PERK inhibition delays neurodegeneration and improves motor function in a mouse model of Marinesco-Sjögren syndrome

PERK inhibition delays neurodegeneration and improves motor function in a mouse model of... Abstract Marinesco-Sjögren syndrome (MSS) is a rare, early onset, autosomal recessive multisystem disorder characterized by cerebellar ataxia, cataracts and myopathy. Most MSS cases are caused by loss-of-function mutations in the gene encoding SIL1, a nucleotide exchange factor for the molecular chaperone BiP which is essential for correct protein folding in the endoplasmic reticulum. Woozy mice carrying a spontaneous Sil1 mutation recapitulate key pathological features of MSS, including cerebellar atrophy with degeneration of Purkinje cells and progressive myopathy. Because the PERK branch of the unfolded protein response is activated in degenerating neurons of woozy mice, and inhibiting PERK-mediated translational attenuation has shown protective effects in protein-misfolding neurodegenerative disease models, we tested the therapeutic efficacy of GSK2606414, a potent inhibitor of PERK. Mice were chronically treated with GSK2606414 starting from a presymptomatic stage, and the effects were evaluated on biochemical, histopathological and clinical readouts. GSK2606414 delayed Purkinje cell degeneration and the onset of motor deficits, prolonging the asymptomatic phase of the disease; it also reduced the skeletal muscle abnormalities and improved motor performance during the symptomatic phase. The protein but not the mRNA level of ORP150, a nucleotide exchange factor which can substitute for SIL1, was increased in the cerebellum of GSK2606414-treated woozy mice, suggesting that translational recovery promoted the synthesis of this alternative BiP co-factor. Targeting PERK signaling may have beneficial disease-modifying effects in carriers of SIL1 mutations. Introduction Marinesco-Sjögren syndrome (MSS; OMIM 248800) is a rare autosomal recessive multisystem disease causing cerebellar ataxia, cataracts, myopathy, dysarthria, mental retardation, short stature and hypergonadotropic hypogonadism in some cases (1,2). Clinical signs appear in early infancy, and progress for a variable number of years; then they stabilize, and patients have a normal lifespan. There is no pharmacological therapy for MSS, apart from hormone replacement for primary gonadal failure, and medical care involves mainly educational and rehabilitative programs to improve walking, cognition and speaking. More than 60% of MSS patients carry homozygous or compound heterozygous mutations in the gene encoding SIL1 (also known as BiP-associated protein or BAP) (3–5). A spontaneous recessive Sil1 mutation (Sil1wz) is also responsible for the ataxic phenotype of woozy mice, which develop cerebellar atrophy with Purkinje cell (PC) loss, and myopathic changes highly reminiscent of MSS (6,7). The SIL1 protein is an ATP-exchange factor for the endoplasmic reticulum (ER) chaperone BiP (binding immunoglobulin protein, also known as GRP78) (8), which is essential in protein translocation and folding. Mutations in SIL1 are thought to impair BiP activity, leading to unfolded protein accumulation in the ER and maladaptive unfolded protein response (UPR) (3,6). Supporting this, degenerating PCs in cerebellar lobules I–VIII of woozy mice contain ubiquitinated protein inclusions and display typical signs of UPR, including elevated levels of BiP and of the pro-apoptotic factor CHOP (C/EBP homologous protein, also known as GADD153) (6). Overexpression of ORP150 (oxygen-regulated protein of 150 kDa, also known as GRP170), an ATP-exchange factor that works in parallel with SIL1, prevents ER stress and PC death, while reducing its expression exacerbates neurodegeneration, leading to UPR activation and PC loss also in the caudal lobules IX and X, which are normally preserved in woozy mice (9). The kinase PERK [protein kinase RNA (PKR)-like ER kinase] is one of the three primary effectors of the UPR, the others being ATF6 (activating transcription factor 6) and IRE1 (inositol-requiring enzyme 1) (10). PERK is an ER transmembrane protein containing a stress-sensing domain facing the ER lumen, and a cytosolic kinase domain. PERK is maintained in its inactive state through its association with BiP. An increase in unfolded proteins in the ER lumen causes the release of BiP from the PERK stress-sensing domain, resulting in PERK activation via oligomerization and autophosphorylation. Activated PERK phosphorylates eIF2α (the α-subunit of the eukaryotic initiation factor 2) in the cytoplasm, preventing the formation of methionine-bearing ternary complexes needed to initiate protein translation, thereby reducing global protein synthesis as a mechanism to manage the load of unfolded proteins in the ER (10). Some specific mRNAs, however, are preferentially synthesized during phospho-eIF2α (eIF2α-P)-mediated translational attenuation. These include the mRNA encoding ATF4 (activating transcription factor 4), which upregulates the expression of genes encoding ER chaperones and proteins involved in amino acid metabolism, autophagy and redox balance. ATF4 also upregulates GADD34 (growth arrest and DNA-damage-inducible protein-34), the regulatory subunit of the serine/threonine protein phosphatase 1, which dephosphorylates eIF2α-P, providing a negative feedback mechanism that helps rapidly restore protein synthesis upon resolution of ER stress. If ER stress is not resolved, prolonged expression of ATF4 upregulates CHOP, which initiates the apoptotic signaling cascade, leading to cell death. Chronic activation of the PERK/eIF2α branch of the UPR appears to be especially detrimental to neurons, which are exquisitely dependent on new protein synthesis for synaptic maintenance and survival. Thus genetic and pharmacological inhibition of the pathway to restore protein synthesis has marked neuroprotective effects in prion-infected mice and in a transgenic mouse model of frontotemporal dementia (rTg4510 tauP301L), rescuing synaptic failure and behavioral deficits (11–14). In some neurodegenerative conditions, however, prolonging rather than inhibiting PERK/eIF2α signaling is neuroprotective: for example, in the SOD1 G93A mouse model of amyotrophic lateral sclerosis and in the α-synuclein A53T mouse model of Parkinson’s disease (15–17). Thus, manipulating PERK/eIF2α signaling may have different effects in different neurodegenerative diseases, perhaps depending on the nature of the stress induced by the specific misfolded protein (18). We examined the role of the PERK pathway in the woozy mouse model of MSS, in which ER stress is triggered by loss of SIL1 co-chaperone activity, rather than by misfolding of a single disease-related protein. We first analyzed the activation of PERK/eIF2α signaling in relation to cerebellar degeneration and motor dysfunction. Next, we tested the effects of pharmacological inhibition of PERK on the development of motor symptoms, PC loss and muscle pathology. Results PERK/eIF2α signaling is activated in Purkinje cells of woozy mice before cerebellar degeneration and onset of motor dysfunction Woozy mice develop ataxia between 3 and 4 months of age (6). To determine the first appearance of motor dysfunction more precisely and follow its course, groups of wild-type (WT) and woozy littermate mice were periodically tested on the accelerating rotarod. This motor behavioral task requires the animals to walk on an accelerating rotating rod, with latency to fall as a readout, and is a sensitive test of cerebellar abnormalities. There were no significant differences in rotarod performance between the two groups of mice up to 8 weeks of age (Fig. 1A). From 10 weeks on, however, woozy mice showed a shorter latency to fall than WT controls; their performance worsened up to 16 weeks of age, after which there was no further significant decline (Fig. 1A). Magnetic resonance imaging (MRI) detected a ∼50% reduction in the cerebellar volume of woozy compared with WT mice (Fig. 1B and C). Figure 1. View largeDownload slide Woozy mice develop motor dysfunction and cerebellar atrophy. (A) Groups of WT and woozy mice were tested on the rotarod at the ages indicated. Each mouse was tested three times, and the mean latency to fall was calculated. Bars indicate the mean ± S.E.M. of latency to fall (s) for 9–10 animals; F9,144 = 20.95; P < 0.0001 by two-way analysis of variance for repeated measures (RM-ANOVA); **P < 0.01; ****P < 0.0001 Bonferroni’s post-hoc test. (B) Representative T2-weighted images (TE/TR = 50/2, 500 ms) of a WT and a woozy mouse at 28 weeks of age. (C) Volume of the cerebellum, normalized on the intracranial volume, of 9 WT and 9 woozy mice at 28 weeks of age. ****P < 0.0001 by Student’s t-test. Figure 1. View largeDownload slide Woozy mice develop motor dysfunction and cerebellar atrophy. (A) Groups of WT and woozy mice were tested on the rotarod at the ages indicated. Each mouse was tested three times, and the mean latency to fall was calculated. Bars indicate the mean ± S.E.M. of latency to fall (s) for 9–10 animals; F9,144 = 20.95; P < 0.0001 by two-way analysis of variance for repeated measures (RM-ANOVA); **P < 0.01; ****P < 0.0001 Bonferroni’s post-hoc test. (B) Representative T2-weighted images (TE/TR = 50/2, 500 ms) of a WT and a woozy mouse at 28 weeks of age. (C) Volume of the cerebellum, normalized on the intracranial volume, of 9 WT and 9 woozy mice at 28 weeks of age. ****P < 0.0001 by Student’s t-test. CHOP is upregulated in degenerating PCs of woozy mice, suggesting that the PERK branch of the UPR is active in these neurons (6). To confirm this, and assess the temporal relation between PERK/eIF2α signaling and neurodegeneration, we immunostained the cerebella of 4–16 weeks-old woozy mice with antibodies against eIF2α-P and CHOP, with an anti-calbindin antibody to selectively mark PCs. There was no difference in PC density and dendritic arborization between WT and woozy mice up to 6 weeks of age, but PCs were clearly degenerating in 8-week-old woozy mice, and were almost completely lost by 16 weeks (Figs 2A, and 6D and E). At 6 weeks of age there were many eIF2α-P- and CHOP-immunopositive PCs in the anterior cerebellar lobes of woozy mice (Fig. 2B and C). Figure 2. View largeDownload slide Phosphorylated eIF2α and CHOP are up-regulated in PC of woozy mice before neurodegeneration. Brain sections from WT and woozy mice of the ages indicated were incubated with an anti-calbindin antibody (A), or with anti-calbindin and anti-eIF2α-P (B) or anti-CHOP (C) antibodies. Sections were incubated with Alexa 488 (green)- or Alexa 594 (red)-conjugated secondary antibodies, and reacted with Hoechst 33258 (blue) to stain the nuclei. Scale bars, 50 μm in (A), and 100 μm in (B) and (C). Figure 2. View largeDownload slide Phosphorylated eIF2α and CHOP are up-regulated in PC of woozy mice before neurodegeneration. Brain sections from WT and woozy mice of the ages indicated were incubated with an anti-calbindin antibody (A), or with anti-calbindin and anti-eIF2α-P (B) or anti-CHOP (C) antibodies. Sections were incubated with Alexa 488 (green)- or Alexa 594 (red)-conjugated secondary antibodies, and reacted with Hoechst 33258 (blue) to stain the nuclei. Scale bars, 50 μm in (A), and 100 μm in (B) and (C). Phosphorylated eIF2α and PERK were also detectable by western blot of whole cerebellar lysates (Figs 3A, and 7A and B). Reverse transcription quantitative real-time PCR (RT-qPCR) confirmed the increase in CHOP, and found increases in the levels of both total and spliced XBP-1 mRNAs in the cerebellum of woozy mice aged 6 weeks (Fig. 3B), indicating that the ATF6 and IRE1 branches of the UPR were also activated (19). These markers decreased at 10 and 16 weeks of age, most likely because of progressive PC loss (Fig. 3B). In the cerebrum there was no increase in UPR markers at any of the times tested (Fig. 4). Figure 3. View largeDownload slide Analysis of UPR markers in the cerebellum of woozy mice. (A) Protein extracts (20 μg) from the whole cerebella of WT and woozy littermate mice of 6 weeks of age were analyzed by western blot with anti-eIF2α-P and anti-total eIF2α antibodies. Molecular mass markers are in kilodaltons. (B) Total RNA was extracted from the cerebella of WT and woozy mice of 6, 10 and 16 weeks of age, reverse-transcribed and analyzed by RT-qPCR. mRNAs were quantified by the ΔΔCt method and expressed as the fold difference from the levels in age-matched WT mice (dotted line). Data are the mean ± S.E.M. of 4–5 animals per experimental group. *P < 0.05, **P < 0.01 by Student’s t-test. Figure 3. View largeDownload slide Analysis of UPR markers in the cerebellum of woozy mice. (A) Protein extracts (20 μg) from the whole cerebella of WT and woozy littermate mice of 6 weeks of age were analyzed by western blot with anti-eIF2α-P and anti-total eIF2α antibodies. Molecular mass markers are in kilodaltons. (B) Total RNA was extracted from the cerebella of WT and woozy mice of 6, 10 and 16 weeks of age, reverse-transcribed and analyzed by RT-qPCR. mRNAs were quantified by the ΔΔCt method and expressed as the fold difference from the levels in age-matched WT mice (dotted line). Data are the mean ± S.E.M. of 4–5 animals per experimental group. *P < 0.05, **P < 0.01 by Student’s t-test. Figure 4. View largeDownload slide Analysis of UPR markers in the cerebrum of woozy mice. (A) Total RNA was extracted from the cerebra of WT and woozy mice of 6, 10 and 16 weeks of age, reverse-transcribed and analyzed by RT-qPCR. mRNAs were quantified by the ΔΔCt method and expressed as the fold difference from the levels in age-matched WT mice (dotted line). Data are the mean ± S.E.M. of 4–7 animals per experimental group. (B) Protein extracts (20 μg) from the cerebra of 16 weeks old WT and woozy mice were analyzed by western blot with anti-PERK-P and anti-total PERK antibodies. The ratio of PERK-P/PERK was quantified by densitometic analysis of western blots. Data are the mean ± S.E.M. of five animals per group. (C) The same protein extracts used in (B) were analyzed with anti-eIF2α-P and anti-total eIF2α antibodies. Results were similar in animals of 6 and 10 weeks of age. Figure 4. View largeDownload slide Analysis of UPR markers in the cerebrum of woozy mice. (A) Total RNA was extracted from the cerebra of WT and woozy mice of 6, 10 and 16 weeks of age, reverse-transcribed and analyzed by RT-qPCR. mRNAs were quantified by the ΔΔCt method and expressed as the fold difference from the levels in age-matched WT mice (dotted line). Data are the mean ± S.E.M. of 4–7 animals per experimental group. (B) Protein extracts (20 μg) from the cerebra of 16 weeks old WT and woozy mice were analyzed by western blot with anti-PERK-P and anti-total PERK antibodies. The ratio of PERK-P/PERK was quantified by densitometic analysis of western blots. Data are the mean ± S.E.M. of five animals per group. (C) The same protein extracts used in (B) were analyzed with anti-eIF2α-P and anti-total eIF2α antibodies. Results were similar in animals of 6 and 10 weeks of age. Thus the UPR—particularly the PERK/eIF2α branch—was clearly activated in the woozy mouse cerebellum starting from a pre-neurodegenerative stage, calling for further investigations to test the therapeutic inhibition of PERK signaling. Pharmacological PERK inhibition is neuroprotective, and delays the onset and progression of clinical disease in woozy mice We tested the therapeutic effect of GSK2606414, an orally available PERK inhibitor (20). In a first pilot experiment, groups of WT and woozy mice (four per group) were treated twice daily with 50 mg/kg GSK2606414 or the vehicle starting from 4 weeks of age. To check for any beneficial effect before motor deficits became detectable on the accelerating rotarod, we used the beam walking test (see Study design in the Materials and Methods section), which is a sensitive indicator of fine motor coordination and balance in mouse models of spinocerebellar ataxia. Mice walked on a suspended metal beam, 0.8 cm wide, 100 cm long, and the number of hindfoot missteps and time to traverse the beam were recorded. There were no differences in performance between the different groups of mice up to 6 weeks of age (Fig. 5A and B). At 7 weeks, however, the number of hindfoot missteps and the time to traverse the beam in vehicle-treated woozy mice were significantly higher than in WT controls, with missteps further increasing at 8 and 9 weeks. Strikingly, the motor performance of GSK2606414-treated woozy mice was undistinguishable from that of WT controls (Fig. 5A and B, andSupplementary Material, Movie S1); they