Paternal Exposure to Environmental Chemical Stress Affects Male Offspring’s Hepatic Mitochondria

Paternal Exposure to Environmental Chemical Stress Affects Male Offspring’s Hepatic Mitochondria Abstract Preconceptional paternal exposures may affect offspring’s health, which cannot be explained by mutations in germ cells, but by persistent changes in the regulation of gene expression. Therefore, we investigated whether pre-conceptional paternal exposure to benzo[a]pyrene (B[a]P) could alter the offspring’s phenotype. Male C57BL/6 mice were exposed to B[a]P by gavage for 6 weeks, 3× per week, and were crossed with unexposed BALB-c females 6 weeks after the final exposure. The offspring was kept under normal feeding conditions and was sacrificed at 3 weeks of age. Analysis of the liver proteome by 2D-gel electrophoresis and mass spectrometry indicated that proteins involved in mitochondrial function were significantly downregulated in the offspring of exposed fathers. This down-regulation of mitochondrial proteins was paralleled by a reduction in mitochondrial DNA copy number and reduced activity of citrate synthase and β-hydroxyacyl-CoA dehydrogenase, but in male offspring only. Surprisingly, analysis of hepatic mRNA expression revealed a male-specific up-regulation of the genes, whose proteins were downregulated, including Aldh2 and Ogg1. This discrepancy could be related to several selected microRNA (miRNA)’s that regulate the translation of these proteins; miRNA-122, miRNA-129-2-5p, and miRNA-1941 were upregulated in a gender-specific manner. Since mitochondria are thought to be a source of intracellular reactive oxygen species, we additionally assessed oxidatively-induced DNA damage. Both 8-hydroxy-deoxyguanosine and malondialdehyde-dG adduct levels were significantly reduced in male offspring of exposed fathers. In conclusion, we show that paternal exposure to B[a]P can regulate mitochondrial metabolism in offspring, which may have profound implications for our understanding of health and disease risk inherited from fathers. paternal exposure, offspring, mitochondria, oxidative stress, DNA damage Nowadays there are several examples in which parental environmental exposures could change the phenotype of future generations, suggesting the existence of mechanisms that enable the transmission of acquired traits across generations (Gapp et al., 2014; Nettle and Bateson, 2015; Vanhees et al., 2014). The concept that early life diet and exposures could lead to an increased risk of diseases later in life was originally called the Barker Hypothesis, but is now known as the hypothesis of Developmental Origins of Health and Disease (Wells, 2012). Apparently, the traditional view of Mendelian genetic inheritance of traits is no longer satisfactory. Additional carriers of parental information in the gametes may include various forms of RNA and epigenetic signals, such as DNA methylation and chromatin modifications (Rando, 2016). This nongenetic inheritance of traits is often studied in offspring of females that were exposed to external environmental factors during pregnancy, including limited calorie intake (Wattez et al., 2015), infection (Straubinger et al., 2014), stress (Chaby, 2016), drugs and toxins (Anway et al., 2005), resulting in an adverse gestational environment. More recently, it has become clear from rodent studies that also paternal exposures or lifestyle can have detectable biological effects in the offspring, which cannot be explained by mutations. For instance, a pre-conceptional high fat diet of males resulted in beta-cell dysfunction in female offspring (Ng et al., 2010), and paternal exposure to radiation affected DNA methylation and the expression of certain genes and miRNA’s in their offspring’s thymus (Filkowski et al., 2010). Also overweight of fathers induced paternal programming of the offspring phenotypes, likely mediated through genetic, but also epigenetic changes in spermatozoa (McPherson et al., 2014). These transmittable effects are tissue-specific and/or exposure-specific. The underlying mechanisms and health consequences are far from completely clear. Therefore, this area of research needs significantly further attention. The mechanism by which nongenetic information is transmitted from one generation to the other may be related to the RNA content of sperm. Rassouzadegan et al. (Rassoulzadegan et al., 2006) showed that the type of RNA in sperm resulted in non-Mendelian inheritance of tail color in mice and their findings were later extended to heart malformation and body size (Grandjean et al., 2009; Wagner et al., 2008). In these studies, noncoding RNAs, either RNA fragments or miRNAs, in sperm were the causative epigenetic factors that induced the biological effect in offspring. The RNA in sperm that is transmitted to the oocyte during fertilization can be changed by exposure to lifestyle-related compounds and environmentally derived genotoxins (Linschooten et al., 2009). One important environmental genotoxic agent is benzo[a]pyrene (B[a]P), which is formed by incomplete combustion of organic materials and is present in cigarette smoke, diesel exhaust or smoked food products. B[a]P reaches the testes of exposed males and can damage the DNA of sperm, but can also change the RNA content of sperm and DNA methylation profiles in the testes (Godschalk et al., 2015). Although, we previously showed that B[a]P can induce mutations in sperm that are subsequently transmitted to the offspring (Godschalk et al., 2015; Verhofstad et al., 2011), these mutations are probably too rare and too much distributed over the whole genome to induce consistent biological effects in offspring. Brevik et al. (2012a,b) showed that fertilization of mouse oocytes by sperm of fathers that were previously exposed to B[a]P, consistently changed the mRNA and miRNA content of the developing embryo up to the blastocyst stage, but the consequences of these changes for the health of the embryo and its further development were not assessed. The altered RNA content of sperm could however modify postfertilization events and development, which may have effects in offspring later in life. A hypothesis describing this phenomenon is called the predictive adaptive response (PAR) (Bateson et al., 2014), in which it is stated that a fetus adapts to perceived environmental cues, which reach the fetus via the placenta during pregnancy but possibly also via the content of sperm. If this PAR predicts the postnatal environment correctly, it may be advantageous in later life because, due to its plasticity, the developing fetus adapts to the anticipated environmental cues. Since B[a]P is predominantly metabolized in the liver, a PAR after paternal exposure to B[a]P may especially result in adaptation of the liver. We thus hypothesized that paternal B[a]P exposure could change gene and protein expression in the liver of offspring. We first performed a lead finding study, in which the proteome of liver of 3-week-old offspring of male C57BL6 mice that were exposed to B[a]P was analyzed by 2D-gel electrophoresis. Down-regulation of several mitochondria-related proteins involved in metabolism and DNA repair was observed. We subsequently studied mitochondrial DNA copy number, gene-expression and miRNA expression and oxidative stress-related DNA damage in more detail in both male and female offspring. MATERIALS AND METHODS Animal exposure and breeding Mice were bred and maintained in a 12-h light-dark cycle at the animal facilities of the Netherlands Vaccine Institute (NVI, Bilthoven, the Netherlands) and received food and water ad libitum. Experiments were approved by the Institute’s Animal Ethics Committee and were carried out according to their guidelines. Male C57BL/6 mice were exposed for 6 weeks to B[a]P (3 times per week, 13 mg/kg bw dissolved in sunflower