Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Physiological performance of transplastomic tobacco plants overexpressing aquaporin AQP1 in chloroplast membranes

Physiological performance of transplastomic tobacco plants overexpressing aquaporin AQP1 in... The leaf mesophyll CO conductance and the concentration of CO within the chloroplast are major factors affecting 2 2 photosynthetic performance. Previous studies have shown that the aquaporin NtAQP1 (which localizes to the plasma membrane and chloroplast inner envelope membrane) is involved in CO permeability in the chloroplast. Levels of NtAQP1 in plants genetically engineered to overexpress the protein correlated positively with leaf mesophyll CO con- ductance and photosynthetic rate. In these studies, the nuclear transformation method used led to changes in NtAQP1 levels in the plasma membrane and the chloroplast inner envelope membrane. In the present work, NtAQP1 levels were increased up to 16-fold in the chloroplast membranes alone by the overexpression of NtAQP1 from the plastid genome. Despite the high NtAQP1 levels achieved, transplastomic plants showed lower photosynthetic rates than wild-type plants. This result was associated with lower Rubisco maximum carboxylation rate and ribulose 1,5-bispho- sphate regeneration. Transplastomic plants showed reduced mesophyll CO conductance but no changes in chloro- plast CO concentration. The absence of differences in chloroplast CO concentration was associated with the lower 2 2 CO fixation activity of the transplastomic plants. These findings suggest that non-functional pores of recombinant NtAQP1 may be produced in the chloroplast inner envelope membrane. Keywords: Aquaporin, chloroplast envelope, CO permeability, plastid transformation, protein targeting, tobacco. Introduction It is predicted that future increases in the human popula- et al., 2013; Flexas et al., 2012). Photosynthetic performance tion will require a 30% increase in crop yield rates (Edgerton, is affected by two major factors: the concentration of CO 2009). Improving the photosynthetic performance of crops within the chloroplast and the efficiency of the carboxyla- is one way in which plant production might be increased tion biochemistry. Availability of CO at the carboxylation (Parry et  al., 2011; Reynolds et  al., 2011; Parry et  al., 2013; site in the chloroplast can be limited by its diffusion into the Flexas et  al., 2013), and a number of strategies have been substomatal cavities, referred to as stomatal conductance (g ), identified that, either individually or in combination, might and by the conductance of CO from the substomatal cavity achieve this (Long et  al., 2006; Flexas et  al., 2006; Parry to the chloroplast, referred to as mesophyll conductance (g ). © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Experimental Biology. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 3662 | Fernández-San Millán et al. Classically, g has been described not to limit photosynthesis, in tobacco and Arabidopsis, however, increased chloroplast and the CO concentration was thought to be similar in the membrane CO permeability, the rate of photosynthesis, and 2 2 substomatal cavity (C ) and in the chloroplast stroma (C ). plant growth (Aharon et al., 2003; Uehlein et al., 2003; Flexas i c However, over the past decade, a number of studies (Flexas et al., 2006). A similar positive effect on CO permeability, plus et al., 2006; Scafaro et al., 2011; Kaldenhoff, 2012; Evans and an increase in leaf net photosynthesis, was observed in tomato von Caemmerer, 2013; Flexas et  al., 2013) have shown that and rice plants overexpressing AQP (Hanba et al., 2004; Sade g has a major influence on CO diffusion into the chloro- et  al., 2010). It was eventually suggested that the function of m 2 plast, with a consequent impact on the photosynthetic rate. NtAQP1 might depend on its localization in the cell, and that At the cellular level, atmospheric CO has to pass through it might provide a water channel in the plasma membrane the cell wall and three membranes (the plasma membrane and a CO channel in the chloroplast envelope (Uehlein et al., and the two membranes of the chloroplast envelope) to reach 2008). the chloroplast stroma. The CO permeability of the chlo- In the present study, the hypothesis that higher levels of roplast envelope is low, probably due to its relatively large AQPs in the chloroplast would increase CO transport and the protein content (Priestley and Woolhouse, 1980); indeed, it rate of photosynthesis was tested by overexpressing NtAQP1 was estimated that it may account for almost half of the inter- from the chloroplast genome of tobacco. Compared with nal leaf resistance to CO (Uehlein et  al., 2008). As a result, nuclear transformation, plastid transformation provides the under light-saturated conditions, photosynthesis is limited by advantage of high transgene expression levels (Bock, 2015). the availability of CO within the chloroplast. Other studies In addition, the recombinant protein is confined to the chlo- have shown that the g can change quickly in response to roplast, eliminating the effect of AQP1 modification in the varying environmental conditions, such as leaf temperature plasma membrane. Therefore, the main objective of the pre- (Bernacchi et  al., 2002), water stress (Galmés et  al., 2007), sent study was to evaluate the role of NtAQP1 overexpression blue light (Loreto et  al., 2009), and the external CO con- specifically in the chloroplast membranes on CO permeabil- 2 2 centration (Flexas et  al., 2007a). This rapid modification of ity and photosynthetic performance. g points to the existence of additional components, some of them probably proteins, controlling the conductance of the mesophyll to CO diffusion. Proteins forming pore-like Materials and methods structures, such as aquaporins (AQPs), might help explain Production of plants overexpressing NtAQP1 in the chloroplast how these rapid variations in g  occur. AQPs are small proteins that increase the permeability Total RNA from Nicotiana tabacum L. (cv. Petite Havana SR1) leaves was extracted using the Ultraspec RNA kit (Biotecx Laboratories, Houston, of cell membranes to water and certain small, neutral mol- TX, USA), and cDNA was synthesized using the SuperScript III system ecules, including CO (Maurel et  al., 2008; Gomes et  al., (Invitrogen, Carlsbad, CA, USA). The NtAQP1 gene (GenBank Accession 2009; Chaumont and Tyerman, 2014; Kaldenhoff et al., 2014; AJ001416) was amplified by PCR with the primers NTAQP1for: Groszmann et  al., 2017). AQPs were discovered for the first AAGCTTTTGCAAGTATATT TTCCATGGCAGAAAACAAAGAA time in plants in the vacuolar tonoplast of Arabidopsis (Maurel GAAGATGTTAAGCTCGG and NTAQP1rev: GCGGCCGCTTAA GACGACTTG TGGAATGGAATGGCTCTG. The full-length cDNA et al., 1993), and are present in the whole plant kingdom. AQPs was then cloned into the pGEMTeasy vector (Promega, Madison, WI, are located in the plasma membrane and also in most of the USA) and sequenced. The tobacco NtAQP1 gene was subsequently intracellular membranes. Many isoforms of AQPs exist, which cloned into the pAF chloroplast transformation vector (Fernández- can be classified according to their sequence homologies and San Millán et  al., 2008) under the control of the psbA promoter and subcellular localization. The plasma membrane intrinsic pro- 5ʹ-untranslated region, to obtain the expression vector pAF-AQP1. The Tic40 transit peptide sequence (240  bp) was amplified by PCR tein (PIP) class includes isoforms that are most abundant in the using cDNA from A.  thaliana using the primers AtTic40TPfor: plasma membrane. This class can be subdivided into subclasses CCATGGAGAACCTTACCCTAGTTTC and AtTic40TPrev: PIP1 and PIP2 according to sequence similarity. Investigations GCGGCCGCAAGCTTTGCTTCTCTGTTTC. It was then fused on the mesophyll cells of tobacco leaves have shown that the with NtAQP1 at an NcoI restriction site to produce the expression vector plasma membrane protein NtAQP1 (a PIP1 member) facili- pAF-TicAQP1. N.  tabacum L. (cv. Petite Havana SR1) was also used in plastid trans- tates CO transport, and that it has important functions in formations. The PDS-1000/He biolistic system (Bio-Rad, Hercules, CA, photosynthesis and stomatal opening (Uehlein et  al., 2003). USA) was used for the integration of transgenes as previously described Further studies revealed a dual localization of NtAQP1 in the (Daniell, 1997). The aadA gene, conferring resistance to spectinomycin, plasma membrane and the inner envelope membrane (IEM) was used as a selectable marker gene. Two rounds of selection and shoot of the chloroplast (Uehlein et  al., 2008). A  mutation in the development on RMOP medium containing 500  mg/l spectinomycin were performed. The transplastomic plants produced were named AQP1 Arabidopsis thaliana AtPIP1;2 gene was found to be associated and TicAQP1. with reduced g and a reduction in the rate of photosynthe- sis (Heckwolf et  al., 2011). Genetic engineering to modify NtAQP1 expression levels confirmed these results, revealing Southern and northern blotting a function for NtAQP1 in CO conductance. Antisense or Southern and northern blotting experiments were performed as previ- RNA interference-mediated downregulation of NtAQP1 ously described (Sanz-Barrio et  al., 2013). For Southern blotting, the resulted in a reduction of IEM CO permeability, C values, 2 c flanking sequence P1 probe generated by PCR was used. After Southern and photosynthetic performance (Uehlein et al., 2003; Flexas blot confirmation of the T generation, selected plants were transplanted into pots and grown in the greenhouse for seed production. T plants were et al., 2006; Uehlein et al., 2008). Overexpression of NtAQP1 1 Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 Performance of transplastomic tobacco overexpressing NtAQP1 | 3663 used in further experiments. Northern blotting was performed using the Plants used for gas exchange AQP1-specific P2 probe (515 bp) obtained by NcoI digestion of AQP1. Plants were grown in 2 litre pots (organic soil/perlite, 70/30 v/v) in two places, Pamplona and Mallorca (Spain). In Pamplona, plants were grown in a greenhouse at 24–28  °C and relative humidity ~40%. Plants were Protein extraction, separation, and western blotting watered with water by drip irrigation and twice a week with 50% diluted Leaf samples (100 mg) from transformed and untransformed 70-day-old Hoagland’s solution. In Mallorca, plants were grown in a growth chamber −2 −1 plants were ground in liquid nitrogen, homogenized in 300  μl of 2× at PPFD ~350 µmol m s at the top of the plants, daily temperature of Laemmli buffer (0.5 M Tris–HCl, pH 6.5, 4% SDS, 20% glycerol, and 24–26 °C, relative humidity ~40%, and watered twice a week with water 10% β-mercaptoethanol) and heated at 95 °C for 5 min. After 5 min of and once a week with 50% diluted Hoagland’s solution. centrifugation at 20 000 g, the supernatant was deemed to represent the total protein (TP) content. TP was quantified using the RC-DC protein Gas exchange and chlorophyll fluorescence analyses assay (Bio-Rad) with BSA as a standard. Proteins were separated by SDS- PAGE on 12% polyacrylamide gels and transferred to a polyvinylidene Gas exchange measurements were perfor med with a calibrated Li-6400 fluoride (PVDF) membrane for immunoblotting. The primary antibod- XT portable gas analyser (Licor, Lincoln, NE, USA) equipped with ies used were anti-PIP1 (Agrisera, Vännäs, Sweden) and anti-NtAQP1 the 2  cm Li-6400-40 Leaf Chamber Fluorometer. Determinations (kindly provided by R.  Kaldenhoff) (dilution 1:3000). Peroxidase- were conducted in apical fully developed leaves. Three independent conjugated goat anti-rabbit or anti-chicken immunoglobulin G (Sigma- exper iments (two in Pamplona and one in Mallorca) were perfor med. Aldrich, St Louis, MO, USA) (both at a dilution of 1:3000) were used as For the measurements made in Pamplona, plants were transferred to secondary antibodies with the anti-PIP1 and anti-NtAQP1 primary anti- a growth chamber with similar environmental conditions to those of bodies, respectively. Detection was performed using the chemilumines- the Mallorca site. For each plant, the same procedure was followed: cence ECL western blotting system (GE Healthcare, Fairfield, CT, USA). first, stabilization until a steady state of stomatal conductance was Relative quantification of NtAQP1 monomers and oligomers was reached (typically ~20–30 minutes) in ambient conditions (CO con- −1 performed by comparing dilution series of TP from wild-type (WT) centration=400 µmol mol , 1500 PPFD, and 25 °C). After stabiliza- plants and both types of transplastomic plant (three replicates were ana- tion, the A /C curve was performed by changing the concentration N i lysed). For each line, adequate amounts were loaded on to an SDS-PAGE of CO entering the leaf chamber with, the following steps: 400, gel, electrophoretically separated, and then analysed by western blot- 300, 250, 200, 150, 100, 50, 400, 400, 500, 600, 700, 800, 1000, 1200 −1 ting. Immunoblots were quantified using GeneTools Analyzer software and 1500 µmol mol , with typically 2–3 minutes between each step. (SynGene, Cambridge, UK). Each A /C curve was corrected for leaks by following the proto- N i col described by Flexas et  al., (2007b). In all three experiments, the results of net CO assimilation and stomatal conductance were very Plasma membrane isolation consistent (data not shown). In the third experiment, performed in Plasma membranes from 50-day-old WT and transplastomic plants Mallorca, chlorophyll fluorescence was measured together with gas −2 −1 grown in a growth chamber [16  h light/8  h dark; 200  µmol m s exchange to estimate the mesophyll conductance to CO . Therefore, photosynthetic photon flux density (PPFD) and a day/night tempera- all the results shown in the present paper correspond to this latter ture regime of 28  °C/25  °C] were obtained as previously described exper iment. (Santoni, 2007). After performing the A /C curve, the leaf was kept in the chamber N i and N from a tank (Air Liquide) was piped into the Li-6400 inlet to remove O from the entering air in the leaf chamber, to allow measure- ments to be made in non-photorespiratory conditions (Valentini et  al., Chloroplast isolation, fractionation, and immunoblotting 1995). We then performed a light curve at ambient CO concentration 2  −1 For chloroplast isolation, leaves from 50-day-old tobacco plants were cut (400  µmol mol ) with the following PPFD steps: 1500, 2000, 1750, −2 −1 into 1–3 cm pieces and homogenized in a blender. The isolation buffer 1500, 1250, 1000, 800, 550, 300, 150, 100, 75, 50, 25 and 0 µmol m s . (330  mM sorbitol, 20  mM MOPS, 13  mM Tris, 3  mM MgCl , 0.1% 2 These measurements were used to estimate the product of leaf absorption BSA) was six times (v/w) the fresh mass weight of the leaf samples. The (α) and the partitioning of absorbed quanta between photosystems I and homogenate was passed through a filter mesh and centrifuged for 5 min II (β) (see Valentini et al., 1995 and Pons et al., 2009 for details). We used −2 −1 at 1000 g and 4 °C. The pellet fraction was resuspended in isolation buffer only the first points of the curve, with PPFD >400 µmol m s , to esti- and chloroplasts were isolated by 80–40% Percoll gradient fractionation mate α*β (Martins et al., 2013), avoiding non-linearity of ΦPSII versus after centrifugation for 10 min at 7700 g and 4 °C. Isolated chloroplasts ΦCO due to changes/higher influence of leaf respiration at low PPFD. were washed in 3 volumes of washing buffer (330 mM sorbitol, 50 mM Values of (α*β) were 0.36 ± 0.04 (TicAQP1), 0.35 ± 0.03 (AQP1), and HEPES/KOH, pH 7.6, 3 mM MgCl ). 2 0.38  ±  0.03 (WT), with no significant differences between genotypes For fractionation, the chloroplasts were lysed by freeze-thawing in (see Supplementary Fig.  