have a negative impact on the ability of cationic antimicrobial peptides to affect C. albicans viability (Harris et al.2009), anionic peptides are important players to control fungal infection in G. mellonella (Cytryńska et al.2007; Mak, Zdybicka-Barabas and Cytrynska 2010; Sowa-Jasiłek et al.2014; Zdybicka-Barabas et al.2014; Wojda 2017). Among them, the anionic peptide 2 has been demonstrated to be relevant to control infections caused by C. albicans (Sowa-Jasiłek et al.2014). Since the MNN4 mutants lack a negatively charged wall component, i.e., phosphomannan, it is likely that the anionic antimicrobial peptides would be more accessible to the fungal surface. The dispensable role of phosphomannan to induce both pro- and anti-inflammatory cytokines was already reported for C. albicans cells lacking this wall component (Cambi et al.2008; Mora-Montes et al.2010; Mukaremera et al.2017), and our results here confirmed its dispensability for cytokine stimulation. Candida tropicalis cells showed more susceptibility to phagocytosis by macrophages than C. albicans cells, and this could be explained by the increased content of phosphomannan at the cell wall when compared to C. albicans cells. This observation does not undermine the contribution of dectin-1 to Candida phagocytosis, on the contrary, our results confirmed the importance of this receptor during Candida uptake. However, for the case of C. tropicalis, concentrations of laminarin that inhibited C. albicans phagocytosis failed to have a similar impact on C. tropicalis phagocytosis because of the higher abundance of phosphomannan and, therefore, the increased probability to be engaged with its receptor, most likely galectin-3, as reported for C. albicans (Netea et al.2008). Although unlikely, we cannot formally rule out the possibility that a different receptor could be involved in the recognition of C. tropicalis phosphomannan. The wall porosity of C. tropicalis cells was higher than in C. albicans, and this has been related to increased accessibility of inner wall components to the surface of the wall, such as β1,3-glucan. This agrees with the observation that even though the receptor for phosphomannan was blocked with this cell wall component during pre-incubation, C. tropicalis cells were more readily phagocytosed than C. albicans cells. In conclusion, our results indicate that cell wall phosphomannosylation is required for C. tropicalis–host interaction and loss of this wall component affects virulence in larvae of G. mellonella, and phagocytosis by human monocyte-derived macrophages. SUPPLEMENTARY DATA Supplementary data are available at FEMSYR online. Acknowledgements We thank Luz A. López-Ramírez (Universidad de Guanajuato) for technical assistance, and Professors Neil A. R. Gow and Donna M. MacCallum (University of Aberdeen) for the donation of the strains used in this study. FUNDING This work was supported by Consejo Nacional de Ciencia y Tecnología [grant numbers CB2011/166860, PDCPN2014-247109, FC 2015-02-834]; Universidad de Guanajuato [grant numbers 000025/11, 0087/13, 1025/2016, Convocatoria Institucional para Fortalecer la Excelencia Académica 2015, CIFOREA 89/2016]; Programa de Mejoramiento de Profesorado [grant number UGTO-PTC-261] and Red Temática Glicociencia en Salud (grant number CONACYT-México 2016-2017). Conflicts of interest. None declare. REFERENCES Abrams WR , Diamond LW , Kane AB . A flow cytometric assay of neutrophil degranulation . J