oil) by oral gavage. Sunflower oil was used as solvent, because of the lipophilicity of B[a]P and the dose of 13 mg/kg bw was based on previous studies in which it induced detectable DNA adduct levels in testis and sperm (Verhofstad et al., 2010). Control male mice received sunflower oil 3 times per week for 6 weeks. Six weeks after the last exposure, all mice (6 mice per group) were subsequently crossed with 2 unexposed Balb/c wildtype female mice in order to obtain offspring. This 6-week break ensured that the effects in the F1 originate from spermatogonial stem cells and dividing spermatogonia (note that it takes ∼6 weeks for sperm cells to reach the epididymis/ejaculate after the first mitotic division of a spermatogonial stem cell). Offspring was euthanized 3 weeks after birth and liver tissues were snap frozen in liquid nitrogen and stored at −80 °C. Proteome analysis by 2D-gel electrophoresis Liver tissues were crushed in liquid nitrogen to obtain a homogenized sample for protein extraction. Eight liver samples of male offspring mice (4 of exposed fathers, 4 of control fathers) were lysed in lysis buffer (40 mM Tris, 7 M urea, 4% CHAPS and 100 mM DTT). Chemicals were purchased from Sigma-Aldrich unless stated otherwise. Cells were further lysed by 3 cycles of quick freezing in liquid nitrogen and subsequent thawing. DNA was digested by adding DNase. The homogenate was vortexed for 1 min and centrifuged at 20 000 × g for 30 min at 10 °C. The protein concentration of the supernatants was determined by a Bradford based protein assay and an albumin calibration curve. Aliquots were stored at −80 °C. The 2D-gel-electrophoresis was essentially performed as described previously (de Roos et al., 2008). Total protein (200 µg) was loaded for the first dimension in 500 μl with 0.5% v/v IPG Biolyte buffer 3–11 nonlinear. Immobiline Dry Strips (pH 3–11, nonlinear, 18 cm long) were rehydrated for 12 h in 8 M urea, 2% w/v CHAPS, 65 mM DTT, 0.5% v/v IPG buffer at 30 V. Then the isoelectric focusing was performed on an IPGphor electrophoresis unit (Amersham Biosciences) at 20 °C (12-h rehydration 20 °C 50 µA, 2 h 500 V, 2 h 1000 V Gradient, 3.5 h 8000 V Gradient and a focusing step of 32 000 Vh at 8000 V). After iso-electric focusing, IPG strips were equilibrated for 15 min in 50 mM Tris-HCl, pH 6.8, 6 M urea, 30% v/v glycerol, 2% w/v SDS, 1% w/v DTT and for 15 min in 50 mM Tris-HCl, pH 6.8, 6 M urea, 30% v/v glycerol, 2% w/v SDS, 2.5% w/v iodoacetamide, and were placed onto a 12.5% SDS-PAGE gel and sealed with a 0.5% w/v agarose solution in Laemmli buffer with a trace of bromophenol blue. Electrophoresis was conducted at a constant voltage of 200 V for 5 h in a Dodeca system (Bio-Rad). Gels were removed from the casting plates and fixed for at least 30 min in 10% v/v Methanol, 7% v/v Acetic Acid. After fixation, the gels were stained in SYPRO RUBY protein gel stain (BioRad). The scanning was performed using a fluorescent laser scanner (BioRad Personal Molecular Imager FX) using the Quantity One software (Version 4.6.5 Build 094). All gels were analyzed using the PDQuest software (Version 8.0.1 Build 055). Protein identification by mass spectrometry Spots of interest (ie, 2-fold change in abundance combined with a t-test value of <0.05) were manually excised from the gel and processed on a MassPREP digestion robot (Waters, Manchester UK). A solution of 50 mM ammonium bicarbonate in 50% v/v acetonitrile was used for destaining. Cysteines were reduced with 10 mM DTT in 100 mM ammonium bicarbonate for 30 min followed by alkylation with 55 mM iodoacetamide in 100 mM ammonium bicarbonate for 20 min. Spots were washed with 100 mM ammonium bicarbonate to remove excess reagents and were subsequently dehydrated with 100% acetonitrile. Trypsin (6 ng/ml) in 50 mM ammonium bicarbonate was added to the gel plug and incubated at 37 °C for 5 h. The peptides were extracted with 1% v/v formic acid/2% v/v acetonitrile. Proteins were identified by MALDI-TOF- mass spectrometry (MS) (M@LDI-LR mass spectrometer, Waters, Manchester, UK) or LC-MS (nanoflow HPLC instrument [Dionex ultimate 300] with a C18-reversed phase column [Thermo Scientific Acclaim PepMap C18 column, 75 μm inner diameter × 15 cm, 5 μm particle size] coupled on-line to a Q Exactive [Thermo Scientific] with a nanoelectrospray Flex ion source [Proxeon]). The peptide mass list was searched with ProteinLynx GlobalServer (Micromass, UK Manchester) against the Swiss-Prot database (http://expasy.ch/sprot) for protein identification. One mis-cleavage was tolerated, carbamido-methylation and oxidation of methionine were regarded as optional modifications. The peptide mass tolerance was set to 100 ppm. No restrictions were made on the protein molecular weight and the isoelectric point (pI). A protein was regarded identified with at least 5 peptide mass hits or sequence coverage of 30% of the complete protein sequence. Additionally, the data were searched using Sequest HT Proteome Discoverer 1.4 search engine (Thermo Scientific), against the Uniprot database. The false discovery rate was set to 0.01 for proteins and peptides, which had to have a minimum length of 6 amino acids. The precursor mass tolerance was set at 10 ppm and the fragment tolerance at 0.2 Da. One miss-cleavage was tolerated, oxidation of methionine was set as a dynamic modification and carbamido-methylation of cysteines was a fixed modification. Enzyme activity assay A tissue homogenate was prepared by dispersion (5% wt/vol, using a Polytron PT 1600 E; Kinematica, Lucerne, Switzerland) in 250 mM sucrose, 2 mM EDTA, and 10 mM Tris (pH 7.4), followed by 1 min sonication (Branson 2210; Branson Ultrasonics). Samples were centrifuged (10 min, 10 000 × g, 4 °C) and the supernatant was used for enzyme activity assays of β-hydroxyacyl-CoA dehydrogenase (HADH) and citrate synthase (CS) (Gosker et al., 2002, 2006). Enzyme activity levels were corrected for total protein content. Total protein content was determined using a detergent compatible protein determination assay (Bio-Rad, Hercules, California). Protein extraction and western blotting Pieces of liver were powdered and homogenized in 400 μl IP lysis buffer (50 mM Tris, 150 mM NaCl, 10% glycerol, 0.5% Nonidet P40, 1 mM EDTA, 1 mM Na3VO4, 5 mM NaF, 10 mM β-glycerophosphate, 1 mM Na4O7P2, 1 mM DTT, 10 μg/μl leupeptin, 1% apropeptin, 1 mM PMSF, pH 7.4) with a tissue homogenizer (Polytron PT 1600 E; Kinematica). Lysates were incubated while rotating for 15-60 min, and subsequently centrifuged at 20 000 × g for 30 min at 4 °C. Protein concentrations were determined using the Pierce BCA Protein Assay Kit (Thermo Scientific, Landsmeer, Netherlands) according to the manufacturer’s protocol. Lysate (1 μg/μl) was aliquoted in sample buffer (0.25 M Tris-HCl, 8% (w/v) SDS, 40% (v/v) glycerol, 0.4 M DTT, 0.04% (w/v) bromophenol blue, pH 6.8) and boiled for 5 min at 95 °C. 10 µg of protein per sample was run on a Criterion 26-wells 12% precast gel (Bio-Rad Laboratories B.V., Veenendaal, Netherlands) in 1x MES buffer (Bio-Rad Laboratories B.V., Veenendaal, The Netherlands) at 100 V, and was subsequently blotted on a Nitrocellulose membrane (Bio-Rad Laboratories B.V., Veenendaal, The Netherlands) by electroblotting in TBS-Tween-20 (0.05%). At least 2 protein ladders were loaded on each gel (Precision Plus Protein All Blue Standards, Bio-Rad Laboratories B.V.). Membranes were incubated in Ponceau S (Bio-Rad Laboratories B.V., Veenendaal, The Netherlands) for 5 min and washed with milliQ before they were photographed using the AmershamImager 600 (GE Healthcare Life Sciences, Eindhoven, Netherlands). Ponceau S quantification was used as correction for loading. Subsequently, membranes were destained by repeated washing with TBS-Tween-20 (0.05%), blocked with 3% nonfat dried milk (NFDM (non-fat, dried