Phlebotomus halepensis (Diptera: Psychodidae) Vectorial Capacity in Afyon and Nigde Province, Turkey

Phlebotomus halepensis (Diptera: Psychodidae) Vectorial Capacity in Afyon and Nigde Province, Turkey Abstract Leishmaniasis is a one of the vector-borne diseases and has two clinical forms in Turkey: cutaneous and visceral. The aim of this study was to determine the sand fly fauna in Afyon and Nigde provinces where endemic foci of cutaneous leishmaniasis (CL) in Turkey. In Afyon, 2,259 sand flies were collected in 73 locations in August 2009 and August 2010, using CDC light traps. In total, eight Phlebotomus species were identified; Phlebotomus halepensis (47.41%), Phlebotomus papatasi (31.42%), Phlebotomus neglectus/syriacus (9.38%), Phlebotomus balcanicus (7.48%), Phlebotomus simici (2.12%), Phlebotomus perfiliewi (1.90%), Phlebotomus sergenti (0.08%), Phlebotomus similis (0.13%), and Sergentomyia dentata (0.04%). A total of 418 sand fly specimens were caught by CDC light traps in 40 stations in Nigde in September 2009 and September 2010. In total, seven Phlebotomus species were identified; P. halepensis (74.16%), P. simici (13.87%), P. papatasi (3.82%), P. neglectus/syriacus (2.87%), P. balcanicus (2.63%), P. sergenti (2.39%), and Phlebotomus tobbi (0.23%). Collected sand flies were examined by microscope, and no promastigotes were found in their midguts. We categorized and pooled female specimens (1,031 females, 73 pools of 2–33 individuals). Leishmania species-specific ITS1 real-time PCR assay was performed for detection and identification of parasites. We detected 6 of the 73 pools with Leishmania tropica (Ross, 1903), (Trypanosomatidae). In conclusion, P. halepensis was found to be dominant species in both areas. We are in opinion that our findings support P. halepensis vectorial role for L. tropica in nature and it could be responsible for the transmission of L. tropica in these endemic areas. sand fly, Leishmania, vector, fauna, cutaneous leishmaniasis Phlebotomine sand flies are the arthropod vectors of the Leishmania species and played an important role for the transmission of leishmaniasis in The Old World. Both types of leishmaniasis, visceral and cutaneous known as major public health problem in Turkey, and cause 30–40 and 2,000 cases every year, respectively. Leishmania infantum is responsible for both clinical forms occurring in the Aegean and Mediterranean regions and sporadically in other regions of Turkey while Leishmania tropica (Ross, 1903), (Trypanosomatidae) causes cutaneous leishmaniasis (CL) which is especially highly endemic in the southeastern, western, and eastern Mediterranean parts of Turkey (Ok et al. 2002, Yaman and Ozbel 2004). Svobodova et al. proved vectorial role of Phlebotomus tobbi microscopically in Osmaniye, Turkey and observed promastigotes of L. infantum in its midguts. Also, Phlebotomus sergenti and Phlebotomus similis are probable vectors of L. tropica in southeastern and western Turkey, respectively (Depaquit et al. 1998, Depaquit et al. 2002, WHO 2010). L. tropica can also be transmitted by Phlebotomus halepensis, which show high susceptibility to both leishmaniasis forms, supporting typical suprapylarian parasite development similar to the other vectors (Sadlova et al. 2003). Twenty-eight sand fly species (or subspecies recently raised to species level) belonging to the Phlebotomus and Sergentomyia genera have been described in Turkey, 18 of them known as proven or probable vectors of human leishmaniasis in The Old World (Houin 1971, Yaman and Ozbel 2004, WHO 2010). In this study, the aim was to determine sand fly fauna of two endemic areas for CL in Afyon and Nigde provinces located in the Aegean and Southeastern Anatolia Regions, respectively. In our study areas, a total of 51 (28 cases are in Afyon, 23 cases are in Nigde) CL cases were reported between 2006 and 2010 (Ministry of Health [MoH] 2015). Materials and Methods Study Area Our study was conducted in five villages in (Aydin, Yiprak, Kulak, Gocerli, and Doganli) Afyon and three villages (Eynelli, Feslegen, and Balci) in Nigde. Afyon province has a basin of 14570 km2 in area, and is located in the eastern part of Turkey (altitude 1034 m, latitude 38° 45′ 20.88″ N, longitude 30° 32′ 30.48″ E). Niğde province has a basin of 7795 km2 in area, and is located in Central Anatolia, Turkey (altitude 1218 m, latitude 37° 53′ 34.09″ N, longitude 34° 41′ 14.95″ E) (Fig. 1). Fig. 1. View largeDownload slide The locations of both provinces that the present study conducted. Fig. 1. View largeDownload slide The locations of both provinces that the present study conducted. Collection of the Data and Statistical Analyses The data for instant temperature and humidity was recorded using thermo-hygrometer in each location. A Global Positioning System (handheld) (Magellan Explorist 310) was used to record the coordinates (Table 1). Table 1. Geographical data of study area Villages  City  CL cases  Altitude (m)  Temperature max–min (°C)  Humidity max–min (%)  Coordinates  Aydin  Afyon  5  1242  30.43–22.73  55.6–27.05  38° 30′ 36.19″ N  30° 28′ 39.09″ E  Yiprak  Afyon  1  1329  27.1–17.6  51–24  38° 19′ 56.61″ N  30° 27′ 47.25″ E  Gocerli  Afyon  7  1237  31.33–22.34  62.11–25.66  38° 17′ 53.44″ N  30° 26′ 55.41″ E  Kulak  Afyon  2  1349  28.6–22.1  74.5–34.5  38° 23′ 04.55″ N  30° 35′ 23.22″ E  Doganli  Afyon  13  1136  28.87–22.32  56–26  38° 32′ 00.00″ N  30° 33′ 00.00″ E  Eynelli  Nigde  77  1674  33.68–24.43  47.4–24  37° 55′ 50.70″ N  35° 00′ 55.48″ E  Feslegen  Nigde  1  1692  30.63–24.35  47–26  37° 59′ 21.98″ N  34° 33′ 25.17″ E  Balci  Nigde  15  1545  30.36–24.26  46–30  37° 58′ 18.19″ N  34° 27′ 46.08″ E  Villages  City  CL cases  Altitude (m)  Temperature max–min (°C)  Humidity max–min (%)  Coordinates  Aydin  Afyon  5  1242  30.43–22.73  55.6–27.05  38° 30′ 36.19″ N  30° 28′ 39.09″ E  Yiprak  Afyon  1  1329  27.1–17.6  51–24  38° 19′ 56.61″ N  30° 27′ 47.25″ E  Gocerli  Afyon  7  1237  31.33–22.34  62.11–25.66  38° 17′ 53.44″ N  30° 26′ 55.41″ E  Kulak  Afyon  2  1349  28.6–22.1  74.5–34.5  38° 23′ 04.55″ N  30° 35′ 23.22″ E  Doganli  Afyon  13  1136  28.87–22.32  56–26  38° 32′ 00.00″ N  30° 33′ 