S1 at JXB online). Night respiration rate (R ) hypotonic TE buffer [10  mM Tris, 2  mM EDTA, pH 7.5, including a was estimated by measuring leaf gas exchange in darkness, 1 h after the cocktail of protease inhibitors from Roche (Mannheim, Germany)]. lights of the growing chamber were turned off (night). Stroma, envelopes, and thylakoids were separated by using discontinu- Mesophyll conductance (g ) was estimated by the method developed ous sucrose gradients (0.93/0.6/0.3 M) after 2  h of centrifugation at by Harley et al. (1992), as follows: 20 000 rpm in a swing-out rotor. Stroma was collected from the upper fractions and one volume of extracts was combined with one volume gE =− AC /( Γ */  TR ++ 8A RE   TR – 4A + R  { () () }) m Ni Nl Nl     of 2× Laemmli buffer. The thylakoid membranes sedimented out and were resuspended in 10  mM TE buffer, to which one volume of 2× where A is the net CO assimilation rate, C is the CO concentration in N 2 i 2 Laemmli buffer was added. The chloroplast envelopes were collected at the substomatal cavity, Γ* is the CO compensation point in the absence the interface between 0.9 and 0.6 M sucrose. The envelope proteins were −1 of R (assumed to be 40 µmol mol , from Walker et al., 2013), R is the d l concentrated by methanol/chloroform extraction (Ferro et al., 2002) and respiration rate in light (estimated as R /2), and ETR is the electron resuspended in 10 mM TE buffer with one volume of 2× Laemmli buffer transport rate, estimated as follows: added. All three fractions were heated for 1  h at 37  °C. Protein con- centrations were determined by the Bradford method. All samples were ETR =× αβ ×× ΦPSII PPFD resolved by 9% SDS-PAGE and transferred to PVDF membranes for western blotting. Antisera to ADP-glucose pyrophosphorylase (AGPase), where ΦPSII is the yield of photosystem 2. ΦPSII was estimated using LHC chlorophyll a/b binding protein 1 (Lhcb1), and Tic40 (Agrisera) the ‘Multiphase Flash’ method described by Loriaux et al. (2013). proteins were used at dilutions of 1:1000. Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 3664 | Fernández-San Millán et al. Discrimination against CO means were analysed using the Tukey test (P<0.05). All calculations were performed using SPSS 10.0 software. The C isotope discrimination (Δ, ‰) was calculated as: 13 13 δδ CC − atm sample Δ= Results δ C1 + sample Generation of tobacco transplastomic plants and where δ C is the carbon isotope composition in atmospheric CO in atm 2 determination of homoplasmy the greenhouse (–10.8‰) and δ C is the carbon isotope composi- sample tion of leaf total organic matter (TOM). Tobacco plants expressing NtAQP1 from the plastid genome 13 12 The C/ C ratio (R) in plant material was expressed in δ notation were obtained by biolistic bombardment of the leaves with (δ C) with respect to Vienna Pee Dee Belemnite calcium carbonate the engineered pAF vector (Fernández-San Millán et  al., (V-PDB), and measured with an analytical precision of 0.1‰: 2008), which inserted the transgenes between the trnI and  R  trnA regions of the plastid genome (Fig.  1A). Two different sample δ C= − 1   transformation vectors were designed, both with the transgene  R  standard controlled by the promoter and the 5ʹ-untranslated region of δ C accuracy was monitored using international secondary standards the psbA gene. The pAF-AQP1 vector included the full cod- 13 12 of known C/ C ratios (IAEA-CH7 polyethylene foil, IAEA-CH6 ing sequence of NtAQP1. In the pAF-TicAQP1 vector, the sucrose, and USGS-40 glutamic acid, IAEA, Austria). 76 amino acid sequence transit peptide of A.  thaliana Tic40 TOM and gas δ C determinations were conducted at the Serveis protein was fused to the N-terminus of NtAQP1. Two inde- Cientifico-Tecnics of the University of Barcelona. For TOM analyses, pendent transplastomic lines for each construction, developed 1 mg of dry ground leaf material was analysed using an elemental analyser (EA1108, Series 1, Carbo Erba Instrumentazione, Milan, Italy) coupled to an after two rounds of selection on spectinomycin, were analysed isotope ratio mass spectrometer (Delta C, Finnigan MAT, Bremen, Germany) by Southern blotting (Fig.  1B). As predicted for the correct operating in continuous flow mode. Air δ C samples were analysed by gas homologous recombination of the transgenes, the flanking chromatography (Agilent 6890 Gas Chromatograph, Agilent Technologies, region P1 probe hybridized to a 10.4 or 10.7 kb BamHI DNA Spain) coupled to an isotope ratio mass spectrometer Deltaplus via a GC-C fragment in the AQP1 and TicAQP1 transplastomic plants, Combustion III interphase (ThermoFinnigan, Thermo, Barcelona, Spain). respectively. A 7.1 kb band was detected only in the WT plants, indicating that all four lines were homoplasmic. Determination of Rubisco, starch, and chlorophyll contents Samples from the same leaves used for gas exchange and chlorophyll fluor- Expression of aquaporin in the chloroplast escence measurements were analysed for their Rubisco, starch, and chloro- phyll contents. Three leaf discs (2.1 cm ) per plant from WT, AQP1, and Analysis at the transcriptional level in the transplastomic plants TicAQP1 plants were frozen in liquid nitrogen and ground in a Mikro- revealed transcripts of the expected size in both cases (Fig. 2A). dismembrator (Braun, Melsungen, Germany). The volume of the extrac- tion buffer (phosphate buffer, pH 7.0, 100 mM) was three times the fresh Monocistrons of 1.4 and 1.7 kb der ived from the psbA promoter weight (v/w) of the powdered leaf sample obtained from the three leaf discs. were detected in the AQP1 and TicAQP1 plants, respectively. Samples were mixed in a vortex and, after 15 min on ice, centrifuged for Dicistrons transcribed from the upstream rrn promoter were 5 min at 20 000 g at 4 °C. Protein fractions recovered from the supernatants also present. A greater abundance of transcripts was observed in were quantified by the Bradford method. For the separation of these pro- the AQP1 plants than in the TicAQP1 plants, probably owing teins, one volume of the protein fraction was combined with one volume of 2× Laemmli buffer, boiled for 5 min, and then centrifuged at 20 000 g for to the TicAQP1 transcripts being less stable. The endogenous 5 min. Samples (15 μg) of the proteins in these supernatants were separated AQP1 mRNA was below the detection limit. by SDS-PAGE (10%) and the gels were stained with Coomassie brilliant The overexpression of AQP1 protein in the transformed blue G-250. The Rubisco levels of the transplastomic plants were compared chloroplasts was confirmed by immunoblotting (Fig.  2B). with those of the WT plants using GeneTools Analyzer software (SynGene). A faint 30 kDa band of the expected size for the AQP1 protein Starch was determined using an amyloglucosidase-based test kit (R-Biopharm AG, Darmstadt, Germany). monomer was observed in the WT plants. A stronger signal of The leaf chlorophyll contents of the transplastomic and WT plants the same electrophoretic mobility was detected in the AQP1 [measured with a SPAD 502 chlorophyll meter (Minolta Optics Inc, and TicAQP1 plants. Thus, the TicAQP1 recombinant protein Tokyo, Japan)] were recorded in the same leaves used for photosynthetic was correctly processed in the stroma of the chloroplast fol- rate measurements. lowing cleavage of the Tic40 transit peptide. Higher molecu- Leaf area of flowering plants grown in a growth chamber was deter- mined after scanning with ImageJ. lar weight signals were mainly present in transplastomic plants, indicating the presence of abundant oligomeric structures des- pite the denaturing conditions used during sample preparation Electron microscopy and electrophoresis. It is also possible that the increased AQP1 Samples from the same leaves used to measure the photosynthetic rate protein production or inadequate post-translational modifica- were fixed in Karnovsky fixative (4% formaldehyde and 5% glutaralde- tions caused misfolding or the formation of non-specific aggre- hyde in 0.025 M cacodylate buffer, pH 6.7) by vacuum infiltration and further prepared for examination by transmission electron microscopy at gates with other proteins that resulted in abnormal migration the Microscopy Service of the University of Navarre, Spain. patterns in the gel. The putative non-specific protein aggregates of high molecular weight could indicate that only a propor- tion of the recombinant protein equates to functional AQP1 Statistical analysis complexes. Relative AQP1 protein levels were estimated by One-way ANOVA was used to analyse differences in the measured vari- densitometry of different protein extract dilutions in western ables between the control and transplastomic plants. Differences among Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 Performance of transplastomic tobacco overexpressing NtAQP1 | 3665 Fig. 1. Integration of Nicotiana tabacum AQP1 into the tobacco chloroplast genome. (A) Map of the wild-type (WT) and AQP1-transformed plastid (pt) genomes. The transgenes were targeted to the intergenic region between trnI and trnA. The selectable marker gene aadA (encoding aminoglycoside 3ʹ-adenylyltransferase) was driven by the 16S ribosomal RNA operon promoter (Prrn). AQP1 was driven by the psbA promoter and 5ʹ-untranslated region (PpsbA). Arrows within boxes show the direction of transcription. Numbers below each ptDNA indicate the predicted size of hybridizing fragments when total DNA was digested with BamHI. A 0.8 kb fragment of the targeting region for homologous recombination was used as a probe (P1) for Southern blot analysis. TpsbA, 3ʹ-untranslated region of the psbA gene. (B) Southern blot analysis of two independent lines (1 and 2) for each transformation cassette. blots, analysing both monomeric and multimeric signals. The and the purity of the fractions were assessed using specific anti- expression level of AQP1 protein in the AQP1 and TicAQP1 bodies: anti-ADP-glucose pyrophosphorylase (AGPase) for the plants was approximately 10-fold and 16-fold greater, respect- stroma (ap Rees, 1995), anti-Tic40 for the envelope, and anti- ively, than in the WT plants. LHC chlorophyll a/b binding protein 1 (Lhcb1) for the thyla- As expected, analysis of purified plasma membranes by koid membrane (Farmaki et al., 2007). AQP1 was detected in immunoblotting indicated that the AQP1 protein levels in the the envelope and thylakoid membrane fractions but no signal WT and transplastomic plants were similar (Fig. 2C), confirm- was seen for the stroma soluble fraction (Fig. 3). As expected, a ing that the AQP1 protein synthesized in the chloroplast was stronger signal was detected in the AQP1 and TicAQP1 trans- not exported out of the chloroplast. plastomic plants than in the WT plants. Monomeric and oli- gomeric forms were detected in the envelope and thylakoid fractions of both types of transplastomic plants. The AQP1 NtAQP1 was mainly localized to the chloroplast signal was most intense in the envelope fraction; note that envelope 10-fold more thylakoid fraction protein was loaded to enable The distribution of AQP1 in the chloroplast of the AQP1 and the detection of AQP1. Monomers and dimers were present TicAQP1 transplastomic plants was examined by chloroplast mainly in the envelope fraction, with faint signals detected in purification and suborganellar fractionation followed by immu- the thylakoid fraction. Trimers and tetramers were detected noblotting (Fig. 3). The equal loading of gels for each fraction in the envelope fraction but not in the thylakoid fraction. Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 3666 | Fernández-San Millán et al. in the thylakoid and envelope membranes of these plants rela- tive to AQP1 transplastomic plants (Fig. 3). Photosynthetic performance and protein and starch metabolism were impaired by chloroplast NtAQP1 overexpression The transplastomic plants, particularly TicAQP1 plants, showed retarded growth in comparison to the WT plants during the first 3 weeks following transplantation into pots, but thereafter they caught up and reached a similar height under standard growth conditions (data not shown). Net photosynthesis (A ) analyses showed both the AQP1 and the TicAQP1 plants to have lower CO fixation rates than the WT plants (Fig.  4A), with no differences between the transplastomic plants. As expected, no significant differences were observed between genotypes for leaf stomatal conduct- ance (g ) (Fig. 4D). In contrast, g was diminished by 50% in s m AQP1 and TicAQP1 plants relative to WT plants (Fig.  4E). A /C curve determinations highlighted that the Rubisco N i maximum carboxylation capacity (V ) and the maximum Cmax electron transport rate contributing to ribulose 1,5-bisphos- phate regeneration (J ) values measured in both transplas- max tomic plants were lower than those in WT plants (Fig. 4B, C). Gas exchange analyses also showed that the transplastomic plants had a higher C value (Fig. 5A), while no significant dif- ferences in C were detected (Fig. 5B). The C /C ratio was not c c i altered in the transplastomic plants relative to the WT plants (Fig.  5C). In contrast, compared with the WT plants, AQP1 and TicAQP1 plants showed higher CO discrimination (Δ) values (Fig. 4F). Transplastomic plants had lower soluble pro- tein levels than their WT counterparts (Table  1). Moreover, the Rubisco levels were strongly reduced in the AQP1 and TicAQP1 plants (reductions of 23% and 41%, respectively). A  4-fold reduction in the leaf starch content, and reduced chlorophyll levels, were detected in the transplastomic plants relative to the WT plants (Table 1). In addition, the leaf mass Fig. 2. Analysis of AQP1 expression in wild-type (WT) and AQP1 and area was reduced in the transplastomic plants (12.5% in AQP1 TicAQP1 transplastomic plants. (A) Northern blot analysis of leaf samples. and 15.9% in TicAQP1 plants). The expected transcript sizes of the mono- and dicistrons originating from The ultrastructure of the mesophyll cell chloroplasts was different promoters are indicated below the map of the transformed plastid analysed by transmission electron microscopy. Major differ- genome. The 515 bp AQP1 sequence (P2) was used as a probe. A 10 μg aliquot of total RNA was loaded per well. Ethidium bromide-stained rRNA ences were observed between the WT and transplastomic was used to assess loading. (B) Western blot analysis of total protein from plants (Fig.  6). The WT plants showed the normal architec- leaf samples (two independent lines for each construction). The lower ture of the thylakoid network, arranged in grana and lamel- panel was overexposed to show the 30 kDa AQP1 monomer, which was lae (Fig.  6A), while the AQP1 and TicAQP1 plants showed not detected in the upper panel. A 30 μg aliquot of protein was loaded abnormal granal stacking with a reduced number of appressed per well. (C) Western blot analysis of proteins extracted from the plasma membrane. A 3 μg aliquot of protein was loaded per well. The positions thylakoids (Fig.  6B, C). In comparison to the normal granal and sizes of molecular weight protein standards are indicated. The blots in structure of the WT plants (Fig. 6D), the transplastomic plants B and C were detected using anti-NtAQP1 as the primary antibody. (especially the TicAQP1 plants) also showed defective grana and swelling of the thylakoid lumen (Fig.  6E, F). Large pro- A higher proportion of high molecular weight aggregates was tein aggregates detected by western blot (Figs 2B and 3), par- observed in the thylakoid fraction of TicAPQ1 plants relative ticularly in TicAQP1 plants, could have affected the thylakoid to the envelope fraction. Immunoblotting could not provide membrane integrity, resulting in abnormal thylakoid architec- an accurate estimate of the relative distribution of NtAQP1 ture. No differences were observed in the envelope membranes in each membrane fraction owing to the disproportion- (Fig. 6G–I). ate method by which each membrane fraction was purified. The integrity of the thylakoid membranes was assessed by However, the higher NtAQP1 expression level in TicAQP1 treating isolated chloroplasts with SDS, a product commonly transplastomic plants correlated with the higher AQP1 content used in cell permeation assays in bacteria (Griffith and Wolf, Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 Performance of transplastomic tobacco overexpressing NtAQP1 | 3667 Fig. 3. Localization of AQP1 in the thylakoid and envelope membranes. Envelope, thylakoid, and stroma fractions were isolated from wild-type (WT), AQP1, and TicAQP1 leaves, and separated by SDS-PAGE. Samples of 2, 20, and 30 μg of protein from the envelope, thylakoid, and stroma, respectively, were loaded per well. Representative western blots performed with antibodies to AQP1, the inner-membrane Tic40 protein, the thylakoid membrane-specific LHC chlorophyll a/b binding protein 1 (Lhcb1), and the stroma-specific ADP-glucose pyrophosphorylase (AGPase) are shown. Asterisks indicate the positions of monomer (*), dimer (**), trimer (***), and tetramer (****) AQP1. 