milk) (Campina, Amersfoort, Netherlands) in TBS-Tween-20 (0.05%) for 1 h, washed, and incubated overnight at 4 °C with different protein-specific primary antibodies against: oxidative phosphorylation (OXPHOS) (Mitoscience, Eugene), mitochondrial transcription factor A (Tfam; Merck Millipore, Amsterdam, The Netherlands), nuclear respiratory factor 1 (NRF-1; Abcam, Cambridge, U.K.) and peroxisome proliferator-activated receptor gamma co-activator (PGC)-1α (Cell Signaling, Danvers), which were all diluted in 3% NFDM/BSA in TBS-Tween-20. Membranes were washed and incubated with Horseradish Peroxidase-labeled, primary antibody-specific, secondary antibody (Vector Laboratories, Amsterdam, The Netherlands) (1: 10 000 diluted in 3% milk in TBS-Tween20) for 1 h at room temperature. Membranes were washed and incubated with either 0.5× SuperSignal West Pico Chemiluminescent Substrate or 0.25× SuperSignal West Femto Chemiluminescent Substrate (Thermo Scientific, Landsmeer, The Netherlands) for 5 min, depending on the expected signal strength. Photographs were taken with the LAS-3000 or AmershamImager 600 and analyzed with ImageQuant TL software (GE Healthcare Life Sciences, Eindhoven, The Netherlands). Specific protein band intensity was corrected for Ponceau S intensity before statistical analysis. Gene-expression and mitochondrial copy number analysis by PCR RNA was isolated from crushed liver samples using an AllPrep DNA/RNA Mini Kit (Qiagen), which included DNase treatment. cDNA was subsequently synthesized using an iScript kit (bio-rad 170-8891) according to the manufacturer’s protocol. For the SYBR Green Q-PCR analyses, a 25-μl reaction mixture was prepared containing PCR buffer, 0.2 mM deoxynucleotide triphosphates, 0.5 mM MgCl2, 1.25 U of Taq-polymerase, and 200 ng of template DNA (for analysis of mt copy number) or cDNA (for analysis of gene expression). The final primer concentrations were 0.1 μM. PCR was performed with an initial denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 16 s, 60 °C for 15 s, and 72 °C for 10 s. The genes that were analyzed and the corresponding primers can be found in Table 1. Data were analyzed by using MyiQ Software system (BioRad) and were expressed as relative gene expression (fold change) using the 2−ΔΔCt method (Schmittgen and Livak, 2008). The Ct-value of the house-keeping gene Gapdh was calculated for all samples and used as reference Ct-value. Table 1. Overview of the Primers Used in the PCR Experiments for Mitochondrial Copy Number and Gene Expression Gene  Full Name  Type  Sequence 5′→3′  MtCo1  mt-Co1 Mitochondrial gene  Forward  CAGTCTAATGCTTACTCAGC  Reverse  GGGCAGTTACGATAACATTG  Gapdh  Glyceraldehyde-3-phosphate dehydrogenase  Forward  GGGAAGCCCATCACCATCTTC  Reverse  AGAGGGGCCATCCACAGTCT  Ogg1  8-oxoguanine Glycosylase 1  Forward  TGGCACTGGCACGTACATAG  Reverse  TATCATGGCTTCCCAAACCT  Sod2  Superoxide dismutase 2  Forward  GCTTGATAGCCTCCAGCAAC  Reverse  ACTGAAGTTCAATGGTGGGG  Aldh2  Aldehyde dehydrogenase 2  Forward  GATGACCTCCCCTGTGGAA  Reverse  AGCCTGAGGTCTTCTGCAAC  Actb  Beta-actin  Forward  ATGGAGGGGAATACAGCCC  Reverse  TTCTTTGCAGCTCCTTCGTT  Cat  Catalase  Forward  GACTGACCAGGGCATCAAAAA  Reverse  CGGATGCCATAGTCAGGATCTT  Gene  Full Name  Type  Sequence 5′→3′  MtCo1  mt-Co1 Mitochondrial gene  Forward  CAGTCTAATGCTTACTCAGC  Reverse  GGGCAGTTACGATAACATTG  Gapdh  Glyceraldehyde-3-phosphate dehydrogenase  Forward  GGGAAGCCCATCACCATCTTC  Reverse  AGAGGGGCCATCCACAGTCT  Ogg1  8-oxoguanine Glycosylase 1  Forward  TGGCACTGGCACGTACATAG  Reverse  TATCATGGCTTCCCAAACCT  Sod2  Superoxide dismutase 2  Forward  GCTTGATAGCCTCCAGCAAC  Reverse  ACTGAAGTTCAATGGTGGGG  Aldh2  Aldehyde dehydrogenase 2  Forward  GATGACCTCCCCTGTGGAA  Reverse  AGCCTGAGGTCTTCTGCAAC  Actb  Beta-actin  Forward  ATGGAGGGGAATACAGCCC  Reverse  TTCTTTGCAGCTCCTTCGTT  Cat  Catalase  Forward  GACTGACCAGGGCATCAAAAA  Reverse  CGGATGCCATAGTCAGGATCTT  Analysis of microRNA expression microRNA (miRNA) of interest were selected from Brevik et al. (2012a) in which changes of miRNA expression were studied in early developmental stages after paternal exposure to B[a]P. Proteomics analysis and PCR analysis showed that genes and proteins related to mitochondrial homeostasis were altered in a gender-specific manner (see “Results” section). Therefore, the miRNA for analysis by dedicated PCR was selected on basis of (1) the miRNA should have predicted targets in the regulation of gene transcription and translation of proteins that were identified by our lead finding proteomics analysis. Targets were predicted by miRWalk (Dweep and Gretz, 2015); (2) the miRNA was found to be regulated by B[a]P exposure and gender in previous publications, and (3) the miRNA is involved in mitochondrial function. The cDNA synthesis and miRNA profiling was carried as describe previously (Aarem et al., 2016). In brief, cDNA from 0.5 μg of RNA was synthesized using the miScript II RT kit including 5× miScript HiSpec Buffer (for selective conversion of mature miRNA into cDNA) according to the manufacturers protocol (Qiagen, Norway). A no reverse transcriptase control (NRT) was included and samples were incubated at 37 °C for 60 min and 95 °C for 5 min. All cDNA samples were stored at −20 °C prior to gene expression analysis. The miRNA profiling was carried out in 384-well PCR plates using miScript SYBR Green PCR Kit according to the manufacturer’s protocol (Qiagen, Norway) on a CFX384 TouchReal-Time PCR Detection System (Bio-Rad, Norway). Serial dilutions of cDNA were prepared to determine the optimal dilution. A 1: 10 dilution of cDNA from each sample was run in triplicate for each miRNA of interest. The expression levels of the following 10 miRNAs (mmu-miR-107-3p, mmu-miR-107-5p, mmu-miR-122-3p, mmu-miR-122-5p, mmu-miR-129-1-3p, mmu-miR-129-2-3p, mmu-miR-129-5p, mmu-miR-1941-3p, mmu-miR-1941-5p and mmu-miR-34a,), and 3 small nuclear RNAs (snRNA; RNU6, RNU43 and RNU1), were measured. The quantification cycle (Cq) values were recorded with CFX ManagerSoftware (Bio-Rad, Norway). Target miRNAs were normalized by the average of 3 stably expressed reference genes (RNU6, RNU43 and RNU1); this is given by ΔCq; where ΔCq (sample) = Cq (target miRNA) – Cq (reference snRNAs). The ΔΔCq values were generated by subtracting the ΔCq-value for the reference samples (calibrators; untreated controls) from the ΔCq-value of the samples [ΔΔCq = ΔCq (sample) − ΔCq (calibrator); fold change = 2−ΔΔCq] (Brevik et al., 2012a). Oxidative stress-related genetic damage Oxidatively-induced DNA damage was measured by assessing both 8-oxo-dG and malondialdehyde (MDA)-dG adducts in liver DNA. DNA was obtained from crushed liver tissue by a standard phenol extraction that was optimized to minimize artificial induction of 8-oxo-dG (ESCODD [European Standards Committee on Oxidative DNA Damage], 2002), by using radical-free phenol, minimizing exposure to oxygen, and adding 1 mM deferoxamine mesylate (metal chelator) and 20 mM 2, 2, 6, 6-tetramethylpiperidine-N-oxyl. DNA concentrations were spectrophotometrically quantified at 260 nm. 8-oxo-dG was assessed by HPLC-electrochemical detection (ECD) as previously described by van Helden et al. (2009). A total of 30 µg DNA was digested to deoxyribonucleosides by addition of 6 µl 0.5 M NaAc, 9 µl 10 mM ZnCl2 and 1.5 µl nuclease P1 (NP1, stock: 1 U/µl) and incubation for 90 min at 37 °C. Subsequently, 30 µl 0.5 M Tris–HCl (pH 7.4) and 1.5 µl alkaline phosphatase (0.014 U/µl) were added followed by incubation at 37 °C for 45 min. The digest was then analysed by HPLC-ECD on a SupelcosilTM LC-18 S column (250 mm × 4.6 mm) (Supelco Park, Bellefonte, Pennsylvania) in combination with a DECADE electrochemical detector (Antec, Leiden, The Netherlands). The ECD-signal was first stabilized with mobile phase (94 mM KH2PO4, 13 mM K2HPO4, 26 mM KCl and 0.5 mM EDTA, 10% methanol) for approximately 