00.00″ E  Eynelli  Nigde  77  1674  33.68–24.43  47.4–24  37° 55′ 50.70″ N  35° 00′ 55.48″ E  Feslegen  Nigde  1  1692  30.63–24.35  47–26  37° 59′ 21.98″ N  34° 33′ 25.17″ E  Balci  Nigde  15  1545  30.36–24.26  46–30  37° 58′ 18.19″ N  34° 27′ 46.08″ E  View Large Sand Fly Collection and Identification Sand fly specimens were collected from 113 locations (73 in Afyon and 40 in Nigde) using CDC light traps, in two different periods, August 2009 and September 2010. In each area, we set up the traps according to the number of CL patients recorded by MoH. During the collection period, traps were setup in animal (goat, cattle, sheep, or poultry) sheds near or under rooms in which an active or treated case of CL was living, and left for one night (Alten et al. 2015). The animal sheds and nearby houses are usually made of brick, mud, wood and/or stone. Specimens were kept in 96% alcohol for morphological identifications, which were based on the morphology of male genitalia and female spermatheca and pharynges using several written keys (Theodor 1958, Lewis 1982, Killick-Kendrick et al. 1990). The midguts of 116 females were examined by direct microscopy technique for the presence of promastigotes in both study areas. DNA Extraction From Sand Flies and ITS-1 PCR Zymo insect kit (Zymo Research Corp., Irvine, CA) was used for obtaining DNA from sand flies. In our study, for detection of Leishmania promastigote, we prepared 73 pools, which consisted of 2–33 individuals from 1,031 out of 1,089 female sand fly specimens to detect Leishmania promastigote. The real-time PCR method targeting ITS1 region specific for Leishmania species was performed using primers LITSR/L5.8S. Real-time PCR assay amplification was carried out in a reaction mixture containing 5 µl of extracted DNA, LITSR (5′CTGGATCATTTTCCGATG 3′), L5.8S (5′TGATACCACTTATCGCACTT 3′). Results Afyon Fauna Overall, 73 CDC light traps were placed in five villages. A total of 2,259 (1,356 male, 903 female) sand flies were collected and eight Phlebotomus species (47.41% P. halepensis, 31.42% Phlebotomus papatasi, 9.38% Phlebotomus neglectus/syriacus, 7.48% Phlebotomus balcanicus, 2.12% Phlebotomus simici, 1.90% Phlebotomus perfiliewi, 0.08% P. sergenti, 0.13% P. similis) and one Sergentomyia species (0.04% Sergentomyia dentata) were identified (Fig. 2). Among all study areas, in Afyon, P. halepensis appeared to be the most abundant species. P. papatasi and P. neglectus/syriacus were second and third dominant species in Afyon. In addition, the male/female rate was found to be 1.50 (Table 2). Fig. 2. View largeDownload slide Densities of the sand fly species in the study villages of Afyon and Nigde provinces. Fig. 2. View largeDownload slide Densities of the sand fly species in the study villages of Afyon and Nigde provinces. Table 2. The results of the sand fly collection in Afyon and Nigde province, 2009–2010 Taxon  Subgenus  Species  AFYON  NIGDE  Aydin  Kulak  Yiprak  Gocerli  Doganli  ♂  ♀  ♂/♀  Total (%)  Eynelli  Feslegen  Balci  ♂  ♀  ♂/♀  Total (%)  Phlebotomus  Adlerius  P. halepensis  352  13  5  231  470  749  322  2.32  1071 (41.41)  165  78  67  189  121  0.64  310 (74.16)  P. balcanicus  140  1  —  14  14  97  72  1.34  169 (7.48)  7  2  2  0  11  0  11 (2.63)  P. simici  5  —  —  5  38  12  15  1.25  27 (1.78)  29  7  22  21  37  1.76  58 (13.90)  Phlebotomus  P. papatasi  69  —  —  178  463  377  333  1.13  710 (31.42)  1  11  4  9  7  0.78  16 (3.83)  Larroussius  P. neglectus/syriacus  118  6  —  29  59  110  102  1.07  212 (9.38)  7  2  3  2  10  2  12 (2.87)  P. perfiliewi  7  —  —  4  32  7  36  0.19  43 (1.90)  —  —  —  —  —  —  —  P. tobbi  —  —  —  —  —  —  —  —  —  1  —  —  1  —  0  1 (0.23)  Paraphlebotomus  P. sergenti  —  —  —  —  2  2  0  —  2 (0.08)  —  2  8  10  —  0  10 (2.39)  P. similis  1  —  —  —  2  1  2  0.5  3 (0.13)  —  —  —  —  —  —  —  Sergentomyia  Sergentomyia  Sergentomyia dentata  —  —  —  —  1  0  1  0  1 (0.04)  —  —  —  —  —  —  —  All  692  20  5  461  1,081  1,356  903  1.50  2,259 (100)  210  102  106  232  186  1.24  418 (100)  Taxon  Subgenus  Species  AFYON  NIGDE  Aydin  Kulak  Yiprak  Gocerli  Doganli  ♂  ♀  ♂/♀  Total (%)  Eynelli  Feslegen  Balci  ♂  ♀  ♂/♀  Total (%)  Phlebotomus  Adlerius  P. halepensis  352  13  5  231  470  749  322  2.32  1071 (41.41)  165  78  67  189  121  0.64  310 (74.16)  P. balcanicus  140  1  —  14  14  97  72  1.34  169 (7.48)  7  2  2  0  11  0  11 (2.63)  P. simici  5  —  —  5  38  12  15  1.25  27 (1.78)  29  7  22  21  37  1.76  58 (13.90)  Phlebotomus  P. papatasi  69  —  —  178  463  377  333  1.13  710 (31.42)  1  11  4  9  7  0.78  16 (3.83)  Larroussius  P. neglectus/syriacus  118  6  —  29  59  110  102  1.07  212 (9.38)  7  2  3  2  10  2  12 (2.87)  P. perfiliewi  7  —  —  4  32  7  36  0.19  43 (1.90)  —  —  —  —  —  —  —  P. tobbi  —  —  —  —  —  —  —  —  —  1  —  —  1  —  0  1 (0.23)  Paraphlebotomus  P. sergenti  —  —  —  —  2  2  0  —  2 (0.08)  —  2  8  10  —  0  10 (2.39)  P. similis  1  —  —  —  2  1  2  0.5  3 (0.13)  —  —  —  —  —  —  —  Sergentomyia  Sergentomyia  Sergentomyia dentata  —  —  —  —  1  0  1  0  1 (0.04)  —  —  —  —  —  —  —  All  692  20  5  461  1,081  1,356  903  1.50  2,259 (100)  210  102  106  232  186  1.24  418 (100)  View Large Nigde Fauna A total of 40 CDC light traps were setup in three villages. Overall, 418 (232 male, 186 female) specimens belonging to seven Phlebotomus species were caught by using CDC light traps and seven Phlebotomus species (74.16% P. halepensis, 13.90% P. simici, 3.83% P. papatasi, 2.87% P. neglectus/syriacus, 2.63% P. balcanicus, 2.39% P. sergenti, and 0.23% P. tobbi) were identified (Fig. 2). Among all study areas, in Nigde, P. halepensis appeared to be the most abundant species. Also, the male/female rate was found to be 0.80 (Table 2). Leishmania-Infected Sand Flies and PCR During the field work, no promastigotes were found in the midgut specimens obtained from 116 (76 in Afyon, 40 in Nigde) females. Overall, 1,031 female sand flies were placed into four categories as blood-fed, normal, gravid and blood-fed + gravid. Also, specimens were pooled for examination of Leishmania presence. Leishmania