Histochem Cytochem 1983 ; 31 : 737 – 44 . Google Scholar CrossRef Search ADS PubMed Bain JM , Louw J , Lewis LE et al. Candida albicans hypha formation and mannan masking of beta-glucan inhibit macrophage phagosome maturation . mBio 2014 ; 5 : e01874 . Google Scholar CrossRef Search ADS PubMed Barelle CJ , Manson CL , MacCallum DM et al. GFP as a quantitative reporter of gene regulation in Candida albicans . Yeast 2004 ; 21 : 333 – 40 . Google Scholar CrossRef Search ADS PubMed Bates S , Hall RA , Cheetham J et al. Role of the Candida albicans MNN1 gene family in cell wall structure and virulence . BMC Res Notes 2013 ; 6 : 294 . Google Scholar CrossRef Search ADS PubMed Bates S , MacCallum DM , Bertram G et al. Candida albicans Pmr1p, a secretory pathway P-type Ca2+/Mn2+-ATPase, is required for glycosylation and virulence . J Biol Chem 2005 ; 280 : 23408 – 15 . Google Scholar CrossRef Search ADS PubMed Bates S , Hughes HB , Munro CA et al. Outer chain N-glycans are required for cell wall integrity and virulence of Candida albicans . J Biol Chem 2006 ; 281 : 90 – 98 . Google Scholar CrossRef Search ADS PubMed Bizerra FC , Melo ASA , Katchburian E et al. Changes in cell wall synthesis and ultrastructure during paradoxical growth effect of caspofungin on four different Candida species . Antimicrob Agents Ch 2011 ; 55 : 302 – 10 . Google Scholar CrossRef Search ADS Brand A , MacCallum DM , Brown AJ et al. Ectopic expression of URA3 can influence the virulence phenotypes and proteome of Candida albicans but can be overcome by targeted reintegration of URA3 at the RPS10 locus . Eukaryot Cell 2004 ; 3 : 900 – 9 . Google Scholar CrossRef Search ADS PubMed Brown GD , Denning DW , Gow NA et al. Hidden killers: human fungal infections . Sci Transl Med 2012 ; 4 : 165rv13- . Google Scholar CrossRef Search ADS PubMed Butler G , Rasmussen MD , Lin MF et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes . Nature 2009 ; 459 : 657 – 62 . Google Scholar CrossRef Search ADS PubMed Cambi A , Netea MG , Mora-Montes HM et al. Dendritic cell interaction with Candida albicans critically depends on N-linked mannan . J Biol Chem . 2008 ; 283 : 20590 – 9 . Google Scholar CrossRef Search ADS PubMed Cohen-Kedar S , Baram L , Elad H et al. Human intestinal epithelial cells respond to beta-glucans via Dectin-1 and Syk . Eur J Immunol 2014 ; 44 : 3729 – 40 . Google Scholar CrossRef Search ADS PubMed Courjol F , Jouault T , Mille C et al. Beta-1,2-mannosyltransferases 1 and 3 participate in yeast and hyphae O- and N-linked mannosylation and alter Candida albicans fitness during infection . Open Forum Infect Dis 2015 ; 2 : ofv116 . Google Scholar CrossRef Search ADS PubMed Cytryńska M , Mak P , Zdybicka-Barabas A et al. Purification and characterization of eight peptides from Galleria mellonella immune hemolymph . Peptides 2007 ; 28 : 533 – 46 . Google Scholar CrossRef Search ADS PubMed De Nobel JG , Klis FM , Munnik T et al. An assay of relative cell wall porosity in Saccharomyces cerevisiae, Kluyveromyces lactis and Schizosaccharomyces pombe . Yeast 1990 ; 6 : 483 – 90 . Google Scholar CrossRef Search ADS PubMed Diaz-Jimenez DF , Mora-Montes HM , Hernandez-Cervantes A et al. Biochemical characterization of recombinant Candida albicans mannosyltransferases Mnt1, Mnt2 and Mnt5 reveals new functions in O- and N-mannan biosynthesis . Biochem Bioph Res Com 2012 ; 419 : 77 – 82 . Google Scholar CrossRef Search ADS Díaz-Jiménez DF , Pérez-García