3 h at a flow rate of 1 ml/min. After stabilization, 8-oxo-dG was detected at a potential of 400 mV and dG was simultaneously monitored by UV absorption at 260 nm. Malondialdehyde-dG adducts (M1-dG) were determined by 32P-postlabelling as previously described by Peluso et al. (2013). In short, DNA was hydrolyzed by incubation with micrococcal nuclease (21.45 mU/μl) and spleen phosphodiesterase (6.0 mU/μl) in 5.0 mM Sodium succinate, 2.5 mM calcium chloride, pH 6.0, at 37 °C for 4.5 h. Hydrolyzed samples were treated with NP1 (0.1 U/μl) in 46.6 mM sodium acetate, pH 5.0, and 0.24 mM ZnCl2 at 37 °C for 30 min. After NP1 treatment, 1.8 μl of 0.16 mM Tris base was added and samples were incubated with 7–25 μCi of carrier-free [γ-32 P]ATP (3000 Ci/mM) and polynucleotide kinase T4 (0.75 U/μl) to generate 32 P-labelled DNA adducts in bicine buffer (20 mM bicine, 10 mM MgCl2, 10 mM dithiotreithol, 0.5 mM spermidine, pH 9.0) at 37 °C for 30 min. 32 P-labeled samples were applied to polyethyleneimine cellulose thin layer chromatography plates (Macherey-Nagel, Germany) and resolved in a low-urea solvent system as described. Detection and quantification of M1–dG adducts and normal nucleotides (ie, diluted samples that were not treated with NP1), were performed by storage phosphor imaging techniques employing intensifying screens from Molecular Dynamics (Sunnyvale, California). Levels of M1-dG adducts were expressed as relative adduct labeling = pixels in adducted nucleotides/pixel in normal nucleotides. The levels of M1–dG adducts were corrected across experiments based on the recovery of an MDA-treated DNA adduct standard. Statistics Data are presented as average and standard error of the mean. Differences between offspring of B[a]P-exposed fathers and non-exposed fathers were tested for male and female offspring separately by the nonparametric Mann-Whitney U-test, considering p < .05 as statistically significant. To prevent litter-effects, all analyses were performed on individuals originating from different litters, ie, no brothers/sisters were analyzed in a specific analysis. RESULTS 2D-Gel Electrophoresis and Identification of Proteins of Interest Analysis of the liver by 2D-gel electrophoresis revealed a total of 265 protein spots that were detectable in all livers studied. From these, 3 spots were >2 fold up-regulated and 18 spots were >2-fold downregulated in offspring liver of B(a)P-exposed fathers when compared with offspring of fathers that were not exposed. Only the spots that were downregulated met the criterion of statistical significance (p < .05), and 9 spots could subsequently be identified by mass spectroscopy (MS). The 2 strongest down regulated proteins were centromere protein A and aldehyde dehydrogenase 2 (Aldh2). Eight out of the nine proteins identified by 2D-gel electrophoresis could be linked to mitochondrial function (Figure 1) , which included aldehyde dehydrogenase 2 (Aldh2, fold change compared with control [FC]: 0.26), carbamoyl-phosphate synthase (Cps1, found in 2 protein spots with FC = 0.32 and FC = 0.43), medium Chain Acyl-coA dehydrogenase (Mcad, FC = 0.33), 8-oxo-dG glycosylase (Ogg1, found in 2 protein spots with FC = 0.40 and FC = 0.45) and glyoxylate reductase/hydroxypyruvate reductase (Grhpr, FC = 0.49). Figure 1. View largeDownload slide Typical result of 2D-gel electrophoresis. Spots with a different intensity in offspring of B[a]P-exposed fathers versus unexposed fathers (>2-fold and p < .05) that could also be identified by MS are indicated with a number. The identity (name) and role of these proteins in mitochondria are indicated. In 2 occasions, 2 protein spots appeared to have the same identity, which could represent a shift in pI due to small structural changes (Cps1, spots 3 and 6) or a shift in mass, possibly due to the presence of different isoforms (Ogg1, spots 5 and 7). Figure 1. View largeDownload slide Typical result of 2D-gel electrophoresis. Spots with a different intensity in offspring of B[a]P-exposed fathers versus unexposed fathers (>2-fold and p < .05) that could also be identified by MS are indicated with a number. The identity (name) and role of these proteins in mitochondria are indicated. In 2 occasions, 2 protein spots appeared to have the same identity, which could represent a shift in pI due to small structural changes (Cps1, spots 3 and 6) or a shift in mass, possibly due to the presence of different isoforms (Ogg1, spots 5 and 7). Mitochondrial DNA Copy Number and Activity of Mitochondrial Enzymes The decreased expression of mitochondrial proteins in male offspring of B[a]P–exposed fathers could be related to either a lower number of mitochondria or to a lower concentration of these proteins per mitochondrion. One strategy to obtain information about the number of mitochondria is to assess the mitochondrial DNA copy number relative to nuclear DNA in both male and female offspring of exposed and unexposed fathers. The mitochondrial copy number was approximately 50% lower in male offspring of fathers that were exposed to B[a]P when compared with offspring of control fathers, whereas no significant change was found in female offspring (Figure 2A). Figure 2. View largeDownload slide A, Mitochondrial DNA copy number in male and female offspring of fathers that were exposed to vehicle only (white bars) or B[a]P (black bars). Offspring of fathers that were not exposed to B[a]P were used as control and set to 1. B, Enzyme activity of CS and HADH activity in homogenized liver samples of male offspring whose fathers were exposed to vehicle only (white bars) or B[a]P (black bars). C, Two examples of Western Blot analysis of OXPHOS subunits, PGC-1α, Nrf1 and Tfam in homogenized liver samples in male offspring whose fathers were exposed to vehicle only or B[a]P (protein bands of all samples were very similar in intensity and therefore only 2 representative samples are shown here), and their quantitation in D, Offspring of fathers that were exposed to vehicle only (white bars) or B[a]P (black bars). Indicated are means and SE, n = 8, *statistically different from unexposed, p < .05. Figure 2. View largeDownload slide A, Mitochondrial DNA copy number in male and female offspring of fathers that were exposed to vehicle only (white bars) or B[a]P (black bars). Offspring of fathers that were not exposed to B[a]P were used as control and set to 1. B, Enzyme activity of CS and HADH activity in homogenized liver samples of male offspring whose fathers were exposed to vehicle only (white bars) or B[a]P (black bars). C, Two examples of Western Blot analysis of OXPHOS subunits, PGC-1α, Nrf1 and Tfam in homogenized liver samples in male offspring whose fathers were exposed to vehicle only or B[a]P (protein bands of all samples were very similar in intensity and therefore only 2 representative samples are shown here), and their quantitation in D, Offspring of fathers that were exposed to vehicle only (white bars) or B[a]P (black bars). Indicated are means and SE, n = 8, *statistically different from unexposed, p < .05. Similarly, subsequent analyses of CS and beta-hydroxyacyl-CoA dehydrogenase enzyme activity in male offspring (Figure 2B) indicated that these were decreased in offspring whose fathers were exposed to B[a]P (only CS activity was significantly decreased from 51.3 to 29.4 µmol/min, p < .05). On the other hand, the protein abundance of subunits of mitochondrial OXPHOS complexes 1, 2, 3, and 5 were not different between the groups (Figs. 2C and D). Since mitochondrial biogenesis is regulated via Pgc-1α, Nrf1, and Tfam, we additionally studied the abundance of these proteins, but none of them were differentially expressed in liver of offspring whose fathers were exposed to B[a]P (Figure 2C). Gene Expression of Relevant Genes mRNA expression of genes that were differentially expressed