DNA was detected in 6 of 73 pools, containing DNA of infected female sand flies captured in Afyon and Nigde. Melting curves of control pools, which included L. tropica, L. infantum and Leishmania major were detected as 61.35°C Tm, 65.88°C Tm, and 53.10°C, respectively in real-time PCR. Melting curves of three (pool 1, 2, and 5), two (pool 20 and 33), and one (pool 35) positive pools containing P. halepensis, P. papatasi, and P. neglectus/syriacus female specimens, showed similarity to L. tropica positive control, respectively (Fig. 3a–g). Fig. 3. View largeDownload slide (A) Melting curves of L. tropica positive pools, (B) melting curves of pool 1, (C) melting curves of pool 2, (D) melting curves of pool 5, (E) melting curves of pool 20, (F) melting curves of pool 33, (G) melting curves of pool 35. Fig. 3. View largeDownload slide (A) Melting curves of L. tropica positive pools, (B) melting curves of pool 1, (C) melting curves of pool 2, (D) melting curves of pool 5, (E) melting curves of pool 20, (F) melting curves of pool 33, (G) melting curves of pool 35. Discussion According to literature, 28 sand fly species resident in Turkey. To date, various sand fly fauna studies were carried out in approximately 40 endemic areas in Turkey. Results of studies emphasize that there is a relationship between sand fly fauna and either one or both of the two forms of the disease epidemiology. Twenty-eight sand fly species have been described belonging to the Phlebotomus (24 species) and Sergentomyia (four species) genera. In Anatolia, 18 of 28 species can transmit leishmaniasis as proven or probable vector, in other words they are medically important (WHO 2010, Ozbel et al. 2011, Alten et al. 2015, Kasap et al. 2015). In addition, only P. tobbi known proven vector (Svobodova et al. 2009). P. sergenti and P. similis are the probable vectors of L. tropica in southeastern and western parts of Turkey, respectively (Depaquit et al. 1998, Alptekin et al. 1999, Depaquit et al. 2002, Svobodova et al. 2009, WHO 2010). P. halepensis infection rates were ~90% for L. major and ~80% for L. tropica with high parasite densities (Sadlova et al. 2003). Tagi-zade et al. (1989) detected P. halepensis as potential and predominant vector of CL and VL in endemic areas. In Afyon and Nigde P. halepensis is the predominant sand fly species, so there it is a suspected vector of L. tropica. The study was conducted for determining the sand fly fauna in two CL endemic areas located in Central Anatolia of Turkey. In our study, we also found that P. halepensis was the dominant species among all study areas. Also P. sergenti was recorded for the first time in Afyon (0.66%) and Nigde provinces (2.39%). In accordance with previous studies performed in Afyon and Nigde, the authors reported P. halepensis among most dominant species (Cicek et al. 2005, Simsek et al. 2007). A total of 2,677 (2,259 in Afyon, 418 in Nigde) sand flies were collected from two study areas. Although Svobodova et al. (2009) and Ozbel et al. (2016) found promastigotes in P. tobbi and P. tobbi and S. dentata respectively, no promastigotes were found in the midgut specimens obtained from 116 females and studied by microscopically after the dissection in mobile laboratory. We prepared 73 pools containing 687 female sand fly specimens, for searching the presence of Leishmania DNA by using ITS1 real-time PCR assay. PCR were used to amplify ribosomal internal transcribed spacer 1 (ITS1) separating the gene coding for ssu rRNA and 5.8S rRNA for confirmation of Leishmania species identification in clinical samples and sand flies specimens (Svobodova et al. 2009, Ozensoy Toz 2013, Ayari et al. 2016). We detected six pools (4 pools from Afyon, 2 pools from Nigde) as L. tropica positive by ITS1 real-time PCR method in species level. Pool 1, pool 2 and pool 5 contained P. halepensis females, pool 20 and pool 35 contained P. papatasi females, pool 33 contained P. neglectus/syriacus females. It is known that P. halepensis can transmit L. tropica promastigotes (Sadlova et al. 2003, Svobodova et al. 2009) while P. papatasi and P. neglectus/syriacus cannot. According the results of real-time PCR method targeting ITS1 region, only L. tropica was detected while L. major and L. infantum were not found among the specimens (Table 3). For that reason, we can speculate that, P. papatasi and P. neglectus/syriacus females that found positive had the blood meal containing L. tropica amastigotes. Table 3. ITS-1 PCR results Species  Total number of specimens  Leishmania-positive pool no.  The villages of positive pools  N  G  BF  BFG  Total  P. halepensis  284  0  0  149  433  3 (Pool 1, 2 and 5)  Yıprak/Kulak; Göçerli; Doganli  P. balcanicus  58  0  0  24  82  0  —  P. simici  46  0  0  20  66  0  —  P. papatasi  222  0  0  98  320  2 (Pool 20, 35)  Doganli; Feslegen; Balci  P. neglectus/syriacus  54  0  0  41  95  1 (Pool 33)  Eynelli  P. perfiliewi  22  0  0  2  13  0  —  Total  686  0  0  334  1,020  6  —  Species  Total number of specimens  Leishmania-positive pool no.  The villages of positive pools  N  G  BF  BFG  Total  P. halepensis  284  0  0  149  433  3 (Pool 1, 2 and 5)  Yıprak/Kulak; Göçerli; Doganli  P. balcanicus  58  0  0  24  82  0  —  P. simici  46  0  0  20  66  0  —  P. papatasi  222  0  0  98  320  2 (Pool 20, 35)  Doganli; Feslegen; Balci  P. neglectus/syriacus  54  0  0  41  95  1 (Pool 33)  Eynelli  P. perfiliewi  22  0  0  2  13  0  —  Total  686  0  0  334  1,020  6  —  N: Number; G: Gravid; BF: Blood-fed; BFG: Blood-fed gravid. View Large L. infantum DNA was detected in P. tobbi females using real-time PCR assay and it was shown microscopically (Svobodova et al. 2009, Ozbel et al. 2016). Aghaei Afshar et al. (2014) determined 2.6% infection rate of L. tropica in P. sergenti female samples by using ITS1-HRM PCR assay. Eleven isolates from sand flies, which were collected from Adana and Osmaniye, showed Leishmania infection by using PCR-restriction fragment length polymorphism of ITS1 fragments of DNA digested with HaeIII (Svobodova et al. 2009). In conclusion, in our present study, performed in Afyon and Niğde provinces where KL disease is endemic in Turkey, sand