only showed a slight, non-significant increase in missteps after 5 weeks (9 weeks of age) (Fig. 5A), at which time the experiment was terminated to assess the effect of PERK inhibition on incipient cerebellar pathology. Figure 5. View largeDownload slide GSK2606414 delays the onset of motor dysfunction and PC degeneration in woozy mice. (A) Groups of WT and woozy mice (four each) were given GSK2606414 or the vehicle starting from 4 weeks of age, and tested weekly for their ability to walk on a suspended beam. Each mouse was tested three times and the mean number of hindfoot missteps was scored. Data are the mean ± S.E.M. F12,48 = 14.27; P < 0.0001 by two-way RM-ANOVA; ****P < 0.0001 woozy vehicle versus all other groups by Tukey’s post hoc test. (B) Mean time to traverse the beam during the three trials. Data are the mean ± S.E.M. F12,48 = 3.836 P = 0.0004 by two-way RM-ANOVA; *P < 0.05, ****P < 0.0001 woozy vehicle versus all other groups by Tukey’s post-hoc test. (C) CHOP immunostaining in cerebellar sections of WT and woozy mice treated with GSK2606414 or the vehicle for 5 weeks. (D) The number of CHOP-positive PC was analyzed by immunohistochemistry and expressed as the percentage of total PCs. Data are the mean ± SEM of 16–19 brain sections from four animals per experimental group. *P < 0.05 by Student’s t-test. No CHOP-positive PCs were detected in vehicle- and GSK2606414-treated WT mice. (E) Calbindin immunostaining in cerebellar sections of WT and woozy mice treated with GSK2606414 or the vehicle for 5 weeks. The boxes outlined in panels (i)-(iv) indicate the areas shown at higher magnification in panels (v)-(viii). Scale bars, 400 μm in (i)–(iv), and 50 μm in (v)–(viii). (F) Percentage of the calbinding positive area in the PC and molecular layers of the cerebellar cortex. Data are the mean ± S.E.M. of 21–27 brain sections from four animals per experimental group. F1,12 = 17.17; P = 0.0014 by two-way ANOVA, ***P < 0.001 by Bonferroni’s post-hoc test. Figure 5. View largeDownload slide GSK2606414 delays the onset of motor dysfunction and PC degeneration in woozy mice. (A) Groups of WT and woozy mice (four each) were given GSK2606414 or the vehicle starting from 4 weeks of age, and tested weekly for their ability to walk on a suspended beam. Each mouse was tested three times and the mean number of hindfoot missteps was scored. Data are the mean ± S.E.M. F12,48 = 14.27; P < 0.0001 by two-way RM-ANOVA; ****P < 0.0001 woozy vehicle versus all other groups by Tukey’s post hoc test. (B) Mean time to traverse the beam during the three trials. Data are the mean ± S.E.M. F12,48 = 3.836 P = 0.0004 by two-way RM-ANOVA; *P < 0.05, ****P < 0.0001 woozy vehicle versus all other groups by Tukey’s post-hoc test. (C) CHOP immunostaining in cerebellar sections of WT and woozy mice treated with GSK2606414 or the vehicle for 5 weeks. (D) The number of CHOP-positive PC was analyzed by immunohistochemistry and expressed as the percentage of total PCs. Data are the mean ± SEM of 16–19 brain sections from four animals per experimental group. *P < 0.05 by Student’s t-test. No CHOP-positive PCs were detected in vehicle- and GSK2606414-treated WT mice. (E) Calbindin immunostaining in cerebellar sections of WT and woozy mice treated with GSK2606414 or the vehicle for 5 weeks. The boxes outlined in panels (i)-(iv) indicate the areas shown at higher magnification in panels (v)-(viii). Scale bars, 400 μm in (i)–(iv), and 50 μm in (v)–(viii). (F) Percentage of the calbinding positive area in the PC and molecular layers of the cerebellar cortex. Data are the mean ± S.E.M. of 21–27 brain sections from four animals per experimental group. F1,12 = 17.17; P = 0.0014 by two-way ANOVA, ***P < 0.001 by Bonferroni’s post-hoc test. The number of CHOP-immunopositive PCs was significantly reduced in woozy mice treated with GSK2606414 (Fig. 5C and D), consistent with inhibition of PERK and downstream signaling. Immunohistochemistry with the anti-calbindin antibody showed clear preservation of PC bodies and dendritic arborizations in GSK2606414-treated woozy mice (Fig. 5E); in fact, the percentage of calbindin-positive area in their cerebellar cortex was similar to that of WT controls (Fig. 5F). To assess the long-term effects of the treatment, we repeated the experiment using larger groups of mice (10 per group), again giving GSK2606414 twice daily from 4 weeks of age. Mice were assessed weekly on the accelerating rotarod starting from the fifth week of treatment, at which time vehicle-treated woozy mice had a significantly shorter latency to fall than WT controls (Fig. 6A). However, the latency to fall of woozy mice treated with GSK2606414 was comparable to that of WT animals (Fig. 6A), confirming the protective effect of PERK inhibition on motor dysfunction, documented by the beam walking test (Fig. 5A and B). At later times, however, rotarod performance progressively declined in both vehicle- and GSK2606414-treated woozy mice, although the latter continued to do better (Fig. 6A). Figure 6. View largeDownload slide GSK2606414-treated woozy mice eventually develop ataxia and cerebellar atrophy, but have better motor performance and significantly less PC degeneration than vehicle-treated controls. (A) Groups of WT and woozy mice (10 each) treated with GSK2606414 or the vehicle were tested weekly on the accelerating rotarod at the treatment times/ages indicated. Bars indicate the mean ± S.E.M. of latency to fall (s); F21,238 = 3.294; P < 0.0001 by two-way RM-ANOVA; *P < 0.05; **P  < 0.01; ***P < 0.001; ****P < 0.0001; ns, non-significant versus WT GSK2606414 Tukey’s post-hoc test. (B) Brain anatomy of vehicle- and GSK2606414-treated WT and woozy mice after 10 weeks of treatment. Representative T2-weighted images (TE/TR, 50/2, 500 ms). (C) Bars indicate the mean ± S.E.M. cerebellar volumes normalized on the intracranial volumes. F1,35 = 2.744; P = 0.1066 by two-way ANOVA. (D) Calbindin immunostaining in cerebellar sections of WT and woozy mice treated with GSK2606414 or the vehicle for 12 weeks. The boxes outlined in panels (iii) and (iv) indicate the areas shown at higher magnification in panels (v) and (vi). Scale bars, 400 μm in (i)-(iv), and 100 μm in (v) and (vi). (E) Percentages of the calbindin-positive area in the PC and molecular layers of the cerebellar cortex. Data are the mean ± S.E.M. of 19–20 brain sections from five animals per experimental group. F1,16 = 5.638; P = 0.0304 by two-way ANOVA; **P < 0.01 Bonferroni’s post-hoc test. Figure 6. View largeDownload slide GSK2606414-treated woozy mice eventually develop ataxia and cerebellar atrophy, but have better motor performance and significantly less PC degeneration than vehicle-treated controls. (A) Groups of WT and woozy mice (10 each) treated with GSK2606414 or the vehicle were tested weekly on the accelerating rotarod at the treatment times/ages indicated. Bars indicate the mean ± S.E.M. of latency to fall (s); F21,238 = 3.294; P < 0.0001 by two-way RM-ANOVA; *P < 0.05; **P  < 0.01; ***P < 0.001; ****P < 0.0001; ns, non-significant versus WT GSK2606414 Tukey’s post-hoc test. (B) Brain anatomy of vehicle- and GSK2606414-treated WT and woozy mice after 10 weeks of treatment. Representative T2-weighted images (TE/TR, 50/2, 500 ms). (C) Bars indicate the mean ± S.E.M. cerebellar volumes normalized on the intracranial volumes. F1,35 = 2.744; P = 0.1066 by two-way ANOVA. (D) Calbindin immunostaining in cerebellar sections of WT and woozy mice treated with GSK2606414 or the vehicle for 12 weeks. The boxes outlined in panels (iii) and (iv) indicate the areas shown at higher magnification in panels (v) and (vi). Scale bars, 400 μm in (i)-(iv), and 100 μm in (v) and (vi). (E) Percentages of the calbindin-positive area in the PC and molecular layers of the cerebellar cortex. Data are the mean ± S.E.M. of 19–20 brain sections from five animals per experimental group. F1,16 = 5.638; P = 0.0304 by two-way ANOVA; **P < 0.01 Bonferroni’s post-hoc test. This was confirmed by the beam walking test at 10 weeks of treatment. Both vehicle- and GSK2606414-treated woozy mice were unable to walk on the suspended beam without dragging the hindlimbs, so the hindfoot missteps could not be scored (Supplementary Material, Movie S2). The two groups of mice took the same time to traverse the beam (Supplementary Material, Fig. S1); however, GSK2606414-treated mice fell from the beam much less during the three trials than vehicle-treated controls, with only one falling once in the treated woozy group, compared with six falling a total of 23 times in the vehicle group. Progressive tremor is part of the neurological picture of woozy mice (6). Mild tremor is first apparent at ∼10 weeks of age when mice start walking; the tremor is perpendicular to the line of motion and can be clearly seen when mice walk on the suspended beam, possibly contributing to their poor performance in this test (Supplementary Material, Movie S2). As the mice age, the tremor becomes more severe and can also be seen when mice start walking on a table top. Woozy mice were scored for tremors after 10 weeks of treatment (14 weeks of age). Eight mice in the vehicle-treated group had severe and two had mild tremor, while in the GSK2606414-treated group, five had severe and five had mild tremor. At this stage, MRI showed similar atrophy of the cerebellum in vehicle- and GSK2606414-treated woozy mice (Fig. 6B and C). However, calbindin immunostaining at the end of the experiment after 12 weeks of treatment showed that PCs were relatively spared in GSK2606414-treated woozy mice (Fig. 6D), so the calbindin-positive area was significantly larger than in vehicle-treated animals (Fig. 6E). Biochemical analysis showed reduced PERK-P levels in the cerebellum of GSK2606414-treated woozy mice (Fig. 7A and B), but no increase in mRNA expression of XBP1, which is induced by activated ATF6 (19), and IRE1-mediated XBP1 splicing (Fig. 7C and D), indicating that protracted PERK inhibition was not associated with over-activation of the other UPR branches. The protein but not the mRNA level of ORP150 was increased in the cerebellum of woozy mice treated with GSK2606414 (Fig. 8A–C). Immunofluorescence analysis of cerebellar sections showed that ORP150 was expressed in surviving PCs of GSK2606414-treated woozy mice (Fig. 8D). No significant changes in ORP150 protein or mRNA levels were found in the cerebrum of the treated mice (Supplementary Material, Fig. S2). Figure 7. View largeDownload slide Long-term treatment with GSK2606414 reduces the levels of phosphorylated PERK and has no effect on XBP1 expression or splicing. (A) Protein extracts (20 μg) from the cerebella of WT and woozy mice treated with the vehicle or GSK2606414 for 12 weeks were analyzed by western blot with anti-PERK-P and anti-total PERK antibodies. (B) The ratio of PERK-P/PERK was quantified by densitometric analysis of western blot, like the one in (A). Data are the mean ± S.E.M. of 4–5 animals per group. F(t)1,14 = 8.64; P = 0.0108 by two-way ANOVA; *P < 0.05 Bonferroni’s post-hoc test. (C, D) Total RNA was extracted from the cerebella of vehicle- or GSK2606414-treated WT and woozy mice, and total (C) and spliced (s) XBP1 (D) mRNA expression was quantified by RT-qPCR. Data are the mean ± S.E.M. of four animals per group. F1,12 = 0.1488; P = 0.7064 (in C) and F1,12 = 0.5312; P = 0.4801 (in D) by two-way ANOVA. Figure 7. View largeDownload slide Long-term treatment with GSK2606414 reduces the levels of phosphorylated PERK and has no effect on XBP1 expression or splicing. (A) Protein extracts (20 μg) from the cerebella of WT and woozy mice treated with the vehicle or GSK2606414 for 12 weeks were analyzed by western blot with anti-PERK-P and anti-total PERK antibodies. (B) The ratio of PERK-P/PERK was quantified by densitometric analysis of western blot, like the one in (A). Data are the mean ± S.E.M. of 4–5 animals per group. F(t)1,14 = 8.64; P = 0.0108 by two-way ANOVA; *P < 0.05 Bonferroni’s post-hoc test. (C, D) Total RNA was extracted from the cerebella of vehicle- or GSK2606414-treated WT and woozy mice, and total (C) and spliced (s) XBP1 (D) mRNA expression was quantified by RT-qPCR. Data are the mean ± S.E.M. of four animals per group. F1,12 = 0.1488; P = 0.7064 (in C) and F1,12 = 0.5312; P = 0.4801 (in D) by two-way ANOVA. Figure 8. View largeDownload slide ORP150 increases in the cerebellum of GSK2606414-treated woozy mice. (A) Protein extracts (20 μg) from the cerebella of vehicle- or GSK2606414-treated woozy mice were analyzed by western blot with anti-ORP150 (top panel) and anti-vinculin (lower panel) antibodies. (B) ORP150 was quantified by densitometic analysis, normalized for the amount of vinculin and expressed as a percentage of the amount in WT mice. Data are the mean ± S.E.M. of 4–5 animals per experimental group. *P < 0.05 by one-way ANOVA, Tukey’s post-hoc test. (C) ORP150 mRNA was quantified by RT-qPCR and expressed as percentage of WT. Data are the mean ± S.E.M.; n = 3–4; F2,7 = 0.7435; P = 0.5096 by one-way ANOVA. (D) Brain sections from vehicle- and GSK2606414-treated mice were incubated with anti-ORP150 and anti-calbindin antibodies. Sections were incubated with Alexa 488 (green)- or Alexa 594 (red)-conjugated secondary antibodies, and reacted with Hoechst 33258 (blue) to stain the nuclei. Scale bar, 25 μm. No significant changes in ORP150 mRNA or protein levels were seen in WT mice treated with GSK2606414 (data not shown). Figure 8. View largeDownload slide ORP150 increases in the cerebellum of GSK2606414-treated woozy mice. (A) Protein extracts (20 μg) from the cerebella of vehicle- or GSK2606414-treated woozy mice were analyzed by western blot with anti-ORP150 (top panel) and anti-vinculin (lower panel) antibodies. (B) ORP150 was quantified by densitometic analysis, normalized for the amount of vinculin and expressed as a percentage of the amount in WT mice. Data are the mean ± S.E.M. of 4–5 animals per experimental group. *P < 0.05 by one-way ANOVA, Tukey’s post-hoc test. (C) ORP150 mRNA was quantified by RT-qPCR and expressed as percentage of WT. Data are the mean ± S.E.M.; n = 3–4; F2,7 = 0.7435; P = 0.5096 by one-way ANOVA. (D) Brain sections from vehicle- and GSK2606414-treated mice were incubated with anti-ORP150 and anti-calbindin antibodies. Sections were incubated with Alexa 488 (green)- or Alexa 594 (red)-conjugated secondary antibodies, and reacted with Hoechst 33258 (blue) to stain the nuclei. Scale bar, 25 μm. No significant changes in ORP150 mRNA or protein levels were seen in WT mice treated with GSK2606414 (data not shown). GSK2606414 attenuates the muscle pathology of woozy mice Woozy mice develop severe progressive myopathy, with upregulation of UPR markers, which is first evident at 16 weeks of age by electron microscopy when histological examination is still unrevealing (7). To test whether GSK2606414 had any effect on skeletal muscle, we analyzed the quadriceps of the treated mice by transmission electron microscopy. Consistent with previous observations (7), we found a number of ultrastructural alterations in the muscle fibers of woozy mice that were absent in WT controls. These included enlargements of the sarcoplasmic reticulum in the myofibrillar compartment and the presence of perinuclear autophagic vacuoles containing myelin-like membranous material (Fig. 9A). These alterations were seen in both vehicle- and GSK2606414-treated animals, although they were less marked in the latter (Fig. 9B and C). Figure 9. View largeDownload slide GSK2606414 attenuates the ultrastructural alterations in the quadriceps muscle fibers of woozy mice. Quadriceps muscle ultrastructure of vehicle- and GSK2606414-treated mice after 12 weeks of treatment (16 week of age). (A) Examples of normal intermyofibrillar (i) and perinuclear (iv) muscle fiber ultrastructure in two vehicle-treated WT mice; pathological enlargement of the sarcoplasmic reticulum in the myofibrillar compartment of a woozy mouse treated with the vehicle (ii) or GSK2606414 (iii); perinuclear vacuoles (black arrows) sometimes engulfed with myelin-like autophagic material (white arrows) in the skeletal muscle of a woozy mouse treated with vehicle (v) or GSK2606414 (vi). Scale bar, 1 μm. (B) Percentage of the area occupied by the sarcoplasmic reticulum in the myofibrillar compartment of the different groups of mice. Data are the mean ± S.E.M. of four animals per experimental group. F1,12 = 45.33; P < 0.0001 by two-way ANOVA; ****P < 0.0001 by Bonferroni’s post-hoc test. (C) Percentage of nuclei with perinuclear ultrastructural alterations. Data are the mean ± S.E.M.; *P < 0.05 by t-test. No perinuclear