at the protein level was assessed by qPCR (Figure 3). Although the protein levels of Ogg1, Actb and Aldh2 were downregulated, as assessed by 2D-gel electrophoresis, their mRNA levels were respectively 2.1 ± 0.4-fold, 2.5 ± 0.7 fold, and 3.2- ± 0.7-fold up-regulated (p < .05), again in a gender-specific manner, because no changes were observed in female offspring. We also studied 2 mitochondrial anti-oxidant enzymes, i.e. Catalase (Cat) and Superoxide dismutase 2 (Sod2), and mRNA expression of both was also significantly up-regulated: Cat: 3.5- ± 0.7-fold and Sod2 1.8- ± 0.3-fold; both p < .05) (Figure 3). Figure 3. View largeDownload slide mRNA expression of selected mitochondria-related genes, relative to male offspring of control fathers. Gapdh was used as reference gene and expression was related to the expression in male offspring of unexposed fathers (reference = 1). Indicated are means and SE, n = 6,*statistically different from unexposed, p < .05; **p < .01. Figure 3. View largeDownload slide mRNA expression of selected mitochondria-related genes, relative to male offspring of control fathers. Gapdh was used as reference gene and expression was related to the expression in male offspring of unexposed fathers (reference = 1). Indicated are means and SE, n = 6,*statistically different from unexposed, p < .05; **p < .01. miRNA Expression The discrepancy between protein concentrations (downregulated in offspring of exposed fathers) and gene expression changes (up-regulated in offspring of exposed fathers) in male offspring, prompted us to analyze miRNA levels that could regulate the translation process of 4 gene products (Aldh2, Actb, Cat, and Ogg1). Therefore, the following miRNA’s, known to be involved in the regulation of the above-mentioned genes were selected: (1) mu-mir-122 which was previously found to be altered after B[a]P exposure (Halappanavar et al., 2011) and it is predicted to regulate Ogg1. miR122 was reported to be involved in mitochondrial function and it targets CS mRNA (Jin et al., 2014). Moreover, it is liver-specific and seems to be regulated by testosterone (Delić et al., 2010); (2) mmu-mir-129 which is predicted to regulate a number of genes that were identified in our proteomics and PCR analysis, including Ogg1, Cat, and Actb; (3) mmu-mir-107 is predicted to be involved in the regulation of Aldh2, which was identified in both our proteomics and gene expression analyses; (4) mmu-mir-1941 which regulates Aldh2 and is significantly and strongly up-regulated in the blastocyst stage (Brevik et al., 2012a); (5) mmu-miR-34a was included as control. Of these selected miRNA’s, mmu-miR-122-3p, mmu-miR-122-5p, mmu-miR-129-3p, mmu-miR-1941-3p, and mmu-miR-1941-5p, were all significantly up-regulated in male offspring whose father was exposed to B[a]P, but not in female offspring (Figure 4). The strongest up-regulation was found for mmu-miR-122-5p, which was 3.7- ± 0.5-fold increased in male offspring of exposed fathers. Figure 4. View largeDownload slide Expression of selected miRNA in male (ME) and female (FE) offspring of B[a]P-exposed fathers. The expression in offspring of unexposed fathers was used as reference and set at 1.0. This reference is indicated with a horizontal dashed line. Indicated are means and SE, n = 6, *p < .05 **p < .005 compared with respective unexposed controls. Figure 4. View largeDownload slide Expression of selected miRNA in male (ME) and female (FE) offspring of B[a]P-exposed fathers. The expression in offspring of unexposed fathers was used as reference and set at 1.0. This reference is indicated with a horizontal dashed line. Indicated are means and SE, n = 6, *p < .05 **p < .005 compared with respective unexposed controls. Oxidative Stress in Liver Mitochondria are a major source of intracellular oxidative stress. The lower number of mitochondria and the lower activity of CS in male offspring of B[a]P-exposed fathers may therefore lead to lower levels of oxidative stress. On the other hand, if these mitochondria have to ‘work harder’ to meet the energy requirements, it may theoretically also increase oxidative stress and associated oxidative cell damage. Especially, since several anti-oxidant and DNA repair enzymes were downregulated at the protein level (Ogg1 and Aldh2). However, analysis of the oxidative stress-related DNA damages 8-oxo-dG and M1dG indicated that both were decreased in male offspring of B[a]P exposed fathers (Figure 5); 8-Oxo-dG levels were 35.7 ± 3.7 adducts per 106 dG in offspring of unexposed males, and 25.2 ± 3.0 adducts per 106 dG in offspring of exposed fathers (p < .05). Similarly, M1dG levels were 0.62 ± 0.14 adducts per 107 nucleotides in offspring of unexposed males, and 0.11 ± 0.15 adducts per 107 nucleotides in offspring of exposed males (p < .05). Figure 5. View largeDownload slide Oxidative DNA damage assessed by 8-oxo-dG (A) and M1-dG (B) in liver of offspring mice, whose fathers were exposed to B[a]P (Black bars). Offspring of unexposed fathers (white bars) were used as gender-specific control (ie, 100%). Indicated are means and SD, n = 6, *statistically different from unexposed, p < .05. Figure 5. View largeDownload slide Oxidative DNA damage assessed by 8-oxo-dG (A) and M1-dG (B) in liver of offspring mice, whose fathers were exposed to B[a]P (Black bars). Offspring of unexposed fathers (white bars) were used as gender-specific control (ie, 100%). Indicated are means and SD, n = 6, *statistically different from unexposed, p < .05. DISCUSSION The PAR hypothesis describes a form of developmental plasticity in which environmental cues can influence the development of the fetus in such a way that the offspring is better equipped for the environmental conditions later in life (Bateson et al., 2014). Although it is well studied that these cues can be transferred to the offspring via the placenta during pregnancy, it is also possible that these environmental cues are transferred via the gametes of both parents (Vanhees et al., 2014). The male spermatocytes contain, next to the genetic material, epigenetic marks that could have long lasting effects in the developing fetus (Rando, 2016). In this experiment, we studied whether paternal exposure to the environmental contaminant B[a]P can have such programming effects and lead to changes to the offspring’s phenotype. Although this study is descriptive in nature, we clearly show that exposures of the father can have unexpected consistent effects in offspring. Specifically, we uncovered changes in mitochondrial protein abundance and enzyme activity as well as decreases in mitochondrial DNA copy number, but in the liver of male offspring only. This was unexpected because mitochondria are maternally inherited. Oocytes possess large numbers of mitochondria at fertilization and there is no biogenesis of mitochondria until postimplantation. Each newly formed cell within the preimplantation embryo will possess fewer mitochondria until the blastocyst stage, because during each cell division the mitochondria are distributed over each daughter cell (Shoubridge and Wai, 2007; Thundathil et al., 2005). After implantation, the biogenesis of mitochondria is initiated in a cell type specific manner and is tightly regulated during development to meet the metabolic demands of cells (Moyes et al., 1998; Williams, 1986). Interestingly, in our study, abundance of proteins known to be involved in the regulation of mitochondrial biogenesis, Pgc1α, Nrf1, and Tfam, were not significantly altered in offspring. Whether or not these proteins were differentially expressed during development of B[a]P-exposed offspring or whether or not other processes were altered that are involved in the regulation of mitochondrial content, eg, selective clearing of mitochondria by mitophagy, remains to be established. In addition, it could also be