fly fauna was determined; and P. halepensis was detected as dominant species in both areas; and 3 of 38 pools, in which collected sand fly females were contained, included P. halepensis females, and they were identified as L. tropica positive. Our findings which are believed to be the first evidence to be shown in nature, suggest that the P. halepensis may be the probable vector of L. tropica in two provinces. Acknowledgments We thank Scientific Research Projects Coordination Unit of Ege University, which supported our study with a project ID of ‘2009 TIP 32’. References Cited Aghaei Afshar, A., Rassi Y., Sharifi I., Vatandoost H., Mollaie H. R., Oshaghi M. A., and Abai M. R.. 2014. First report on natural Leishmania infection of Phlebotomus sergenti due L. tropica by high resolution melting curve method in South-eastern Iran. Asian Pac J Trop Med  7: 93– 96. Google Scholar CrossRef Search ADS PubMed  Alptekin, D., Kasap M., Luleyap U., Kasap H., Aksoy S., and Wilson M. L.. 1999. Sand flies (Diptera: Psychodidae) associated with epidemic Cutaneous Leishmaniasis in Sanlıurfa. Turkey. J. Med. Entomol . 36: 277– 281. Google Scholar PubMed  Alten, B., Ozbel Y., Ergunay K., Kasap O. E., Cull B., Antoniou M., Velo E., Prudhomme J., Molina R., Bañuls A. L.,et al.   2015. Sampling strategies for phlebotomine sand flies (Diptera: Psychodidae) in Europe. Bull. Entomol. Res . 105: 664– 678. Google Scholar CrossRef Search ADS PubMed  Ayari, C., Othman S. B., Chemkhi J., Tabbabi A., Fisa R., Salah A. B., and Abderrazak S.. 2016. First detection of Leishmania major DNA in Sergentomyia (Sintonius) clydei (Sinton, 1928, Psychodidae: Phlebotominae), from an outbreak area of cutaneous leishmaniasis in Tunisia. Infect. Genet. Evol . 39: 241– 248. Google Scholar CrossRef Search ADS PubMed  Cicek H., Yaman M., Yagcı S., and Karaer Z.. 2005. Afyon yöresi Phlebotomus (Diptera: Psychodidae) türleri. Ankara Üniv Vet Fak Derg . 52: 49– 51. Depaquit J., Leger N., and Ferte H.. 1998. Le statut taxinomique de Phlebotomus sergenti PARROT, 1917, vecteur de Leishmania tropica (WRIGHT, 1903) et Phlebotomus similis PERFILIEV, 1963 (Diptera-Psychodidae). Approches morphologique et morphometrique. Corollaires biogeographiques et epidemiologiques. Bulletin de la Societd de Pathologie Exotique . 9I: 346– 352. Depaquit J., Ferte H., Leger N., Lefranc F., Alves-Pires C., Hanafi H., Maroli M., Morillas-Marquez F., Rioux J. A., Svobodova M.,et al.   2002. ITS 2 sequences heterogeneity in Phlebotomus sergenti and Phlebotomus similis (Diptera, Psychodidae): possible consequences in their ability to transmit Leishmania tropica. Int. J. Parasitol . 32: 1123– 1131. Google Scholar CrossRef Search ADS PubMed  Houin, R., Abonnence E., and Deniau M.. 1971. Phlébotomes du Sud de la Turquie. Ann. Parasitol. Hum. Comp . 46: 633– 652. Google Scholar CrossRef Search ADS   Killick-Kendrick, R. 1990. Phlebotomine vectors of the leishmaniases: a review. Med. Vet. Entomol . 4: 1– 24. Google Scholar CrossRef Search ADS PubMed  Lewis, D. J. 1982. A Taxonomic Review of the Genus Phlebotomus (Diptera: Psycodidae). Bull. Br. Mus. Nat. Hist. Ent . 45: 121– 209. (MoH) Ministry of Health. 2015. Leishmaniasis data of Adana province, Turkey . MoH, Ankara, Turkey. Ok Z., Balcioglu I. C., Ozkan A. T., Ozensoy S., and Ozbel Y.. 2002. Leishmaniasis in Turkey. Acta Tropica  84: 43– 48. Google Scholar CrossRef Search ADS PubMed  Ozbel, Y., Balcioğlu I. C., Olgen M. K., Simsek M. F., Ozensoy Töz S., Ertabaklar H., Demir S., Alkan M. Z.. 2011. Spatial Distribution of Phlebotomine Sand Flies in Aydin Mountains and Surroundings; the Main Focus of Cutaneous Leishmaniasis in Western Turkey. J Vector Ecol . 36 (Suppl 1): S99– S105. Google Scholar CrossRef Search ADS PubMed  Ozbel, Y., Karakus M., Arserim S. K., Kalkan S. O., and Toz S.. 2016. Molecular detection and identification of Leishmania spp. in naturally infected Phlebotomus tobbi and Sergentomyia dentata in a focus of human and canine leishmaniasis in western Turkey. Acta Tropica  155: 89– 94. Google Scholar CrossRef Search ADS PubMed  Ozensoy Toz, S., Culha G., Yildiz Zeyrek F., Ertabaklar H., Alkan M. Z., Tetik Vardarlı A., Gunduz C., and Ozbel Y.. 2013. A Real-Time ITS1-PCR based method in the diagnosis and species identification of Leishmania parasite from human and dog clinical samples in Turkey. PLoS Negl. Trop. Dis . 7: 1– 8. Sadlova, J., Hajmova M., and Volf P.. 2003. Phlebotomus (Adlerius) halepensis vector competence for Leishmania major and Le. tropica. Med. Vet. Entomol . 17: 244– 250. Google Scholar CrossRef Search ADS PubMed  Simsek, F. M., Alten B., Caglar S. S., Ozbel Y., Aytekin A. M., Kaynas S., Belen A., Kasap O. E., Yaman M., and Rastgeldi S.. 2007. Distribution and altitudinal structuring of phlebotomine sand flies (Diptera:Psychodidae) in southern Anatolia, Turkey: their relation to human cutaneous leishmaniasis. J. Vector Ecol . 32: 269– 279. Google Scholar CrossRef Search ADS PubMed  Svobodová, M., Alten B., Zídková L., Dvorák V., Hlavacková J., Myšková J., Šeblová V., Kasap O. E., Belen A., Votypka J.,et al.   2009. Cutaneous leishmaniasis caused by Leishmania infantum transmitted by Phlebotomus tobbi. Int. J. Parasitol . 39: 251– 256. Google Scholar CrossRef Search ADS PubMed  Tagi-zade, T. A., Gasanzade G. B., and Safyanova V. M.. 1989. Visceral leishmaniasis in the Ordubad district of the Nakhichevan ASSR. Med Parazitol (Mosk)  3: 22– 27. Theodor, O. 1958. Psychodidae-Phlebotominae, pp. 1– 55. In Die Fliegen Der Palaerktischen Region Lindner E. (ed.), Lieferung 201 . E. Schweizerbart’sche Verlagsbuchhandlung (Nagele u. Obermiller), Stuttgart, Germany. WHO-World Health Organization. 2010. WHO Technical Report Series Report No: 949 . WHO, Geneva, Switzerland. Yaman M., and Ozbel Y.. 2004. The sandflies (Diptera: Psychodidae) in the Turkish province of Hatay: some possible vectors ofthe parasites causing human cutaneous leishmaniasis. Ann. Trop. Med. Parasitol . 98: 741– 750. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Medical Entomology Oxford University Press

Phlebotomus halepensis (Diptera: Psychodidae) Vectorial Capacity in Afyon and Nigde Province, Turkey

Loading next page...