abnormalities were observed in WT mice. Figure 9. View largeDownload slide GSK2606414 attenuates the ultrastructural alterations in the quadriceps muscle fibers of woozy mice. Quadriceps muscle ultrastructure of vehicle- and GSK2606414-treated mice after 12 weeks of treatment (16 week of age). (A) Examples of normal intermyofibrillar (i) and perinuclear (iv) muscle fiber ultrastructure in two vehicle-treated WT mice; pathological enlargement of the sarcoplasmic reticulum in the myofibrillar compartment of a woozy mouse treated with the vehicle (ii) or GSK2606414 (iii); perinuclear vacuoles (black arrows) sometimes engulfed with myelin-like autophagic material (white arrows) in the skeletal muscle of a woozy mouse treated with vehicle (v) or GSK2606414 (vi). Scale bar, 1 μm. (B) Percentage of the area occupied by the sarcoplasmic reticulum in the myofibrillar compartment of the different groups of mice. Data are the mean ± S.E.M. of four animals per experimental group. F1,12 = 45.33; P < 0.0001 by two-way ANOVA; ****P < 0.0001 by Bonferroni’s post-hoc test. (C) Percentage of nuclei with perinuclear ultrastructural alterations. Data are the mean ± S.E.M.; *P < 0.05 by t-test. No perinuclear abnormalities were observed in WT mice. Finally, we used high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) to measure the levels of GSK2606414 in the blood and tissues of the treated mice. GSK2606414 concentrations in the blood, brain and quadriceps muscles taken at the end of the study (∼4 h after last dose) were 5968 ± 523 ng/ml, 4667 ± 541 ng/g and 4966 ± 543 ng/g, respectively (mean ± S.E.M.; n = 10). Mean brain/blood and muscle/blood ratios were 0.78 and 0.83. This confirmed that the compound had penetrated the brain and skeletal muscle of the woozy mice, reaching therapeutically useful concentrations similar to those reported by others (13). Discussion We tested the effect of pharmacologically inhibiting PERK kinase in the woozy mouse model of MSS, in which activation of PERK/eIF2α signaling prefigures PC degeneration, ataxia and myopathy. Treatment of presymptomatic mice with the PERK inhibitor GSK2606414 delayed neurodegeneration and the onset of motor dysfunction, prolonging the asymptomatic phase of the disease, and attenuated the motor impairment and skeletal muscle pathology in the symptomatic phase. Thus inhibiting PERK signaling early in the disease may have significant potential to alleviate symptoms and delay progression of neurodegeneration and myopathy. Cerebellar ataxia is a prominent pathological feature of MMS, which develops during infancy, worsens progressively for some years, then stabilizes (1). Similarly, early in their life woozy mice develop motor deficits detectable in the beam walking and rotarod tests, and their motor function worsens progressively to a point beyond which it does not decline further. At this stage both MRI and histological analysis indicate marked cerebellar atrophy. Cerebellar degeneration is characterized by selective loss of PCs of lobules I–VIII, in which BiP and CHOP are upregulated (6). We have now found that eIF2α is phosphorylated in these cells, and eIF2α-P and CHOP are already increased at 6 weeks of age before neurons degenerate and motor deficits ensue, between 7 and 10 weeks. Thus the PERK branch of the UPR is activated from an early stage in the cerebellum of woozy mice, like in prion-infected mice, and in rTg4510 tauP301L mice modeling frontotemporal dementia, in which activation of PERK precedes neurodegeneration and the appearance of neurological signs (13,14). Oral treatment with GSK2606414 starting from the fifth week of life significantly delayed the appearance of ataxia in woozy mice. After five weeks, when mice given vehicle were clearly impaired in the beam walking and rotarod tests, and showed significant loss of vulnerable PCs, motor deficits were absent and PCs were spared in GSK2606414-treated mice. This result is in line with the neuroprotective effects of GSK2606414 in prion-diseased and rTg4510 tauP301L mice (13,14). Treatment of prion-infected tg37 mice overexpressing the prion protein (PrP) from 7 weeks post-inoculation (w.p.i.) prevented the memory deficit and the abnormal burrowing behavior normally seen in this model at 9 w.p.i., and preserved hippocampal CA1 pyramidal neurons at 12 w.p.i. (13,14). In rTg4510 tauP301L mice, in which hippocampal degeneration and behavioral abnormalities develop much more slowly than in prion-infected mice, chronic GSK2606414 treatment from 6 months of age, when degeneration of CA1 neurons is beginning, reduced further neuronal loss and prevented clinical signs at 8 months of age (14). However, whether GSK2606414 provided long-term neuroprotection was not investigated in these models (in prion-infected mice this was not possible because of loss of 20% body mass by 12 w.p.i. which, per protocol, required the investigators to terminate the experiment). In woozy mice, we tested the effect of GSK2606414 up to 16 weeks of age, when in the absence of any treatment PCs are almost completely lost and motor function has maximally declined. In contrast to the almost complete neuroprotection seen after 5 weeks of treatment, after 12 weeks there was widespread loss of PCs, although still significantly less than in vehicle-treated mice. Consistent with this, GSK2606414-treated woozy mice continued to perform better in the rotarod and beam walking tests, and had less severe tremors than vehicle-treated controls. Thus even a modest increase in PC survival had detectable beneficial effects. The GSK2606414 concentrations in the brains of woozy mice were similar to those reported in other mouse models, ruling out the possibility that partial neuroprotection was due to poor compound bioavailability. Moreover, PERK-P was low in the cerebellum of GSK2606414-treated woozy mice, indicating continued inhibition of PERK signaling. There was no increase in total or spliced XBP1 mRNA expression, suggesting that protracted PERK inhibition did not lead to ATF6 and IRE1 over-activation. The observation that GSK2606414 delayed but did not halt PC degeneration suggests that PERK-mediated UPR is not the effector mechanism of neuronal cell death in woozy mice, and is consistent with evidence that genetic ablation of CHOP is not neuroprotective in this model (9). So how does PERK inhibition retard PC demise, and how do these cells eventually die? Blocking PERK/eIF2α-mediated translational attenuation, either genetically or pharmacologically, restores the synthesis of vital pre- and post-synaptic proteins in the hippocampus of prion-infected mice, and this accounts for the positive effects on synaptic transmission, neuronal survival and behavior (11–13). Recovery of synaptic protein synthesis is also likely to explain the neuroprotective effect of GSK2606414 in rTg4510 tauP301L mice, and may contribute to prolonging the survival of PCs in woozy mice. Unlike in prion diseases and frontotemporal dementia, where neurodegeneration is due to a gain of toxicity of misfolded PrP or tau, neuronal death in MSS is caused by functional loss of SIL1, which is important for BiP chaperone activity. BiP’s ability to bind unfolded proteins and release the folded substrate is tightly regulated by a cycle of ATP binding, hydrolysis and nucleotide exchange, which is controlled by a number of cofactors (21). SIL1 binds to ADP-bound BiP to catalyze the release of ADP and rebinding of ATP. In the absence of this nucleotide exchange, BiP remains associated with its client protein, ultimately leading to accumulation of unfolded proteins and the UPR. ORP150 can substitute for SIL1 (22), and its transgenic overexpression prevents PC death in woozy mice (9). Pharmacological PERK inhibition, by rescuing protein translation, may allow for more efficient ORP150 synthesis in ER-stressed PCs, restoring BiP-assisted folding and transport of membrane proteins essential for neuronal function and survival. In line with this, ORP150 was increased in PCs of GSK2606414-treated woozy mice, and PERK inhibition rescued the impairment in membrane protein trafficking seen in SIL1-deficient cells (manuscript submitted). However, in the long run this may still not be enough to support the normal activity of Purkinje neurons which, when dysfunctional, become susceptible to a variety of stresses and eventually die (23). Electron microscopy of the quadriceps muscles of GSK2606414-treated woozy mice showed attenuation of the incipient myopathy detectable in this model at 16 weeks of age. In contrast to the almost complete protection by GSK2606414 from early neuronal death, skeletal muscle was only partially protected, with pathological myofibers reduced by ∼40%. This is unlikely to be due to poor GSK2606414 penetration, since its concentrations in the quadriceps and brain were similar, but may be related to the fact that in the woozy skeletal muscle PERK is poorly activated (7). Thus, other signaling pathways may contribute to skeletal muscle degeneration that GSK2606414 cannot counteract (24). The delay in the onset of motor deficits and prolonged amelioration of motor function in GSK2606414-treated woozy mice might potentially translate into a significant improvement in the quality of life for carriers of SIL1 mutations, who could be diagnosed by molecular genetic screening prenatally or soon after birth, and treated in a pre-symptomatic stage. The use of GSK2606414 in humans, however, is questionable because of its pancreatic toxicity and effect on body weight seen in preclinical models of prion disease (13). In this regard, we found degeneration of exocrine acinar pancreatic tissue (Supplementary Material, Fig. S3) but no weight loss in woozy mice after 3 months of continuous GSK2606414, although they did not gain weight like vehicle-treated controls (Supplementary Material, Fig. S4). There was also no obvious sign of distress or alteration in home-cage behavior in treated WT or woozy mice. Thus in neurodegenerative conditions less severe than the rapidly progressing prion diseases, PERK pathway inhibition may be tolerable and managed clinically to achieve the intended therapeutic benefit without significant side effects. In addition, small-molecule inhibitors of PERK signaling have been described that act downstream of eIF2α-P and uncouple the neuroprotective effect from pancreatic toxicity (11,25). So it may be useful to pursue this approach for the treatment of SIL1-related MSS and other diseases associated with pathological PERK activation. Materials and Methods Study design The aim of the study was to test whether pharmacological inhibition of PERK is protective in the woozy mouse model of MSS. The rationale is based on findings that the PERK/eIF2a branch of the UPR is activated in degenerating Purkinje neurons and skeletal muscle fibers of woozy mice (6,7,9 and this study), and that genetic and pharmacological inhibition of the pathway is protective in several neurodegenerative disease models (11–14,26). We therefore tested the effect of GSK2606414, an orally available pharmacological inhibitor of PERK, on clinical and histopathological readouts. Longitudinal assessment of motor function was preliminarily employed to determine the onset and progression of ataxia in naïve woozy mice (Fig. 1A). Then treatment with GSK2606414 was planned in order to overlap the whole progressive phase of the disease, starting from a presymptomatic stage (i.e. from 4 to 16 weeks of age). Since we found no significant differences in motor performance and cerebellar anatomy between +/+ and +/wz mice (latency to fall from the rotarod at 34 weeks of age was 200 ± 13 s in +/+, and 217 ± 28 s in +/wz mice; the cerebellar volume at 28 weeks was 49.3 ± 1.0 mm3 in +/+, and 48.6 ± 1.6 mm3 in +/wz mice; mean ± S.E.M.; n = 9–10), animals of both genotypes were pooled and used as controls. No sex-related differences in the woozy phenotype were observed, so both male and female mice were included. The beam walking test, which detects subtle deficits in motor skills and balance but is too hard for severely ataxic woozy mice, was used to assess the effect of PERK inhibition on early motor dysfunction; the accelerating rotarod test, which is less challenging and can also be run with woozy mice in the advanced stage of disease, was used to monitor the long-term effects of the treatment starting from 9 weeks of age, when preliminary analysis indicated performance was beginning to be impaired in vehicle-treated woozy mice (Fig. 1A). Mice were trained three times to walk on the suspended beam and the accelerating rotating rod during the fourth week of life. At the end of the training there were no significant differences in performance between mice assigned to the different experimental groups. All animal experiments were designed in accordance with the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines (27), with a commitment to refinement, reduction and replacement, minimizing the number of mice, while using biostatistics to optimize mouse numbers. Thus, for statistical validity, sample size was calculated based on our preliminary assessment of rotarod performance (primary endpoint) in naïve woozy mice (Fig. 1A; expected treatment effect ≥ 50%; σ8–12wks = 48; α = 0.05, β = 0.2; n = 10). We used 9–10 mice for MRI, and 3–6 for biochemical analysis, histology and electron microscopy, which, according to our preliminary analysis in woozy mice, are sufficient to detect biologically relevant differences. GSK2606414 50 mg/kg was given orally by gavage twice daily, since in a preliminary experiment we found a clear reduction of PERK-P in the cerebellum of woozy mice treated with 50 but not 10 mg/kg of GSK2606414, consistent with previous pharmacokinetic analysis showing that 10 mg/kg gives inadequate brain exposure to efficiently inhibit PERK (13). Mice Woozy mice (CXB5/By-Sil1wz/J) (6) were obtained from The Jackson Laboratory (Stock No. 003777). They were maintained by heterozygous mating and genotyped by standard PCR, as recommended by the supplier. The animals were housed at controlled temperature (22 ± 2°C) with a 12/12 h light/dark cycle and free access to pelleted food and water. The health and home-cage behavior of the treated mice were monitored daily, according to guidelines for health evaluation of experimental laboratory animals (28). Procedures involving animals and their care were conducted in conformity with the institutional guidelines at the IRCCS–Mario Negri Institute for Pharmacological Research in compliance with national (D.lgs 26/2014; authorization no. 19/2008-A issued March 6, 2008 by Ministry of Health) and international laws and policies (EEC Council Directive 2010/63/UE; the NIH Guide for the Care and Use of Laboratory Animals, 2011 edition). They were reviewed and approved by the Mario Negri Institute Animal Care and Use Committee, which includes ad hoc members for ethical issues (18.03), and by the Italian Ministry of Health (decreto no. 93/2014-PR). Animal facilities meet international standards and are regularly checked by a certified veterinarian who is responsible for health monitoring, animal welfare supervision, experimental protocols and review of procedures. Accelerated rotarod test The accelerating Rotarod 7650 model (Ugo Basile) was used as described (29). Mice were trained three times before official testing. They were positioned on the rotating bar and allowed to become acquainted with the environment for 30 s. The rod motor was started at 7 rpm and accelerated to 40 rpm at a constant rate of 0.11 rpm/s for a maximum of 300 s. Performance was scored as latency to fall, in seconds. Animals were given three trials, and the average was used for statistical analysis. Beam walking test Mice were trained to walk along a metal beam 0.8 cm wide, 100 cm long, suspended 30 cm above bedding, for 3 days before testing. On the day of testing, animals were given three trials. Mice were video recorded and the number of hindfoot missteps, falls and time to traverse the beam during the three trials were counted by an investigator blinded to the experimental group. The average number of missteps and time to traverse the beam during the three trials were used for statistical analysis. Tremor Tremor was scored as mild (visible only when mice walked on the suspended beam) or severe (also visible when mice walked on a table top) by an investigator blinded to the experimental group. MRI Animals were anesthetized with 1% isoflurane in a 30: 70% O2: N2O gas mixture and imaged in a horizontal bore 7-Tesla USR preclinical MRI system (BioSpec 70/30, Bruker BioSpin, Germany) with a shielded gradient insert (BGA 12, 400 mT/m; rise time, 110 us). A 72 mm birdcage resonator for RF transmission, and a 10 mm diameter single-loop receiver coil were used to receive the signal. 