speculated that the differences found in mitochondrial content in our study do not originate from alterations in mitochondrial biogenesis, but from alterations in early phases of development in which mitochondria need to be equally distributed over daughter cells. To coordinate this distribution, interaction of mitochondria with microtubules, B- and F-actin during cytokinesis is important (Li et al., 2004; Boldogh and Pon, 2007). Interestingly, B-actin was differentially expressed at both protein and mRNA level. In 2 occasions, 2 protein spots appeared to have the same identity, which could represent a shift in pI due to small structural posttranslational changes (Cps1, spots 3 and 6) or a shift in mass, possibly due to the presence of different isoforms (Ogg1, spots 5 and 7). Since we found gender-specific differences in mtDNA copy numbers and mitochondrial enzyme activity in liver of offspring of fathers that were exposed to B[a]P, the sperm likely contained a factor that impacted mitochondrial content. It is unknown which factors are involved, but these could include DNA methylation, histone modifications or a number of noncoding RNA’s including short non-coding RNA’s and long noncoding RNA’s. A known example of involvement of long noncoding RNA’s in transgenerational effects is the X-inactivation in female offspring (Maclary et al., 2014). Additionally, there are examples of transgenerational passage of epigenetic information through RNA as well as chromatin proteins (Rando, 2016; Rassoulzadegan et al., 2006). In our study, there was a discrepancy between gene expression (up-regulated) and subsequent protein levels (downregulated). Analysis of the expression of miRNA expression levels was therefore a logical next step, because miRNA inhibit the production of proteins by blocking translation. In our case, we identified miRNA122 as a potential mediator of altered mitochondrial content. It is regulated in a gender-specific manner, because its expression is controlled by testosterone (Delić et al., 2010) and it was previously found to be differentially expressed after B[a]P exposure (Halappanavar et al., 2011). More interestingly, miR122 was reported to be involved in mitochondrial function (Jin et al., 2014). It should be noted however, that miR122 is not necessarily the sperm-related factor that transmitted the effect, but it is at least differentially regulated in early development of the fetus (Brevik et al., 2012a,b) after paternal exposure to B[a]P. Is this actually a PAR? Exposure to B[a]P via cigarette smoke is known to increase the level of oxidative stress and subsequent DNA strand breaks in the male germ line (Laubenthal et al., 2012; Sipinen et al., 2010). Therefore, the offspring may ‘predict’ that it may encounter more oxidative stress later in life and adapts to that by downscaling its own production of radicals from mitochondria or by upregulating the expression of anti-oxidant enzymes. Expression of anti-oxidant enzymes was indeed upregulated at the level of mRNA, but was not confirmed by protein or activity analysis. Still, this idea is also in line with decreased levels of the oxidative stress-related DNA damage (8-hydroxy-deoxyguanosine and M1-dG) in liver DNA. However, it remains unclear why this would only occur in male offspring. When the predicted and actual environment differs; this mismatch between the individual's phenotype and the environmental exposures can have adverse consequences for health. In our case, lowered mitochondrial content and possibly impaired metabolism in mitochondria may become problematic if for instance energy intake is too high due to a Western type of diet. Indeed, an epidemiological study showed that sons but not daughters of fathers that initiated smoking behavior early in life, have an increased risk of obesity (Northstone et al. 2014). Therefore, this concept could also explain inter-individual differences in how people react to environmental triggers later in life. Smoking was also found to increase DNA damage in sperm (Linschooten et al., 2011), which may by itself be a programming factor, because damaged sperm DNA may initiate DNA repair processes in early development, which could lead to different developmental paths that eventually affect for instance the maintenance of genetic integrity later in life. We previously showed that paternal preconceptional smoking (ie, exposure to B[a]P via cigarette smoke) increased DNA damage in blood cells of newborns (Laubenthal et al., 2012). This is not in line with the decreased levels of DNA damage in the liver of offspring as observed in this study. In conclusion, paternal exposure to the genotoxic agent B[a]P changed the male offspring’s hepatic oxidative stress levels, likely as a result from decreased mitochondrial numbers, however further research is needed to understand the origins of these phenotypic changes and the health consequences later in life. ACKNOWLEDGMENT The authors thank the biotechnicians of the animal facility of The Netherlands Vaccine Institute (The Netherlands) for their skillful assistance in this study. REFERENCES Aarem J., Brunborg G., Aas K. K., Harbak K., Taipale M. M., Magnus P., Knudsen G. P., Duale N. ( 2016). Comparison of blood RNA isolation methods from samples stabilized in Tempus tubes and stored at a large human biobank. BMC Res. Notes  9, 430. Google Scholar CrossRef Search ADS PubMed  Anway M. D., Cupp A. S., Uzumcu M., Skinner M. K. ( 2005). Epigenetic transgenerational actions of endocrine disruptors and male fertility. Science (New York, N.Y.)  308, 1466– 1469. Google Scholar CrossRef Search ADS PubMed  Bateson P., Gluckman P., Hanson M. ( 2014). The biology of developmental plasticity and the predictive adaptive response hypothesis. J. Physiol.gy  592, 2357– 2368. http://dx.doi.org/10.1113/jphysiol.2014.271460 Google Scholar CrossRef Search ADS   Boldogh I. R., Pon L. A. ( 2007). Mitochondria on the move. Trends Cell Biol . 17, 502– 510. http://dx.doi.org/10.1016/j.tcb.2007.07.008 Google Scholar CrossRef Search ADS PubMed  Brevik A., Lindeman B., Brunborg G., Duale N. ( 2012). Paternal Benzo[a]pyrene exposure modulates MicroRNA expression patterns in the developing mouse embryo. Int. J. Cell Biol . 2012, 1– 11. Google Scholar CrossRef Search ADS   Brevik A., Lindeman B., Rusnakova V., Olsen A.-K., Brunborg G., Duale N. ( 2012). Paternal benzo[a]pyrene exposure affects gene expression in the early developing mouse embryo. Toxicol. Sci . 129, 157– 165. Google Scholar CrossRef Search ADS PubMed  Chaby L. E. ( 2016). Why are there lasting effects from exposure to stress during development? An analysis of current models of early stress. Physiol. Behav . 164, 164– 181. http://dx.doi.org/10.1016/j.physbeh.2016.05.032 Google Scholar CrossRef Search ADS PubMed  de Roos B., Duthie S. J., Polley A. C. J., Mulholland F., Bouwman F. G., Heim C., Rucklidge G. J., Johnson I. T., Mariman E. C., Daniel H., et al.   ( 2008). Proteomic methodological recommendations for studies involving human plasma, platelets, and peripheral blood mononuclear cells. J. Proteome Res . 7, 2280– 2290. Google Scholar CrossRef Search ADS PubMed  Delić D., Grosser C., Dkhil M., Al-Quraishy S., Wunderlich F. ( 2010). Testosterone-induced upregulation of miRNAs in the female mouse liver. Steroids  75, 998– 1004. Google Scholar CrossRef Search ADS PubMed  Dweep H., Gretz N. ( 2015). miRWalk2.0: A comprehensive atlas of microRNA-target interactions. Nat. Methods  12, 697–697. http://dx.doi.org/10.1038/nmeth.3485 Google Scholar CrossRef Search ADS   ESCODD (European Standards Committee on Oxidative DNA Damage). ( 2002). Comparative analysis of baseline 8-oxo-7, 8-dihydroguanine in mammalian cell DNA, by different methods in different laboratories: An approach to consensus. Carcinogenesis  23, 2129– 2133. CrossRef Search ADS PubMed  Filkowski J. N., Ilnytskyy Y., Tamminga J., Koturbash I., Golubov A., Bagnyukova T., Pogribny I. P., Kovalchuk O. ( 2010). Hypomethylation and genome instability in the germline of exposed parents and their progeny is associated with altered miRNA expression. Carcinogenesis  31, 1110– 1115. Google Scholar CrossRef Search ADS PubMed  Gapp K., Jawaid A., Sarkies P., Bohacek J., Pelczar P., Prados J., Farinelli L., Miska E., Mansuy I. M. ( 2014). Implication of sperm RNAs in transgenerational inheritance of the effects of early trauma in mice. Nat. Neurosci . 