 
/lp/ou_press/phlebotomus-halepensis-diptera-psychodidae-vectorial-capacity-in-afyon-2XsB5EU20G
Publisher
Oxford University Press
Copyright
© The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
ISSN
0022-2585
eISSN
1938-2928
D.O.I.
10.1093/jme/tjx210
Publisher site
See Article on Publisher Site

Abstract

Abstract Leishmaniasis is a one of the vector-borne diseases and has two clinical forms in Turkey: cutaneous and visceral. The aim of this study was to determine the sand fly fauna in Afyon and Nigde provinces where endemic foci of cutaneous leishmaniasis (CL) in Turkey. In Afyon, 2,259 sand flies were collected in 73 locations in August 2009 and August 2010, using CDC light traps. In total, eight Phlebotomus species were identified; Phlebotomus halepensis (47.41%), Phlebotomus papatasi (31.42%), Phlebotomus neglectus/syriacus (9.38%), Phlebotomus balcanicus (7.48%), Phlebotomus simici (2.12%), Phlebotomus perfiliewi (1.90%), Phlebotomus sergenti (0.08%), Phlebotomus similis (0.13%), and Sergentomyia dentata (0.04%). A total of 418 sand fly specimens were caught by CDC light traps in 40 stations in Nigde in September 2009 and September 2010. In total, seven Phlebotomus species were identified; P. halepensis (74.16%), P. simici (13.87%), P. papatasi (3.82%), P. neglectus/syriacus (2.87%), P. balcanicus (2.63%), P. sergenti (2.39%), and Phlebotomus tobbi (0.23%). Collected sand flies were examined by microscope, and no promastigotes were found in their midguts. We categorized and pooled female specimens (1,031 females, 73 pools of 2–33 individuals). Leishmania species-specific ITS1 real-time PCR assay was performed for detection and identification of parasites. We detected 6 of the 73 pools with Leishmania tropica (Ross, 1903), (Trypanosomatidae). In conclusion, P. halepensis was found to be dominant species in both areas. We are in opinion that our findings support P. halepensis vectorial role for L. tropica in nature and it could be responsible for the transmission of L. tropica in these endemic areas. sand fly, Leishmania, vector, fauna, cutaneous leishmaniasis Phlebotomine sand flies are the arthropod vectors of the Leishmania species and played an important role for the transmission of leishmaniasis in The Old World. Both types of leishmaniasis, visceral and cutaneous known as major public health problem in Turkey, and cause 30–40 and 2,000 cases every year, respectively. Leishmania infantum is responsible for both clinical forms occurring in the Aegean and Mediterranean regions and sporadically in other regions of Turkey while Leishmania tropica (Ross, 1903), (Trypanosomatidae) causes cutaneous leishmaniasis (CL) which is especially highly endemic in the southeastern, western, and eastern Mediterranean parts of Turkey (Ok et al. 2002, Yaman and Ozbel 2004). Svobodova et al. proved vectorial role of Phlebotomus tobbi microscopically in Osmaniye, Turkey and observed promastigotes of L. infantum in its midguts. Also, Phlebotomus sergenti and Phlebotomus similis are probable vectors of L. tropica in southeastern and western Turkey, respectively (Depaquit et al. 1998, Depaquit et al. 2002, WHO 2010). L. tropica can also be transmitted by Phlebotomus halepensis, which show high susceptibility to both leishmaniasis forms, supporting typical suprapylarian parasite development similar to the other vectors (Sadlova et al. 2003). Twenty-eight sand fly species (or subspecies recently raised to species level) belonging to the Phlebotomus and Sergentomyia genera have been described in Turkey, 18 of them known as proven or probable vectors of human leishmaniasis in The Old World (Houin 1971, Yaman and Ozbel 2004, WHO 2010). In this study, the aim was to determine sand fly fauna of two endemic areas for CL in Afyon and Nigde provinces located in the Aegean and Southeastern Anatolia Regions, respectively. In our study areas, a total of 51 (28 cases are in Afyon, 23 cases are in Nigde) CL cases were reported between 2006 and 2010 (Ministry of Health [MoH] 2015). Materials and Methods Study Area Our study was conducted in five villages in (Aydin, Yiprak, Kulak, Gocerli, and Doganli) Afyon and three villages (Eynelli, Feslegen, and Balci) in Nigde. Afyon province has a basin of 14570 km2 in area, and is located in the eastern part of Turkey (altitude 1034 m, latitude 38° 45′ 20.88″ N, longitude 30° 32′ 30.48″ E). Niğde province has a basin of 7795 km2 in area, and is located in Central Anatolia, Turkey (altitude 1218 m, latitude 37° 53′ 34.09″ N, longitude 34° 41′ 14.95″ E) (Fig. 1). Fig. 1. View largeDownload slide The locations of both provinces that the present study conducted. Fig. 1. View largeDownload slide The locations of both provinces that the present study conducted. Collection of the Data and Statistical Analyses The data for instant temperature and humidity was recorded using thermo-hygrometer in each location. A Global Positioning System (handheld) (Magellan Explorist 310) was used to record the coordinates (Table 1). Table 1. Geographical data of study area Villages  City  CL cases  Altitude (m)  Temperature max–min (°C)  Humidity max–min (%)  Coordinates  Aydin  Afyon  5  1242  30.43–22.73  55.6–27.05  38° 30′ 36.19″ N  30° 28′ 39.09″ E  Yiprak  Afyon  1  1329  27.1–17.6  51–24  38° 19′ 56.61″ N  30° 27′ 47.25″ E  Gocerli  Afyon  7  1237  31.33–22.34  62.11–25.66  38° 17′ 53.44″ N  30° 26′ 55.41″ E  Kulak  Afyon  2  1349  28.6–22.1  74.5–34.5  38° 23′ 04.55″ N  30° 35′ 23.22″ E  Doganli  Afyon  13  1136  28.87–22.32  56–26  38° 32′ 00.00″ N  30° 33′ 00.00″ E  Eynelli  Nigde  77  1674  33.68–24.43  47.4–24  37° 55′ 50.70″ N  35° 00′ 55.48″ E  Feslegen  Nigde  1  1692  30.63–24.35  47–26  37° 59′ 21.98″ N  34° 33′ 25.17″ E  Balci  Nigde  15  1545  30.36–24.26  46–30  37° 58′ 18.19″ N  34° 27′ 46.08″ E  Villages  City  CL cases  Altitude (m)  Temperature max–min (°C)  Humidity max–min (%)  Coordinates  Aydin  Afyon  5  1242  30.43–22.73  55.6–27.05  38° 30′ 36.19″ N  30° 28′ 39.09″ E  Yiprak  Afyon  1  1329  27.1–17.6  51–24  38° 19′ 56.61″ N  30° 27′ 47.25″ E  Gocerli  Afyon  7  1237  31.33–22.34  62.11–25.66  38° 17′ 53.44″ N  30° 26′ 55.41″ E  Kulak  Afyon  2  1349  28.6–22.1  74.5–34.5  38° 23′ 