3D T2-weighted anatomical images of the mouse brain were acquired with the following parameters: TR 2500 ms, TE 50 ms, RARE factor 16, FOV 3 × 1.5 × 1.5 cm, matrix 256 × 102 × 102, voxel 0.147 × 0.117 × 0.147. The scan time was approximately 25 min. The intracranial and cerebellar volumes were quantified manually using Fiji software (30), after a rigid body registration (6 dof) to a reference image to avoid bias due to bad head positioning. Immunohistochemistry and immunofluorescence Mice were deeply anesthetized by intraperitoneal injection of 100 mg/kg ketamine hydrochloride and 1 mg/kg medetomidine hydrochloride (Alcyon), and perfused through the ascending aorta with phosphate-buffered saline (PBS, 0.05 M; pH 7.4) followed by 4% paraformaldehyde (PFA) in PBS. Brains were removed, post-fixed, cryoprotected and frozen at −80°C. Serial sections (20 μm thick) were cut using a Leica cryostat and incubated for 1 h at RT with 10% FBS, 5% bovine serum albumin, 1% Triton X-100 in PBS 0.1 M, pH 7.4, then overnight at 4°C with mouse monoclonal anti-calbindin-D-28K antibody (Sigma Aldrich, C9848, 1: 2000), or rabbit polyclonal anti-CHOP (GADD153; Santa Cruz Biothechnology, sc-575, 1: 500) followed by visualization with the Vectastain ABC kit (Vector), using DAB as chromogen. Images were acquired with a VS120 Virtual Slide Microscope by Olympus and analyzed with NIH ImageJ software. Four sagittal sections were quantified for each mouse cerebellum using an algorithm to segment the stained area. The calbindin immunostained area in the cerebellar molecular layer was expressed as positive pixels/total assessed pixels and reported as a percentage of the total stained area. CHOP-positive cells were counted over the entire perimeter of the PC layer by an investigator blinded to the experimental group. For immunoflurescence staining, sections were incubated with the anti-calbindin antibody diluted 1: 1000 and with a rabbit polyclonal anti-eIF2α-P (Ser51) antibody (Cell Signaling, Cat. No. 9721S, 1: 100), the anti-CHOP antibody diluted 1: 100, or the anti-ORP15 antibody diluted 1: 100, followed by Alexa Fluor (Molecular Probes)-conjugated secondary antibodies. After extensive washing and staining with 2 μg/ml Hoechst 33258 (Molecular Probes), sections were mounted with FluorSave Reagent (Millipore). Images were acquired with an FV-500 Olympus laser confocal scanning system. Pancreas histology Sections (4 μm thick) of formalin-fixed, paraffin-embedded pancreas tissue were stained with hematoxylin and eosin and examined under a light microscope for the presence of exocrine acinar cell necrosis and ductal hyperplasia by a veterinary pathologist blind to the experimental group. The pancreas of two vehicle- and three GSK2606414-treated WT and woozy mice were analyzed. Western blot Western blot analysis was done as described (31). The following primary antibodies were used: rabbit polyclonal anti-eIF2α-P (Cell Signaling, Cat. No. 9721, 1: 1000); mouse monoclonal anti-total eIF2α (Cell Signaling Cat No. 2103, 1: 1000); mouse monoclonal anti-vinculin (Sigma, V9264, 1: 5000); rabbit polyclonal anti-PERK-P (Cell Signaling T980, 3179, 1: 1000); rabbit polyclonal anti-total PERK (Cell Signaling C33E10, 3192, 1: 1000); and rabbit monoclonal anti-ORP150 (Abcam EPR5890, ab124884, 1: 1000). RT-qPCR Total RNA was extracted from the mouse tissues with an RNeasy kit (Qiagen) according to the manufacturer’s instructions. A total of 0.5 μg RNA was reverse-transcribed with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) using random primers, and quantitative PCR was done in Optical 96- or 384-well plates (Applied Biosystem) using the 7300 or 7900 Real Time PCR System (Applied Biosystems) and GoTaq qPCR Master Mix (Promega) according to the manufacturer’s instructions. Reaction conditions were 50°C for 2 min, 95°C for 10 min, then 95°C for 15 s alternating with 60°C for 1 min for 41 cycles, followed by 95°C for 15 s and 60°C for 15 s. The amplifications were always run in triplicate with a blank control consisting of a water template (RNase/DNase-free water). For RT-qPCR of ORP150 the RT2 qPCR Primer Assay for Mouse Hyou1 (Qiagen) was used. The primer pair sequences were: ACTCCGGCGTGAGGTAGAAA (Fw) and AGAGCGGAACAGGTCCATGT (Rv) for BiP; CCACCACACCTGAAAGCAGAA (Fw) and AGGTGCCCCCAATTTCATCT (Rv) for CHOP; GGAGTGGAGTAAGGCTGGTG (Fw) and CCAGAATGCCCAAAAGGATA (Rv) for total XBP-1; and GAGTCCGCAGCAGGTG (Fw) and GTGTCAGAGTCCATGGGA (Rv) for sXBP-1. Three housekeeping genes were used for data normalization: HPRT1 (Fw, CTTCCTCCTCAGACCGCTTTT and Rv, CATCATCGCTAATCACGACGC), PGK1 (Fw, GGTCGTGATGAGGGTGGAC and Rv, GCAGCCTTGATCCTTTGGTTG) and SV2B (Fw, AGCATGTCACTGGCCATCAA and Rv, CCCAATCCCTATGCCTGAGAT). Transmission electron microscopy Quadriceps femoris muscle from 16-week-old mice were excised, cut in the sagittal plane with a razor blade, and fixed with 4% PFA and 2% glutaraldehyde in phosphate buffer 0.12 M, pH 7.4 for 4 h at room temperature, followed by post-fixation with 1% OsO4 and 1.5% ferrocyanide in 0.12 M cacodylate buffer (ferrocyanide-reduced OsO4) at room temperature for 1 h, then 0.3% thiocarbohydrazide in H2O for 5 min, and 1% OsO4 in 0.12 M cacodylate buffer for 1 h. After dehydration in graded series of ethanol, tissue samples were cleared in propylene oxide, embedded in epoxy medium (Epon 812, Fluka) and polymerized at 60°C for 72 h. From each sample, one semithin section (1 μm) was cut with a Leica EM UC6 ultramicrotome and mounted on glass slides for light microscopy. Ultrathin sections (60 nm thick) of areas of interest were obtained, counterstained with uranyl acetate and lead citrate and examined with an Energy Filter Transmission Electron Microscope (EFTEM, ZEISS LIBRA® 120) equipped with an yttrium aluminum garnet (YAG) scintillator slow-scan charge-coupled device (CCD) camera (Sharp eye, TRS, Moorenweis, Germany). The percentage of nuclei with perinuclear ultrastructural alterations was assessed by analyzing 50 perinuclear areas in each animal; the percentage of the area occupied by the sarcoplasmic reticulum in the myofibrillar compartment was calculated by iTem software (Olympus Soft Imaging Solutions, Germany) in 20 random fields in each animal. GSK2606414 dosing and bioanalysis The PERK inhibitor GSK2606414 (supplied by GlaxoSmithKline) was formulated as a suspension (5 mg/ml) in 0.5% hydroxypropyl-methyl cellulose (HPMC), 0.1% Tween-80, pH 4.0 and given orally by gavage. GSK2606414 concentrations were quantified in blood (1: 1 dilution with water) and tissue homogenates (1: 4 for brain or 1: 9 for muscle dilution with 20: 80 methanol: water) at Alliance Pharma (Malvern, PA, USA) by protein precipitation followed by HPLC-MS/MS. The lower limit of quantification of GSK2606414 was 1.0 ng/ml. Supplementary Material Supplementary Material is available at HMG online. Acknowledgements We thank Elisa R. Zanier and Luana Fioriti for comments on the manuscript. We are grateful to Stefano Fumagalli for advice on quantification of the calbindin immunostaining; to Lara Paracchini and Sara Ballabio for advice on RT-qPCR; to Mauro Tettamanti and Ilaria Speranza for help with statistical analysis; to Lorenzo Taiarol for help with RNA extraction; and to Camilla Recordati for pancreas histology. This work was supported by a grant from Fondazione Telethon (GGP12220). Conflict of Interest statement. J.M.A. and N.J.L. are employees of GlaxoSmithKline with equity holdings and stock options. GlaxoSmithKline holds patents for PERK inhibitors including GSK2606414: U.S. Pat. Appl. Publ. (2012), US 20120077828 A1 PCT Int. Appl. (2011), WO 2011119663 A1. The other authors declare no competing interests. References 1 Anttonen A.K., Lehesjoki A.E. ( 2006) Marinesco-Sjögren Syndrome. [Updated 2010 Sep 7]. In Adam, M.P., Ardinger, H.H., Pagon, R.A., et al., (eds), GeneReviews® [Internet]. University of Washington, Seattle, WA; 1993-2018. Available from: https://www.ncbi.nlm.nih.gov/books/NBK1192/. 2 Ezgu F., Krejci P., Li S., de Sousa C., Graham J.M., Hansmann I., He W., Porpora K., Wand D., Wertelecki W. ( 2014) Phenotype-genotype correlations in patients with Marinesco-Sjögren syndrome. Clin. Genet ., 86, 74– 84. Google Scholar CrossRef Search ADS PubMed  3 Senderek J., Krieger M., Stendel C., Bergmann C., Moser M., Breitbach-Faller N., Rudnik-Schoneborn S., Blaschek A., Wolf N.I., Harting I. et al.   ( 2005) Mutations in SIL1 cause Marinesco-Sjogren syndrome, a cerebellar ataxia with cataract and myopathy. Nat. Genet ., 37, 1312– 1314. Google Scholar CrossRef Search ADS PubMed  4 Anttonen A.K., Mahjneh I., Hamalainen R.H., Lagier-Tourenne C., Kopra O., Waris L., Anttonen M., Joensuu T., Kalimo H., Paetau A. et al.   ( 2005) The gene disrupted in Marinesco-Sjogren syndrome encodes SIL1, an HSPA5 cochaperone. Nat. Genet ., 37, 1309– 1311. Google Scholar CrossRef Search ADS PubMed  5 Krieger M., Roos A., Stendel C., Claeys K.G., Sonmez F.M., Baudis M., Bauer P., Bornemann A., de Goede C., Dufke A. et al.   ( 2013) SIL1 mutations and clinical spectrum in patients with Marinesco-Sjogren syndrome. Brain , 136, 3634– 3644. Google Scholar CrossRef Search ADS PubMed  6 Zhao L., Longo-Guess C., Harris B.S., Lee J.W., Ackerman S.L. ( 2005) Protein accumulation and neurodegeneration in the woozy mutant mouse is caused by disruption of SIL1, a cochaperone of BiP. Nat. Genet ., 37, 974– 979. Google Scholar CrossRef Search ADS PubMed  7 Roos A., Buchkremer S., Kollipara L., Labisch T., Gatz C., Zitzelsberger M., Brauers E., Nolte K., Schroder J.M., Kirschner J. et al.   ( 2014) Myopathy in Marinesco-Sjogren syndrome links endoplasmic reticulum chaperone dysfunction to nuclear envelope pathology. Acta Neuropathol ., 127, 761– 777. Google Scholar CrossRef Search ADS PubMed  8 Chung K.T., Shen Y., Hendershot L.M. ( 2002) BAP, a mammalian BiP-associated protein, is a nucleotide exchange factor that regulates the ATPase activity of BiP. J. Biol. Chem ., 277, 47557– 47563. Google Scholar CrossRef Search ADS PubMed  9 Zhao L., Rosales C., Seburn K., Ron D., Ackerman S.L. ( 2010) Alteration of the unfolded protein response modifies neurodegeneration in a mouse model of Marinesco-Sjogren syndrome. Hum. Mol. Genet ., 19, 25– 35. Google Scholar CrossRef Search ADS PubMed  10 Ron D., Walter P. ( 2007) Signal integration in the endoplasmic reticulum unfolded protein response. Nat. Rev. Mol. Cell Biol ., 8, 519– 529. Google Scholar CrossRef Search ADS PubMed  11 Halliday M., Radford H., Sekine Y., Moreno J., Verity N., le Quesne J., Ortori C.A., Barrett D.A., Fromont C., Fischer P.M. et al.   ( 2015) Partial restoration of protein synthesis rates by the small molecule ISRIB prevents neurodegeneration without pancreatic toxicity. Cell Death Dis ., 6, e1672. Google Scholar CrossRef Search ADS PubMed  12 Moreno J.A., Radford H., Peretti D., Steinert J.R., Verity N., Martin M.G., Halliday M., Morgan J., Dinsdale D., Ortori C.A. et al.   ( 2012) Sustained translational repression by eIF2alpha-P mediates prion neurodegeneration. Nature , 485, 507– 511. Google Scholar CrossRef Search ADS PubMed  13 Moreno J.A., Halliday M., Molloy C., Radford H., Verity N., Axten J.M., Ortori C.A., Willis A.E., Fischer P.M., Barrett D.A. et al.   ( 2013) Oral treatment targeting the unfolded protein response prevents neurodegeneration and clinical disease in prion-infected mice. Sci. Transl. Med ., 5, 206ra138. Google Scholar CrossRef Search ADS PubMed  14 Radford H., Moreno J.A., Verity N., Halliday M., Mallucci G.R. ( 2015) PERK inhibition prevents tau-mediated neurodegeneration in a mouse model of frontotemporal dementia. Acta Neuropathol ., 130, 633– 642. Google Scholar CrossRef Search ADS PubMed  15 Saxena S., Cabuy E., Caroni P. ( 2009) A role for motoneuron subtype-selective ER stress in disease manifestations of FALS mice. Nat. Neurosci ., 12, 627– 636. Google Scholar CrossRef Search ADS PubMed  16 Colla E., Coune P., Liu Y., Pletnikova O., Troncoso J.C., Iwatsubo T., Schneider B.L., Lee M.K. ( 2012) Endoplasmic reticulum stress is important for the manifestations of alpha-synucleinopathy in vivo. J. Neurosci ., 32, 3306– 3320. Google Scholar CrossRef Search ADS PubMed  17 Das I., Krzyzosiak A., Schneider K., Wrabetz L., D'Antonio M., Barry N., Sigurdardottir A., Bertolotti A. ( 2015) Preventing proteostasis diseases by selective inhibition of a phosphatase regulatory subunit. Science , 348, 239– 242. Google Scholar CrossRef Search ADS PubMed  18 Halliday M., Hughes D., Mallucci G.R. ( 2017) Fine-tuning PERK signaling for neuroprotection. J. Neurochem ., 142, 812– 826. Google Scholar CrossRef Search ADS   19 Lee K., Tirasophon W., Shen X., Michalak M., Prywes R., Okada T., Yoshida H., Mori K., Kaufman R.J. ( 2002) IRE1-mediated unconventional mRNA splicing and S2P-mediated ATF6 cleavage merge to regulate XBP1 in signaling the unfolded protein response. Genes Dev ., 16, 452– 466. Google Scholar CrossRef Search ADS PubMed  20 Axten J.M., Medina J.R., Feng Y., Shu A., Romeril S.P., Grant S.W., Li W.H.H., Heerding D.A., Minthorn E., Mencken T. et al.   ( 2012) Discovery of 7-methyl-5-(1-{[3-(trifluoromethyl)phenyl]acetyl}-2, 3-dihydro-1H-indol-5-yl)-7H-p yrrolo[2, 3-d]pyrimidin-4-amine (GSK2606414), a potent and selective first-in-class inhibitor of protein kinase R (PKR)-like endoplasmic reticulum kinase (PERK). J. Med. Chem ., 55, 7193– 7207. Google Scholar CrossRef Search ADS PubMed  21 Behnke J., Feige M.J., Hendershot L.M. ( 2015) BiP and its nucleotide exchange factors Grp170 and Sil1: mechanisms of action and biological functions. J. Mol. Biol ., 427, 1589– 1608. Google Scholar CrossRef Search ADS PubMed  22 Weitzmann A., Volkmer J., Zimmermann R. ( 2006) The nucleotide exchange factor activity of Grp170 may explain the non-lethal phenotype of loss of Sil1 function in man and mouse. FEBS Lett ., 580, 5237– 5240. Google Scholar CrossRef Search ADS PubMed  23 Sarna J.R., Hawkes R. ( 2003) Patterned Purkinje cell death in the cerebellum. Prog. Neurobiol ., 70, 473– 507. Google Scholar CrossRef Search ADS PubMed  24 Pakos-Zebrucka K., Koryga I., Mnich K., Ljujic M., Samali A., Gorman A.M. ( 2016) The integrated stress response. EMBO Rep ., 17, 1374– 1395. Google Scholar CrossRef Search ADS PubMed  25 Halliday M., Radford H., Zents K.A.M., Molloy C., Moreno J.A., Verity N.C., Smith E., Ortori C.A., Barrett D.A., Bushell M. et al.   ( 2017) Repurposed drugs targeting eIF2α-P-mediated translational repression prevent neurodegeneration in mice. Brain J. Neurol ., 140, 1768– 1783. Google Scholar CrossRef Search ADS   26 Mercado G., Castillo V., Soto P., López N., Axten J.M., Sardi P., Hoozemans J.J.M., Hetz C. ( 2018) Targeting PERK signaling with the small molecule GSK2606414 prevents neurodegeneration in a model of Parkinson’s disease. Neurobiol. Dis ., 112, 136– 148. Google Scholar CrossRef Search ADS PubMed  27 Kilkenny C., Browne W.J., Cuthill I.C., Emerson M., Altman D.G. ( 2010) Improving bioscience research reporting: the ARRIVE guidelines for reporting animal research. PLoS Biol ., 8, e1000412. Google Scholar CrossRef Search ADS PubMed  28 Burkholder T., Foltz C., Karlsson E., Linton C.G., Smith J.M. ( 2012) Health evaluation of experimental laboratory mice. Curr. Protocol. Mouse Biol ., 2, 145– 165. Google Scholar CrossRef Search ADS   29 Bouybayoune I., Mantovani S., Del Gallo F., Bertani I., Restelli E., Comerio L., Tapella L., Baracchi F., Fernandez-Borges N., Mangieri M. et al.   ( 2015) Transgenic fatal familial insomnia mice indicate prion infectivity-independent mechanisms of pathogenesis and phenotypic expression of disease. PLoS Pathog ., 11, e1004796. Google Scholar CrossRef Search ADS PubMed  30 Schindelin J., Arganda-Carreras I., Frise E., Kaynig V., Longair M., Pietzsch T., Preibisch S., Rueden C., Saalfeld S., Schmid B. et al.   ( 2012) Fiji: an open-source platform for biological-image analysis. Nat. Methods , 9, 676– 682. Google Scholar CrossRef Search ADS PubMed  31 Quaglio E., Restelli E., Garofoli A., Dossena S., De Luigi A., Tagliavacca L., Imperiale D., Migheli A., Salmona M., Sitia R. et al.   ( 2011) Expression of mutant or cytosolic PrP in transgenic mice and cells is not associated with endoplasmic reticulum stress or proteasome dysfunction. PLoS One , 6, e19339. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Human Molecular Genetics Oxford University Press

PERK inhibition delays neurodegeneration and improves motor function in a mouse model of Marinesco-Sjögren syndrome

Loading next page...