17, 667– 669. Google Scholar CrossRef Search ADS PubMed  Godschalk R. W. L., Verhofstad N., Verheijen M., Yauk C. L., Linschooten J. O., van Steeg H., van Oostrom C. T., van Benthem J., van Schooten F. J. ( 2015). Effects of benzo[a]pyrene on mouse germ cells: Heritable DNA mutation, testicular cell hypomethylation and their interaction with nucleotide excision repair. Toxicol. Res . 4, 718. Google Scholar CrossRef Search ADS   Gosker H. R., Schrauwen P., Broekhuizen R., Hesselink M. K. C., Moonen-Kornips E., Ward K. A., Schols A. M. W. J. ( 2006). Exercise training restores uncoupling protein-3 content in limb muscles of patients with chronic obstructive pulmonary disease. Endocrinol. Metab . 290, E976– E981. Gosker H. R., van Mameren H., van Dijk P. J., Engelen M. P. K. J., van der Vusse G. J., Wouters E. F. M., Schols A. M. W. J. ( 2002). Skeletal muscle fibre-type shifting and metabolic profile in patients with chronic obstructive pulmonary disease. Eur. Respir. J . 19, 617– 625. Google Scholar CrossRef Search ADS PubMed  Grandjean V., Gounon P., Wagner N., Martin L., Wagner K. D., Bernex F., Cuzin F., Rassoulzadegan M. ( 2009). The miR-124-Sox9 paramutation: RNA-mediated epigenetic control of embryonic and adult growth. Development  136, 3647– 3655. http://dx.doi.org/10.1242/dev.041061 Google Scholar CrossRef Search ADS PubMed  Halappanavar S., Wu D., Williams A., Kuo B., Godschalk R. W., Van Schooten F. J., Yauk C. L. ( 2011). Pulmonary gene and microRNA expression changes in mice exposed to benzo(a)pyrene by oral gavage. Toxicology  285, 133– 141. Google Scholar CrossRef Search ADS PubMed  Jin J.-C., Zhang X., Jin X.-L., Qian C.-S., Jiang H., Ruan Y. ( 2014). MicroRNA-122 regulation of the morphology and cytoarchitecture of hepatoma carcinoma cells. Mol. Med. Rep . 9, 1376– 1380. Google Scholar CrossRef Search ADS PubMed  Laubenthal J., Zlobinskaya O., Poterlowicz K., Baumgartner A., Gdula M. R., Fthenou E., Keramarou M., Hepworth S. J., Kleinjans J. C. S., van Schooten F.-J., et al.   ( 2012). Cigarette smoke-induced transgenerational alterations in genome stability in cord blood of human F1 offspring. FASEB J . 26, 3946– 3956. Google Scholar CrossRef Search ADS PubMed  Li J., Li Q., Xie C., Zhou H., Wang Y., Zhang N., Han J. ( 2004). actin is required for mitochondria clustering and ROS generation in TNF-induced, caspase-independent cell death. J. Cell Sci . 117, 4673– 4680. http://dx.doi.org/10.1242/jcs.01339 Google Scholar CrossRef Search ADS PubMed  Linschooten J. O., Laubenthal J., Cemeli E., Baumgartner A., Anderson D., Sipinen V. E., Brunborg G., Haenen G. R. M. M., Fthenou E., Briedé J. J., et al.   ( 2011). Incomplete protection of genetic integrity of mature spermatozoa against oxidative stress. Reprod. Toxicol . 32, 106– 111. Google Scholar CrossRef Search ADS PubMed  Linschooten J. O., Van Schooten F. J., Baumgartner A., Cemeli E., van Delft J., Anderson D., Godschalk R. W. L. ( 2009). Use of spermatozoal mRNA profiles to study gene–environment interactions in human germ cells. Mutat. Res. Fund. Mol. Mech. Mutagen . 667, 70– 76. Google Scholar CrossRef Search ADS   Maclary E., Buttigieg E., Hinten M., Gayen S., Harris C., Sarkar M. K., Purushothaman S., Kalantry S. ( 2014). Differentiation-dependent requirement of Tsix long non-coding RNA in imprinted X-chromosome inactivation. Nat. Commun . 5, e1002212. http://doi.org/10.1038/ncomms5209 Google Scholar CrossRef Search ADS   McPherson N. O., Fullston T., Aitken R. J., Lane M. ( 2014). Paternal obesity, interventions, and mechanistic pathways to impaired health in offspring. Ann. Nutr. Metab . 64, 231– 238. http://dx.doi.org/10.1159/000365026 Google Scholar CrossRef Search ADS PubMed  Moyes C. D., Battersby B. J., Leary S. C. ( 1998). Regulation of muscle mitochondrial design. J. Exp. Biol . 201(Pt 3), 299– 307. Nettle D., Bateson M. ( 2015). Adaptive developmental plasticity: What is it, how can we recognize it and when can it evolve? Proc. R. Soc. B Biol. Sci . 282, 20151005. http://dx.doi.org/10.1098/rspb.2015.1005 Google Scholar CrossRef Search ADS   Ng S.-F., Lin R. C. Y., Laybutt D. R., Barres R., Owens J. A., Morris M. J. ( 2010). Chronic high-fat diet in fathers programs β-cell dysfunction in female rat offspring. Nature  467, 963– 966. Google Scholar CrossRef Search ADS PubMed  Northstone K., Golding J., Davey Smith G., Miller L. L., Pembrey M. ( 2014). Prepubertal start of father’s smoking and increased body fat in his sons: Further characterisation of paternal transgenerational responses. Eur. J. Hum. Genet . 22, 1382– 1386. Google Scholar CrossRef Search ADS PubMed  Peluso M., Munnia A., Ceppi M., Giese R. W., Catelan D., Rusconi F., Godschalk R. W. L., Biggeri A. ( 2013). Malondialdehyde-deoxyguanosine and bulky DNA adducts in schoolchildren resident in the proximity of the Sarroch industrial estate on Sardinia Island, Italy. Mutagenesis  28, 315– 321. Google Scholar CrossRef Search ADS PubMed  Rando O. J. ( 2016). Intergenerational transfer of epigenetic information in sperm. Cold Spring Harb. Perspect. Med . 6, a022988. http://dx.doi.org/10.1101/cshperspect.a022988 Google Scholar CrossRef Search ADS PubMed  Rassoulzadegan M., Grandjean V., Gounon P., Vincent S., Gillot I., Cuzin F. ( 2006). RNA-mediated non-mendelian inheritance of an epigenetic change in the mouse. Nature  441, 469– 474. Google Scholar CrossRef Search ADS PubMed  Schmittgen T. D., Livak K. J. ( 2008). Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc . 3, 1101– 1108. http://dx.doi.org/10.1038/nprot.2008.73 Google Scholar CrossRef Search ADS PubMed  Shoubridge E. A., Wai T. ( 2007). Mitochondrial DNA and the mammalian oocyte. Curr. Top. Dev. Biol . 77, 87– 111. Google Scholar CrossRef Search ADS PubMed  Sipinen V., Laubenthal J., Baumgartner A., Cemeli E., Linschooten J. O., Godschalk R. W. L., Van Schooten F. J., Anderson D., Brunborg G. ( 2010). In vitro evaluation of baseline and induced DNA damage in human sperm exposed to benzo[a]pyrene or its metabolite benzo[a]pyrene-7, 8-diol-9, 10-epoxide, using the comet assay. Mutagenesis  25, 417– 425. Google Scholar CrossRef Search ADS PubMed  Straubinger K., Paul S., Prazeres da Costa O., Ritter M., Buch T., Busch D. H., Layland L. E., Prazeres da Costa C. U. ( 2014). Maternal immune response to helminth infection during pregnancy determines offspring susceptibility to allergic airway inflammation. J. Allergy Clin. Immunol . 134, 1271– 1279.e10. Google Scholar CrossRef Search ADS PubMed  Thundathil J., Filion F., Smith L. C. ( 2005). Molecular control of mitochondrial function in preimplantation mouse embryos. Mol. Reprod. Dev . 71, 405– 413. http://dx.doi.org/10.1002/mrd.20260 Google Scholar CrossRef Search ADS PubMed  van Helden Y. G. J., Keijer J., Heil S. G., Pico C., Palou A., Oliver P., Munnia A., Briede J. J., Peluso M., Franssen-van Hal N. L., et al.   ( 2009). Beta-carotene affects oxidative stress-related DNA damage in lung epithelial cells and in ferret lung. Carcinogenesis  30, 2070– 2076. Google Scholar CrossRef Search ADS PubMed  Vanhees K., Vonhögen I. G. C., van Schooten F. J., Godschalk R. W. L. ( 2014). You are what you eat, and so are your children: The impact of micronutrients on the epigenetic programming of offspring. Cell. Mol. Life Sci . 