2002). For the chloroplasts of the AQP1 and especially the IEM targeting (Li and Schnell, 2006). Both constructs resulted TicAQP1 plants, total chlorophyll solubilization was obtained in the incorporation of AQP1 in the chloroplast envelope and with lower SDS concentrations than those required to achieve the thylakoid membranes. This result shows that the topology- the same effect with WT plant chloroplasts (Supplementary determining sequence information within NtAQP1 is suffi- Fig. S2A, C). The same pattern was observed for the solubil- cient for its integration into the envelope membranes from ization of AQP1 and the thylakoid membrane Lhcb1 proteins, the stroma (Fig. 3). Chloroplast IEM proteins that follow the but not for the stromal AGPase or thylakoid-lumen-associated post-import pathway are first imported from the cytoplasm TL29 proteins (Supplementary Fig. S2B). into the chloroplast stroma in the form of a soluble, processed, intermediate product, and subsequently reinserted from the stroma into the IEM. NtAQP1 expressed from the plastid gen- Discussion ome could putatively use the second part of this pathway from the stroma to the IEM. It has been shown that conserved pro- Targeting of recombinant AQP1 to chloroplast line residues in the N-terminal region of IEM proteins such membranes as Tic40 and Tic110 are required for stromal reinsertion (Chiu The present study shows that NtAQP1 can be overexpressed and Li, 2008). The six proline residues present at positions 21, from the plastid genome and that it localizes to the chloro- 35, 36, 37, 39, and 43 of NtAQP1 suggest that it uses a com- plast membranes. Native NtAQP1 localizes to both the plasma mon import mechanism from the stroma. membrane and the chloroplast IEM. No transit peptide for its Native IEM proteins utilize two different pathways for their chloroplast targeting has been identified, and the sorting mech- targeting. It is unknown whether the native AQP1, with six anisms responsible for this dual localization are unknown (Luu membrane-spanning alpha helices, uses the post-import path- and Maurel, 2013). The expression of NtAQP1 from the plastid way or the stop-transfer pathway. Very little is known about genome results in the AQP1 polypeptide being synthesized in the insertion of polytopic IEM proteins. For instance, the the stroma and not in the cytosol as in WT plants, condition- Cor413im1 membrane protein, with five or six transmembrane ing its subsequent import pathway to the IEM. Hence, in add- domains, is incorporated in the IEM via the stop-transfer path- ition to the AQP1 coding sequence, and given the uncertainty way (Okawa et  al., 2014), while Tic110, which has six trans- that the recombinant AQP1 from the chloroplast stroma would membrane domains, utilizes the post-import pathway (Lübeck reach its target location correctly, a second construct with the et al., 1997; Li and Schnell, 2006). If native and plastidial AQP1 transit peptide of the IEM Tic40 protein fused to AQP1 was use different import pathways, this could result in an improper prepared for plastid transformation. Tic40 is an integral IEM location within the IEM that negatively affects its functional- protein involved in protein translocation across this membrane ity. Tic40, a component of the TIC complex, is involved in (Chou et  al., 2003) that follows the post-import pathway for the reinsertion process for proteins that use the post-import Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 3668 | Fernández-San Millán et al. Fig. 4. (A) Net photosynthesis, (A ), (B) maximum carboxylation velocity of Rubisco (V ), (C) maximum electron transport rate contributing to ribulose N Cmax 1,5-bisphosphate regeneration (J ), (D) stomatal conductance (g ), (E) mesophyll conductance (g ), and (F) C isotope discrimination (Δ) of wild-type max s m (WT) and AQP1 and TicAQP1 transplastomic plants. Representative data from two independent experiments are presented. Values are means ±SE (n=7). Different letters indicate significantly different values (ANOVA, P<0.05). Fig. 5. (A) Intercellular CO concentration (C ), (B) chloroplast CO concentration (C ), (C) and C /C ratio of wild-type (WT) and AQP1 and TicAQP1 2 i 2 c c i transplastomic plants. Representative data from two independent experiments are presented. Values are means ±SE (n=7). Different letters indicate statistically different values (ANOVA, P<0.05). pathway (Chiu and Li, 2008). It could be expected that the TIC complex. It remains to be elucidated whether the IEM recombinant TicAQP1 protein, which includes the Tic40 tran- import pathways of recombinant TicAQP1 and AQP1 pro- sit peptide, is inserted close to and potentially interacts with the teins are the same, but the physiological performance of both Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 Performance of transplastomic tobacco overexpressing NtAQP1 | 3669 transplastomic plants was similar. The putative drawback related plasma and thylakoid membranes, allowing protein trafficking to IEM import seems to be equivalent in both transplastomic in short-lived connection assemblies, has been proposed for the plants, irrespective of the presence of the Tic40 transit peptide. cyanobacterium Synechocystis (Pisareva et al., 2011). In addition, However, integration of NtAQP1 into the thylakoid mem- functional thylakoid membranes were developed in association branes was unexpected, and the mechanism of protein sorting with the chloroplast envelope in Chlamydomonas under certain remains unknown. Plastid transformation has also allowed the conditions (Hoober et  al., 1991). These and other investiga- successful integration of other foreign proteins, with or without tions have suggested a role of the IEM for thylakoid biogenesis signal peptides, to the thylakoid membranes (Henig et al., 2007; in vascular plants (Celedon and Cline, 2013). This mechanism De Marchis et  al., 2011; Ahmad et  al., 2012; Shanmugabalaji might tentatively explain the dual targeting of recombinant et al., 2013; Scotti et al., 2015), indicating that different import AQP1 to the envelope and thylakoid membranes. mechanisms might be used. The expression of the Synechococcus BicA bicarbonate transporter in tobacco plastids unexpectedly Physiological performance of transplastomic plants resulted in dual targeting of the protein to the thylakoid mem- branes and, in a smaller proportion, to the chloroplast enve- The present study sought to determine whether CO trans- lope (Pengelly et al., 2014). A model for contact zones between port to the chloroplast could be boosted by increasing the amount of AQP1 in the chloroplast membranes. Much higher Table 1. Biochemical variables measured in young leaves from AQP1 protein levels (up to 16-fold higher than in the WT) wild-type (WT) and transplastomic plants grown in a growth were obtained in this study than in another study using chamber nuclear transformation, in which double the levels in WT were obtained (Flexas et al., 2006); this difference was probably due WT AQ1 TicAQP1 to the plastid transformation method. Despite the integration −1 a b b Starch (μmol Glu g FW ) 21.7 ± 2.9 5.5 ± 0.2 5.7 ± 0.4 of AQP1 into the chloroplast envelope membranes, the trans- −1 a ab b Soluble protein (mg g FW ) 16.1 ± 0.7 13.3 ± 1.0 12.3 ± 0.4 plastomic plants overexpressing NtAQP1 showed lower photo- −1 a a a Insoluble protein (mg g FW ) 13.0 ± 1.7 10.5 ± 1.3 10.2 ± 2.4 synthetic rates than the WT plants. Associated with the low a b c Rubisco (% relative to WT) 100 ± 3.4 76.7 ± 3.9 58.8 ± 5.4 a b c values of A , transplastomic plants showed both a reduction Chlorophyll content (SPAD) 42.9 ± 1.0 34.2 ± 0.9 30.0 ± 0.6 in CO diffusion capacity (associated with g but not g ) and 2 m s Values are means±SE (n=5–7). a lower photosynthetic capacity (V and J ). Because the Cmax max Different superscript letters denote significant differences (ANOVA, different lines differed in their C , and g responds to C (Flexas i m i P<0.05). et al., 2007a), the observed differences in g could be attribut- The chlorophyll content was measured using a Minolta SPAD 502 chlorophyll meter. able to differences in C . However, g /C ratios (obtained from i m i Fig. 6. Changes in chloroplast ultrastructure due to AQP1 overexpression from the plastid genome. Transmission electron microscopic images of chloroplasts from (A) wild-type (WT), (B) AQP1, and (C) TicAQP1 plants. (D–F) Detail of the thylakoids from (D) WT, (E) AQP1, and (F) TicAQP1 plants. (G–I) Detail of the chloroplast envelope (delineated by two arrowheads) in (G) WT, (H) AQP1, and (I) TicAQP1 plants. C, cytosol; s, starch granule; st, stroma; v, vacuole. Scale bar=1 μm. Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 3670 | Fernández-San Millán et al. –3 data shown in Figs  4E and 5A) were 0.3 × 10 for the two Evidence that reduced V and J are the true factors Cmax max –3 transplastomic lines, compared with ~0.7 × 10 for the WT, responsible for decreased A in the two transplastomic lines suggesting that g is reduced in the transplastomic lines regard- arises from reverse photosynthesis modelling and from car- less of their C . Considering that between 200 and 400 μmol bon isotope discrimination. Using reverse modelling, it is −1 CO mol air g decreases at an approximate rate of 0.1% per possible to estimate how large C and g should be for the 2 m c m −1 μmol CO mol air (shown for different species, including transplastomic lines to reach WT A if their V and J 2 N Cmax max tobacco, by Flexas et al., 2008), if WT plants had had the same is reduced. It turns out from this simulation that C should −1 C as the transplastomic plants, their g would have decreased increase from the estimated ~230 μmol mol to ~330 μmol i m −1 by ~5%, that is, it would have still been significantly higher. mol , which would require g values of 8.8 and 4.3  μmol −2 −1 The realized photosynthesis achieved by a plant can be CO m s for AQP1 and TicAQP1, respectively; these are manipulated by two means (Gago et al., 2014; Flexas et al., unrealistically large values, far out of the range of estimates 2016): either by modifying the photosynthetic capacity of for any plant species (Flexas et al., 2012). On the other hand, the plant (i.e. changing the rate of photosynthesis for a given stable isotopes, such as δ C, have been proposed as indica- substrate availability) or by chang ing the diffusion capacity of tors of stomatal opening and CO diffusion (Farquhar et al., the leaf (which, in tur n, will modify the quantity of substrate 1989; Araus et  al., 2003). Changes in Δ have been linked available for photosynthesis). In this study, increasing AQP1 to changes in CO availability and/or Rubisco carboxyla- expression dramatically decreased the photosynthesis of the tion activity (Farquhar et  al. 1989; Brugnoli and Farquhar, transplastomic plants. The reduced A was an unexpected 2000; Ghashghaie et al., 2003). The fact that CO supply was N 2 result, especially given the role of AQP1 in CO diffusion, as reduced in transplastomic plants due to the reduction of g , 2 m descr ibed in tobacco (Uehlein et al., 2003; Flexas et al., 2006) but Δ was still larger in these plants than in WT plants, sug- and in other species (Hanba et  al., 2004; Sade et  al., 2010). gests a reduction of carboxylase activity relative to CO sup- In a previous study, Flexas et  al. (2006) showed that, com- ply around Rubisco. pared with the corresponding WT plants, photosynthetic The localization of AQP1 to the thylakoid membranes rates were lower in NtAQP1-deficient plants and higher in might negatively affect their functionality, perhaps via inter- NtAQP1-overexpressing plants, suggesting that variations action with proteins of the photosynthetic apparatus that in the photosynthetic rate were certainly linked to changes affects the protein dynamics within the thylakoid, with in C (Flexas et  al., 2006). In the present study, the higher a consequent impact on photosynthetic capacity. Indeed, C detected in the transplastomic (compared with the WT) the reduced membrane resistance to SDS (Supplementary plants indicates that stomatal opening was not involved in Fig. S2) suggests that the thylakoid membrane was damaged the lower A of the AQP1 and TicAQP1 plants. Indeed, the in some way, possibly related to the presence of recombinant same stomatal conductance in the three genotypes, along AQP1. It has been reported that targeting foreign membrane with a clearly lower CO fixation by the photosynthetic proteins to thylakoid membranes by chloroplast transforma- machinery in the transplastomic plants, might be related to tion causes mutant phenotypes with reduced growth and the higher C in AQP1 and TicAQP1 plants. Following from photosynthetic capacity, altered thylakoid ultrastructure, and this observation, it could be tentatively concluded that the impairment of the integrity of the photosystems (Henig et al., lower A in the transplastomic plants was caused by their 2007; Gnanasekaran et  al., 2016). A  similar response could lower g (by ~50%) compared with the WT plants, since g be produced by the recombinant AQP1 located in the thy- m m is now recognized to play a major role in CO diffusion into lakoid membranes, particularly considering the presence of the chloroplast (Flexas et al., 2006; Flexas et al., 2007b; Scafaro large protein aggregates (Fig. 3). However, despite the higher et  al., 2011; Kaldenhoff, 2012; Evans and von Caemmerer, content of recombinant AQP1 in the thylakoid membranes 2013; Flexas et  al., 2013). Nevertheless, the hypothesis on of TicAQP1 plants, the photosynthetic parameters were simi- limited diffusion (reduced g ) in AQP1 and TicAQP1 plants lar in both AQP1 and TicAQP1 plants (Fig.  4). Perhaps a cannot explain alone their lower photosynthetic rates. In threshold of chloroplast damage was reached in the AQP1 fact, C was not different between WT and transplastomic plants and the greater content of the recombinant protein in plants, and nor was the C /C ratio, despite very different TicAQP1 plants was inconsequential. Another possibility is c i rates of photosynthesis (Figs  4 and 5). Although g was not that other processes, in addition to the functionality of the affected by the overexpression of AQP1 in transplastomic thylakoids, might be involved in the photosynthetic impair- plants, the overall CO supply was reduced as a consequence ment of these plants. of the reduction of g . However, because the CO demand m 2 was also reduced due to impaired V and J , the overall Cmax max Other factors affecting recombinant AQP1 functionality result was a relatively higher C in the transplastomic plants compared with WT plants; the difference was more evident The gas exchange data highlight the fact that, in contrast to according to the Δ measurements (Fig.  4F) than according what was expected, NtAQP1 overexpression from the chloro- to chlorophyll fluorescence-based estimates (Fig. 5B). If C plast genome constrains CO diffusion from the substomatal c 2 (i.e. the substrate for photosynthesis) was the same between cavity to the chloroplast. An explanation for this harmful effect the WT, AQP1, and TicAQP1 plants, then differences in A is not easy to provide, but other factors, in addition to the were more likely related to differences in photosynthetic above-mentioned factors related to the import pathway and capacity. thylakoid targeting, could be involved. Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 Performance of transplastomic tobacco overexpressing NtAQP1 | 3671 The regulation of the function of AQP proteins depends Acknowledgements on several processes, including post-translational modifications The authors thank Ralf Kaldenhoff (Dar mstadt University of Technology, and protein interactions, that affect both their activity and their Germany) for providing the NtAQP1 antibody and Iván Jáuregui for subcellular localization (Hove and Bhave, 2011; Chaumont and technical assistance. MA is a recipient of a Formación de Profesorado Universitario fellowship from the Ministerio de Educación, Cultura y Tyerman, 2014; Verdoucq et al., 2014). It is possible that differ- Deporte, Spain. MN was supported by a predoctoral fellowship BES- ences between the stromal and cytosolic environments pre- 2015-072578 from the Ministerio de Economía y Competitividad vent the required AQP post-translational modifications and/or (MINECO), Spain, co-financed by the European Science Foundation. interactions in the stroma. Another important aspect to be considered is that AQPs assemble as homo- and/or heterotetramers in the membranes. References The AQP monomer is the functional unit for water trans- Aharon R, Shahak Y, Wininger S, Bendov R, Kapulnik Y, Galili G. port, but the tetramer and its composition may be important 2003. Overexpression of a plasma membrane aquaporin in transgenic tobacco improves plant vigor under favorable growth conditions but not for CO -related transport. Further, in tobacco, CO diffu- 2 2 under drought or salt stress. The Plant Cell 15, 439–447. sion is greater when tetramers consist only of NtAQP1 from Ahmad N, Michoux F, McCarthy J, Nixon PJ. 2012. Expression of the the PIP1 family (Otto et al., 2010), and different proportions affinity tags, glutathione-S-transferase and maltose-binding protein, in of PIP1 and PIP2 subunits in the tetramer may promote tobacco chloroplasts. Planta 235, 863–871. either water or CO transfer, or both (Flexas et al., 2012). If 2 ap Rees T. 1995. Where do plants make ADP-Glc? In: Pontis HG, Salerno G, Echeverría E, eds. Sucrose metabolism, biochemistry, physiology and improper AQP1 monomers (due to incorrect post-transla- molecular biology. Rockville: American Society of Plant Physiologists, tional modifications) synthesized in the chloroplast stroma 143–155. interact with normal WT AQP1 synthesized in the cytosol, Araus JL, Villegas D, Aparicio N, del Moral L, Hani El S, Rharrabti non-functional or partially functional homotetramers might Y, Ferrio JP, Royo C. 2003. Environmental factors determining carbon isotope discrimination and yield in durum wheat under Mediterranean find their way to the IEM. It must be noted that unusual conditions. Crop Science 43, 170–180. oligomeric and possible non-specific protein aggregates Bernacchi CJ, Portis AR, Nakano H, von Caemmerer S, Long SP. were detected (Figs 2B and 3). Given that the transplastomic 2002. Temperature response of mesophyll conductance. Implications plants in this study had 10–16 times the AQP1 content of for the determination of Rubisco enzyme kinetics and for limitations to photosynthesis in vivo. Plant Physiology 130, 1992–1998. the WT plants, defective homotetramers might have pre- Bock R. 2015. Engineering plastid genomes: methods, tools, and vailed over any homotetramers composed exclusively of WT applications in basic research and biotechnology. Annual Review of Plant AQP1 monomers, thus compromising AQP1-mediated CO Biology 66, 211–241. transport in the IEM. Brugnoli E, Farquhar GD. 2000. Photosynthetic fractionation of Finally, despite the engineered modification to AQP1 expres- carbon isotopes. In: Leegood RC, Sharkey TD, von Caemmerer S, eds. Photosynthesis: physiology and metabolism. Dordrecht: Kluwer Academic sion levels being able to alter g (suggesting a role for AQPs Publishers, 399–434. in CO transport), the molecular bases controlling g remain 2 m Celedon JM, Cline K. 2013. Intra-plastid protein trafficking: how plant cells unclear and are affected by components such as the cell walls, adapted prokaryotic mechanisms to the eukaryotic condition. Biochimica et plasma and chloroplastic membranes, and carbonic anhydrases. Biophysica Acta 1833, 341–351. Thus, other regulatory mechanisms that control g might be m Chaumont F, Tyerman SD. 2014. Aquaporins: highly regulated channels controlling plant water relations. Plant Physiology 164, 1600–1618. unmasked in plants with altered levels of AQPs (Verdoucq Chiu CC, Li HM. 2008. Tic40 is important for reinsertion of proteins from et al., 2014), such as those analysed in the present study. the chloroplast stroma into the inner membrane. The Plant Journal 56, In conclusion, in an attempt to increase CO diffusion across 793–801. the chloroplast membranes we engineered tobacco plants with Chou ML, Fitzpatrick LM, Tu SL, Budziszewski G, Potter-Lewis substantially increased levels of the CO -permeable NtAQP1 2 S, Akita M, Levin JZ, Keegstra K, Li HM. 2003. Tic40, a membrane- anchored co-chaperone homolog in the chloroplast protein translocon. The protein within the chloroplast membranes. However, there EMBO Journal 22, 2970–2980. was no improvement in intracellular CO transfer capacity in Daniell H. 1997. Transformation and foreign gene expression in plants by the transplastomic plants. In fact, we observed impairment in microprojectile bombardment. Methods in Molecular Biology 62, 463–489. photosynthetic capacity, which could be partially attributed De Marchis F, Pompa A, Mannucci R, Morosinotto T, Bellucci M. 2011. to changes in the thylakoid ultrastructure, and reductions in A plant secretory signal peptide targets plastome-encoded recombinant proteins to the thylakoid membrane. Plant Molecular Biology 76, 427–441. V and J , which were the main limiting factors. This Cmax max Edgerton MD. 2009. Increasing crop productivity to meet global needs for study serves to highlight obstacles that need to be overcome in feed, food, and fuel. Plant Physiology 149, 7–13. work towards engineering improved CO transfer capacity for Evans JR, von Caemmerer S. 2013. Temperature response of carbon enhanced photosynthesis. isotope discrimination and mesophyll conductance in tobacco. Plant, Cell & Environment 36, 745–756. Farmaki T, Sanmartín M, Jiménez P, Paneque M, Sanz C, Vancanneyt Supplementary data G, León J, Sánchez-Serrano JJ. 2007. Differential distribution of the lipoxygenase pathway enzymes within potato chloroplasts. Journal of Supplementary data are available at JXB online. Experimental Botany 58, 555–568. Fig. S1. Relationship between ΦPSII versus ΦCO used to Farquhar GD, Ehleringer JR, Hubick KT. 1989. Carbon isotope discrimination and photosynthesis. Annual Review of Plant Physiology and correct ETR. Plant Molecular Biology 40, 503–537. Fig.  S2. Membrane disruption of chloroplasts from wild- Fernández-San Millán A, Ortigosa SM, Hervás-Stubbs S, Corral- type (WT), AQP1, and TicAQP1 plants with increasing con- Martínez P, Seguí-Simarro JM, Gaétan J, Coursaget P, Veramendi J. centrations of SDS. 2008. Human papillomavirus L1 protein expressed in tobacco chloroplasts Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 3672 | Fernández-San Millán et al. self-assembles into virus-like particles that are highly immunogenic. Plant Hoober JK, Boyd CO, Paavola LG. 1991. Origin of thylakoid membranes Biotechnology Journal 6, 427–441. in Chlamydomonas reinhardtii y-1 at 38°C. Plant Physiology 96, 1321–1328. Ferro M, Salvi D, Riviere-Rolland H, Vermat T, Seigneurin-Berny D, Hove RM, Bhave M. 2011. Plant aquaporins with non-aqua functions: Grunwald D, Garin J, Joyard J, Rolland N. 2002. Integral membrane deciphering the signature sequences. Plant Molecular Biology 75, 413–430. proteins of the chloroplast envelope: identification and subcellular Kaldenhoff R. 2012. Mechanisms underlying CO diffusion in leaves. localization of new transporters. Proceedings of the National Academy of Current Opinion in Plant Biology 15, 276–281. Sciences, USA 99, 11487–11492. Kaldenhoff R, Kai L, Uehlein N. 2014. Aquaporins and membrane Flexas J, Barbour MM, Brendel O, et  al. 2012. Mesophyll diffusion diffusion of CO in living organisms. Biochimica et Biophysica Acta 1840, conductance to CO : an unappreciated central player in photosynthesis. 1592–1595. Plant Science 193-194, 70–84. Li M, Schnell DJ. 2006. Reconstitution of protein targeting to the inner Flexas J, Díaz-Espejo A, Berry JA, Cifre J, Galmés J, Kaldenhoff R, envelope membrane of chloroplasts. The Journal of Cell Biology 175, Medrano H, Ribas-Carbó M. 2007b. Analysis of leakage in IRGA’s leaf 249–259. chambers of open gas exchange systems: quantification and its effects Long SP, Ainsworth EA, Leakey AD, Nösberger J, Ort DR. 2006. Food in photosynthesis parameterization. Journal of Experimental Botany 58, for thought: lower-than-expected crop yield stimulation with rising CO 1533–1543. concentrations. Science 312, 1918–1921. Flexas J, Díaz-Espejo A, Conesa MA, et  al. 2016. Mesophyll Loreto F, Tsonev T, Centritto M. 2009. The impact of blue light on leaf conductance to CO and Rubisco as targets for improving intrinsic water mesophyll conductance. Journal of Experimental Botany 60, 2283–2290. use efficiency in C3 plants. Plant, Cell & Environment 39, 965–982. Loriaux SD, Avenson TJ, Welles JM, McDermitt DK, Eckles RD, Flexas J, Diaz-Espejo A, Galmés J, Kaldenhoff R, Medrano H, Ribas- Riensche B, Genty B. 2013. Closing in on maximum yield of chlorophyll Carbo M. 2007a. Rapid variations of mesophyll conductance in response fluorescence using a single multiphase flash of sub-saturating intensity. to changes in CO concentration around leaves. Plant, Cell & Environment Plant, Cell & Environment 36, 1755–1770. 30, 1284–1298. Luu DT, Maurel C. 2013. Aquaporin trafficking in plant cells: an emerging Flexas J, Niinemets U, Gallé A, et al. 2013. Diffusional conductances to membrane-protein model. Traffic 14, 629–635. CO as a target for increasing photosynthesis and photosynthetic water-use efficiency. Photosynthesis Research 117, 45–59. Lübeck J, Heins L, Soll J. 1997. A nuclear-coded chloroplastic inner envelope membrane protein uses a soluble sorting intermediate upon Flexas J, Ribas-Carbó M, Diaz-Espejo A, Galmés J, Medrano H. 2008. import into the organelle. The Journal of Cell Biology 137, 1279–1286. Mesophyll conductance to CO : current knowledge and future prospects. Plant, Cell & Environment 31, 602–621. Martins SC, Galmés J, Molins A, DaMatta FM. 2013. Improving the estimation of mesophyll conductance to CO : on the role of electron Flexas J, Ribas-Carbó M, Hanson DT, Bota J, Otto B, Cifre J, transport rate correction and respiration. Journal of Experimental Botany McDowell N, Medrano H, Kaldenhoff R. 2006. Tobacco aquaporin 64, 3285–3298. NtAQP1 is involved in mesophyll conductance to CO in vivo. The Plant Journal 48, 427–439. Maurel C, Reizer J, Schroeder JI, Chrispeels MJ. 1993. The vacuolar membrane protein gamma-TIP creates water specific channels in Xenopus Gago J, Douthe C, Florez-Sarasa I, Escalona JM, Galmes J, Fernie oocytes. The EMBO Journal 12, 2241–2247. AR, Flexas J, Medrano H. 2014. Opportunities for improving leaf water use efficiency under climate change conditions. Plant Science 226, 108–119. Maurel C, Verdoucq L, Luu DT, Santoni V. 2008. Plant aquaporins: membrane channels with multiple integrated functions. Annual Review of Galmés J, Medrano H, Flexas J. 2007. Photosynthetic limitations in Plant Biology 59, 595–624. response to water stress and recovery in Mediterranean plants with different growth forms. New Phytologist 175, 81–93. Okawa K, Inoue H, Adachi F, Nakayama K, Ito-Inaba Y, Schnell DJ, Uehara S, Inaba T. 2014. Targeting of a polytopic membrane protein Ghashghaie J, Badeck FW, Lanigan G, Nogués S, Tcherkez G, to the inner envelope membrane of chloroplasts in vivo involves multiple Deléens E, Cornic G, Griffiths H. 2003. Carbon isotope fractionation transmembrane segments. Journal of Experimental Botany 65, 5257–5265. during dark respiration and photorespiration in C3 plants. Phytochemistry Reviews 2, 145–161. Otto B, Uehlein N, Sdorra S, et al. 2010. Aquaporin tetramer composition modifies the function of tobacco aquaporins. The Journal of Biological Gnanasekaran T, Karcher D, Nielsen AZ, et al. 2016. Transfer of the Chemistry 285, 31253–31260. cytochrome P450-dependent dhurrin pathway from Sorghum bicolor into Nicotiana tabacum chloroplasts for light-driven synthesis. Journal of Parry MA, Andralojc PJ, Scales JC, Salvucci ME, Carmo-Silva AE, Experimental Botany 67, 2495–2506. Alonso H, Whitney SM. 2013. Rubisco activity and regulation as targets for crop improvement. Journal of Experimental Botany 64, 717–730. Gomes D, Agasse A, Thiébaud P, Delrot S, Gerós H, Chaumont F. 2009. Aquaporins are multifunctional water and solute transporters Parry MA, Reynolds M, Salvucci ME, Raines C, Andralojc PJ, Zhu highly divergent in living organisms. Biochimica et Biophysica Acta 1788, XG, Price GD, Condon AG, Furbank RT. 2011. Raising yield potential 1213–1228. of wheat. II. Increasing photosynthetic capacity and efficiency. Journal of Experimental Botany 62, 453–467. Griffith KL, Wolf RE Jr. 2002. Measuring β-galactosidase activity in bacteria: cell growth, permeabilization, and enzyme assays in 96-well arrays. Pengelly JJ, Förster B, von Caemmerer S, Badger MR, Price GD, Biochemical and Biophysical Research Communications 290, 397–402. Whitney SM. 2014. Transplastomic integration of a cyanobacterial bicarbonate transporter into tobacco chloroplasts. Journal of Experimental Groszmann M, Osborn HL, Evans JR. 2017. Carbon dioxide and Botany 65, 3071–3080. water transport through plant aquaporins. Plant, Cell & Environment 40, 938–961. Pisareva T, Kwon J, Oh J, Kim S, Ge C, Wieslander A, Choi JS, Norling B. 2011. Model for membrane organization and protein sorting in Hanba YT, Shibasaka M, Hayashi Y, Hayakawa T, Kasamo K, the cyanobacterium Synechocystis sp. PCC 6803 inferred from proteomics Terashima I, Katsuhara M. 2004. Overexpression of the barley aquaporin and multivariate sequence analyses. Journal of Proteome Research 10, HvPIP2;1 increases internal CO conductance and CO assimilation in the 2 2 3617–3631. leaves of transgenic rice plants. Plant & Cell Physiology 45, 521–529. Pons TL, Flexas J, von Caemmerer S, Evans JR, Genty B, Ribas- Harley PC, Loreto F, Di Marco G, Sharkey TD. 1992. Theoretical Carbo M, Brugnoli E. 2009. Estimating mesophyll conductance to considerations when estimating the mesophyll conductance to CO flux by CO : methodology, potential errors, and recommendations. Journal of analysis of the response of photosynthesis to CO . Plant Physiology 98, 2 Experimental Botany 60, 2217–2234. 1429–1436. Priestley DA, Woolhouse HW. 1980. The chloroplast envelope of Heckwolf M, Pater D, Hanson DT, Kaldenhoff R. 2011. The Arabidopsis Phaseolus vulgaris L .1. Isolation and compositional characteristics. Journal thaliana aquaporin AtPIP1;2 is a physiologically relevant CO transport of Experimental Botany 31, 437–447. facilitator. The Plant Journal 67, 795–804. Henig A, Bonfig K, Roitsch T, Warzecha H. 2007. Expression of the Reynolds M, Bonnett D, Chapman SC, Furbank RT, Manès Y, Mather recombinant bacterial outer surface protein A in tobacco chloroplasts leads DE, Parry MA. 2011. Raising yield potential of wheat. I.  Overview of a to thylakoid localization and loss of photosynthesis. The FEBS Journal 274, consortium approach and breeding strategies. Journal of Experimental 5749–5758. Botany 62, 439–452. Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 Performance of transplastomic tobacco overexpressing NtAQP1 | 3673 Sade N, Gebretsadik M, Seligmann R, Schwartz A, Wallach R, protein to chloroplast plastoglobules and thylakoids in transplastomic Moshelion M. 2010. The role of tobacco Aquaporin1 in improving water tobacco plants. Plant Molecular Biology 81, 13–25. use efficiency, hydraulic conductivity, and yield production under salt stress. Uehlein N, Lovisolo C, Siefritz F, Kaldenhoff R. 2003. The tobacco Plant Physiology 152, 245–254. aquaporin NtAQP1 is a membrane CO pore with physiological functions. Santoni V. 2007. Plant plasma membrane protein extraction and solubilization Nature 425, 734–737. for proteomic analysis. Methods in Molecular Biology 355, 93–109. Uehlein N, Otto B, Hanson DT, Fischer M, McDowell N, Kaldenhoff R. Sanz-Barrio R, Corral-Martinez P, Ancin M, Segui-Simarro JM, 2008. Function of Nicotiana tabacum aquaporins as chloroplast gas pores Farran I. 2013. Overexpression of plastidial thioredoxin f leads to enhanced challenges the concept of membrane CO permeability. The Plant Cell 20, starch accumulation in tobacco leaves. Plant Biotechnology Journal 11, 648–657. 618–627. Valentini R, Epron D, De Angelis P, Matteucci G, Dreyer E. 1995. In Scafaro AP, von Caemmerer S, Evans JR, Atwell BJ. 2011. Temperature situ estimation of net CO assimilation, photosynthetic electron flow and response of mesophyll conductance in cultivated and wild Oryza species photorespiration in Turkey oak (Quercus cerris L.) leaves: diurnal cycles with contrasting mesophyll cell wall thickness. Plant, Cell & Environment under different levels of water supply. Plant Cell and Environment 18, 34, 1999–2008. 631–640. Scotti N, Sannino L, Idoine A, Hamman P, De Stradis A, Giorio P, Verdoucq L, Rodrigues O, Martinière A, Luu DT, Maurel C. 2014. Plant Maréchal-Drouard L, Bock R, Cardi T. 2015. The HIV-1 Pr55 gag aquaporins on the move: reversible phosphorylation, lateral motion and polyprotein binds to plastidial membranes and leads to severe impairment cycling. Current Opinion in Plant Biology 22, 101–107. of chloroplast biogenesis and seedling lethality in transplastomic tobacco Walker B, Ariza LS, Kaines S, Badger MR, Cousins AB. 2013. plants. Transgenic Research 24, 319–331. Temperature response of in vivo Rubisco kinetics and mesophyll Shanmugabalaji V, Besagni C, Piller LE, Douet V, Ruf S, Bock R, conductance in Arabidopsis thaliana: comparisons to Nicotiana tabacum. Kessler F. 2013. Dual targeting of a mature plastoglobulin/fibrillin fusion Plant, Cell & Environment 36, 2108–2119. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Experimental Botany Oxford University Press

Physiological performance of transplastomic tobacco plants overexpressing aquaporin AQP1 in chloroplast membranes

Download PDF
13 pages

Loading next page...