 
/lp/ou_press/perk-inhibition-delays-neurodegeneration-and-improves-motor-function-gUWjXblc0u
Publisher
Oxford University Press
Copyright
© The Author(s) 2018. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com
ISSN
0964-6906
eISSN
1460-2083
D.O.I.
10.1093/hmg/ddy152
Publisher site
See Article on Publisher Site

Abstract

Abstract Marinesco-Sjögren syndrome (MSS) is a rare, early onset, autosomal recessive multisystem disorder characterized by cerebellar ataxia, cataracts and myopathy. Most MSS cases are caused by loss-of-function mutations in the gene encoding SIL1, a nucleotide exchange factor for the molecular chaperone BiP which is essential for correct protein folding in the endoplasmic reticulum. Woozy mice carrying a spontaneous Sil1 mutation recapitulate key pathological features of MSS, including cerebellar atrophy with degeneration of Purkinje cells and progressive myopathy. Because the PERK branch of the unfolded protein response is activated in degenerating neurons of woozy mice, and inhibiting PERK-mediated translational attenuation has shown protective effects in protein-misfolding neurodegenerative disease models, we tested the therapeutic efficacy of GSK2606414, a potent inhibitor of PERK. Mice were chronically treated with GSK2606414 starting from a presymptomatic stage, and the effects were evaluated on biochemical, histopathological and clinical readouts. GSK2606414 delayed Purkinje cell degeneration and the onset of motor deficits, prolonging the asymptomatic phase of the disease; it also reduced the skeletal muscle abnormalities and improved motor performance during the symptomatic phase. The protein but not the mRNA level of ORP150, a nucleotide exchange factor which can substitute for SIL1, was increased in the cerebellum of GSK2606414-treated woozy mice, suggesting that translational recovery promoted the synthesis of this alternative BiP co-factor. Targeting PERK signaling may have beneficial disease-modifying effects in carriers of SIL1 mutations. Introduction Marinesco-Sjögren syndrome (MSS; OMIM 248800) is a rare autosomal recessive multisystem disease causing cerebellar ataxia, cataracts, myopathy, dysarthria, mental retardation, short stature and hypergonadotropic hypogonadism in some cases (1,2). Clinical signs appear in early infancy, and progress for a variable number of years; then they stabilize, and patients have a normal lifespan. There is no pharmacological therapy for MSS, apart from hormone replacement for primary gonadal failure, and medical care involves mainly educational and rehabilitative programs to improve walking, cognition and speaking. More than 60% of MSS patients carry homozygous or compound heterozygous mutations in the gene encoding SIL1 (also known as BiP-associated protein or BAP) (3–5). A spontaneous recessive Sil1 mutation (Sil1wz) is also responsible for the ataxic phenotype of woozy mice, which develop cerebellar atrophy with Purkinje cell (PC) loss, and myopathic changes highly reminiscent of MSS (6,7). The SIL1 protein is an ATP-exchange factor for the endoplasmic reticulum (ER) chaperone BiP (binding immunoglobulin protein, also known as GRP78) (8), which is essential in protein translocation and folding. Mutations in SIL1 are thought to impair BiP activity, leading to unfolded protein accumulation in the ER and maladaptive unfolded protein response (UPR) (3,6). Supporting this, degenerating PCs in cerebellar lobules I–VIII of woozy mice contain ubiquitinated protein inclusions and display typical signs of UPR, including elevated levels of BiP and of the pro-apoptotic factor CHOP (C/EBP homologous protein, also known as GADD153) (6). Overexpression of ORP150 (oxygen-regulated protein of 150 kDa, also known as GRP170), an ATP-exchange factor that works in parallel with SIL1, prevents ER stress and PC death, while reducing its expression exacerbates neurodegeneration, leading to UPR activation and PC loss also in the caudal lobules IX and X, which are normally preserved in woozy mice (9). The kinase PERK [protein kinase RNA (PKR)-like ER kinase] is one of the three primary effectors of the UPR, the others being ATF6 (activating transcription factor 6) and IRE1 (inositol-requiring enzyme 1) (10). PERK is an ER transmembrane protein containing a stress-sensing domain facing the ER lumen, and a cytosolic kinase domain. PERK is maintained in its inactive state through its association with BiP. An increase in unfolded proteins in the ER lumen causes the release of BiP from the PERK stress-sensing domain, resulting in PERK activation via oligomerization and autophosphorylation. Activated PERK phosphorylates eIF2α (the α-subunit of the eukaryotic initiation factor 2) in the cytoplasm, preventing the formation of methionine-bearing ternary complexes needed to initiate protein translation, thereby reducing global protein synthesis as a mechanism to manage the load of unfolded proteins in the ER (10). Some specific mRNAs, however, are preferentially synthesized during phospho-eIF2α (eIF2α-P)-mediated translational attenuation. These include the mRNA encoding ATF4 (activating transcription factor 4), which upregulates the expression of genes encoding ER chaperones and proteins involved in amino acid metabolism, autophagy and redox balance. ATF4 also upregulates GADD34 (growth arrest and DNA-damage-inducible protein-34), the regulatory subunit of the serine/threonine protein phosphatase 1, which dephosphorylates eIF2α-P, providing a negative feedback mechanism that helps rapidly restore protein synthesis upon resolution of ER stress. If ER stress is not resolved, prolonged expression of ATF4 upregulates CHOP, which initiates the apoptotic signaling cascade, leading to cell death. Chronic activation of the PERK/eIF2α branch of the UPR appears to be especially detrimental to neurons, which are exquisitely dependent on new protein synthesis for synaptic maintenance and survival. Thus genetic and pharmacological inhibition of the pathway to restore protein synthesis has marked neuroprotective effects in prion-infected mice and in a transgenic mouse model of frontotemporal dementia (rTg4510 tauP301L), rescuing synaptic failure and behavioral deficits (11–14). In some neurodegenerative conditions, however, prolonging rather than inhibiting PERK/eIF2α signaling is neuroprotective: for example, in the SOD1 G93A mouse model of amyotrophic lateral sclerosis and in the α-synuclein A53T mouse model of Parkinson’s disease (15–17). Thus, manipulating PERK/eIF2α signaling may have different effects in different neurodegenerative diseases, perhaps depending on the nature of the stress induced by the specific misfolded protein (18). We examined the role of the PERK pathway in the woozy mouse model of MSS, in which ER stress is triggered by loss of SIL1 co-chaperone activity, rather than by misfolding of a single disease-related protein. We first analyzed the activation of PERK/eIF2α signaling in relation to cerebellar degeneration and motor dysfunction. Next, we tested the effects of pharmacological inhibition of PERK on the development of motor symptoms, PC loss and muscle pathology. Results PERK/eIF2α signaling is activated in Purkinje cells of woozy mice before cerebellar degeneration and onset of motor dysfunction Woozy mice develop ataxia between 3 and 4 months of age (6). To determine the first appearance of motor dysfunction more precisely and follow its course, groups of wild-type (WT) and woozy littermate mice were periodically tested on the accelerating rotarod. This motor behavioral task requires the animals to walk on an accelerating rotating rod, with latency to fall as a readout, and is a sensitive test of cerebellar abnormalities. There were no significant differences in rotarod performance between the two groups of mice up to 8 weeks of age (Fig. 1A). From 10 weeks on, however, woozy mice showed a shorter latency to fall than WT controls; their performance worsened up to 16 weeks of age, after which there was no further significant decline (Fig. 1A). Magnetic resonance imaging (MRI) detected a ∼50% reduction in the cerebellar volume of woozy compared with WT mice (Fig. 1B and C). Figure 1. View largeDownload slide Woozy mice develop motor dysfunction and cerebellar atrophy. (A) Groups of WT and woozy mice were tested on the rotarod at the ages indicated. Each mouse was tested three times, and the mean latency to fall was calculated. Bars indicate the mean ± S.E.M. of latency to fall (s) for 9–10 animals; F9,144 = 20.95; P < 0.0001 by two-way analysis of variance for repeated measures (RM-ANOVA); **P < 0.01; ****P < 0.0001 Bonferroni’s post-hoc test. (B) Representative T2-weighted images (TE/TR = 50/2, 500 ms) of a WT and a woozy mouse at 28 weeks of age. (C) Volume of the cerebellum, normalized on the intracranial volume, of 9 WT and 9 woozy mice at 28 weeks of age. ****P < 0.0001 by Student’s t-test. Figure 1. View largeDownload slide Woozy mice develop motor dysfunction and cerebellar atrophy. (A) Groups of WT and woozy mice were tested on the rotarod at the ages indicated. Each mouse was tested three times, and the mean latency to fall was calculated. Bars indicate the mean ± S.E.M. of latency to fall (s) for 9–10 animals; F9,144 = 20.95; P < 0.0001 by two-way analysis of variance for repeated measures (RM-ANOVA); **P < 0.01; ****P < 0.0001 Bonferroni’s post-hoc test. (B) Representative T2-weighted images (TE/TR = 50/2, 500 ms) of a WT and a woozy mouse at 28 weeks of age. (C) Volume of the cerebellum, normalized on the intracranial volume, of 9 WT and 9 woozy mice at 28 weeks of age. ****P < 0.0001 by Student’s t-test. CHOP is upregulated in degenerating PCs of woozy mice, suggesting that the PERK branch of the UPR is active in these neurons (6). To confirm this, and assess the temporal relation between PERK/eIF2α signaling and neurodegeneration, we immunostained the cerebella of 4–16 weeks-old woozy mice with antibodies against eIF2α-P and CHOP, with an anti-calbindin antibody to selectively mark PCs. There was no difference in PC density and dendritic arborization between WT and woozy mice up to 6 weeks of age, but PCs were clearly degenerating in 8-week-old woozy mice, and were almost completely lost by 16 weeks (Figs 2A, and 6D and E). At 6 weeks of age there were many eIF2α-P- and CHOP-immunopositive PCs in the anterior cerebellar lobes of woozy mice (Fig. 2B and C). Figure 2. View largeDownload slide Phosphorylated eIF2α and CHOP are up-regulated in PC of woozy mice before neurodegeneration. Brain sections from WT and woozy mice of the ages indicated were incubated with an anti-calbindin antibody (A), or with anti-calbindin and anti-eIF2α-P (B) or anti-CHOP (C) antibodies. Sections were incubated with Alexa 488 (green)- or Alexa 594 (red)-conjugated secondary antibodies, and reacted with Hoechst 33258 (blue) to stain the nuclei. Scale bars, 50 μm in (A), and 100 μm in (B) and (C). Figure 2. View largeDownload slide Phosphorylated eIF2α and CHOP are up-regulated in PC of woozy mice before neurodegeneration. Brain sections from WT and woozy mice of the ages indicated were incubated with an anti-calbindin antibody (A), or with anti-calbindin and anti-eIF2α-P (B) or anti-CHOP (C) antibodies. Sections were incubated with Alexa 488 (green)- or Alexa 594 (red)-conjugated secondary antibodies, and reacted with Hoechst 33258 (blue) to stain the nuclei. Scale bars, 50 μm in (A), and 100 μm in (B) and (C). Phosphorylated eIF2α and PERK were also detectable by western blot of whole cerebellar lysates (Figs 3A, and 7A and B). Reverse transcription quantitative real-time PCR (RT-qPCR) confirmed the increase in CHOP, and found increases in the levels of both total and spliced XBP-1 mRNAs in the cerebellum of woozy mice aged 6 weeks (Fig. 3B), indicating that the ATF6 and IRE1 branches of the UPR were also activated (19). These markers decreased at 10 and 16 weeks of age, most likely because of progressive PC loss (Fig. 3B). In the cerebrum there was no increase in UPR markers at any of the times tested (Fig. 4). Figure 3. View largeDownload slide Analysis of UPR markers in the cerebellum of woozy mice. (A) Protein extracts (20 μg) from the whole cerebella of WT and woozy littermate mice of 6 weeks of age were analyzed by western blot with anti-eIF2α-P and anti-total eIF2α antibodies. Molecular mass markers are in kilodaltons. (B) Total RNA was extracted from the cerebella of WT and woozy mice of 6, 10 and 16 weeks of age, reverse-transcribed and analyzed by RT-qPCR. mRNAs were quantified by the ΔΔCt method and expressed as the fold difference from the levels in age-matched WT mice (dotted line). Data are the mean ± S.E.M. of 4–5 animals per experimental group. *P < 0.05, **P < 0.01 by Student’s t-test. Figure 3. View largeDownload slide Analysis of UPR markers in the cerebellum of woozy mice. (A) Protein extracts (20 μg) from the whole cerebella of WT and woozy littermate mice of 6 weeks of age were analyzed by western blot with anti-eIF2α-P and anti-total eIF2α antibodies. Molecular mass markers are in kilodaltons. (B) Total RNA was extracted from the cerebella of WT and woozy mice of 6, 10 and 16 weeks of age, reverse-transcribed and analyzed by RT-qPCR. mRNAs were quantified by the ΔΔCt method and expressed as the fold difference from the levels in age-matched WT mice (dotted line). Data are the mean ± S.E.M. of 4–5 animals per experimental group. *P < 0.05, **P < 0.01 by Student’s t-test. Figure 4. View largeDownload slide Analysis of UPR markers in the cerebrum of woozy mice. (A) Total RNA was extracted from the cerebra of WT and woozy mice of 6, 10 and 16 weeks of age, reverse-transcribed and analyzed by RT-qPCR. mRNAs were quantified by the ΔΔCt method and expressed as the fold difference from the levels in age-matched WT mice (dotted line). Data are the mean ± S.E.M. of 4–7 animals per experimental group. (B) Protein extracts (20 μg) from the cerebra of 16 weeks old WT and woozy mice were analyzed by western blot with anti-PERK-P and anti-total PERK antibodies. The ratio of PERK-P/PERK was quantified by densitometic analysis of western blots. Data are the mean ± S.E.M. of five animals per group. (C) The same protein extracts used in (B) were analyzed with anti-eIF2α-P and anti-total eIF2α antibodies. Results were similar in animals of 6 and 10 weeks of age. Figure 4. View largeDownload slide Analysis of UPR markers in the cerebrum of woozy mice. (A) Total RNA was extracted from the cerebra of WT and woozy mice of 6, 10 and 16 weeks of age, reverse-transcribed and analyzed by RT-qPCR. mRNAs were quantified by the ΔΔCt method and expressed as the fold difference from the levels in age-matched WT mice (dotted line). Data are the mean ± S.E.M. of 4–7 animals per experimental group. (B) Protein extracts (20 μg) from the cerebra of 16 weeks old WT and woozy mice were analyzed by western blot with anti-PERK-P and anti-total PERK antibodies. The ratio of PERK-P/PERK was quantified by densitometic analysis of western blots. Data are the mean ± S.E.M. of five animals per group. (C) The same protein extracts used in (B) were analyzed with anti-eIF2α-P and anti-total eIF2α antibodies. Results were similar in animals of 6 and 10 weeks of age. Thus the UPR—particularly the PERK/eIF2α branch—was clearly activated in the woozy mouse cerebellum starting from a pre-neurodegenerative stage, calling for further investigations to test the therapeutic inhibition of PERK signaling. Pharmacological PERK inhibition is neuroprotective, and delays the onset and progression of clinical disease in woozy mice We tested the therapeutic effect of GSK2606414, an orally available PERK inhibitor (20). In a first pilot experiment, groups of WT and woozy mice (four per group) were treated twice daily with 50 mg/kg GSK2606414 or the vehicle starting from 4 weeks of age. To check for any beneficial effect before motor deficits became detectable on the accelerating rotarod, we used the beam walking test (see Study design in the Materials and Methods section), which is a sensitive indicator of fine motor coordination and balance in mouse models of spinocerebellar ataxia. Mice walked on a suspended metal beam, 0.8 cm wide, 100 cm long, and the number of hindfoot missteps and time to traverse the beam were recorded. There were no differences in performance between the different groups of mice up to 6 weeks of age (Fig. 5A and B). At 7 weeks, however, the number of hindfoot missteps and the time to traverse the beam in vehicle-treated woozy mice were significantly higher than in WT controls, with missteps further increasing at 8 and 9 weeks. Strikingly, the motor performance of GSK2606414-treated woozy