04.55″ N  30° 35′ 23.22″ E  Doganli  Afyon  13  1136  28.87–22.32  56–26  38° 32′ 00.00″ N  30° 33′ 00.00″ E  Eynelli  Nigde  77  1674  33.68–24.43  47.4–24  37° 55′ 50.70″ N  35° 00′ 55.48″ E  Feslegen  Nigde  1  1692  30.63–24.35  47–26  37° 59′ 21.98″ N  34° 33′ 25.17″ E  Balci  Nigde  15  1545  30.36–24.26  46–30  37° 58′ 18.19″ N  34° 27′ 46.08″ E  View Large Sand Fly Collection and Identification Sand fly specimens were collected from 113 locations (73 in Afyon and 40 in Nigde) using CDC light traps, in two different periods, August 2009 and September 2010. In each area, we set up the traps according to the number of CL patients recorded by MoH. During the collection period, traps were setup in animal (goat, cattle, sheep, or poultry) sheds near or under rooms in which an active or treated case of CL was living, and left for one night (Alten et al. 2015). The animal sheds and nearby houses are usually made of brick, mud, wood and/or stone. Specimens were kept in 96% alcohol for morphological identifications, which were based on the morphology of male genitalia and female spermatheca and pharynges using several written keys (Theodor 1958, Lewis 1982, Killick-Kendrick et al. 1990). The midguts of 116 females were examined by direct microscopy technique for the presence of promastigotes in both study areas. DNA Extraction From Sand Flies and ITS-1 PCR Zymo insect kit (Zymo Research Corp., Irvine, CA) was used for obtaining DNA from sand flies. In our study, for detection of Leishmania promastigote, we prepared 73 pools, which consisted of 2–33 individuals from 1,031 out of 1,089 female sand fly specimens to detect Leishmania promastigote. The real-time PCR method targeting ITS1 region specific for Leishmania species was performed using primers LITSR/L5.8S. Real-time PCR assay amplification was carried out in a reaction mixture containing 5 µl of extracted DNA, LITSR (5′CTGGATCATTTTCCGATG 3′), L5.8S (5′TGATACCACTTATCGCACTT 3′). Results Afyon Fauna Overall, 73 CDC light traps were placed in five villages. A total of 2,259 (1,356 male, 903 female) sand flies were collected and eight Phlebotomus species (47.41% P. halepensis, 31.42% Phlebotomus papatasi, 9.38% Phlebotomus neglectus/syriacus, 7.48% Phlebotomus balcanicus, 2.12% Phlebotomus simici, 1.90% Phlebotomus perfiliewi, 0.08% P. sergenti, 0.13% P. similis) and one Sergentomyia species (0.04% Sergentomyia dentata) were identified (Fig. 2). Among all study areas, in Afyon, P. halepensis appeared to be the most abundant species. P. papatasi and P. neglectus/syriacus were second and third dominant species in Afyon. In addition, the male/female rate was found to be 1.50 (Table 2). Fig. 2. View largeDownload slide Densities of the sand fly species in the study villages of Afyon and Nigde provinces. Fig. 2. View largeDownload slide Densities of the sand fly species in the study villages of Afyon and Nigde provinces. Table 2. The results of the sand fly collection in Afyon and Nigde province, 2009–2010 Taxon  Subgenus  Species  AFYON  NIGDE  Aydin  Kulak  Yiprak  Gocerli  Doganli  ♂  ♀  ♂/♀  Total (%)  Eynelli  Feslegen  Balci  ♂  ♀  ♂/♀  Total (%)  Phlebotomus  Adlerius  P. halepensis  352  13  5  231  470  749  322  2.32  1071 (41.41)  165  78  67  189  121  0.64  310 (74.16)  P. balcanicus  140  1  —  14  14  97  72  1.34  169 (7.48)  7  2  2  0  11  0  11 (2.63)  P. simici  5  —  —  5  38  12  15  1.25  27 (1.78)  29  7  22  21  37  1.76  58 (13.90)  Phlebotomus  P. papatasi  69  —  —  178  463  377  333  1.13  710 (31.42)  1  11  4  9  7  0.78  16 (3.83)  Larroussius  P. neglectus/syriacus  118  6  —  29  59  110  102  1.07  212 (9.38)  7  2  3  2  10  2  12 (2.87)  P. perfiliewi  7  —  —  4  32  7  36  0.19  43 (1.90)  —  —  —  —  —  —  —  P. tobbi  —  —  —  —  —  —  —  —  —  1  —  —  1  —  0  1 (0.23)  Paraphlebotomus  P. sergenti  —  —  —  —  2  2  0  —  2 (0.08)  —  2  8  10  —  0  10 (2.39)  P. similis  1  —  —  —  2  1  2  0.5  3 (0.13)  —  —  —  —  —  —  —  Sergentomyia  Sergentomyia  Sergentomyia dentata  —  —  —  —  1  0  1  0  1 (0.04)  —  —  —  —  —  —  —  All  692  20  5  461  1,081  1,356  903  1.50  2,259 (100)  210  102  106  232  186  1.24  418 (100)  Taxon  Subgenus  Species  AFYON  NIGDE  Aydin  Kulak  Yiprak  Gocerli  Doganli  ♂  ♀  ♂/♀  Total (%)  Eynelli  Feslegen  Balci  ♂  ♀  ♂/♀  Total (%)  Phlebotomus  Adlerius  P. halepensis  352  13  5  231  470  749  322  2.32  1071 (41.41)  165  78  67  189  121  0.64  310 (74.16)  P. balcanicus  140  1  —  14  14  97  72  1.34  169 (7.48)  7  2  2  0  11  0  11 (2.63)  P. simici  5  —  —  5  38  12  15  1.25  27 (1.78)  29  7  22  21  37  1.76  58 (13.90)  Phlebotomus  P. papatasi  69  —  —  178  463  377  333  1.13  710 (31.42)  1  11  4  9  7  0.78  16 (3.83)  Larroussius  P. neglectus/syriacus  118  6  —  29  59  110  102  1.07  212 (9.38)  7  2  3  2  10  2  12 (2.87)  P. perfiliewi  7  —  —  4  32  7  36  0.19  43 (1.90)  —  —  —  —  —  —  —  P. tobbi  —  —  —  —  —  —  —  —  —  1  —  —  1  —  0  1 (0.23)  Paraphlebotomus  P. sergenti  —  —  —  —  2  2  0  —  2 (0.08)  —  2  8  10  —  0  10 (2.39)  P. similis  1  —  —  —  2  1  2  0.5  3 (0.13)  —  —  —  —  —  —  —  Sergentomyia  Sergentomyia  Sergentomyia dentata  —  —  —  —  1  0  1  0  1 (0.04)  —  —  —  —  —  —  —  All  692  20  5  461  1,081  1,356  903  1.50  2,259 (100)  210  102  106  232  186  1.24  418 (100)  View Large Nigde Fauna A total of 40 CDC light traps were setup in three villages. Overall, 418 (232 male, 186 female) specimens belonging to seven Phlebotomus species were caught by using CDC light traps and seven Phlebotomus species (74.16% P. halepensis, 13.90% P. simici, 3.83% P. papatasi, 2.87% P. neglectus/syriacus, 2.63% P. balcanicus, 2.39% P. sergenti, and 0.23% P. tobbi) were identified (Fig. 2). Among all study areas, in Nigde, P. halepensis appeared to be the most abundant species. Also, the male/female rate was found to be 0.80 (Table 2). Leishmania-Infected Sand Flies and PCR During the field work, no promastigotes were found in the midgut specimens obtained from 116 (76 in Afyon, 40 in Nigde) females. Overall, 1,031 female sand flies were placed into four categories as blood-fed, normal, gravid and