 
/lp/ou_press/physiological-performance-of-transplastomic-tobacco-plants-01WW4Puba3

References (82)

Publisher
Oxford University Press
Copyright
Copyright © 2022 Society for Experimental Biology
ISSN
0022-0957
eISSN
1460-2431
DOI
10.1093/jxb/ery148
Publisher site
See Article on Publisher Site

Abstract

The leaf mesophyll CO conductance and the concentration of CO within the chloroplast are major factors affecting 2 2 photosynthetic performance. Previous studies have shown that the aquaporin NtAQP1 (which localizes to the plasma membrane and chloroplast inner envelope membrane) is involved in CO permeability in the chloroplast. Levels of NtAQP1 in plants genetically engineered to overexpress the protein correlated positively with leaf mesophyll CO con- ductance and photosynthetic rate. In these studies, the nuclear transformation method used led to changes in NtAQP1 levels in the plasma membrane and the chloroplast inner envelope membrane. In the present work, NtAQP1 levels were increased up to 16-fold in the chloroplast membranes alone by the overexpression of NtAQP1 from the plastid genome. Despite the high NtAQP1 levels achieved, transplastomic plants showed lower photosynthetic rates than wild-type plants. This result was associated with lower Rubisco maximum carboxylation rate and ribulose 1,5-bispho- sphate regeneration. Transplastomic plants showed reduced mesophyll CO conductance but no changes in chloro- plast CO concentration. The absence of differences in chloroplast CO concentration was associated with the lower 2 2 CO fixation activity of the transplastomic plants. These findings suggest that non-functional pores of recombinant NtAQP1 may be produced in the chloroplast inner envelope membrane. Keywords: Aquaporin, chloroplast envelope, CO permeability, plastid transformation, protein targeting, tobacco. Introduction It is predicted that future increases in the human popula- et al., 2013; Flexas et al., 2012). Photosynthetic performance tion will require a 30% increase in crop yield rates (Edgerton, is affected by two major factors: the concentration of CO 2009). Improving the photosynthetic performance of crops within the chloroplast and the efficiency of the carboxyla- is one way in which plant production might be increased tion biochemistry. Availability of CO at the carboxylation (Parry et  al., 2011; Reynolds et  al., 2011; Parry et  al., 2013; site in the chloroplast can be limited by its diffusion into the Flexas et  al., 2013), and a number of strategies have been substomatal cavities, referred to as stomatal conductance (g ), identified that, either individually or in combination, might and by the conductance of CO from the substomatal cavity achieve this (Long et  al., 2006; Flexas et  al., 2006; Parry to the chloroplast, referred to as mesophyll conductance (g ). © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Experimental Biology. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 3662 | Fernández-San Millán et al. Classically, g has been described not to limit photosynthesis, in tobacco and Arabidopsis, however, increased chloroplast and the CO concentration was thought to be similar in the membrane CO permeability, the rate of photosynthesis, and 2 2 substomatal cavity (C ) and in the chloroplast stroma (C ). plant growth (Aharon et al., 2003; Uehlein et al., 2003; Flexas i c However, over the past decade, a number of studies (Flexas et al., 2006). A similar positive effect on CO permeability, plus et al., 2006; Scafaro et al., 2011; Kaldenhoff, 2012; Evans and an increase in leaf net photosynthesis, was observed in tomato von Caemmerer, 2013; Flexas et  al., 2013) have shown that and rice plants overexpressing AQP (Hanba et al., 2004; Sade g has a major influence on CO diffusion into the chloro- et  al., 2010). It was eventually suggested that the function of m 2 plast, with a consequent impact on the photosynthetic rate. NtAQP1 might depend on its localization in the cell, and that At the cellular level, atmospheric CO has to pass through it might provide a water channel in the plasma membrane the cell wall and three membranes (the plasma membrane and a CO channel in the chloroplast envelope (Uehlein et al., and the two membranes of the chloroplast envelope) to reach 2008). the chloroplast stroma. The CO permeability of the chlo- In the present study, the hypothesis that higher levels of roplast envelope is low, probably due to its relatively large AQPs in the chloroplast would increase CO transport and the protein content (Priestley and Woolhouse, 1980); indeed, it rate of photosynthesis was tested by overexpressing NtAQP1 was estimated that it may account for almost half of the inter- from the chloroplast genome of tobacco. Compared with nal leaf resistance to CO (Uehlein et  al., 2008). As a result, nuclear transformation, plastid transformation provides the under light-saturated conditions, photosynthesis is limited by advantage of high transgene expression levels (Bock, 2015). the availability of CO within the chloroplast. Other studies In addition, the recombinant protein is confined to the chlo- have shown that the g can change quickly in response to roplast, eliminating the effect of AQP1 modification in the varying environmental conditions, such as leaf temperature plasma membrane. Therefore, the main objective of the pre- (Bernacchi et  al., 2002), water stress (Galmés et  al., 2007), sent study was to evaluate the role of NtAQP1 overexpression blue light (Loreto et  al., 2009), and the external CO con- specifically in the chloroplast membranes on CO permeabil- 2 2 centration (Flexas et  al., 2007a). This rapid modification of ity and photosynthetic performance. g points to the existence of additional components, some of them probably proteins, controlling the conductance of the mesophyll to CO diffusion. Proteins forming pore-like Materials and methods structures, such as aquaporins (AQPs), might help explain Production of plants overexpressing NtAQP1 in the chloroplast how these rapid variations in g  occur. AQPs are small proteins that increase the permeability Total RNA from Nicotiana tabacum L. (cv. Petite Havana SR1) leaves was extracted using the Ultraspec RNA kit (Biotecx Laboratories, Houston, of cell membranes to water and certain small, neutral mol- TX, USA), and cDNA was synthesized using the SuperScript III system ecules, including CO (Maurel et  al., 2008; Gomes et  al., (Invitrogen, Carlsbad, CA, USA). The NtAQP1 gene (GenBank Accession 2009; Chaumont and Tyerman, 2014; Kaldenhoff et al., 2014; AJ001416) was amplified by PCR with the primers NTAQP1for: Groszmann et  al., 2017). AQPs were discovered for the first AAGCTTTTGCAAGTATATT TTCCATGGCAGAAAACAAAGAA time in plants in the vacuolar tonoplast of Arabidopsis (Maurel GAAGATGTTAAGCTCGG and NTAQP1rev: GCGGCCGCTTAA GACGACTTG TGGAATGGAATGGCTCTG. The full-length cDNA et al., 1993), and are present in the whole plant kingdom. AQPs was then cloned into the pGEMTeasy vector (Promega, Madison, WI, are located in the plasma membrane and also in most of the USA) and sequenced. The tobacco NtAQP1 gene was subsequently intracellular membranes. Many isoforms of AQPs exist, which cloned into the pAF chloroplast transformation vector (Fernández- can be classified according to their sequence homologies and San Millán et  al., 2008) under the control of the psbA promoter and subcellular localization. The plasma membrane intrinsic pro- 5ʹ-untranslated region, to obtain the expression vector pAF-AQP1. The Tic40 transit peptide sequence (240  bp) was amplified by PCR tein (PIP) class includes isoforms that are most abundant in the using cDNA from A.  thaliana using the primers AtTic40TPfor: plasma membrane. This class can be subdivided into subclasses CCATGGAGAACCTTACCCTAGTTTC and AtTic40TPrev: PIP1 and PIP2 according to sequence similarity. Investigations GCGGCCGCAAGCTTTGCTTCTCTGTTTC. It was then fused on the mesophyll cells of tobacco leaves have shown that the with NtAQP1 at an NcoI restriction site to produce the expression vector plasma membrane protein NtAQP1 (a PIP1 member) facili- pAF-TicAQP1. N.  tabacum L. (cv. Petite Havana SR1) was also used in plastid trans- tates CO transport, and that it has important functions in formations. The PDS-1000/He biolistic system (Bio-Rad, Hercules, CA, photosynthesis and stomatal opening (Uehlein et  al., 2003). USA) was used for the integration of transgenes as previously described Further studies revealed a dual localization of NtAQP1 in the (Daniell, 1997). The aadA gene, conferring resistance to spectinomycin, plasma membrane and the inner envelope membrane (IEM) was used as a selectable marker gene. Two rounds of selection and shoot of the chloroplast (Uehlein et  al., 2008). A  mutation in the development on RMOP medium containing 500  mg/l spectinomycin were performed. The transplastomic plants produced were named AQP1 Arabidopsis thaliana AtPIP1;2 gene was found to be associated and TicAQP1. with reduced g and a reduction in the rate of photosynthe- sis (Heckwolf et  al., 2011). Genetic engineering to modify NtAQP1 expression levels confirmed these results, revealing Southern and northern blotting a function for NtAQP1 in CO conductance. Antisense or Southern and northern blotting experiments were performed as previ- RNA interference-mediated downregulation of NtAQP1 ously described (Sanz-Barrio et  al., 2013). For Southern blotting, the resulted in a reduction of IEM CO permeability, C values, 2 c flanking sequence P1 probe generated by PCR was used. After Southern and photosynthetic performance (Uehlein et al., 2003; Flexas blot confirmation of the T generation, selected plants were transplanted into pots and grown in the greenhouse for seed production. T plants were et al., 2006; Uehlein et al., 2008). Overexpression of NtAQP1 1 Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 Performance of transplastomic tobacco overexpressing NtAQP1 | 3663 used in further experiments. Northern blotting was performed using the Plants used for gas exchange AQP1-specific P2 probe (515 bp) obtained by NcoI digestion of AQP1. Plants were grown in 2 litre pots (organic soil/perlite, 70/30 v/v) in two places, Pamplona and Mallorca (Spain). In Pamplona, plants were grown in a greenhouse at 24–28  °C and relative humidity ~40%. Plants were Protein extraction, separation, and western blotting watered with water by drip irrigation and twice a week with 50% diluted Leaf samples (100 mg) from transformed and untransformed 70-day-old Hoagland’s solution. In Mallorca, plants were grown in a growth chamber −2 −1 plants were ground in liquid nitrogen, homogenized in 300  μl of 2× at PPFD ~350 µmol m s at the top of the plants, daily temperature of Laemmli buffer (0.5 M Tris–HCl, pH 6.5, 4% SDS, 20% glycerol, and 24–26 °C, relative humidity ~40%, and watered twice a week with water 10% β-mercaptoethanol) and heated at 95 °C for 5 min. After 5 min of and once a week with 50% diluted Hoagland’s solution. centrifugation at 20 000 g, the supernatant was deemed to represent the total protein (TP) content. TP was quantified using the RC-DC protein Gas exchange and chlorophyll fluorescence analyses assay (Bio-Rad) with BSA as a standard. Proteins were separated by SDS- PAGE on 12% polyacrylamide gels and transferred to a polyvinylidene Gas exchange measurements were perfor med with a calibrated Li-6400 fluoride (PVDF) membrane for immunoblotting. The primary antibod- XT portable gas analyser (Licor, Lincoln, NE, USA) equipped with ies used were anti-PIP1 (Agrisera, Vännäs, Sweden) and anti-NtAQP1 the 2  cm Li-6400-40 Leaf Chamber Fluorometer. Determinations (kindly provided by R.  Kaldenhoff) (dilution 1:3000). Peroxidase- were conducted in apical fully developed leaves. Three independent conjugated goat anti-rabbit or anti-chicken immunoglobulin G (Sigma- exper iments (two in Pamplona and one in Mallorca) were perfor med. Aldrich, St Louis, MO, USA) (both at a dilution of 1:3000) were used as For the measurements made in Pamplona, plants were transferred to secondary antibodies with the anti-PIP1 and anti-NtAQP1 primary anti- a growth chamber with similar environmental conditions to those of bodies, respectively. Detection was performed using the chemilumines- the Mallorca site. For each plant, the same procedure was followed: cence ECL western blotting system (GE Healthcare, Fairfield, CT, USA). first, stabilization until a steady state of stomatal conductance was Relative quantification of NtAQP1 monomers and oligomers was reached (typically ~20–30 minutes) in ambient conditions (CO con- −1 performed by comparing dilution series of TP from wild-type (WT) centration=400 µmol mol , 1500 PPFD, and 25 °C). After stabiliza- plants and both types of transplastomic plant (three replicates were ana- tion, the A /C curve was performed by changing the concentration N i lysed). For each line, adequate amounts were loaded on to an SDS-PAGE of CO entering the leaf chamber with, the following steps: 400, gel, electrophoretically separated, and then analysed by western blot- 300, 250, 200, 150, 100, 50, 400, 400, 500, 600, 700, 800, 1000, 1200 −1 ting. Immunoblots were quantified using GeneTools Analyzer software and 1500 µmol mol , with typically 2–3 minutes between each step. (SynGene, Cambridge, UK). Each A /C curve was corrected for leaks by following the proto- N i col described by Flexas et  al., (2007b). In all three experiments, the results of net CO assimilation and stomatal conductance were very Plasma membrane isolation consistent (data not shown). In the third experiment, performed in Plasma membranes from 50-day-old WT and transplastomic plants Mallorca, chlorophyll fluorescence was measured together with gas −2 −1 grown in a growth chamber [16  h light/8  h dark; 200  µmol m s exchange to estimate the mesophyll conductance to CO . Therefore, photosynthetic photon flux density (PPFD) and a day/night tempera- all the results shown in the present paper correspond to this latter ture regime of 28  °C/25  °C] were obtained as previously described exper iment. (Santoni, 2007). After performing the A /C curve, the leaf was kept in the chamber N i and N from a tank (Air Liquide) was piped into the Li-6400 inlet to remove O from the entering air in the leaf chamber, to allow measure- ments to be made in non-photorespiratory conditions (Valentini et  al., Chloroplast isolation, fractionation, and immunoblotting 1995). We then performed a light curve at ambient CO concentration 2  −1 For chloroplast isolation, leaves from 50-day-old tobacco plants were cut (400  µmol mol ) with the following PPFD steps: 1500, 2000, 1750, −2 −1 into 1–3 cm pieces and homogenized in a blender. The isolation buffer 1500, 1250, 1000, 800, 550, 300, 150, 100, 75, 50, 25 and 0 µmol m s . (330  mM sorbitol, 20  mM MOPS, 13  mM Tris, 3  mM MgCl , 0.1% 2 These measurements were used to estimate the product of leaf absorption BSA) was six times (v/w) the fresh mass weight of the leaf samples. The (α) and the partitioning of absorbed quanta between photosystems I and homogenate was passed through a filter mesh and centrifuged for 5 min II (β) (see Valentini et al., 1995 and Pons et al., 2009 for details). We used −2 −1 at 1000 g and 4 °C. The pellet fraction was resuspended in isolation buffer only the first points of the curve, with PPFD >400 µmol m s , to esti- and chloroplasts were isolated by 80–40% Percoll gradient fractionation mate α*β (Martins et al., 2013), avoiding non-linearity of ΦPSII versus after centrifugation for 10 min at 7700 g and 4 °C. Isolated chloroplasts ΦCO due to changes/higher influence of leaf respiration at low PPFD. were washed in 3 volumes of washing buffer (330 mM sorbitol, 50 mM Values of (α*β) were 0.36 ± 0.04 (TicAQP1), 0.35 ± 0.03 (AQP1), and HEPES/KOH, pH 7.6, 3 mM MgCl ). 2 0.38  ±  0.03 (WT), with no significant differences between genotypes For fractionation, the chloroplasts were lysed by freeze-thawing in (see Supplementary Fig.  