mice was undistinguishable from that of WT controls (Fig. 5A and B, andSupplementary Material, Movie S1); they only showed a slight, non-significant increase in missteps after 5 weeks (9 weeks of age) (Fig. 5A), at which time the experiment was terminated to assess the effect of PERK inhibition on incipient cerebellar pathology. Figure 5. View largeDownload slide GSK2606414 delays the onset of motor dysfunction and PC degeneration in woozy mice. (A) Groups of WT and woozy mice (four each) were given GSK2606414 or the vehicle starting from 4 weeks of age, and tested weekly for their ability to walk on a suspended beam. Each mouse was tested three times and the mean number of hindfoot missteps was scored. Data are the mean ± S.E.M. F12,48 = 14.27; P < 0.0001 by two-way RM-ANOVA; ****P < 0.0001 woozy vehicle versus all other groups by Tukey’s post hoc test. (B) Mean time to traverse the beam during the three trials. Data are the mean ± S.E.M. F12,48 = 3.836 P = 0.0004 by two-way RM-ANOVA; *P < 0.05, ****P < 0.0001 woozy vehicle versus all other groups by Tukey’s post-hoc test. (C) CHOP immunostaining in cerebellar sections of WT and woozy mice treated with GSK2606414 or the vehicle for 5 weeks. (D) The number of CHOP-positive PC was analyzed by immunohistochemistry and expressed as the percentage of total PCs. Data are the mean ± SEM of 16–19 brain sections from four animals per experimental group. *P < 0.05 by Student’s t-test. No CHOP-positive PCs were detected in vehicle- and GSK2606414-treated WT mice. (E) Calbindin immunostaining in cerebellar sections of WT and woozy mice treated with GSK2606414 or the vehicle for 5 weeks. The boxes outlined in panels (i)-(iv) indicate the areas shown at higher magnification in panels (v)-(viii). Scale bars, 400 μm in (i)–(iv), and 50 μm in (v)–(viii). (F) Percentage of the calbinding positive area in the PC and molecular layers of the cerebellar cortex. Data are the mean ± S.E.M. of 21–27 brain sections from four animals per experimental group. F1,12 = 17.17; P = 0.0014 by two-way ANOVA, ***P < 0.001 by Bonferroni’s post-hoc test. Figure 5. View largeDownload slide GSK2606414 delays the onset of motor dysfunction and PC degeneration in woozy mice. (A) Groups of WT and woozy mice (four each) were given GSK2606414 or the vehicle starting from 4 weeks of age, and tested weekly for their ability to walk on a suspended beam. Each mouse was tested three times and the mean number of hindfoot missteps was scored. Data are the mean ± S.E.M. F12,48 = 14.27; P < 0.0001 by two-way RM-ANOVA; ****P < 0.0001 woozy vehicle versus all other groups by Tukey’s post hoc test. (B) Mean time to traverse the beam during the three trials. Data are the mean ± S.E.M. F12,48 = 3.836 P = 0.0004 by two-way RM-ANOVA; *P < 0.05, ****P < 0.0001 woozy vehicle versus all other groups by Tukey’s post-hoc test. (C) CHOP immunostaining in cerebellar sections of WT and woozy mice treated with GSK2606414 or the vehicle for 5 weeks. (D) The number of CHOP-positive PC was analyzed by immunohistochemistry and expressed as the percentage of total PCs. Data are the mean ± SEM of 16–19 brain sections from four animals per experimental group. *P < 0.05 by Student’s t-test. No CHOP-positive PCs were detected in vehicle- and GSK2606414-treated WT mice. (E) Calbindin immunostaining in cerebellar sections of WT and woozy mice treated with GSK2606414 or the vehicle for 5 weeks. The boxes outlined in panels (i)-(iv) indicate the areas shown at higher magnification in panels (v)-(viii). Scale bars, 400 μm in (i)–(iv), and 50 μm in (v)–(viii). (F) Percentage of the calbinding positive area in the PC and molecular layers of the cerebellar cortex. Data are the mean ± S.E.M. of 21–27 brain sections from four animals per experimental group. F1,12 = 17.17; P = 0.0014 by two-way ANOVA, ***P < 0.001 by Bonferroni’s post-hoc test. The number of CHOP-immunopositive PCs was significantly reduced in woozy mice treated with GSK2606414 (Fig. 5C and D), consistent with inhibition of PERK and downstream signaling. Immunohistochemistry with the anti-calbindin antibody showed clear preservation of PC bodies and dendritic arborizations in GSK2606414-treated woozy mice (Fig. 5E); in fact, the percentage of calbindin-positive area in their cerebellar cortex was similar to that of WT controls (Fig. 5F). To assess the long-term effects of the treatment, we repeated the experiment using larger groups of mice (10 per group), again giving GSK2606414 twice daily from 4 weeks of age. Mice were assessed weekly on the accelerating rotarod starting from the fifth week of treatment, at which time vehicle-treated woozy mice had a significantly shorter latency to fall than WT controls (Fig. 6A). However, the latency to fall of woozy mice treated with GSK2606414 was comparable to that of WT animals (Fig. 6A), confirming the protective effect of PERK inhibition on motor dysfunction, documented by the beam walking test (Fig. 5A and B). At later times, however, rotarod performance progressively declined in both vehicle- and GSK2606414-treated woozy mice, although the latter continued to do better (Fig. 6A). Figure 6. View largeDownload slide GSK2606414-treated woozy mice eventually develop ataxia and cerebellar atrophy, but have better motor performance and significantly less PC degeneration than vehicle-treated controls. (A) Groups of WT and woozy mice (10 each) treated with GSK2606414 or the vehicle were tested weekly on the accelerating rotarod at the treatment times/ages indicated. Bars indicate the mean ± S.E.M. of latency to fall (s); F21,238 = 3.294; P < 0.0001 by two-way RM-ANOVA; *P < 0.05; **P  < 0.01; ***P < 0.001; ****P < 0.0001; ns, non-significant versus WT GSK2606414 Tukey’s post-hoc test. (B) Brain anatomy of vehicle- and GSK2606414-treated WT and woozy mice after 10 weeks of treatment. Representative T2-weighted images (TE/TR, 50/2, 500 ms). (C) Bars indicate the mean ± S.E.M. cerebellar volumes normalized on the intracranial volumes. F1,35 = 2.744; P = 0.1066 by two-way ANOVA. (D) Calbindin immunostaining in cerebellar sections of WT and woozy mice treated with GSK2606414 or the vehicle for 12 weeks. The boxes outlined in panels (iii) and (iv) indicate the areas shown at higher magnification in panels (v) and (vi). Scale bars, 400 μm in (i)-(iv), and 100 μm in (v) and (vi). (E) Percentages of the calbindin-positive area in the PC and molecular layers of the cerebellar cortex. Data are the mean ± S.E.M. of 19–20 brain sections from five animals per experimental group. F1,16 = 5.638; P = 0.0304 by two-way ANOVA; **P < 0.01 Bonferroni’s post-hoc test. Figure 6. View largeDownload slide GSK2606414-treated woozy mice eventually develop ataxia and cerebellar atrophy, but have better motor performance and significantly less PC degeneration than vehicle-treated controls. (A) Groups of WT and woozy mice (10 each) treated with GSK2606414 or the vehicle were tested weekly on the accelerating rotarod at the treatment times/ages indicated. Bars indicate the mean ± S.E.M. of latency to fall (s); F21,238 = 3.294; P < 0.0001 by two-way RM-ANOVA; *P < 0.05; **P  < 0.01; ***P < 0.001; ****P < 0.0001; ns, non-significant versus WT GSK2606414 Tukey’s post-hoc test. (B) Brain anatomy of vehicle- and GSK2606414-treated WT and woozy mice after 10 weeks of treatment. Representative T2-weighted images (TE/TR, 50/2, 500 ms). (C) Bars indicate the mean ± S.E.M. cerebellar volumes normalized on the intracranial volumes. F1,35 = 2.744; P = 0.1066 by two-way ANOVA. (D) Calbindin immunostaining in cerebellar sections of WT and woozy mice treated with GSK2606414 or the vehicle for 12 weeks. The boxes outlined in panels (iii) and (iv) indicate the areas shown at higher magnification in panels (v) and (vi). Scale bars, 400 μm in (i)-(iv), and 100 μm in (v) and (vi). (E) Percentages of the calbindin-positive area in the PC and molecular layers of the cerebellar cortex. Data are the mean ± S.E.M. of 19–20 brain sections from five animals per experimental group. F1,16 = 5.638; P = 0.0304 by two-way ANOVA; **P < 0.01 Bonferroni’s post-hoc test. This was confirmed by the beam walking test at 10 weeks of treatment. Both vehicle- and GSK2606414-treated woozy mice were unable to walk on the suspended beam without dragging the hindlimbs, so the hindfoot missteps could not be scored (Supplementary Material, Movie S2). The two groups of mice took the same time to traverse the beam (Supplementary Material, Fig. S1); however, GSK2606414-treated mice fell from the beam much less during the three trials than vehicle-treated controls, with only one falling once in the treated woozy group, compared with six falling a total of 23 times in the vehicle group. Progressive tremor is part of the neurological picture of woozy mice (6). Mild tremor is first apparent at ∼10 weeks of age when mice start walking; the tremor is perpendicular to the line of motion and can be clearly seen when mice walk on the suspended beam, possibly contributing to their poor performance in this test (Supplementary Material, Movie S2). As the mice age, the tremor becomes more severe and can also be seen when mice start walking on a table top. Woozy mice were scored for tremors after 10 weeks of treatment (14 weeks of age). Eight mice in the vehicle-treated group had severe and two had mild tremor, while in the GSK2606414-treated group, five had severe and five had mild tremor. At this stage, MRI showed similar atrophy of the cerebellum in vehicle- and GSK2606414-treated woozy mice (Fig. 6B and C). However, calbindin immunostaining at the end of the experiment after 12 weeks of treatment showed that PCs were relatively spared in GSK2606414-treated woozy mice (Fig. 6D), so the calbindin-positive area was significantly larger than in vehicle-treated animals (Fig. 6E). Biochemical analysis showed reduced PERK-P levels in the cerebellum of GSK2606414-treated woozy mice (Fig. 7A and B), but no increase in mRNA expression of XBP1, which is induced by activated ATF6 (19), and IRE1-mediated XBP1 splicing (Fig. 7C and D), indicating that protracted PERK inhibition was not associated with over-activation of the other UPR branches. The protein but not the mRNA level of ORP150 was increased in the cerebellum of woozy mice treated with GSK2606414 (Fig. 8A–C). Immunofluorescence analysis of cerebellar sections showed that ORP150 was expressed in surviving PCs of GSK2606414-treated woozy mice (Fig. 8D). No significant changes in ORP150 protein or mRNA levels were found in the cerebrum of the treated mice (Supplementary Material, Fig. S2). Figure 7. View largeDownload slide Long-term treatment with GSK2606414 reduces the levels of phosphorylated PERK and has no effect on XBP1 expression or splicing. (A) Protein extracts (20 μg) from the cerebella of WT and woozy mice treated with the vehicle or GSK2606414 for 12 weeks were analyzed by western blot with anti-PERK-P and anti-total PERK antibodies. (B) The ratio of PERK-P/PERK was quantified by densitometric analysis of western blot, like the one in (A). Data are the mean ± S.E.M. of 4–5 animals per group. F(t)1,14 = 8.64; P = 0.0108 by two-way ANOVA; *P < 0.05 Bonferroni’s post-hoc test. (C, D) Total RNA was extracted from the cerebella of vehicle- or GSK2606414-treated WT and woozy mice, and total (C) and spliced (s) XBP1 (D) mRNA expression was quantified by RT-qPCR. Data are the mean ± S.E.M. of four animals per group. F1,12 = 0.1488; P = 0.7064 (in C) and F1,12 = 0.5312; P = 0.4801 (in D) by two-way ANOVA. Figure 7. View largeDownload slide Long-term treatment with GSK2606414 reduces the levels of phosphorylated PERK and has no effect on XBP1 expression or splicing. (A) Protein extracts (20 μg) from the cerebella of WT and woozy mice treated with the vehicle or GSK2606414 for 12 weeks were analyzed by western blot with anti-PERK-P and anti-total PERK antibodies. (B) The ratio of PERK-P/PERK was quantified by densitometric analysis of western blot, like the one in (A). Data are the mean ± S.E.M. of 4–5 animals per group. F(t)1,14 = 8.64; P = 0.0108 by two-way ANOVA; *P < 0.05 Bonferroni’s post-hoc test. (C, D) Total RNA was extracted from the cerebella of vehicle- or GSK2606414-treated WT and woozy mice, and total (C) and spliced (s) XBP1 (D) mRNA expression was quantified by RT-qPCR. Data are the mean ± S.E.M. of four animals per group. F1,12 = 0.1488; P = 0.7064 (in C) and F1,12 = 0.5312; P = 0.4801 (in D) by two-way ANOVA. Figure 8. View largeDownload slide ORP150 increases in the cerebellum of GSK2606414-treated woozy mice. (A) Protein extracts (20 μg) from the cerebella of vehicle- or GSK2606414-treated woozy mice were analyzed by western blot with anti-ORP150 (top panel) and anti-vinculin (lower panel) antibodies. (B) ORP150 was quantified by densitometic analysis, normalized for the amount of vinculin and expressed as a percentage of the amount in WT mice. Data are the mean ± S.E.M. of 4–5 animals per experimental group. *P < 0.05 by one-way ANOVA, Tukey’s post-hoc test. (C) ORP150 mRNA was quantified by RT-qPCR and expressed as percentage of WT. Data are the mean ± S.E.M.; n = 3–4; F2,7 = 0.7435; P = 0.5096 by one-way ANOVA. (D) Brain sections from vehicle- and GSK2606414-treated mice were incubated with anti-ORP150 and anti-calbindin antibodies. Sections were incubated with Alexa 488 (green)- or Alexa 594 (red)-conjugated secondary antibodies, and reacted with Hoechst 33258 (blue) to stain the nuclei. Scale bar, 25 μm. No significant changes in ORP150 mRNA or protein levels were seen in WT mice treated with GSK2606414 (data not shown). Figure 8. View largeDownload slide ORP150 increases in the cerebellum of GSK2606414-treated woozy mice. (A) Protein extracts (20 μg) from the cerebella of vehicle- or GSK2606414-treated woozy mice were analyzed by western blot with anti-ORP150 (top panel) and anti-vinculin (lower panel) antibodies. (B) ORP150 was quantified by densitometic analysis, normalized for the amount of vinculin and expressed as a percentage of the amount in WT mice. Data are the mean ± S.E.M. of 4–5 animals per experimental group. *P < 0.05 by one-way ANOVA, Tukey’s post-hoc test. (C) ORP150 mRNA was quantified by RT-qPCR and expressed as percentage of WT. Data are the mean ± S.E.M.; n = 3–4; F2,7 = 0.7435; P = 0.5096 by one-way ANOVA. (D) Brain sections from vehicle- and GSK2606414-treated mice were incubated with anti-ORP150 and anti-calbindin antibodies. Sections were incubated with Alexa 488 (green)- or Alexa 594 (red)-conjugated secondary antibodies, and reacted with Hoechst 33258 (blue) to stain the nuclei. Scale bar, 25 μm. No significant changes in ORP150 mRNA or protein levels were seen in WT mice treated with GSK2606414 (data not shown). GSK2606414 attenuates the muscle pathology of woozy mice Woozy mice develop severe progressive myopathy, with upregulation of UPR markers, which is first evident at 16 weeks of age by electron microscopy when histological examination is still unrevealing (7). To test whether GSK2606414 had any effect on skeletal muscle, we analyzed the quadriceps of the treated mice by transmission electron microscopy. Consistent with previous observations (7), we found a number of ultrastructural alterations in the muscle fibers of woozy mice that were absent in WT controls. These included enlargements of the sarcoplasmic reticulum in the myofibrillar compartment and the presence of perinuclear autophagic vacuoles containing myelin-like membranous material (Fig. 9A). These alterations were seen in both vehicle- and GSK2606414-treated animals, although they were less marked in the latter (Fig. 9B and C). Figure 9. View largeDownload slide GSK2606414 attenuates the ultrastructural alterations in the quadriceps muscle fibers of woozy mice. Quadriceps muscle ultrastructure of vehicle- and GSK2606414-treated mice after 12 weeks of treatment (16 week of age). (A) Examples of normal intermyofibrillar (i) and perinuclear (iv) muscle fiber ultrastructure in two vehicle-treated WT mice; pathological enlargement of the sarcoplasmic reticulum in the myofibrillar compartment of a woozy mouse treated with the vehicle (ii) or GSK2606414 (iii); perinuclear vacuoles (black arrows) sometimes engulfed with myelin-like autophagic material (white arrows) in the skeletal muscle of a woozy mouse treated with vehicle (v) or GSK2606414 (vi). Scale bar, 1 μm. (B) Percentage of the area occupied by the sarcoplasmic reticulum in the myofibrillar compartment of the different groups of mice. Data are the mean ± S.E.M. of four animals per experimental group. F1,12 = 45.33; P < 0.0001 by two-way ANOVA; ****P < 0.0001 by Bonferroni’s post-hoc test. (C) Percentage of nuclei with perinuclear