LA , Martínez-Álvarez JA et al. Role of the fungal cell wall in pathogenesis and antifungal resistance . Curr Fungal Infect Rep 2012 ; 6 : 275 – 82 . Google Scholar CrossRef Search ADS DuBois M , Gilles KA , Hamilton JK et al. Colorimetric method for determination of sugars and related substances . Anal Chem 1956 ; 28 : 350 – 6 . Google Scholar CrossRef Search ADS Erwig LP , Gow NAR . Interactions of fungal pathogens with phagocytes . Nat Rev Micro 2016 ; 14 : 163 – 76 . Google Scholar CrossRef Search ADS Estrada-Mata E , Navarro-Arias MJ , Perez-Garcia LA et al. Members of the Candida parapsilosis complex and Candida albicans are differentially recognized by human peripheral blood mononuclear cells . Front Microbiol 2015 ; 6 : 1527 . Google Scholar PubMed Falagas ME , Apostolou KE , Pappas VD . Attributable mortality of candidemia: a systematic review of matched cohort and case-control studies . Eur J Clin Microbiol Infect Dis 2006 ; 25 : 419 – 25 . Google Scholar CrossRef Search ADS PubMed Gonzalez-Hernandez RJ , Jin K , Hernandez-Chavez MJ et al. Phosphomannosylation and the functional analysis of the extended Candida albicans MNN4-like gene family . Front Microbiol 2017 ; 8 : 2156 . Google Scholar CrossRef Search ADS PubMed Gow NA , Netea MG , Munro CA et al. Immune recognition of Candida albicans beta-glucan by dectin-1 . J Infect Dis 2007 ; 196 : 1565 – 71 . Google Scholar CrossRef Search ADS PubMed Gow NAR , Hube B . Importance of the Candida albicans cell wall during commensalism and infection . Curr Opin Microbiol 2012 ; 15 : 406 – 12 . Google Scholar CrossRef Search ADS PubMed Hall RA , Gow NA . Mannosylation in Candida albicans: role in cell wall function and immune recognition . Mol Microbiol 2013 ; 90 : 1147 – 61 . Google Scholar CrossRef Search ADS PubMed Hall RA , Bates S , Lenardon MD et al. The Mnn2 mannosyltransferase family modulates mannoprotein fibril length, immune recognition and virulence of Candida albicans . PLoS Pathog 2013 ; 9 : e1003276 . Google Scholar CrossRef Search ADS PubMed Han Y , Kanbe T , Cherniak R et al. Biochemical characterization of Candida albicans epitopes that can elicit protective and nonprotective antibodies . Infect Immun 1997 ; 65 : 4100 – 7 . Google Scholar PubMed Harris M , Mora-Montes HM , Gow NA et al. Loss of mannosylphosphate from Candida albicans cell wall proteins results in enhanced resistance to the inhibitory effect of a cationic antimicrobial peptide via reduced peptide binding to the cell surface . Microbiology 2009 ; 155 : 1058 – 70 . Google Scholar CrossRef Search ADS PubMed Heinsbroek SE , Taylor PR , Martinez FO et al. Stage-specific sampling by pattern recognition receptors during Candida albicans phagocytosis . PLoS Pathog 2008 ; 4 : e1000218 . Google Scholar CrossRef Search ADS PubMed Hernández-Chávez M , Pérez-García L , Niño-Vega G et al. Fungal strategies to evade the host immune recognition . J Fungi 2017 ; 3 : 51 . Google Scholar CrossRef Search ADS Hobson RP , Munro CA , Bates S et al. Loss of cell wall mannosylphosphate in Candida albicans does not influence macrophage recognition . J Biol Chem 2004 ; 279 : 39628 – 35 . Google Scholar CrossRef Search ADS PubMed Huang H , Ostroff GR , Lee CK et al. Relative contributions of dectin-1 and complement to immune responses to particulate beta-glucans . J Immunol 2012 ; 189 : 312 – 7 . Google Scholar CrossRef Search ADS PubMed Jigami Y , Odani T . Mannosylphosphate transfer to yeast mannan . Biochim