S1 at JXB online). Night respiration rate (R ) hypotonic TE buffer [10  mM Tris, 2  mM EDTA, pH 7.5, including a was estimated by measuring leaf gas exchange in darkness, 1 h after the cocktail of protease inhibitors from Roche (Mannheim, Germany)]. lights of the growing chamber were turned off (night). Stroma, envelopes, and thylakoids were separated by using discontinu- Mesophyll conductance (g ) was estimated by the method developed ous sucrose gradients (0.93/0.6/0.3 M) after 2  h of centrifugation at by Harley et al. (1992), as follows: 20 000 rpm in a swing-out rotor. Stroma was collected from the upper fractions and one volume of extracts was combined with one volume gE =− AC /( Γ */  TR ++ 8A RE   TR – 4A + R  { () () }) m Ni Nl Nl     of 2× Laemmli buffer. The thylakoid membranes sedimented out and were resuspended in 10  mM TE buffer, to which one volume of 2× where A is the net CO assimilation rate, C is the CO concentration in N 2 i 2 Laemmli buffer was added. The chloroplast envelopes were collected at the substomatal cavity, Γ* is the CO compensation point in the absence the interface between 0.9 and 0.6 M sucrose. The envelope proteins were −1 of R (assumed to be 40 µmol mol , from Walker et al., 2013), R is the d l concentrated by methanol/chloroform extraction (Ferro et al., 2002) and respiration rate in light (estimated as R /2), and ETR is the electron resuspended in 10 mM TE buffer with one volume of 2× Laemmli buffer transport rate, estimated as follows: added. All three fractions were heated for 1  h at 37  °C. Protein con- centrations were determined by the Bradford method. All samples were ETR =× αβ ×× ΦPSII PPFD resolved by 9% SDS-PAGE and transferred to PVDF membranes for western blotting. Antisera to ADP-glucose pyrophosphorylase (AGPase), where ΦPSII is the yield of photosystem 2. ΦPSII was estimated using LHC chlorophyll a/b binding protein 1 (Lhcb1), and Tic40 (Agrisera) the ‘Multiphase Flash’ method described by Loriaux et al. (2013). proteins were used at dilutions of 1:1000. Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 3664 | Fernández-San Millán et al. Discrimination against CO means were analysed using the Tukey test (P<0.05). All calculations were performed using SPSS 10.0 software. The C isotope discrimination (Δ, ‰) was calculated as: 13 13 δδ CC − atm sample Δ= Results δ C1 + sample Generation of tobacco transplastomic plants and where δ C is the carbon isotope composition in atmospheric CO in atm 2 determination of homoplasmy the greenhouse (–10.8‰) and δ C is the carbon isotope composi- sample tion of leaf total organic matter (TOM). Tobacco plants expressing NtAQP1 from the plastid genome 13 12 The C/ C ratio (R) in plant material was expressed in δ notation were obtained by biolistic bombardment of the leaves with (δ C) with respect to Vienna Pee Dee Belemnite calcium carbonate the engineered pAF vector (Fernández-San Millán et  al., (V-PDB), and measured with an analytical precision of 0.1‰: 2008), which inserted the transgenes between the trnI and  R  trnA regions of the plastid genome (Fig.  1A). Two different sample δ C= − 1   transformation vectors were designed, both with the transgene  R  standard controlled by the promoter and the 5ʹ-untranslated region of δ C accuracy was monitored using international secondary standards the psbA gene. The pAF-AQP1 vector included the full cod- 13 12 of known C/ C ratios (IAEA-CH7 polyethylene foil, IAEA-CH6 ing sequence of NtAQP1. In the pAF-TicAQP1 vector, the sucrose, and USGS-40 glutamic acid, IAEA, Austria). 76 amino acid sequence transit peptide of A.  thaliana Tic40 TOM and gas δ C determinations were conducted at the Serveis protein was fused to the N-terminus of NtAQP1. Two inde- Cientifico-Tecnics of the University of Barcelona. For TOM analyses, pendent transplastomic lines for each construction, developed 1 mg of dry ground leaf material was analysed using an elemental analyser (EA1108, Series 1, Carbo Erba Instrumentazione, Milan, Italy) coupled to an after two rounds of selection on spectinomycin, were analysed isotope ratio mass spectrometer (Delta C, Finnigan MAT, Bremen, Germany) by Southern blotting (Fig.  1B). As predicted for the correct operating in continuous flow mode. Air δ C samples were analysed by gas homologous recombination of the transgenes, the flanking chromatography (Agilent 6890 Gas Chromatograph, Agilent Technologies, region P1 probe hybridized to a 10.4 or 10.7 kb BamHI DNA Spain) coupled to an isotope ratio mass spectrometer Deltaplus via a GC-C fragment in the AQP1 and TicAQP1 transplastomic plants, Combustion III interphase (ThermoFinnigan, Thermo, Barcelona, Spain). respectively. A 7.1 kb band was detected only in the WT plants, indicating that all four lines were homoplasmic. Determination of Rubisco, starch, and chlorophyll contents Samples from the same leaves used for gas exchange and chlorophyll fluor- Expression of aquaporin in the chloroplast escence measurements were analysed for their Rubisco, starch, and chloro- phyll contents. Three leaf discs (2.1 cm ) per plant from WT, AQP1, and Analysis at the transcriptional level in the transplastomic plants TicAQP1 plants were frozen in liquid nitrogen and ground in a Mikro- revealed transcripts of the expected size in both cases (Fig. 2A). dismembrator (Braun, Melsungen, Germany). The volume of the extrac- tion buffer (phosphate buffer, pH 7.0, 100 mM) was three times the fresh Monocistrons of 1.4 and 1.7 kb der ived from the psbA promoter weight (v/w) of the powdered leaf sample obtained from the three leaf discs. were detected in the AQP1 and TicAQP1 plants, respectively. Samples were mixed in a vortex and, after 15 min on ice, centrifuged for Dicistrons transcribed from the upstream rrn promoter were 5 min at 20 000 g at 4 °C. Protein fractions recovered from the supernatants also present. A greater abundance of transcripts was observed in were quantified by the Bradford method. For the separation of these pro- the AQP1 plants than in the TicAQP1 plants, probably owing teins, one volume of the protein fraction was combined with one volume of 2× Laemmli buffer, boiled for 5 min, and then centrifuged at 20 000 g for to the TicAQP1 transcripts being less stable. The endogenous 5 min. Samples (15 μg) of the proteins in these supernatants were separated AQP1 mRNA was below the detection limit. by SDS-PAGE (10%) and the gels were stained with Coomassie brilliant The overexpression of AQP1 protein in the transformed blue G-250. The Rubisco levels of the transplastomic plants were compared chloroplasts was confirmed by immunoblotting (Fig.  2B). with those of the WT plants using GeneTools Analyzer software (SynGene). A faint 30 kDa band of the expected size for the AQP1 protein Starch was determined using an amyloglucosidase-based test kit (R-Biopharm AG, Darmstadt, Germany). monomer was observed in the WT plants. A stronger signal of The leaf chlorophyll contents of the transplastomic and WT plants the same electrophoretic mobility was detected in the AQP1 [measured with a SPAD 502 chlorophyll meter (Minolta Optics Inc, and TicAQP1 plants. Thus, the TicAQP1 recombinant protein Tokyo, Japan)] were recorded in the same leaves used for photosynthetic was correctly processed in the stroma of the chloroplast fol- rate measurements. lowing cleavage of the Tic40 transit peptide. Higher molecu- Leaf area of flowering plants grown in a growth chamber was deter- mined after scanning with ImageJ. lar weight signals were mainly present in transplastomic plants, indicating the presence of abundant oligomeric structures des- pite the denaturing conditions used during sample preparation Electron microscopy and electrophoresis. It is also possible that the increased AQP1 Samples from the same leaves used to measure the photosynthetic rate protein production or inadequate post-translational modifica- were fixed in Karnovsky fixative (4% formaldehyde and 5% glutaralde- tions caused misfolding or the formation of non-specific aggre- hyde in 0.025 M cacodylate buffer, pH 6.7) by vacuum infiltration and further prepared for examination by transmission electron microscopy at gates with other proteins that resulted in abnormal migration the Microscopy Service of the University of Navarre, Spain. patterns in the gel. The putative non-specific protein aggregates of high molecular weight could indicate that only a propor- tion of the recombinant protein equates to functional AQP1 Statistical analysis complexes. Relative AQP1 protein levels were estimated by One-way ANOVA was used to analyse differences in the measured vari- densitometry of different protein extract dilutions in western ables between the control and transplastomic plants. Differences among Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 Performance of transplastomic tobacco overexpressing NtAQP1 | 3665 Fig. 1. Integration of Nicotiana tabacum AQP1 into the tobacco chloroplast genome. (A) Map of the wild-type (WT) and AQP1-transformed plastid (pt) genomes. The transgenes were targeted to the intergenic region between trnI and trnA. The selectable marker gene aadA (encoding aminoglycoside 3ʹ-adenylyltransferase) was driven by the 16S ribosomal RNA operon promoter (Prrn). AQP1 was driven by the psbA promoter and 5ʹ-untranslated region (PpsbA). Arrows within boxes show the direction of transcription. Numbers below each ptDNA indicate the predicted size of hybridizing fragments when total DNA was digested with BamHI. A 0.8 kb fragment of the targeting region for homologous recombination was used as a probe (P1) for Southern blot analysis. TpsbA, 3ʹ-untranslated region of the psbA gene. (B) Southern blot analysis of two independent lines (1 and 2) for each transformation cassette. blots, analysing both monomeric and multimeric signals. The and the purity of the fractions were assessed using specific anti- expression level of AQP1 protein in the AQP1 and TicAQP1 bodies: anti-ADP-glucose pyrophosphorylase (AGPase) for the plants was approximately 10-fold and 16-fold greater, respect- stroma (ap Rees, 1995), anti-Tic40 for the envelope, and anti- ively, than in the WT plants. LHC chlorophyll a/b binding protein 1 (Lhcb1) for the thyla- As expected, analysis of purified plasma membranes by koid membrane (Farmaki et al., 2007). AQP1 was detected in immunoblotting indicated that the AQP1 protein levels in the the envelope and thylakoid membrane fractions but no signal WT and transplastomic plants were similar (Fig. 2C), confirm- was seen for the stroma soluble fraction (Fig. 3). As expected, a ing that the AQP1 protein synthesized in the chloroplast was stronger signal was detected in the AQP1 and TicAQP1 trans- not exported out of the chloroplast. plastomic plants than in the WT plants. Monomeric and oli- gomeric forms were detected in the envelope and thylakoid fractions of both types of transplastomic plants. The AQP1 NtAQP1 was mainly localized to the chloroplast signal was most intense in the envelope fraction; note that envelope 10-fold more thylakoid fraction protein was loaded to enable The distribution of AQP1 in the chloroplast of the AQP1 and the detection of AQP1. Monomers and dimers were present TicAQP1 transplastomic plants was examined by chloroplast mainly in the envelope fraction, with faint signals detected in purification and suborganellar fractionation followed by immu- the thylakoid fraction. Trimers and tetramers were detected noblotting (Fig. 3). The equal loading of gels for each fraction in the envelope fraction but not in the thylakoid fraction. Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 3666 | Fernández-San Millán et al. in the thylakoid and envelope membranes of these plants rela- tive to AQP1 transplastomic plants (Fig. 3). Photosynthetic performance and protein and starch metabolism were impaired by chloroplast NtAQP1 overexpression The transplastomic plants, particularly TicAQP1 plants, showed retarded growth in comparison to the WT plants during the first 3 weeks following transplantation into pots, but thereafter they caught up and reached a similar height under standard growth conditions (data not shown). Net photosynthesis (A ) analyses showed both the AQP1 and the TicAQP1 plants to have lower CO fixation rates than the WT plants (Fig.  4A), with no differences between the transplastomic plants. As expected, no significant differences were observed between genotypes for leaf stomatal conduct- ance (g ) (Fig. 4D). In contrast, g was diminished by 50% in s m AQP1 and TicAQP1 plants relative to WT plants (Fig.  4E). A /C curve determinations highlighted that the Rubisco N i maximum carboxylation capacity (V ) and the maximum Cmax electron transport rate contributing to ribulose 1,5-bisphos- phate regeneration (J ) values measured in both transplas- max tomic plants were lower than those in WT plants (Fig. 4B, C). Gas exchange analyses also showed that the transplastomic plants had a higher C value (Fig. 5A), while no significant dif- ferences in C were detected (Fig. 5B). The C /C ratio was not c c i altered in the transplastomic plants relative to the WT plants (Fig.  5C). In contrast, compared with the WT plants, AQP1 and TicAQP1 plants showed higher CO discrimination (Δ) values (Fig. 4F). Transplastomic plants had lower soluble pro- tein levels than their WT counterparts (Table  1). Moreover, the Rubisco levels were strongly reduced in the AQP1 and TicAQP1 plants (reductions of 23% and 41%, respectively). A  4-fold reduction in the leaf starch content, and reduced chlorophyll levels, were detected in the transplastomic plants relative to the WT plants (Table 1). In addition, the leaf mass Fig. 2. Analysis of AQP1 expression in wild-type (WT) and AQP1 and area was reduced in the transplastomic plants (12.5% in AQP1 TicAQP1 transplastomic plants. (A) Northern blot analysis of leaf samples. and 15.9% in TicAQP1 plants). The expected transcript sizes of the mono- and dicistrons originating from The ultrastructure of the mesophyll cell chloroplasts was different promoters are indicated below the map of the transformed plastid analysed by transmission electron microscopy. Major differ- genome. The 515 bp AQP1 sequence (P2) was used as a probe. A 10 μg aliquot of total RNA was loaded per well. Ethidium bromide-stained rRNA ences were observed between the WT and transplastomic was used to assess loading. (B) Western blot analysis of total protein from plants (Fig.  6). The WT plants showed the normal architec- leaf samples (two independent lines for each construction). The lower ture of the thylakoid network, arranged in grana and lamel- panel was overexposed to show the 30 kDa AQP1 monomer, which was lae (Fig.  6A), while the AQP1 and TicAQP1 plants showed not detected in the upper panel. A 30 μg aliquot of protein was loaded abnormal granal stacking with a reduced number of appressed per well. (C) Western blot analysis of proteins extracted from the plasma membrane. A 3 μg aliquot of protein was loaded per well. The positions thylakoids (Fig.  6B, C). In comparison to the normal granal and sizes of molecular weight protein standards are indicated. The blots in structure of the WT plants (Fig. 6D), the transplastomic plants B and C were detected using anti-NtAQP1 as the primary antibody. (especially the TicAQP1 plants) also showed defective grana and swelling of the thylakoid lumen (Fig.  6E, F). Large pro- A higher proportion of high molecular weight aggregates was tein aggregates detected by western blot (Figs 2B and 3), par- observed in the thylakoid fraction of TicAPQ1 plants relative ticularly in TicAQP1 plants, could have affected the thylakoid to the envelope fraction. Immunoblotting could not provide membrane integrity, resulting in abnormal thylakoid architec- an accurate estimate of the relative distribution of NtAQP1 ture. No differences were observed in the envelope membranes in each membrane fraction owing to the disproportion- (Fig. 6G–I). ate method by which each membrane fraction was purified. The integrity of the thylakoid membranes was assessed by However, the higher NtAQP1 expression level in TicAQP1 treating isolated chloroplasts with SDS, a product commonly transplastomic plants correlated with the higher AQP1 content used in cell permeation assays in bacteria (Griffith and Wolf, Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 Performance of transplastomic tobacco overexpressing NtAQP1 | 3667 Fig. 3. Localization of AQP1 in the thylakoid and envelope membranes. Envelope, thylakoid, and stroma fractions were isolated from wild-type (WT), AQP1, and TicAQP1 leaves, and separated by SDS-PAGE. Samples of 2, 20, and 30 μg of protein from the envelope, thylakoid, and stroma, respectively, were loaded per well. Representative western blots performed with antibodies to AQP1, the inner-membrane Tic40 protein, the thylakoid membrane-specific LHC chlorophyll a/b binding protein 1 (Lhcb1), and the stroma-specific ADP-glucose pyrophosphorylase (AGPase) are shown. Asterisks indicate the positions of monomer (*), dimer (**), trimer (***), and tetramer (****) AQP1. 