ultrastructural alterations. Data are the mean ± S.E.M.; *P < 0.05 by t-test. No perinuclear abnormalities were observed in WT mice. Figure 9. View largeDownload slide GSK2606414 attenuates the ultrastructural alterations in the quadriceps muscle fibers of woozy mice. Quadriceps muscle ultrastructure of vehicle- and GSK2606414-treated mice after 12 weeks of treatment (16 week of age). (A) Examples of normal intermyofibrillar (i) and perinuclear (iv) muscle fiber ultrastructure in two vehicle-treated WT mice; pathological enlargement of the sarcoplasmic reticulum in the myofibrillar compartment of a woozy mouse treated with the vehicle (ii) or GSK2606414 (iii); perinuclear vacuoles (black arrows) sometimes engulfed with myelin-like autophagic material (white arrows) in the skeletal muscle of a woozy mouse treated with vehicle (v) or GSK2606414 (vi). Scale bar, 1 μm. (B) Percentage of the area occupied by the sarcoplasmic reticulum in the myofibrillar compartment of the different groups of mice. Data are the mean ± S.E.M. of four animals per experimental group. F1,12 = 45.33; P < 0.0001 by two-way ANOVA; ****P < 0.0001 by Bonferroni’s post-hoc test. (C) Percentage of nuclei with perinuclear ultrastructural alterations. Data are the mean ± S.E.M.; *P < 0.05 by t-test. No perinuclear abnormalities were observed in WT mice. Finally, we used high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) to measure the levels of GSK2606414 in the blood and tissues of the treated mice. GSK2606414 concentrations in the blood, brain and quadriceps muscles taken at the end of the study (∼4 h after last dose) were 5968 ± 523 ng/ml, 4667 ± 541 ng/g and 4966 ± 543 ng/g, respectively (mean ± S.E.M.; n = 10). Mean brain/blood and muscle/blood ratios were 0.78 and 0.83. This confirmed that the compound had penetrated the brain and skeletal muscle of the woozy mice, reaching therapeutically useful concentrations similar to those reported by others (13). Discussion We tested the effect of pharmacologically inhibiting PERK kinase in the woozy mouse model of MSS, in which activation of PERK/eIF2α signaling prefigures PC degeneration, ataxia and myopathy. Treatment of presymptomatic mice with the PERK inhibitor GSK2606414 delayed neurodegeneration and the onset of motor dysfunction, prolonging the asymptomatic phase of the disease, and attenuated the motor impairment and skeletal muscle pathology in the symptomatic phase. Thus inhibiting PERK signaling early in the disease may have significant potential to alleviate symptoms and delay progression of neurodegeneration and myopathy. Cerebellar ataxia is a prominent pathological feature of MMS, which develops during infancy, worsens progressively for some years, then stabilizes (1). Similarly, early in their life woozy mice develop motor deficits detectable in the beam walking and rotarod tests, and their motor function worsens progressively to a point beyond which it does not decline further. At this stage both MRI and histological analysis indicate marked cerebellar atrophy. Cerebellar degeneration is characterized by selective loss of PCs of lobules I–VIII, in which BiP and CHOP are upregulated (6). We have now found that eIF2α is phosphorylated in these cells, and eIF2α-P and CHOP are already increased at 6 weeks of age before neurons degenerate and motor deficits ensue, between 7 and 10 weeks. Thus the PERK branch of the UPR is activated from an early stage in the cerebellum of woozy mice, like in prion-infected mice, and in rTg4510 tauP301L mice modeling frontotemporal dementia, in which activation of PERK precedes neurodegeneration and the appearance of neurological signs (13,14). Oral treatment with GSK2606414 starting from the fifth week of life significantly delayed the appearance of ataxia in woozy mice. After five weeks, when mice given vehicle were clearly impaired in the beam walking and rotarod tests, and showed significant loss of vulnerable PCs, motor deficits were absent and PCs were spared in GSK2606414-treated mice. This result is in line with the neuroprotective effects of GSK2606414 in prion-diseased and rTg4510 tauP301L mice (13,14). Treatment of prion-infected tg37 mice overexpressing the prion protein (PrP) from 7 weeks post-inoculation (w.p.i.) prevented the memory deficit and the abnormal burrowing behavior normally seen in this model at 9 w.p.i., and preserved hippocampal CA1 pyramidal neurons at 12 w.p.i. (13,14). In rTg4510 tauP301L mice, in which hippocampal degeneration and behavioral abnormalities develop much more slowly than in prion-infected mice, chronic GSK2606414 treatment from 6 months of age, when degeneration of CA1 neurons is beginning, reduced further neuronal loss and prevented clinical signs at 8 months of age (14). However, whether GSK2606414 provided long-term neuroprotection was not investigated in these models (in prion-infected mice this was not possible because of loss of 20% body mass by 12 w.p.i. which, per protocol, required the investigators to terminate the experiment). In woozy mice, we tested the effect of GSK2606414 up to 16 weeks of age, when in the absence of any treatment PCs are almost completely lost and motor function has maximally declined. In contrast to the almost complete neuroprotection seen after 5 weeks of treatment, after 12 weeks there was widespread loss of PCs, although still significantly less than in vehicle-treated mice. Consistent with this, GSK2606414-treated woozy mice continued to perform better in the rotarod and beam walking tests, and had less severe tremors than vehicle-treated controls. Thus even a modest increase in PC survival had detectable beneficial effects. The GSK2606414 concentrations in the brains of woozy mice were similar to those reported in other mouse models, ruling out the possibility that partial neuroprotection was due to poor compound bioavailability. Moreover, PERK-P was low in the cerebellum of GSK2606414-treated woozy mice, indicating continued inhibition of PERK signaling. There was no increase in total or spliced XBP1 mRNA expression, suggesting that protracted PERK inhibition did not lead to ATF6 and IRE1 over-activation. The observation that GSK2606414 delayed but did not halt PC degeneration suggests that PERK-mediated UPR is not the effector mechanism of neuronal cell death in woozy mice, and is consistent with evidence that genetic ablation of CHOP is not neuroprotective in this model (9). So how does PERK inhibition retard PC demise, and how do these cells eventually die? Blocking PERK/eIF2α-mediated translational attenuation, either genetically or pharmacologically, restores the synthesis of vital pre- and post-synaptic proteins in the hippocampus of prion-infected mice, and this accounts for the positive effects on synaptic transmission, neuronal survival and behavior (11–13). Recovery of synaptic protein synthesis is also likely to explain the neuroprotective effect of GSK2606414 in rTg4510 tauP301L mice, and may contribute to prolonging the survival of PCs in woozy mice. Unlike in prion diseases and frontotemporal dementia, where neurodegeneration is due to a gain of toxicity of misfolded PrP or tau, neuronal death in MSS is caused by functional loss of SIL1, which is important for BiP chaperone activity. BiP’s ability to bind unfolded proteins and release the folded substrate is tightly regulated by a cycle of ATP binding, hydrolysis and nucleotide exchange, which is controlled by a number of cofactors (21). SIL1 binds to ADP-bound BiP to catalyze the release of ADP and rebinding of ATP. In the absence of this nucleotide exchange, BiP remains associated with its client protein, ultimately leading to accumulation of unfolded proteins and the UPR. ORP150 can substitute for SIL1 (22), and its transgenic overexpression prevents PC death in woozy mice (9). Pharmacological PERK inhibition, by rescuing protein translation, may allow for more efficient ORP150 synthesis in ER-stressed PCs, restoring BiP-assisted folding and transport of membrane proteins essential for neuronal function and survival. In line with this, ORP150 was increased in PCs of GSK2606414-treated woozy mice, and PERK inhibition rescued the impairment in membrane protein trafficking seen in SIL1-deficient cells (manuscript submitted). However, in the long run this may still not be enough to support the normal activity of Purkinje neurons which, when dysfunctional, become susceptible to a variety of stresses and eventually die (23). Electron microscopy of the quadriceps muscles of GSK2606414-treated woozy mice showed attenuation of the incipient myopathy detectable in this model at 16 weeks of age. In contrast to the almost complete protection by GSK2606414 from early neuronal death, skeletal muscle was only partially protected, with pathological myofibers reduced by ∼40%. This is unlikely to be due to poor GSK2606414 penetration, since its concentrations in the quadriceps and brain were similar, but may be related to the fact that in the woozy skeletal muscle PERK is poorly activated (7). Thus, other signaling pathways may contribute to skeletal muscle degeneration that GSK2606414 cannot counteract (24). The delay in the onset of motor deficits and prolonged amelioration of motor function in GSK2606414-treated woozy mice might potentially translate into a significant improvement in the quality of life for carriers of SIL1 mutations, who could be diagnosed by molecular genetic screening prenatally or soon after birth, and treated in a pre-symptomatic stage. The use of GSK2606414 in humans, however, is questionable because of its pancreatic toxicity and effect on body weight seen in preclinical models of prion disease (13). In this regard, we found degeneration of exocrine acinar pancreatic tissue (Supplementary Material, Fig. S3) but no weight loss in woozy mice after 3 months of continuous GSK2606414, although they did not gain weight like vehicle-treated controls (Supplementary Material, Fig. S4). There was also no obvious sign of distress or alteration in home-cage behavior in treated WT or woozy mice. Thus in neurodegenerative conditions less severe than the rapidly progressing prion diseases, PERK pathway inhibition may be tolerable and managed clinically to achieve the intended therapeutic benefit without significant side effects. In addition, small-molecule inhibitors of PERK signaling have been described that act downstream of eIF2α-P and uncouple the neuroprotective effect from pancreatic toxicity (11,25). So it may be useful to pursue this approach for the treatment of SIL1-related MSS and other diseases associated with pathological PERK activation. Materials and Methods Study design The aim of the study was to test whether pharmacological inhibition of PERK is protective in the woozy mouse model of MSS. The rationale is based on findings that the PERK/eIF2a branch of the UPR is activated in degenerating Purkinje neurons and skeletal muscle fibers of woozy mice (6,7,9 and this study), and that genetic and pharmacological inhibition of the pathway is protective in several neurodegenerative disease models (11–14,26). We therefore tested the effect of GSK2606414, an orally available pharmacological inhibitor of PERK, on clinical and histopathological readouts. Longitudinal assessment of motor function was preliminarily employed to determine the onset and progression of ataxia in naïve woozy mice (Fig. 1A). Then treatment with GSK2606414 was planned in order to overlap the whole progressive phase of the disease, starting from a presymptomatic stage (i.e. from 4 to 16 weeks of age). Since we found no significant differences in motor performance and cerebellar anatomy between +/+ and +/wz mice (latency to fall from the rotarod at 34 weeks of age was 200 ± 13 s in +/+, and 217 ± 28 s in +/wz mice; the cerebellar volume at 28 weeks was 49.3 ± 1.0 mm3 in +/+, and 48.6 ± 1.6 mm3 in +/wz mice; mean ± S.E.M.; n = 9–10), animals of both genotypes were pooled and used as controls. No sex-related differences in the woozy phenotype were observed, so both male and female mice were included. The beam walking test, which detects subtle deficits in motor skills and balance but is too hard for severely ataxic woozy mice, was used to assess the effect of PERK inhibition on early motor dysfunction; the accelerating rotarod test, which is less challenging and can also be run with woozy mice in the advanced stage of disease, was used to monitor the long-term effects of the treatment starting from 9 weeks of age, when preliminary analysis indicated performance was beginning to be impaired in vehicle-treated woozy mice (Fig. 1A). Mice were trained three times to walk on the suspended beam and the accelerating rotating rod during the fourth week of life. At the end of the training there were no significant differences in performance between mice assigned to the different experimental groups. All animal experiments were designed in accordance with the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines (27), with a commitment to refinement, reduction and replacement, minimizing the number of mice, while using biostatistics to optimize mouse numbers. Thus, for statistical validity, sample size was calculated based on our preliminary assessment of rotarod performance (primary endpoint) in naïve woozy mice (Fig. 1A; expected treatment effect ≥ 50%; σ8–12wks = 48; α = 0.05, β = 0.2; n = 10). We used 9–10 mice for MRI, and 3–6 for biochemical analysis, histology and electron microscopy, which, according to our preliminary analysis in woozy mice, are sufficient to detect biologically relevant differences. GSK2606414 50 mg/kg was given orally by gavage twice daily, since in a preliminary experiment we found a clear reduction of PERK-P in the cerebellum of woozy mice treated with 50 but not 10 mg/kg of GSK2606414, consistent with previous pharmacokinetic analysis showing that 10 mg/kg gives inadequate brain exposure to efficiently inhibit PERK (13). Mice Woozy mice (CXB5/By-Sil1wz/J) (6) were obtained from The Jackson Laboratory (Stock No. 003777). They were maintained by heterozygous mating and genotyped by standard PCR, as recommended by the supplier. The animals were housed at controlled temperature (22 ± 2°C) with a 12/12 h light/dark cycle and free access to pelleted food and water. The health and home-cage behavior of the treated mice were monitored daily, according to guidelines for health evaluation of experimental laboratory animals (28). Procedures involving animals and their care were conducted in conformity with the institutional guidelines at the IRCCS–Mario Negri Institute for Pharmacological Research in compliance with national (D.lgs 26/2014; authorization no. 19/2008-A issued March 6, 2008 by Ministry of Health) and international laws and policies (EEC Council Directive 2010/63/UE; the NIH Guide for the Care and Use of Laboratory Animals, 2011 edition). They were reviewed and approved by the Mario Negri Institute Animal Care and Use Committee, which includes ad hoc members for ethical issues (18.03), and by the Italian Ministry of Health (decreto no. 93/2014-PR). Animal facilities meet international standards and are regularly checked by a certified veterinarian who is responsible for health monitoring, animal welfare supervision, experimental protocols and review of procedures. Accelerated rotarod test The accelerating Rotarod 7650 model (Ugo Basile) was used as described (29). Mice were trained three times before official testing. They were positioned on the rotating bar and allowed to become acquainted with the environment for 30 s. The rod motor was started at 7 rpm and accelerated to 40 rpm at a constant rate of 0.11 rpm/s for a maximum of 300 s. Performance was scored as latency to fall, in seconds. Animals were given three trials, and the average was used for statistical analysis. Beam walking test Mice were trained to walk along a metal beam 0.8 cm wide, 100 cm long, suspended 30 cm above bedding, for 3 days before testing. On the day of testing, animals were given three trials. Mice were video recorded and the number of hindfoot missteps, falls and time to traverse the beam during the three trials were counted by an investigator blinded to the experimental group. The average number of missteps and time to traverse the beam during the three trials were used for statistical analysis. Tremor Tremor was scored as mild (visible only when mice walked on the suspended beam) or severe (also visible when mice walked on a table top) by an investigator blinded to the experimental group. MRI Animals were anesthetized with 1% isoflurane in a 30: 70% O2: N2O gas mixture and imaged in a horizontal bore 7-Tesla USR preclinical MRI system (BioSpec 70/30, Bruker BioSpin, Germany) with a shielded gradient insert (BGA 12, 400 mT/m; rise time, 110 us). A 72 mm birdcage resonator for RF transmission, and a 10 mm diameter single-loop receiver coil were used to receive the signal. 