Biophys Acta 1999 ; 1426 : 335 – 45 . Google Scholar CrossRef Search ADS PubMed Kim YH , Kang J-Y , Gil JY et al. Abolishment of N-glycan mannosylphosphorylation in glyco-engineered Saccharomyces cerevisiae by double disruption of MNN4 and MNN14 genes . Appl Microbiol Biot 2017 ; 101 : 2979 – 89 . Google Scholar CrossRef Search ADS Kobayashi H , Shibata N , Nakada M et al. Structural study of cell wall phosphomannan of Candida albicans NIH B-792 (serotype B) strain, with special reference to 1H and 13C NMR analyses of acid-labile oligomannosyl residues . Arch Biochem Biophys 1990 ; 278 : 195 – 204 . Google Scholar CrossRef Search ADS PubMed Kobayashi H , Matsuda K , Ikeda T et al. Structures of cell wall mannans of pathogenic Candida tropicalis IFO 0199 and IFO 1647 yeast strains . Infect Immun 1994 ; 62 : 615 – 22 . Google Scholar PubMed Kothavade RJ , Kura MM , Valand AG et al. Candida tropicalis: its prevalence, pathogenicity and increasing resistance to fluconazole . J Med Microbiol 2010 ; 59 : 873 – 80 . Google Scholar CrossRef Search ADS PubMed Lewis LE , Bain JM , Lowes C et al. Stage specific assessment of Candida albicans phagocytosis by macrophages identifies cell wall composition and morphogenesis as key determinants . PLoS Pathog 2012 ; 8 : e1002578 . Google Scholar CrossRef Search ADS PubMed Liu H , Kohler J , Fink G . Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog . Science 1994 ; 266 : 1723 – 6 . Google Scholar CrossRef Search ADS PubMed MacCallum DM , Castillo L , Nather K et al. Property differences among the four major Candida albicans strain clades . Eukaryot Cell 2009 ; 8 : 373 – 87 . Google Scholar CrossRef Search ADS PubMed Mak P , Zdybicka-Barabas A , Cytrynska M . A different repertoire of Galleria mellonella antimicrobial peptides in larvae challenged with bacteria and fungi . Dev Comp Immunol 2010 ; 34 : 1129 – 36 . Google Scholar CrossRef Search ADS PubMed Maneu V , Yanez A , Murciano C et al. Dectin-1 mediates in vitro phagocytosis of Candida albicans yeast cells by retinal microglia . FEMS Immunol Med Microbiol 2011 ; 63 : 148 – 50 . Google Scholar CrossRef Search ADS PubMed Martinez-Alvarez JA , Perez-Garcia LA , Flores-Carreon A et al. The immune response against Candida spp. and Sporothrix schenckii . Rev Iberoam Micol 2014 ; 31 : 62 – 66 . Google Scholar CrossRef Search ADS PubMed Martinez-Alvarez JA , Perez-Garcia LA , Mellado-Mojica E et al. Sporothrix schenckii sensu stricto and Sporothrix brasiliensis are differentially recognized by human peripheral blood mononuclear cells . Front Microbiol 2017 ; 8 : 843 . Google Scholar CrossRef Search ADS PubMed Martinez-Duncker I , Diaz-Jimenez DF , Mora-Montes HM . Comparative analysis of protein glycosylation pathways in humans and the fungal pathogen Candida albicans . Int J Microbiol 2014 ; 2014 : 267497 . Google Scholar CrossRef Search ADS PubMed McKenzie CG , Koser U , Lewis LE et al. Contribution of Candida albicans cell wall components to recognition by and escape from murine macrophages . Infect Immun 2010 ; 78 : 1650 – 8 . Google Scholar CrossRef Search ADS PubMed Mesa-Arango AC , Forastiero A , Bernal-Martínez L et al. The non-mammalian host Galleria mellonella can be used to study the virulence of the fungal pathogen Candida tropicalis and the efficacy of antifungal drugs during infection by this pathogenic yeast . Med Mycol 2013 ; 51 : 461 – 72 . Google Scholar CrossRef Search ADS PubMed Mesa-Arango AC , Rueda C , Román E et al. Cell wall changes in amphotericin B-resistant strains from Candida tropicalis and relationship with the immune responses elicited by the host . Antimicrob Agents Ch 2016 ; 60 : 2326 – 35 . Google Scholar CrossRef Search ADS Miura M , Hirose M , Miwa T et al. Cloning and characterization in Pichia pastoris of PNO1 gene required for phosphomannosylation of N-linked oligosaccharides . Gene 2004 ; 324 : 129 – 37 . Google Scholar CrossRef Search ADS PubMed Mora-Montes HM , Ponce-Noyola P , Villagómez-Castro JC et al. Protein glycosylation in Candida . Future Microbiol 2009 ; 4 : 1167 – 83 . Google Scholar CrossRef Search ADS PubMed Mora-Montes HM , Bates S , Netea MG et al. A multifunctional mannosyltransferase family in Candida albicans determines cell wall mannan structure and host-fungus interactions . J Biol Chem 2010 ; 285 : 12087 – 95 . Google Scholar CrossRef Search ADS PubMed Mora-Montes HM , Bates S , Netea MG et al. Endoplasmic reticulum alpha-glycosidases of Candida albicans are required for N glycosylation, cell wall integrity, and normal host-fungus interaction . Eukaryot Cell 2007 ; 6 : 2184 – 93 . Google Scholar CrossRef Search ADS PubMed Mukaremera L , Lee KK , Mora-Montes HM et al. Candida albicans yeast, pseudohyphal, and hyphal morphogenesis differentially affects immune recognition . Front Immunol 2017 ; 8 : 629 . Google Scholar CrossRef Search ADS PubMed Munro CA , Bates S , Buurman ET et al. Mnt1p and Mnt2p of Candida albicans are partially redundant alpha-1,2-mannosyltransferases that participate in O-linked mannosylation and are required for adhesion and virulence . J Biol Chem 2005 ; 280 : 1051 – 60 . Google Scholar CrossRef Search ADS PubMed Navarro-Arias MJ , Dementhon K , Defosse TA et al. Group X hybrid histidine kinase Chk1 is dispensable for stress adaptation, host-pathogen interactions and virulence in the opportunistic yeast Candida guilliermondii . Res Microbiol 2017 ; 168 : 644 – 54 . Google Scholar CrossRef Search ADS PubMed Navarro-Arias MJ , Defosse TA , Dementhon K et al. Disruption of protein mannosylation affects Candida guilliermondii cell wall, immune sensing, and virulence . Front Microbiol 2016 ; 7 : 1951 . Google Scholar CrossRef Search ADS PubMed Netea MG , Brown GD , Kullberg BJ et al. An integrated model of the recognition of Candida albicans by the innate immune system . Nat Rev 2008 ; 6 : 67 – 78 . Netea MG , Joosten LA , van der Meer JW et al. Immune defence against Candida fungal infections . Nat Rev Immunol 2015 ; 15 : 630 – 42 . Google Scholar CrossRef Search ADS PubMed Odani T , Shimma Y , Tanaka A et al. Cloning and analysis of the MNN4 gene required for phosphorylation of N-linked oligosaccharides in Saccharomyces cerevisiae . Glycobiology 1996 ; 6 : 805 – 10 . Google Scholar CrossRef Search ADS PubMed Park J-N , Song Y , Cheon SA et al. Essential Role of YlMPO1, a Novel Yarrowia lipolytica Homologue of Saccharomyces cerevisiae MNN4, in Mannosylphosphorylation of N- and O-Linked Glycans . Appl Environ Microb 2011 ; 77 : 1187 – 95 . Google Scholar CrossRef Search ADS Perez-Garcia LA , Csonka K , Flores-Carreon A et al. Role of protein glycosylation in Candida parapsilosis cell wall integrity and host interaction . Front Microbiol 2016 ; 7 : 306 . Google Scholar PubMed Picataggio S , Deanda K , Mielenz J . Determination of Candida tropicalis acyl coenzyme A oxidase isozyme function by sequential gene disruption . Mol Cell Biol 1991 ; 11 : 4333 – 9 . Google Scholar CrossRef Search ADS PubMed Plaine A , Walker L , Da Costa G et al. Functional analysis of Candida albicans GPI-anchored proteins: roles in cell wall integrity and caspofungin sensitivity . Fungal Genet Biol 2008 ; 45 : 1404 – 14 . Google Scholar CrossRef Search ADS PubMed Porman AM , Hirakawa MP , Jones SK et al. MTL–independent phenotypic switching in Candida tropicalis and a dual role for Wor1 in regulating switching and filamentation . PLOS Genet 2013 ; 9 : e1003369 . Google Scholar CrossRef Search ADS PubMed Reuß O , Vik Å , Kolter R et al. The SAT1 flipper, an optimized tool for gene disruption in Candida albicans . Gene 2004 ; 341 : 119 – 27 . Google Scholar CrossRef Search ADS PubMed Ruiz-Herrera J , Victoria Elorza M , Valentín E et al. Molecular organization of the cell wall of Candida albicans and its relation to pathogenicity . FEMS Yeast Res 2006 ; 6 : 14 – 29 . Google Scholar CrossRef Search ADS PubMed Santos EOL , Azzolini AECS , Lucisano-Valim YM . Optimization of a flow cytometric assay to evaluate the human neutrophil ability to phagocytose immune complexes via Fcγ and complement receptors . J Pharmacol Toxicol Meth 2015 ; 72 : 67 – 71 . Google Scholar CrossRef Search ADS Singleton DR , Masuoka J , Hazen KC . Surface hydrophobicity changes of two Candida albicans serotype B mnn4Δ mutants . Eukaryot Cell 2005 ; 4 : 639 – 48 . Google Scholar CrossRef Search ADS PubMed Sowa-Jasiłek A , Zdybicka-Barabas A , Stączek S et al. Studies on the role of insect hemolymph polypeptides: Galleria mellonella anionic peptide 2 and lysozyme . Peptides 2014 ; 53 : 194 – 201 . Google Scholar CrossRef Search ADS PubMed Tavanti A , Davidson AD , Johnson EM et al. Multilocus sequence typing for differentiation of strains of Candida tropicalis . J Clin Microbiol 2005 ; 43 : 5593 – 600 . Google Scholar CrossRef Search ADS PubMed Wang H , Xu YC , Hsueh PR . Epidemiology of candidemia and antifungal susceptibility in invasive Candida species in the Asia-Pacific region . Future Microbiol 2016 ; 11 : 1461 – 77 . Google Scholar CrossRef Search ADS PubMed Wang X-H , Nakayama K-I , Shimma Y-I et al. MNN6, a member of the KRE2/MNT1 family, is the gene for mannosylphosphate transfer in Saccharomyces cerevisiae . J Biol Chem 1997 ; 272 : 18117 – 24 . Google Scholar CrossRef Search ADS PubMed West L , Lowman DW , Mora-Montes HM et al. Differential virulence of Candida glabrata glycosylation mutants . J Biol Chem 2013 ; 288 : 22006 – 18 . Google Scholar CrossRef Search ADS PubMed Wojda I . Immunity of the greater wax moth Galleria mellonella . Insect Sci 2017 ; 24 : 342 – 57 . Google Scholar CrossRef Search ADS PubMed Zdybicka-Barabas A , Mak P , Jakubowicz T et al. Lysozyme and defense peptides as suppressors of phenoloxidase activity in Galleria mellonella . Arch Insect Biochem Physiol 2014 ; 87 : 1 – 12 . Google Scholar CrossRef Search ADS PubMed Zhang J-R , Idanpaan-Heikkila I , Fischer W et al. Pneumococcal licD2 gene is involved in phosphorylcholine metabolism . Mol Microbiol 1999 ; 31 : 1477 – 88 . Google Scholar CrossRef Search ADS PubMed Zuza-Alves DL , Silva-Rocha WP , Chaves GM . An update on Candida tropicalis based on basic and clinical approaches . Front Microbiol 2017 ; 8 : 1927 . Google Scholar CrossRef Search ADS PubMed © FEMS 2018. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

FEMS Yeast ResearchOxford University Press

Published: Apr 27, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off