blood-fed + gravid. Also, specimens were pooled for examination of Leishmania presence. Leishmania DNA was detected in 6 of 73 pools, containing DNA of infected female sand flies captured in Afyon and Nigde. Melting curves of control pools, which included L. tropica, L. infantum and Leishmania major were detected as 61.35°C Tm, 65.88°C Tm, and 53.10°C, respectively in real-time PCR. Melting curves of three (pool 1, 2, and 5), two (pool 20 and 33), and one (pool 35) positive pools containing P. halepensis, P. papatasi, and P. neglectus/syriacus female specimens, showed similarity to L. tropica positive control, respectively (Fig. 3a–g). Fig. 3. View largeDownload slide (A) Melting curves of L. tropica positive pools, (B) melting curves of pool 1, (C) melting curves of pool 2, (D) melting curves of pool 5, (E) melting curves of pool 20, (F) melting curves of pool 33, (G) melting curves of pool 35. Fig. 3. View largeDownload slide (A) Melting curves of L. tropica positive pools, (B) melting curves of pool 1, (C) melting curves of pool 2, (D) melting curves of pool 5, (E) melting curves of pool 20, (F) melting curves of pool 33, (G) melting curves of pool 35. Discussion According to literature, 28 sand fly species resident in Turkey. To date, various sand fly fauna studies were carried out in approximately 40 endemic areas in Turkey. Results of studies emphasize that there is a relationship between sand fly fauna and either one or both of the two forms of the disease epidemiology. Twenty-eight sand fly species have been described belonging to the Phlebotomus (24 species) and Sergentomyia (four species) genera. In Anatolia, 18 of 28 species can transmit leishmaniasis as proven or probable vector, in other words they are medically important (WHO 2010, Ozbel et al. 2011, Alten et al. 2015, Kasap et al. 2015). In addition, only P. tobbi known proven vector (Svobodova et al. 2009). P. sergenti and P. similis are the probable vectors of L. tropica in southeastern and western parts of Turkey, respectively (Depaquit et al. 1998, Alptekin et al. 1999, Depaquit et al. 2002, Svobodova et al. 2009, WHO 2010). P. halepensis infection rates were ~90% for L. major and ~80% for L. tropica with high parasite densities (Sadlova et al. 2003). Tagi-zade et al. (1989) detected P. halepensis as potential and predominant vector of CL and VL in endemic areas. In Afyon and Nigde P. halepensis is the predominant sand fly species, so there it is a suspected vector of L. tropica. The study was conducted for determining the sand fly fauna in two CL endemic areas located in Central Anatolia of Turkey. In our study, we also found that P. halepensis was the dominant species among all study areas. Also P. sergenti was recorded for the first time in Afyon (0.66%) and Nigde provinces (2.39%). In accordance with previous studies performed in Afyon and Nigde, the authors reported P. halepensis among most dominant species (Cicek et al. 2005, Simsek et al. 2007). A total of 2,677 (2,259 in Afyon, 418 in Nigde) sand flies were collected from two study areas. Although Svobodova et al. (2009) and Ozbel et al. (2016) found promastigotes in P. tobbi and P. tobbi and S. dentata respectively, no promastigotes were found in the midgut specimens obtained from 116 females and studied by microscopically after the dissection in mobile laboratory. We prepared 73 pools containing 687 female sand fly specimens, for searching the presence of Leishmania DNA by using ITS1 real-time PCR assay. PCR were used to amplify ribosomal internal transcribed spacer 1 (ITS1) separating the gene coding for ssu rRNA and 5.8S rRNA for confirmation of Leishmania species identification in clinical samples and sand flies specimens (Svobodova et al. 2009, Ozensoy Toz 2013, Ayari et al. 2016). We detected six pools (4 pools from Afyon, 2 pools from Nigde) as L. tropica positive by ITS1 real-time PCR method in species level. Pool 1, pool 2 and pool 5 contained P. halepensis females, pool 20 and pool 35 contained P. papatasi females, pool 33 contained P. neglectus/syriacus females. It is known that P. halepensis can transmit L. tropica promastigotes (Sadlova et al. 2003, Svobodova et al. 2009) while P. papatasi and P. neglectus/syriacus cannot. According the results of real-time PCR method targeting ITS1 region, only L. tropica was detected while L. major and L. infantum were not found among the specimens (Table 3). For that reason, we can speculate that, P. papatasi and P. neglectus/syriacus females that found positive had the blood meal containing L. tropica amastigotes. Table 3. ITS-1 PCR results Species  Total number of specimens  Leishmania-positive pool no.  The villages of positive pools  N  G  BF  BFG  Total  P. halepensis  284  0  0  149  433  3 (Pool 1, 2 and 5)  Yıprak/Kulak; Göçerli; Doganli  P. balcanicus  58  0  0  24  82  0  —  P. simici  46  0  0  20  66  0  —  P. papatasi  222  0  0  98  320  2 (Pool 20, 35)  Doganli; Feslegen; Balci  P. neglectus/syriacus  54  0  0  41  95  1 (Pool 33)  Eynelli  P. perfiliewi  22  0  0  2  13  0  —  Total  686  0  0  334  1,020  6  —  Species  Total number of specimens  Leishmania-positive pool no.  The villages of positive pools  N  G  BF  BFG  Total  P. halepensis  284  0  0  149  433  3 (Pool 1, 2 and 5)  Yıprak/Kulak; Göçerli; Doganli  P. balcanicus  58  0  0  24  82  0  —  P. simici  46  0  0  20  66  0  —  P. papatasi  222  0  0  98  320  2 (Pool 20, 35)  Doganli; Feslegen; Balci  P. neglectus/syriacus  54  0  0  41  95  1 (Pool 33)  Eynelli  P. perfiliewi  22  0  0  2  13  0  —  Total  686  0  0  334  1,020  6  —  N: Number; G: Gravid; BF: Blood-fed; BFG: Blood-fed gravid. View Large L. infantum DNA was detected in P. tobbi females using real-time PCR assay and it was shown microscopically (Svobodova et al. 2009, Ozbel et al. 2016). Aghaei Afshar et al. (2014) determined 2.6% infection rate of L. tropica in P. sergenti female samples by using ITS1-HRM PCR assay. Eleven isolates from sand flies, which were collected from Adana and Osmaniye, showed Leishmania infection by using PCR-restriction fragment length polymorphism of ITS1 fragments of DNA digested with HaeIII (Svobodova et al. 2009). In conclusion, in our present study, performed