2002). For the chloroplasts of the AQP1 and especially the IEM targeting (Li and Schnell, 2006). Both constructs resulted TicAQP1 plants, total chlorophyll solubilization was obtained in the incorporation of AQP1 in the chloroplast envelope and with lower SDS concentrations than those required to achieve the thylakoid membranes. This result shows that the topology- the same effect with WT plant chloroplasts (Supplementary determining sequence information within NtAQP1 is suffi- Fig. S2A, C). The same pattern was observed for the solubil- cient for its integration into the envelope membranes from ization of AQP1 and the thylakoid membrane Lhcb1 proteins, the stroma (Fig. 3). Chloroplast IEM proteins that follow the but not for the stromal AGPase or thylakoid-lumen-associated post-import pathway are first imported from the cytoplasm TL29 proteins (Supplementary Fig. S2B). into the chloroplast stroma in the form of a soluble, processed, intermediate product, and subsequently reinserted from the stroma into the IEM. NtAQP1 expressed from the plastid gen- Discussion ome could putatively use the second part of this pathway from the stroma to the IEM. It has been shown that conserved pro- Targeting of recombinant AQP1 to chloroplast line residues in the N-terminal region of IEM proteins such membranes as Tic40 and Tic110 are required for stromal reinsertion (Chiu The present study shows that NtAQP1 can be overexpressed and Li, 2008). The six proline residues present at positions 21, from the plastid genome and that it localizes to the chloro- 35, 36, 37, 39, and 43 of NtAQP1 suggest that it uses a com- plast membranes. Native NtAQP1 localizes to both the plasma mon import mechanism from the stroma. membrane and the chloroplast IEM. No transit peptide for its Native IEM proteins utilize two different pathways for their chloroplast targeting has been identified, and the sorting mech- targeting. It is unknown whether the native AQP1, with six anisms responsible for this dual localization are unknown (Luu membrane-spanning alpha helices, uses the post-import path- and Maurel, 2013). The expression of NtAQP1 from the plastid way or the stop-transfer pathway. Very little is known about genome results in the AQP1 polypeptide being synthesized in the insertion of polytopic IEM proteins. For instance, the the stroma and not in the cytosol as in WT plants, condition- Cor413im1 membrane protein, with five or six transmembrane ing its subsequent import pathway to the IEM. Hence, in add- domains, is incorporated in the IEM via the stop-transfer path- ition to the AQP1 coding sequence, and given the uncertainty way (Okawa et  al., 2014), while Tic110, which has six trans- that the recombinant AQP1 from the chloroplast stroma would membrane domains, utilizes the post-import pathway (Lübeck reach its target location correctly, a second construct with the et al., 1997; Li and Schnell, 2006). If native and plastidial AQP1 transit peptide of the IEM Tic40 protein fused to AQP1 was use different import pathways, this could result in an improper prepared for plastid transformation. Tic40 is an integral IEM location within the IEM that negatively affects its functional- protein involved in protein translocation across this membrane ity. Tic40, a component of the TIC complex, is involved in (Chou et  al., 2003) that follows the post-import pathway for the reinsertion process for proteins that use the post-import Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 3668 | Fernández-San Millán et al. Fig. 4. (A) Net photosynthesis, (A ), (B) maximum carboxylation velocity of Rubisco (V ), (C) maximum electron transport rate contributing to ribulose N Cmax 1,5-bisphosphate regeneration (J ), (D) stomatal conductance (g ), (E) mesophyll conductance (g ), and (F) C isotope discrimination (Δ) of wild-type max s m (WT) and AQP1 and TicAQP1 transplastomic plants. Representative data from two independent experiments are presented. Values are means ±SE (n=7). Different letters indicate significantly different values (ANOVA, P<0.05). Fig. 5. (A) Intercellular CO concentration (C ), (B) chloroplast CO concentration (C ), (C) and C /C ratio of wild-type (WT) and AQP1 and TicAQP1 2 i 2 c c i transplastomic plants. Representative data from two independent experiments are presented. Values are means ±SE (n=7). Different letters indicate statistically different values (ANOVA, P<0.05). pathway (Chiu and Li, 2008). It could be expected that the TIC complex. It remains to be elucidated whether the IEM recombinant TicAQP1 protein, which includes the Tic40 tran- import pathways of recombinant TicAQP1 and AQP1 pro- sit peptide, is inserted close to and potentially interacts with the teins are the same, but the physiological performance of both Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 Performance of transplastomic tobacco overexpressing NtAQP1 | 3669 transplastomic plants was similar. The putative drawback related plasma and thylakoid membranes, allowing protein trafficking to IEM import seems to be equivalent in both transplastomic in short-lived connection assemblies, has been proposed for the plants, irrespective of the presence of the Tic40 transit peptide. cyanobacterium Synechocystis (Pisareva et al., 2011). In addition, However, integration of NtAQP1 into the thylakoid mem- functional thylakoid membranes were developed in association branes was unexpected, and the mechanism of protein sorting with the chloroplast envelope in Chlamydomonas under certain remains unknown. Plastid transformation has also allowed the conditions (Hoober et  al., 1991). These and other investiga- successful integration of other foreign proteins, with or without tions have suggested a role of the IEM for thylakoid biogenesis signal peptides, to the thylakoid membranes (Henig et al., 2007; in vascular plants (Celedon and Cline, 2013). This mechanism De Marchis et  al., 2011; Ahmad et  al., 2012; Shanmugabalaji might tentatively explain the dual targeting of recombinant et al., 2013; Scotti et al., 2015), indicating that different import AQP1 to the envelope and thylakoid membranes. mechanisms might be used. The expression of the Synechococcus BicA bicarbonate transporter in tobacco plastids unexpectedly Physiological performance of transplastomic plants resulted in dual targeting of the protein to the thylakoid mem- branes and, in a smaller proportion, to the chloroplast enve- The present study sought to determine whether CO trans- lope (Pengelly et al., 2014). A model for contact zones between port to the chloroplast could be boosted by increasing the amount of AQP1 in the chloroplast membranes. Much higher Table 1. Biochemical variables measured in young leaves from AQP1 protein levels (up to 16-fold higher than in the WT) wild-type (WT) and transplastomic plants grown in a growth were obtained in this study than in another study using chamber nuclear transformation, in which double the levels in WT were obtained (Flexas et al., 2006); this difference was probably due WT AQ1 TicAQP1 to the plastid transformation method. Despite the integration −1 a b b Starch (μmol Glu g FW ) 21.7 ± 2.9 5.5 ± 0.2 5.7 ± 0.4 of AQP1 into the chloroplast envelope membranes, the trans- −1 a ab b Soluble protein (mg g FW ) 16.1 ± 0.7 13.3 ± 1.0 12.3 ± 0.4 plastomic plants overexpressing NtAQP1 showed lower photo- −1 a a a Insoluble protein (mg g FW ) 13.0 ± 1.7 10.5 ± 1.3 10.2 ± 2.4 synthetic rates than the WT plants. Associated with the low a b c Rubisco (% relative to WT) 100 ± 3.4 76.7 ± 3.9 58.8 ± 5.4 a b c values of A , transplastomic plants showed both a reduction Chlorophyll content (SPAD) 42.9 ± 1.0 34.2 ± 0.9 30.0 ± 0.6 in CO diffusion capacity (associated with g but not g ) and 2 m s Values are means±SE (n=5–7). a lower photosynthetic capacity (V and J ). Because the Cmax max Different superscript letters denote significant differences (ANOVA, different lines differed in their C , and g responds to C (Flexas i m i P<0.05). et al., 2007a), the observed differences in g could be attribut- The chlorophyll content was measured using a Minolta SPAD 502 chlorophyll meter. able to differences in C . However, g /C ratios (obtained from i m i Fig. 6. Changes in chloroplast ultrastructure due to AQP1 overexpression from the plastid genome. Transmission electron microscopic images of chloroplasts from (A) wild-type (WT), (B) AQP1, and (C) TicAQP1 plants. (D–F) Detail of the thylakoids from (D) WT, (E) AQP1, and (F) TicAQP1 plants. (G–I) Detail of the chloroplast envelope (delineated by two arrowheads) in (G) WT, (H) AQP1, and (I) TicAQP1 plants. C, cytosol; s, starch granule; st, stroma; v, vacuole. Scale bar=1 μm. Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 3670 | Fernández-San Millán et al. –3 data shown in Figs  4E and 5A) were 0.3 × 10 for the two Evidence that reduced V and J are the true factors Cmax max –3 transplastomic lines, compared with ~0.7 × 10 for the WT, responsible for decreased A in the two transplastomic lines suggesting that g is reduced in the transplastomic lines regard- arises from reverse photosynthesis modelling and from car- less of their C . Considering that between 200 and 400 μmol bon isotope discrimination. Using reverse modelling, it is −1 CO mol air g decreases at an approximate rate of 0.1% per possible to estimate how large C and g should be for the 2 m c m −1 μmol CO mol air (shown for different species, including transplastomic lines to reach WT A if their V and J 2 N Cmax max tobacco, by Flexas et al., 2008), if WT plants had had the same is reduced. It turns out from this simulation that C should −1 C as the transplastomic plants, their g would have decreased increase from the estimated ~230 μmol mol to ~330 μmol i m −1 by ~5%, that is, it would have still been significantly higher. mol , which would require g values of 8.8 and 4.3  μmol −2 −1 The realized photosynthesis achieved by a plant can be CO m s for AQP1 and TicAQP1, respectively; these are manipulated by two means (Gago et al., 2014; Flexas et al., unrealistically large values, far out of the range of estimates 2016): either by modifying the photosynthetic capacity of for any plant species (Flexas et al., 2012). On the other hand, the plant (i.e. changing the rate of photosynthesis for a given stable isotopes, such as δ C, have been proposed as indica- substrate availability) or by chang ing the diffusion capacity of tors of stomatal opening and CO diffusion (Farquhar et al., the leaf (which, in tur n, will modify the quantity of substrate 1989; Araus et  al., 2003). Changes in Δ have been linked available for photosynthesis). In this study, increasing AQP1 to changes in CO availability and/or Rubisco carboxyla- expression dramatically decreased the photosynthesis of the tion activity (Farquhar et  al. 1989; Brugnoli and Farquhar, transplastomic plants. The reduced A was an unexpected 2000; Ghashghaie et al., 2003). The fact that CO supply was N 2 result, especially given the role of AQP1 in CO diffusion, as reduced in transplastomic plants due to the reduction of g , 2 m descr ibed in tobacco (Uehlein et al., 2003; Flexas et al., 2006) but Δ was still larger in these plants than in WT plants, sug- and in other species (Hanba et  al., 2004; Sade et  al., 2010). gests a reduction of carboxylase activity relative to CO sup- In a previous study, Flexas et  al. (2006) showed that, com- ply around Rubisco. pared with the corresponding WT plants, photosynthetic The localization of AQP1 to the thylakoid membranes rates were lower in NtAQP1-deficient plants and higher in might negatively affect their functionality, perhaps via inter- NtAQP1-overexpressing plants, suggesting that variations action with proteins of the photosynthetic apparatus that in the photosynthetic rate were certainly linked to changes affects the protein dynamics within the thylakoid, with in C (Flexas et  al., 2006). In the present study, the higher a consequent impact on photosynthetic capacity. Indeed, C detected in the transplastomic (compared with the WT) the reduced membrane resistance to SDS (Supplementary plants indicates that stomatal opening was not involved in Fig. S2) suggests that the thylakoid membrane was damaged the lower A of the AQP1 and TicAQP1 plants. Indeed, the in some way, possibly related to the presence of recombinant same stomatal conductance in the three genotypes, along AQP1. It has been reported that targeting foreign membrane with a clearly lower CO fixation by the photosynthetic proteins to thylakoid membranes by chloroplast transforma- machinery in the transplastomic plants, might be related to tion causes mutant phenotypes with reduced growth and the higher C in AQP1 and TicAQP1 plants. Following from photosynthetic capacity, altered thylakoid ultrastructure, and this observation, it could be tentatively concluded that the impairment of the integrity of the photosystems (Henig et al., lower A in the transplastomic plants was caused by their 2007; Gnanasekaran et  al., 2016). A  similar response could lower g (by ~50%) compared with the WT plants, since g be produced by the recombinant AQP1 located in the thy- m m is now recognized to play a major role in CO diffusion into lakoid membranes, particularly considering the presence of the chloroplast (Flexas et al., 2006; Flexas et al., 2007b; Scafaro large protein aggregates (Fig. 3). However, despite the higher et  al., 2011; Kaldenhoff, 2012; Evans and von Caemmerer, content of recombinant AQP1 in the thylakoid membranes 2013; Flexas et  al., 2013). Nevertheless, the hypothesis on of TicAQP1 plants, the photosynthetic parameters were simi- limited diffusion (reduced g ) in AQP1 and TicAQP1 plants lar in both AQP1 and TicAQP1 plants (Fig.  4). Perhaps a cannot explain alone their lower photosynthetic rates. In threshold of chloroplast damage was reached in the AQP1 fact, C was not different between WT and transplastomic plants and the greater content of the recombinant protein in plants, and nor was the C /C ratio, despite very different TicAQP1 plants was inconsequential. Another possibility is c i rates of photosynthesis (Figs  4 and 5). Although g was not that other processes, in addition to the functionality of the affected by the overexpression of AQP1 in transplastomic thylakoids, might be involved in the photosynthetic impair- plants, the overall CO supply was reduced as a consequence ment of these plants. of the reduction of g . However, because the CO demand m 2 was also reduced due to impaired V and J , the overall Cmax max Other factors affecting recombinant AQP1 functionality result was a relatively higher C in the transplastomic plants compared with WT plants; the difference was more evident The gas exchange data highlight the fact that, in contrast to according to the Δ measurements (Fig.  4F) than according what was expected, NtAQP1 overexpression from the chloro- to chlorophyll fluorescence-based estimates (Fig. 5B). If C plast genome constrains CO diffusion from the substomatal c 2 (i.e. the substrate for photosynthesis) was the same between cavity to the chloroplast. An explanation for this harmful effect the WT, AQP1, and TicAQP1 plants, then differences in A is not easy to provide, but other factors, in addition to the were more likely related to differences in photosynthetic above-mentioned factors related to the import pathway and capacity. thylakoid targeting, could be involved. Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 Performance of transplastomic tobacco overexpressing NtAQP1 | 3671 The regulation of the function of AQP proteins depends Acknowledgements on several processes, including post-translational modifications The authors thank Ralf Kaldenhoff (Dar mstadt University of Technology, and protein interactions, that affect both their activity and their Germany) for providing the NtAQP1 antibody and Iván Jáuregui for subcellular localization (Hove and Bhave, 2011; Chaumont and technical assistance. MA is a recipient of a Formación de Profesorado Universitario fellowship from the Ministerio de Educación, Cultura y Tyerman, 2014; Verdoucq et al., 2014). It is possible that differ- Deporte, Spain. MN was supported by a predoctoral fellowship BES- ences between the stromal and cytosolic environments pre- 2015-072578 from the Ministerio de Economía y Competitividad vent the required AQP post-translational modifications and/or (MINECO), Spain, co-financed by the European Science Foundation. interactions in the stroma. Another important aspect to be considered is that AQPs assemble as homo- and/or heterotetramers in the membranes. References The AQP monomer is the functional unit for water trans- Aharon R, Shahak Y, Wininger S, Bendov R, Kapulnik Y, Galili G. port, but the tetramer and its composition may be important 2003. Overexpression of a plasma membrane aquaporin in transgenic tobacco improves plant vigor under favorable growth conditions but not for CO -related transport. Further, in tobacco, CO diffu- 2 2 under drought or salt stress. The Plant Cell 15, 439–447. sion is greater when tetramers consist only of NtAQP1 from Ahmad N, Michoux F, McCarthy J, Nixon PJ. 2012. Expression of the the PIP1 family (Otto et al., 2010), and different proportions affinity tags, glutathione-S-transferase and maltose-binding protein, in of PIP1 and PIP2 subunits in the tetramer may promote tobacco chloroplasts. Planta 235, 863–871. either water or CO transfer, or both (Flexas et al., 2012). If 2 ap Rees T. 1995. Where do plants make ADP-Glc? In: Pontis HG, Salerno G, Echeverría E, eds. Sucrose metabolism, biochemistry, physiology and improper AQP1 monomers (due to incorrect post-transla- molecular biology. Rockville: American Society of Plant Physiologists, tional modifications) synthesized in the chloroplast stroma 143–155. interact with normal WT AQP1 synthesized in the cytosol, Araus JL, Villegas D, Aparicio N, del Moral L, Hani El S, Rharrabti non-functional or partially functional homotetramers might Y, Ferrio JP, Royo C. 2003. Environmental factors determining carbon isotope discrimination and yield in durum wheat under Mediterranean find their way to the IEM. It must be noted that unusual conditions. Crop Science 43, 170–180. oligomeric and possible non-specific protein aggregates Bernacchi CJ, Portis AR, Nakano H, von Caemmerer S, Long SP. were detected (Figs 2B and 3). Given that the transplastomic 2002. Temperature response of mesophyll conductance. Implications plants in this study had 10–16 times the AQP1 content of for the determination of Rubisco enzyme kinetics and for limitations to photosynthesis in vivo. Plant Physiology 130, 1992–1998. the WT plants, defective homotetramers might have pre- Bock R. 2015. Engineering plastid genomes: methods, tools, and vailed over any homotetramers composed exclusively of WT applications in basic research and biotechnology. Annual Review of Plant AQP1 monomers, thus compromising AQP1-mediated CO Biology 66, 211–241. transport in the IEM. Brugnoli E, Farquhar GD. 2000. Photosynthetic fractionation of Finally, despite the engineered modification to AQP1 expres- carbon isotopes. In: Leegood RC, Sharkey TD, von Caemmerer S, eds. Photosynthesis: physiology and metabolism. Dordrecht: Kluwer Academic sion levels being able to alter g (suggesting a role for AQPs Publishers, 399–434. in CO transport), the molecular bases controlling g remain 2 m Celedon JM, Cline K. 2013. Intra-plastid protein trafficking: how plant cells unclear and are affected by components such as the cell walls, adapted prokaryotic mechanisms to the eukaryotic condition. Biochimica et plasma and chloroplastic membranes, and carbonic anhydrases. Biophysica Acta 1833, 341–351. Thus, other regulatory mechanisms that control g might be m Chaumont F, Tyerman SD. 2014. Aquaporins: highly regulated channels controlling plant water relations. Plant Physiology 164, 1600–1618. unmasked in plants with altered levels of AQPs (Verdoucq Chiu CC, Li HM. 2008. Tic40 is important for reinsertion of proteins from et al., 2014), such as those analysed in the present study. the chloroplast stroma into the inner membrane. The Plant Journal 56, In conclusion, in an attempt to increase CO diffusion across 793–801. the chloroplast membranes we engineered tobacco plants with Chou ML, Fitzpatrick LM, Tu SL, Budziszewski G, Potter-Lewis substantially increased levels of the CO -permeable NtAQP1 2 S, Akita M, Levin JZ, Keegstra K, Li HM. 2003. Tic40, a membrane- anchored co-chaperone homolog in the chloroplast protein translocon. The protein within the chloroplast membranes. However, there EMBO Journal 22, 2970–2980. was no improvement in intracellular CO transfer capacity in Daniell H. 1997. Transformation and foreign gene expression in plants by the transplastomic plants. In fact, we observed impairment in microprojectile bombardment. Methods in Molecular Biology 62, 463–489. photosynthetic capacity, which could be partially attributed De Marchis F, Pompa A, Mannucci R, Morosinotto T, Bellucci M. 2011. to changes in the thylakoid ultrastructure, and reductions in A plant secretory signal peptide targets plastome-encoded recombinant proteins to the thylakoid membrane. Plant Molecular Biology 76, 427–441. V and J , which were the main limiting factors. This Cmax max Edgerton MD. 2009. Increasing crop productivity to meet global needs for study serves to highlight obstacles that need to be overcome in feed, food, and fuel. Plant Physiology 149, 7–13. work towards engineering improved CO transfer capacity for Evans JR, von Caemmerer S. 2013. Temperature response of carbon enhanced photosynthesis. isotope discrimination and mesophyll conductance in tobacco. Plant, Cell & Environment 36, 745–756. Farmaki T, Sanmartín M, Jiménez P, Paneque M, Sanz C, Vancanneyt Supplementary data G, León J, Sánchez-Serrano JJ. 2007. Differential distribution of the lipoxygenase pathway enzymes within potato chloroplasts. Journal of Supplementary data are available at JXB online. Experimental Botany 58, 555–568. Fig. S1. Relationship between ΦPSII versus ΦCO used to Farquhar GD, Ehleringer JR, Hubick KT. 1989. Carbon isotope discrimination and photosynthesis. Annual Review of Plant Physiology and correct ETR. Plant Molecular Biology 40, 503–537. Fig.  S2. Membrane disruption of chloroplasts from wild- Fernández-San Millán A, Ortigosa SM, Hervás-Stubbs S, Corral- type (WT), AQP1, and TicAQP1 plants with increasing con- Martínez P, Seguí-Simarro JM, Gaétan J, Coursaget P, Veramendi J. centrations of SDS. 2008. Human papillomavirus L1 protein expressed in tobacco chloroplasts Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 3672 | Fernández-San Millán et al. self-assembles into virus-like particles that are highly immunogenic. Plant Hoober JK, Boyd CO, Paavola LG. 1991. Origin of thylakoid membranes Biotechnology Journal 6, 427–441. in Chlamydomonas reinhardtii y-1 at 38°C. Plant Physiology 96, 1321–1328. Ferro M, Salvi D, Riviere-Rolland H, Vermat T, Seigneurin-Berny D, Hove RM, Bhave M. 2011. Plant aquaporins with non-aqua functions: Grunwald D, Garin J, Joyard J, Rolland N. 2002. Integral membrane deciphering the signature sequences. Plant Molecular Biology 75, 413–430. proteins of the chloroplast envelope: identification and subcellular Kaldenhoff R. 2012. Mechanisms underlying CO diffusion in leaves. localization of new transporters. Proceedings of the National Academy of Current Opinion in Plant Biology 15, 276–281. Sciences, USA 99, 11487–11492. Kaldenhoff R, Kai L, Uehlein N. 2014. Aquaporins and membrane Flexas J, Barbour MM, Brendel O, et  al. 2012. Mesophyll diffusion diffusion of CO in living organisms. Biochimica et Biophysica Acta 1840, conductance to CO : an unappreciated central player in photosynthesis. 1592–1595. Plant Science 193-194, 70–84. Li M, Schnell DJ. 2006. Reconstitution of protein targeting to the inner Flexas J, Díaz-Espejo A, Berry JA, Cifre J, Galmés J, Kaldenhoff R, envelope membrane of chloroplasts. The Journal of Cell Biology 175, Medrano H, Ribas-Carbó M. 2007b. Analysis of leakage in IRGA’s leaf 249–259. chambers of open gas exchange systems: quantification and its effects Long SP, Ainsworth EA, Leakey AD, Nösberger J, Ort DR. 2006. Food in photosynthesis parameterization. Journal of Experimental Botany 58, for thought: lower-than-expected crop yield stimulation with rising CO 1533–1543. concentrations. Science 312, 1918–1921. Flexas J, Díaz-Espejo A, Conesa MA, et  al. 2016. Mesophyll Loreto F, Tsonev T, Centritto M. 2009. The impact of blue light on leaf conductance to CO and Rubisco as targets for improving intrinsic water mesophyll conductance. Journal of Experimental Botany 60, 2283–2290. use efficiency in C3 plants. Plant, Cell & Environment 39, 965–982. Loriaux SD, Avenson TJ, Welles JM, McDermitt DK, Eckles RD, Flexas J, Diaz-Espejo A, Galmés J, Kaldenhoff R, Medrano H, Ribas- Riensche B, Genty B. 2013. Closing in on maximum yield of chlorophyll Carbo M. 2007a. Rapid variations of mesophyll conductance in response fluorescence using a single multiphase flash of sub-saturating intensity. to changes in CO concentration around leaves. Plant, Cell & Environment Plant, Cell & Environment 36, 1755–1770. 30, 1284–1298. Luu DT, Maurel C. 2013. Aquaporin trafficking in plant cells: an emerging Flexas J, Niinemets U, Gallé A, et al. 2013. Diffusional conductances to membrane-protein model. Traffic 14, 629–635. CO as a target for increasing photosynthesis and photosynthetic water-use efficiency. Photosynthesis Research 117, 45–59. Lübeck J, Heins L, Soll J. 1997. A nuclear-coded chloroplastic inner envelope membrane protein uses a soluble sorting intermediate upon Flexas J, Ribas-Carbó M, Diaz-Espejo A, Galmés J, Medrano H. 2008. import into the organelle. The Journal of Cell Biology 137, 1279–1286. Mesophyll conductance to CO : current knowledge and future prospects. Plant, Cell & Environment 31, 602–621. Martins SC, Galmés J, Molins A, DaMatta FM. 2013. Improving the estimation of mesophyll conductance to CO : on the role of electron Flexas J, Ribas-Carbó M, Hanson DT, Bota J, Otto B, Cifre J, transport rate correction and respiration. Journal of Experimental Botany McDowell N, Medrano H, Kaldenhoff R. 2006. Tobacco aquaporin 64, 3285–3298. NtAQP1 is involved in mesophyll conductance to CO in vivo. The Plant Journal 48, 427–439. Maurel C, Reizer J, Schroeder JI, Chrispeels MJ. 1993. The vacuolar membrane protein gamma-TIP creates water specific channels in Xenopus Gago J, Douthe C, Florez-Sarasa I, Escalona JM, Galmes J, Fernie oocytes. The EMBO Journal 12, 2241–2247. AR, Flexas J, Medrano H. 2014. Opportunities for improving leaf water use efficiency under climate change conditions. Plant Science 226, 108–119. Maurel C, Verdoucq L, Luu DT, Santoni V. 2008. Plant aquaporins: membrane channels with multiple integrated functions. Annual Review of Galmés J, Medrano H, Flexas J. 2007. Photosynthetic limitations in Plant Biology 59, 595–624. response to water stress and recovery in Mediterranean plants with different growth forms. New Phytologist 175, 81–93. Okawa K, Inoue H, Adachi F, Nakayama K, Ito-Inaba Y, Schnell DJ, Uehara S, Inaba T. 2014. Targeting of a polytopic membrane protein Ghashghaie J, Badeck FW, Lanigan G, Nogués S, Tcherkez G, to the inner envelope membrane of chloroplasts in vivo involves multiple Deléens E, Cornic G, Griffiths H. 2003. Carbon isotope fractionation transmembrane segments. Journal of Experimental Botany 65, 5257–5265. during dark respiration and photorespiration in C3 plants. Phytochemistry Reviews 2, 145–161. Otto B, Uehlein N, Sdorra S, et al. 2010. Aquaporin tetramer composition modifies the function of tobacco aquaporins. The Journal of Biological Gnanasekaran T, Karcher D, Nielsen AZ, et al. 2016. Transfer of the Chemistry 285, 31253–31260. cytochrome P450-dependent dhurrin pathway from Sorghum bicolor into Nicotiana tabacum chloroplasts for light-driven synthesis. Journal of Parry MA, Andralojc PJ, Scales JC, Salvucci ME, Carmo-Silva AE, Experimental Botany 67, 2495–2506. Alonso H, Whitney SM. 2013. Rubisco activity and regulation as targets for crop improvement. Journal of Experimental Botany 64, 717–730. Gomes D, Agasse A, Thiébaud P, Delrot S, Gerós H, Chaumont F. 2009. Aquaporins are multifunctional water and solute transporters Parry MA, Reynolds M, Salvucci ME, Raines C, Andralojc PJ, Zhu highly divergent in living organisms. Biochimica et Biophysica Acta 1788, XG, Price GD, Condon AG, Furbank RT. 2011. Raising yield potential 1213–1228. of wheat. II. Increasing photosynthetic capacity and efficiency. Journal of Experimental Botany 62, 453–467. Griffith KL, Wolf RE Jr. 2002. Measuring β-galactosidase activity in bacteria: cell growth, permeabilization, and enzyme assays in 96-well arrays. Pengelly JJ, Förster B, von Caemmerer S, Badger MR, Price GD, Biochemical and Biophysical Research Communications 290, 397–402. Whitney SM. 2014. Transplastomic integration of a cyanobacterial bicarbonate transporter into tobacco chloroplasts. Journal of Experimental Groszmann M, Osborn HL, Evans JR. 2017. Carbon dioxide and Botany 65, 3071–3080. water transport through plant aquaporins. Plant, Cell & Environment 40, 938–961. Pisareva T, Kwon J, Oh J, Kim S, Ge C, Wieslander A, Choi JS, Norling B. 2011. Model for membrane organization and protein sorting in Hanba YT, Shibasaka M, Hayashi Y, Hayakawa T, Kasamo K, the cyanobacterium Synechocystis sp. PCC 6803 inferred from proteomics Terashima I, Katsuhara M. 2004. Overexpression of the barley aquaporin and multivariate sequence analyses. Journal of Proteome Research 10, HvPIP2;1 increases internal CO conductance and CO assimilation in the 2 2 3617–3631. leaves of transgenic rice plants. Plant & Cell Physiology 45, 521–529. Pons TL, Flexas J, von Caemmerer S, Evans JR, Genty B, Ribas- Harley PC, Loreto F, Di Marco G, Sharkey TD. 1992. Theoretical Carbo M, Brugnoli E. 2009. Estimating mesophyll conductance to considerations when estimating the mesophyll conductance to CO flux by CO : methodology, potential errors, and recommendations. Journal of analysis of the response of photosynthesis to CO . Plant Physiology 98, 2 Experimental Botany 60, 2217–2234. 1429–1436. Priestley DA, Woolhouse HW. 1980. The chloroplast envelope of Heckwolf M, Pater D, Hanson DT, Kaldenhoff R. 2011. The Arabidopsis Phaseolus vulgaris L .1. Isolation and compositional characteristics. Journal thaliana aquaporin AtPIP1;2 is a physiologically relevant CO transport of Experimental Botany 31, 437–447. facilitator. The Plant Journal 67, 795–804. Henig A, Bonfig K, Roitsch T, Warzecha H. 2007. Expression of the Reynolds M, Bonnett D, Chapman SC, Furbank RT, Manès Y, Mather recombinant bacterial outer surface protein A in tobacco chloroplasts leads DE, Parry MA. 2011. Raising yield potential of wheat. I.  Overview of a to thylakoid localization and loss of photosynthesis. The FEBS Journal 274, consortium approach and breeding strategies. Journal of Experimental 5749–5758. Botany 62, 439–452. Downloaded from https://academic.oup.com/jxb/article/69/15/3661/4975438 by DeepDyve user on 20 July 2022 Performance of transplastomic tobacco overexpressing NtAQP1 | 3673 Sade N, Gebretsadik M, Seligmann R, Schwartz A, Wallach R, protein to chloroplast plastoglobules and thylakoids in transplastomic Moshelion M. 2010. The role of tobacco Aquaporin1 in improving water tobacco plants. Plant Molecular Biology 81, 13–25. use efficiency, hydraulic conductivity, and yield production under salt stress. Uehlein N, Lovisolo C, Siefritz F, Kaldenhoff R. 2003. The tobacco Plant Physiology 152, 245–254. aquaporin NtAQP1 is a membrane CO pore with physiological functions. Santoni V. 2007. Plant plasma membrane protein extraction and solubilization Nature 425, 734–737. for proteomic analysis. Methods in Molecular Biology 355, 93–109. Uehlein N, Otto B, Hanson DT, Fischer M, McDowell N, Kaldenhoff R. Sanz-Barrio R, Corral-Martinez P, Ancin M, Segui-Simarro JM, 2008. Function of Nicotiana tabacum aquaporins as chloroplast gas pores Farran I. 2013. Overexpression of plastidial thioredoxin f leads to enhanced challenges the concept of membrane CO permeability. The Plant Cell 20, starch accumulation in tobacco leaves. Plant Biotechnology Journal 11, 648–657. 618–627. Valentini R, Epron D, De Angelis P, Matteucci G, Dreyer E. 1995. In Scafaro AP, von Caemmerer S, Evans JR, Atwell BJ. 2011. Temperature situ estimation of net CO assimilation, photosynthetic electron flow and response of mesophyll conductance in cultivated and wild Oryza species photorespiration in Turkey oak (Quercus cerris L.) leaves: diurnal cycles with contrasting mesophyll cell wall thickness. Plant, Cell & Environment under different levels of water supply. Plant Cell and Environment 18, 34, 1999–2008. 631–640. Scotti N, Sannino L, Idoine A, Hamman P, De Stradis A, Giorio P, Verdoucq L, Rodrigues O, Martinière A, Luu DT, Maurel C. 2014. Plant Maréchal-Drouard L, Bock R, Cardi T. 2015. The HIV-1 Pr55 gag aquaporins on the move: reversible phosphorylation, lateral motion and polyprotein binds to plastidial membranes and leads to severe impairment cycling. Current Opinion in Plant Biology 22, 101–107. of chloroplast biogenesis and seedling lethality in transplastomic tobacco Walker B, Ariza LS, Kaines S, Badger MR, Cousins AB. 2013. plants. Transgenic Research 24, 319–331. Temperature response of in vivo Rubisco kinetics and mesophyll Shanmugabalaji V, Besagni C, Piller LE, Douet V, Ruf S, Bock R, conductance in Arabidopsis thaliana: comparisons to Nicotiana tabacum. Kessler F. 2013. Dual targeting of a mature plastoglobulin/fibrillin fusion Plant, Cell & Environment 36, 2108–2119.

Journal

Journal of Experimental Botany – Oxford University Press

Published: Jun 27, 2018

There are no references for this article.