3D T2-weighted anatomical images of the mouse brain were acquired with the following parameters: TR 2500 ms, TE 50 ms, RARE factor 16, FOV 3 × 1.5 × 1.5 cm, matrix 256 × 102 × 102, voxel 0.147 × 0.117 × 0.147. The scan time was approximately 25 min. The intracranial and cerebellar volumes were quantified manually using Fiji software (30), after a rigid body registration (6 dof) to a reference image to avoid bias due to bad head positioning. Immunohistochemistry and immunofluorescence Mice were deeply anesthetized by intraperitoneal injection of 100 mg/kg ketamine hydrochloride and 1 mg/kg medetomidine hydrochloride (Alcyon), and perfused through the ascending aorta with phosphate-buffered saline (PBS, 0.05 M; pH 7.4) followed by 4% paraformaldehyde (PFA) in PBS. Brains were removed, post-fixed, cryoprotected and frozen at −80°C. Serial sections (20 μm thick) were cut using a Leica cryostat and incubated for 1 h at RT with 10% FBS, 5% bovine serum albumin, 1% Triton X-100 in PBS 0.1 M, pH 7.4, then overnight at 4°C with mouse monoclonal anti-calbindin-D-28K antibody (Sigma Aldrich, C9848, 1: 2000), or rabbit polyclonal anti-CHOP (GADD153; Santa Cruz Biothechnology, sc-575, 1: 500) followed by visualization with the Vectastain ABC kit (Vector), using DAB as chromogen. Images were acquired with a VS120 Virtual Slide Microscope by Olympus and analyzed with NIH ImageJ software. Four sagittal sections were quantified for each mouse cerebellum using an algorithm to segment the stained area. The calbindin immunostained area in the cerebellar molecular layer was expressed as positive pixels/total assessed pixels and reported as a percentage of the total stained area. CHOP-positive cells were counted over the entire perimeter of the PC layer by an investigator blinded to the experimental group. For immunoflurescence staining, sections were incubated with the anti-calbindin antibody diluted 1: 1000 and with a rabbit polyclonal anti-eIF2α-P (Ser51) antibody (Cell Signaling, Cat. No. 9721S, 1: 100), the anti-CHOP antibody diluted 1: 100, or the anti-ORP15 antibody diluted 1: 100, followed by Alexa Fluor (Molecular Probes)-conjugated secondary antibodies. After extensive washing and staining with 2 μg/ml Hoechst 33258 (Molecular Probes), sections were mounted with FluorSave Reagent (Millipore). Images were acquired with an FV-500 Olympus laser confocal scanning system. Pancreas histology Sections (4 μm thick) of formalin-fixed, paraffin-embedded pancreas tissue were stained with hematoxylin and eosin and examined under a light microscope for the presence of exocrine acinar cell necrosis and ductal hyperplasia by a veterinary pathologist blind to the experimental group. The pancreas of two vehicle- and three GSK2606414-treated WT and woozy mice were analyzed. Western blot Western blot analysis was done as described (31). The following primary antibodies were used: rabbit polyclonal anti-eIF2α-P (Cell Signaling, Cat. No. 9721, 1: 1000); mouse monoclonal anti-total eIF2α (Cell Signaling Cat No. 2103, 1: 1000); mouse monoclonal anti-vinculin (Sigma, V9264, 1: 5000); rabbit polyclonal anti-PERK-P (Cell Signaling T980, 3179, 1: 1000); rabbit polyclonal anti-total PERK (Cell Signaling C33E10, 3192, 1: 1000); and rabbit monoclonal anti-ORP150 (Abcam EPR5890, ab124884, 1: 1000). RT-qPCR Total RNA was extracted from the mouse tissues with an RNeasy kit (Qiagen) according to the manufacturer’s instructions. A total of 0.5 μg RNA was reverse-transcribed with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) using random primers, and quantitative PCR was done in Optical 96- or 384-well plates (Applied Biosystem) using the 7300 or 7900 Real Time PCR System (Applied Biosystems) and GoTaq qPCR Master Mix (Promega) according to the manufacturer’s instructions. Reaction conditions were 50°C for 2 min, 95°C for 10 min, then 95°C for 15 s alternating with 60°C for 1 min for 41 cycles, followed by 95°C for 15 s and 60°C for 15 s. The amplifications were always run in triplicate with a blank control consisting of a water template (RNase/DNase-free water). For RT-qPCR of ORP150 the RT2 qPCR Primer Assay for Mouse Hyou1 (Qiagen) was used. The primer pair sequences were: ACTCCGGCGTGAGGTAGAAA (Fw) and AGAGCGGAACAGGTCCATGT (Rv) for BiP; CCACCACACCTGAAAGCAGAA (Fw) and AGGTGCCCCCAATTTCATCT (Rv) for CHOP; GGAGTGGAGTAAGGCTGGTG (Fw) and CCAGAATGCCCAAAAGGATA (Rv) for total XBP-1; and GAGTCCGCAGCAGGTG (Fw) and GTGTCAGAGTCCATGGGA (Rv) for sXBP-1. Three housekeeping genes were used for data normalization: HPRT1 (Fw, CTTCCTCCTCAGACCGCTTTT and Rv, CATCATCGCTAATCACGACGC), PGK1 (Fw, GGTCGTGATGAGGGTGGAC and Rv, GCAGCCTTGATCCTTTGGTTG) and SV2B (Fw, AGCATGTCACTGGCCATCAA and Rv, CCCAATCCCTATGCCTGAGAT). Transmission electron microscopy Quadriceps femoris muscle from 16-week-old mice were excised, cut in the sagittal plane with a razor blade, and fixed with 4% PFA and 2% glutaraldehyde in phosphate buffer 0.12 M, pH 7.4 for 4 h at room temperature, followed by post-fixation with 1% OsO4 and 1.5% ferrocyanide in 0.12 M cacodylate buffer (ferrocyanide-reduced OsO4) at room temperature for 1 h, then 0.3% thiocarbohydrazide in H2O for 5 min, and 1% OsO4 in 0.12 M cacodylate buffer for 1 h. After dehydration in graded series of ethanol, tissue samples were cleared in propylene oxide, embedded in epoxy medium (Epon 812, Fluka) and polymerized at 60°C for 72 h. From each sample, one semithin section (1 μm) was cut with a Leica EM UC6 ultramicrotome and mounted on glass slides for light microscopy. Ultrathin sections (60 nm thick) of areas of interest were obtained, counterstained with uranyl acetate and lead citrate and examined with an Energy Filter Transmission Electron Microscope (EFTEM, ZEISS LIBRA® 120) equipped with an yttrium aluminum garnet (YAG) scintillator slow-scan charge-coupled device (CCD) camera (Sharp eye, TRS, Moorenweis, Germany). The percentage of nuclei with perinuclear ultrastructural alterations was assessed by analyzing 50 perinuclear areas in each animal; the percentage of the area occupied by the sarcoplasmic reticulum in the myofibrillar compartment was calculated by iTem software (Olympus Soft Imaging Solutions, Germany) in 20 random fields in each animal. GSK2606414 dosing and bioanalysis The PERK inhibitor GSK2606414 (supplied by GlaxoSmithKline) was formulated as a suspension (5 mg/ml) in 0.5% hydroxypropyl-methyl cellulose (HPMC), 0.1% Tween-80, pH 4.0 and given orally by gavage. GSK2606414 concentrations were quantified in blood (1: 1 dilution with water) and tissue homogenates (1: 4 for brain or 1: 9 for muscle dilution with 20: 80 methanol: water) at Alliance Pharma (Malvern, PA, USA) by protein precipitation followed by HPLC-MS/MS. The lower limit of quantification of GSK2606414 was 1.0 ng/ml. Supplementary Material Supplementary Material is available at HMG online. Acknowledgements We thank Elisa R. Zanier and Luana Fioriti for comments on the manuscript. We are grateful to Stefano Fumagalli for advice on quantification of the calbindin immunostaining; to Lara Paracchini and Sara Ballabio for advice on RT-qPCR; to Mauro Tettamanti and Ilaria Speranza for help with statistical analysis; to Lorenzo Taiarol for help with RNA extraction; and to Camilla Recordati for pancreas histology. This work was supported by a grant from Fondazione Telethon (GGP12220). Conflict of Interest statement. J.M.A. and N.J.L. are employees of GlaxoSmithKline with equity holdings and stock options. GlaxoSmithKline holds patents for PERK inhibitors including GSK2606414: U.S. Pat. Appl. Publ. (2012), US 20120077828 A1 PCT Int. Appl. (2011), WO 2011119663 A1. The other authors declare no competing interests. References 1 Anttonen A.K., Lehesjoki A.E. ( 2006) Marinesco-Sjögren Syndrome. [Updated 2010 Sep 7]. In Adam, M.P., Ardinger, H.H., Pagon, R.A., et al., (eds), GeneReviews® [Internet]. University of Washington, Seattle, WA; 1993-2018. Available from: https://www.ncbi.nlm.nih.gov/books/NBK1192/. 2 Ezgu F., Krejci P., Li S., de Sousa C., Graham J.M., Hansmann I., He W., Porpora K., Wand D., Wertelecki W. ( 2014) Phenotype-genotype correlations in patients with Marinesco-Sjögren syndrome. Clin. Genet ., 86, 74– 84. Google Scholar CrossRef Search ADS PubMed  3 Senderek J., Krieger M., Stendel C., Bergmann C., Moser M., Breitbach-Faller N., Rudnik-Schoneborn S., Blaschek A., Wolf N.I., Harting I. et al.   ( 2005) Mutations in SIL1 cause Marinesco-Sjogren syndrome, a cerebellar ataxia with cataract and myopathy. Nat. Genet ., 37, 1312– 1314. Google Scholar CrossRef Search ADS PubMed  4 Anttonen A.K., Mahjneh I., Hamalainen R.H., Lagier-Tourenne C., Kopra O., Waris L., Anttonen M., Joensuu T., Kalimo H., Paetau A. et al.   ( 2005) The gene disrupted in Marinesco-Sjogren syndrome encodes SIL1, an HSPA5 cochaperone. Nat. Genet ., 37, 1309– 1311. Google Scholar CrossRef Search ADS PubMed  5 Krieger M., Roos A., Stendel C., Claeys K.G., Sonmez F.M., Baudis M., Bauer P., Bornemann A., de Goede C., Dufke A. et al.   ( 2013) SIL1 mutations and clinical spectrum in patients with Marinesco-Sjogren syndrome. Brain , 136, 3634– 3644. Google Scholar CrossRef Search ADS PubMed  6 Zhao L., Longo-Guess C., Harris B.S., Lee J.W., Ackerman S.L. ( 2005) Protein accumulation and neurodegeneration in the woozy mutant mouse is caused by disruption of SIL1, a cochaperone of BiP. Nat. Genet ., 37, 974– 979. Google Scholar CrossRef Search ADS PubMed  7 Roos A., Buchkremer S., Kollipara L., Labisch T., Gatz C., Zitzelsberger M., Brauers E., Nolte K., Schroder J.M., Kirschner J. et al.   ( 2014) Myopathy in Marinesco-Sjogren syndrome links endoplasmic reticulum chaperone dysfunction to nuclear envelope pathology. Acta Neuropathol ., 127, 761– 777. Google Scholar CrossRef Search ADS PubMed  8 Chung K.T., Shen Y., Hendershot L.M. ( 2002) BAP, a mammalian BiP-associated protein, is a nucleotide exchange factor that regulates the ATPase activity of BiP. J. Biol. Chem ., 277, 47557– 47563. Google Scholar CrossRef Search ADS PubMed  9 Zhao L., Rosales C., Seburn K., Ron D., Ackerman S.L. ( 2010) Alteration of the unfolded protein response modifies neurodegeneration in a mouse model of Marinesco-Sjogren syndrome. Hum. Mol. Genet ., 19, 25– 35. Google Scholar CrossRef Search ADS PubMed  10 Ron D., Walter P. ( 2007) Signal integration in the endoplasmic reticulum unfolded protein response. Nat. Rev. Mol. Cell Biol ., 8, 519– 529. Google Scholar CrossRef Search ADS PubMed  11 Halliday M., Radford H., Sekine Y., Moreno J., Verity N., le Quesne J., Ortori C.A., Barrett D.A., Fromont C., Fischer P.M. et al.   ( 2015) Partial restoration of protein synthesis rates by the small molecule ISRIB prevents neurodegeneration without pancreatic toxicity. Cell Death Dis ., 6, e1672. Google Scholar CrossRef Search ADS PubMed  12 Moreno J.A., Radford H., Peretti D., Steinert J.R., Verity N., Martin M.G., Halliday M., Morgan J., Dinsdale D., Ortori C.A. et al.   ( 2012) Sustained translational repression by eIF2alpha-P mediates prion neurodegeneration. Nature , 485, 507– 511. Google Scholar CrossRef Search ADS PubMed  13 Moreno J.A., Halliday M., Molloy C., Radford H., Verity N., Axten J.M., Ortori C.A., Willis A.E., Fischer P.M., Barrett D.A. et al.   ( 2013) Oral treatment targeting the unfolded protein response prevents neurodegeneration and clinical disease in prion-infected mice. Sci. Transl. Med ., 5, 206ra138. Google Scholar CrossRef Search ADS PubMed  14 Radford H., Moreno J.A., Verity N., Halliday M., Mallucci G.R. ( 2015) PERK inhibition prevents tau-mediated neurodegeneration in a mouse model of frontotemporal dementia. Acta Neuropathol ., 130, 633– 642. Google Scholar CrossRef Search ADS PubMed  15 Saxena S., Cabuy E., Caroni P. ( 2009) A role for motoneuron subtype-selective ER stress in disease manifestations of FALS mice. Nat. Neurosci ., 12, 627– 636. Google Scholar CrossRef Search ADS PubMed  16 Colla E., Coune P., Liu Y., Pletnikova O., Troncoso J.C., Iwatsubo T., Schneider B.L., Lee M.K. ( 2012) Endoplasmic reticulum stress is important for the manifestations of alpha-synucleinopathy in vivo. J. Neurosci ., 32, 3306– 3320. Google Scholar CrossRef Search ADS PubMed  17 Das I., Krzyzosiak A., Schneider K., Wrabetz L., D'Antonio M., Barry N., Sigurdardottir A., Bertolotti A. ( 2015) Preventing proteostasis diseases by selective inhibition of a phosphatase regulatory subunit. Science , 348, 239– 242. Google Scholar CrossRef Search ADS PubMed  18 Halliday M., Hughes D., Mallucci G.R. ( 2017) Fine-tuning PERK signaling for neuroprotection. J. Neurochem ., 142, 812– 826. Google Scholar CrossRef Search ADS   19 Lee K., Tirasophon W., Shen X., Michalak M., Prywes R., Okada T., Yoshida H., Mori K., Kaufman R.J. ( 2002) IRE1-mediated unconventional mRNA splicing and S2P-mediated ATF6 cleavage merge to regulate XBP1 in signaling the unfolded protein response. Genes Dev ., 16, 452– 466. Google Scholar CrossRef Search ADS PubMed  20 Axten J.M., Medina J.R., Feng Y., Shu A., Romeril S.P., Grant S.W., Li W.H.H., Heerding D.A., Minthorn E., Mencken T. et al.   ( 2012) Discovery of 7-methyl-5-(1-{[3-(trifluoromethyl)phenyl]acetyl}-2, 3-dihydro-1H-indol-5-yl)-7H-p yrrolo[2, 3-d]pyrimidin-4-amine (GSK2606414), a potent and selective first-in-class inhibitor of protein kinase R (PKR)-like endoplasmic reticulum kinase (PERK). J. Med. Chem ., 55, 7193– 7207. Google Scholar CrossRef Search ADS PubMed  21 Behnke J., Feige M.J., Hendershot L.M. ( 2015) BiP and its nucleotide exchange factors Grp170 and Sil1: mechanisms of action and biological functions. J. Mol. Biol ., 427, 1589– 1608. Google Scholar CrossRef Search ADS PubMed  22 Weitzmann A., Volkmer J., Zimmermann R. ( 2006) The nucleotide exchange factor activity of Grp170 may explain the non-lethal phenotype of loss of Sil1 function in man and mouse. FEBS Lett ., 580, 5237– 5240. Google Scholar CrossRef Search ADS PubMed  23 Sarna J.R., Hawkes R. ( 2003) Patterned Purkinje cell death in the cerebellum. Prog. Neurobiol ., 70, 473– 507. Google Scholar CrossRef Search ADS PubMed  24 Pakos-Zebrucka K., Koryga I., Mnich K., Ljujic M., Samali A., Gorman A.M. ( 2016) The integrated stress response. EMBO Rep ., 17, 1374– 1395. Google Scholar CrossRef Search ADS PubMed  25 Halliday M., Radford H., Zents K.A.M., Molloy C., Moreno J.A., Verity N.C., Smith E., Ortori C.A., Barrett D.A., Bushell M. et al.   ( 2017) Repurposed drugs targeting eIF2α-P-mediated translational repression prevent neurodegeneration in mice. Brain J. Neurol ., 140, 1768– 1783. Google Scholar CrossRef Search ADS   26 Mercado G., Castillo V., Soto P., López N., Axten J.M., Sardi P., Hoozemans J.J.M., Hetz C. ( 2018) Targeting PERK signaling with the small molecule GSK2606414 prevents neurodegeneration in a model of Parkinson’s disease. Neurobiol. Dis ., 112, 136– 148. Google Scholar CrossRef Search ADS PubMed  27 Kilkenny C., Browne W.J., Cuthill I.C., Emerson M., Altman D.G. ( 2010) Improving bioscience research reporting: the ARRIVE guidelines for reporting animal research. PLoS Biol ., 8, e1000412. Google Scholar CrossRef Search ADS PubMed  28 Burkholder T., Foltz C., Karlsson E., Linton C.G., Smith J.M. ( 2012) Health evaluation of experimental laboratory mice. Curr. Protocol. Mouse Biol ., 2, 145– 165. Google Scholar CrossRef Search ADS   29 Bouybayoune I., Mantovani S., Del Gallo F., Bertani I., Restelli E., Comerio L., Tapella L., Baracchi F., Fernandez-Borges N., Mangieri M. et al.   ( 2015) Transgenic fatal familial insomnia mice indicate prion infectivity-independent mechanisms of pathogenesis and phenotypic expression of disease. PLoS Pathog ., 11, e1004796. Google Scholar CrossRef Search ADS PubMed  30 Schindelin J., Arganda-Carreras I., Frise E., Kaynig V., Longair M., Pietzsch T., Preibisch S., Rueden C., Saalfeld S., Schmid B. et al.   ( 2012) Fiji: an open-source platform for biological-image analysis. Nat. Methods , 9, 676– 682. Google Scholar CrossRef Search ADS PubMed  31 Quaglio E., Restelli E., Garofoli A., Dossena S., De Luigi A., Tagliavacca L., Imperiale D., Migheli A., Salmona M., Sitia R. et al.   ( 2011) Expression of mutant or cytosolic PrP in transgenic mice and cells is not associated with endoplasmic reticulum stress or proteasome dysfunction. PLoS One , 6, e19339. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Human Molecular GeneticsOxford University Press

Published: Apr 28, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off