in Afyon and Niğde provinces where KL disease is endemic in Turkey, sand fly fauna was determined; and P. halepensis was detected as dominant species in both areas; and 3 of 38 pools, in which collected sand fly females were contained, included P. halepensis females, and they were identified as L. tropica positive. Our findings which are believed to be the first evidence to be shown in nature, suggest that the P. halepensis may be the probable vector of L. tropica in two provinces. Acknowledgments We thank Scientific Research Projects Coordination Unit of Ege University, which supported our study with a project ID of ‘2009 TIP 32’. References Cited Aghaei Afshar, A., Rassi Y., Sharifi I., Vatandoost H., Mollaie H. R., Oshaghi M. A., and Abai M. R.. 2014. First report on natural Leishmania infection of Phlebotomus sergenti due L. tropica by high resolution melting curve method in South-eastern Iran. Asian Pac J Trop Med  7: 93– 96. Google Scholar CrossRef Search ADS PubMed  Alptekin, D., Kasap M., Luleyap U., Kasap H., Aksoy S., and Wilson M. L.. 1999. Sand flies (Diptera: Psychodidae) associated with epidemic Cutaneous Leishmaniasis in Sanlıurfa. Turkey. J. Med. Entomol . 36: 277– 281. Google Scholar PubMed  Alten, B., Ozbel Y., Ergunay K., Kasap O. E., Cull B., Antoniou M., Velo E., Prudhomme J., Molina R., Bañuls A. L.,et al.   2015. Sampling strategies for phlebotomine sand flies (Diptera: Psychodidae) in Europe. Bull. Entomol. Res . 105: 664– 678. Google Scholar CrossRef Search ADS PubMed  Ayari, C., Othman S. B., Chemkhi J., Tabbabi A., Fisa R., Salah A. B., and Abderrazak S.. 2016. First detection of Leishmania major DNA in Sergentomyia (Sintonius) clydei (Sinton, 1928, Psychodidae: Phlebotominae), from an outbreak area of cutaneous leishmaniasis in Tunisia. Infect. Genet. Evol . 39: 241– 248. Google Scholar CrossRef Search ADS PubMed  Cicek H., Yaman M., Yagcı S., and Karaer Z.. 2005. Afyon yöresi Phlebotomus (Diptera: Psychodidae) türleri. Ankara Üniv Vet Fak Derg . 52: 49– 51. Depaquit J., Leger N., and Ferte H.. 1998. Le statut taxinomique de Phlebotomus sergenti PARROT, 1917, vecteur de Leishmania tropica (WRIGHT, 1903) et Phlebotomus similis PERFILIEV, 1963 (Diptera-Psychodidae). Approches morphologique et morphometrique. Corollaires biogeographiques et epidemiologiques. Bulletin de la Societd de Pathologie Exotique . 9I: 346– 352. Depaquit J., Ferte H., Leger N., Lefranc F., Alves-Pires C., Hanafi H., Maroli M., Morillas-Marquez F., Rioux J. A., Svobodova M.,et al.   2002. ITS 2 sequences heterogeneity in Phlebotomus sergenti and Phlebotomus similis (Diptera, Psychodidae): possible consequences in their ability to transmit Leishmania tropica. Int. J. Parasitol . 32: 1123– 1131. Google Scholar CrossRef Search ADS PubMed  Houin, R., Abonnence E., and Deniau M.. 1971. Phlébotomes du Sud de la Turquie. Ann. Parasitol. Hum. Comp . 46: 633– 652. Google Scholar CrossRef Search ADS   Killick-Kendrick, R. 1990. Phlebotomine vectors of the leishmaniases: a review. Med. Vet. Entomol . 4: 1– 24. Google Scholar CrossRef Search ADS PubMed  Lewis, D. J. 1982. A Taxonomic Review of the Genus Phlebotomus (Diptera: Psycodidae). Bull. Br. Mus. Nat. Hist. Ent . 45: 121– 209. (MoH) Ministry of Health. 2015. Leishmaniasis data of Adana province, Turkey . MoH, Ankara, Turkey. Ok Z., Balcioglu I. C., Ozkan A. T., Ozensoy S., and Ozbel Y.. 2002. Leishmaniasis in Turkey. Acta Tropica  84: 43– 48. Google Scholar CrossRef Search ADS PubMed  Ozbel, Y., Balcioğlu I. C., Olgen M. K., Simsek M. F., Ozensoy Töz S., Ertabaklar H., Demir S., Alkan M. Z.. 2011. Spatial Distribution of Phlebotomine Sand Flies in Aydin Mountains and Surroundings; the Main Focus of Cutaneous Leishmaniasis in Western Turkey. J Vector Ecol . 36 (Suppl 1): S99– S105. Google Scholar CrossRef Search ADS PubMed  Ozbel, Y., Karakus M., Arserim S. K., Kalkan S. O., and Toz S.. 2016. Molecular detection and identification of Leishmania spp. in naturally infected Phlebotomus tobbi and Sergentomyia dentata in a focus of human and canine leishmaniasis in western Turkey. Acta Tropica  155: 89– 94. Google Scholar CrossRef Search ADS PubMed  Ozensoy Toz, S., Culha G., Yildiz Zeyrek F., Ertabaklar H., Alkan M. Z., Tetik Vardarlı A., Gunduz C., and Ozbel Y.. 2013. A Real-Time ITS1-PCR based method in the diagnosis and species identification of Leishmania parasite from human and dog clinical samples in Turkey. PLoS Negl. Trop. Dis . 7: 1– 8. Sadlova, J., Hajmova M., and Volf P.. 2003. Phlebotomus (Adlerius) halepensis vector competence for Leishmania major and Le. tropica. Med. Vet. Entomol . 17: 244– 250. Google Scholar CrossRef Search ADS PubMed  Simsek, F. M., Alten B., Caglar S. S., Ozbel Y., Aytekin A. M., Kaynas S., Belen A., Kasap O. E., Yaman M., and Rastgeldi S.. 2007. Distribution and altitudinal structuring of phlebotomine sand flies (Diptera:Psychodidae) in southern Anatolia, Turkey: their relation to human cutaneous leishmaniasis. J. Vector Ecol . 32: 269– 279. Google Scholar CrossRef Search ADS PubMed  Svobodová, M., Alten B., Zídková L., Dvorák V., Hlavacková J., Myšková J., Šeblová V., Kasap O. E., Belen A., Votypka J.,et al.   2009. Cutaneous leishmaniasis caused by Leishmania infantum transmitted by Phlebotomus tobbi. Int. J. Parasitol . 39: 251– 256. Google Scholar CrossRef Search ADS PubMed  Tagi-zade, T. A., Gasanzade G. B., and Safyanova V. M.. 1989. Visceral leishmaniasis in the Ordubad district of the Nakhichevan ASSR. Med Parazitol (Mosk)  3: 22– 27. Theodor, O. 1958. Psychodidae-Phlebotominae, pp. 1– 55. In Die Fliegen Der Palaerktischen Region Lindner E. (ed.), Lieferung 201 . E. Schweizerbart’sche Verlagsbuchhandlung (Nagele u. Obermiller), Stuttgart, Germany. WHO-World Health Organization. 2010. WHO Technical Report Series Report No: 949 . WHO, Geneva, Switzerland. Yaman M., and Ozbel Y.. 2004. The sandflies (Diptera: Psychodidae) in the Turkish province of Hatay: some possible vectors ofthe parasites causing human cutaneous leishmaniasis. Ann. Trop. Med. Parasitol . 98: 741– 750. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Journal

Journal of Medical EntomologyOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off