71, 271– 285. Google Scholar CrossRef Search ADS PubMed  Verhofstad N., van Oostrom C. T. M., van Benthem J., van Schooten F. J., van Steeg H., Godschalk R. W. L. ( 2010). DNA adduct kinetics in reproductive tissues of DNA repair proficient and deficient male mice after oral exposure to benzo(a)pyrene. Environ. Mol. Mutagen . 51, 123– 129. Google Scholar PubMed  Verhofstad N., van Oostrom C. T. M., Zwart E., Maas L. M., van Benthem J., van Schooten F. J., van Steeg H., Godschalk R. W. L. ( 2011). Evaluation of benzo(a)pyrene-induced gene mutations in male germ cells. Toxicol. Sci.  119, 218– 223. Google Scholar CrossRef Search ADS PubMed  Wagner K. D., Wagner N., Ghanbarian H., Grandjean V., Gounon P., Cuzin F., Rassoulzadegan M. ( 2008). RNA induction and inheritance of epigenetic cardiac hypertrophy in the mouse. Dev. Cell  14, 962– 969. Google Scholar CrossRef Search ADS PubMed  Wattez J. S., Delmont A., Bouvet M., Beseme O., Goers S., Delahaye F., Pinet F. ( 2015). Maternal perinatal undernutrition modifies lactose and serotranferrin in milk: Relevance to the programming of metabolic diseases? Am. J. Physiol. Endocrinol. Metab . 308, E393– E401. Google Scholar CrossRef Search ADS PubMed  Wells J. C. ( 2012). A critical appraisal of the predictive adaptive response hypothesis. Int. J. Epidemiol . 41, 229– 235. http://dx.doi.org/10.1093/ije/dyr239 Google Scholar CrossRef Search ADS PubMed  Williams R. S. ( 1986). Mitochondrial gene expression in mammalian striated muscle. Evidence that variation in gene dosage is the major regulatory event. J. Biol. Chem . 261, 12390– 12394. Google Scholar PubMed  © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Toxicological Sciences Oxford University Press

Loading next page...
 
/lp/ou_press/paternal-exposure-to-environmental-chemical-stress-affects-male-TWMtrEsWZ7
Publisher
Oxford University Press
Copyright
© The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
ISSN
1096-6080
eISSN
1096-0929
D.O.I.
10.1093/toxsci/kfx246
Publisher site
See Article on Publisher Site

Abstract

Abstract Preconceptional paternal exposures may affect offspring’s health, which cannot be explained by mutations in germ cells, but by persistent changes in the regulation of gene expression. Therefore, we investigated whether pre-conceptional paternal exposure to benzo[a]pyrene (B[a]P) could alter the offspring’s phenotype. Male C57BL/6 mice were exposed to B[a]P by gavage for 6 weeks, 3× per week, and were crossed with unexposed BALB-c females 6 weeks after the final exposure. The offspring was kept under normal feeding conditions and was sacrificed at 3 weeks of age. Analysis of the liver proteome by 2D-gel electrophoresis and mass spectrometry indicated that proteins involved in mitochondrial function were significantly downregulated in the offspring of exposed fathers. This down-regulation of mitochondrial proteins was paralleled by a reduction in mitochondrial DNA copy number and reduced activity of citrate synthase and β-hydroxyacyl-CoA dehydrogenase, but in male offspring only. Surprisingly, analysis of hepatic mRNA expression revealed a male-specific up-regulation of the genes, whose proteins were downregulated, including Aldh2 and Ogg1. This discrepancy could be related to several selected microRNA (miRNA)’s that regulate the translation of these proteins; miRNA-122, miRNA-129-2-5p, and miRNA-1941 were upregulated in a gender-specific manner. Since mitochondria are thought to be a source of intracellular reactive oxygen species, we additionally assessed oxidatively-induced DNA damage. Both 8-hydroxy-deoxyguanosine and malondialdehyde-dG adduct levels were significantly reduced in male offspring of exposed fathers. In conclusion, we show that paternal exposure to B[a]P can regulate mitochondrial metabolism in offspring, which may have profound implications for our understanding of health and disease risk inherited from fathers. paternal exposure, offspring, mitochondria, oxidative stress, DNA damage Nowadays there are several examples in which parental environmental exposures could change the phenotype of future generations, suggesting the existence of mechanisms that enable the transmission of acquired traits across generations (Gapp et al., 2014; Nettle and Bateson, 2015; Vanhees et al., 2014). The concept that early life diet and exposures could lead to an increased risk of diseases later in life was originally called the Barker Hypothesis, but is now known as the hypothesis of Developmental Origins of Health and Disease (Wells, 2012). Apparently, the traditional view of Mendelian genetic inheritance of traits is no longer satisfactory. Additional carriers of parental information in the gametes may include various forms of RNA and epigenetic signals, such as DNA methylation and chromatin modifications (Rando, 2016). This nongenetic inheritance of traits is often studied in offspring of females that were exposed to external environmental factors during pregnancy, including limited calorie intake (Wattez et al., 2015), infection (Straubinger et al., 2014), stress (Chaby, 2016), drugs and toxins (Anway et al., 2005), resulting in an adverse gestational environment. More recently, it has become clear from rodent studies that also paternal exposures or lifestyle can have detectable biological effects in the offspring, which cannot be explained by mutations. For instance, a pre-conceptional high fat diet of males resulted in beta-cell dysfunction in female offspring (Ng et al., 2010), and paternal exposure to radiation affected DNA methylation and the expression of certain genes and miRNA’s in their offspring’s thymus (Filkowski et al., 2010). Also overweight of fathers induced paternal programming of the offspring phenotypes, likely mediated through genetic, but also epigenetic changes in spermatozoa (McPherson et al., 2014). These transmittable effects are tissue-specific and/or exposure-specific. The underlying mechanisms and health consequences are far from completely clear. Therefore, this area of research needs significantly further attention. The mechanism by which nongenetic information is transmitted from one generation to the other may be related to the RNA content of sperm. Rassouzadegan et al. (Rassoulzadegan et al., 2006) showed that the type of RNA in sperm resulted in non-Mendelian inheritance of tail color in mice and their findings were later extended to heart malformation and body size (Grandjean et al., 2009; Wagner et al., 2008). In these studies, noncoding RNAs, either RNA fragments or miRNAs, in sperm were the causative epigenetic factors that induced the biological effect in offspring. The RNA in sperm that is transmitted to the oocyte during fertilization can be changed by exposure to lifestyle-related compounds and environmentally derived genotoxins (Linschooten et al., 2009). One important environmental genotoxic agent is benzo[a]pyrene (B[a]P), which is formed by incomplete combustion of organic materials and is present in cigarette smoke, diesel exhaust or smoked food products. B[a]P reaches the testes of exposed males and can damage the DNA of sperm, but can also change the RNA content of sperm and DNA methylation profiles in the testes (Godschalk et al., 2015). Although, we previously showed that B[a]P can induce mutations in sperm that are subsequently transmitted to the offspring (Godschalk et al., 2015; Verhofstad et al., 2011), these mutations are probably too rare and too much distributed over the whole genome to induce consistent biological effects in offspring. Brevik et al. (2012a,b) showed that fertilization of mouse oocytes by sperm of fathers that were previously exposed to B[a]P, consistently changed the mRNA and miRNA content of the developing embryo up to the blastocyst stage, but the consequences of these changes for the health of the embryo and its further development were not assessed. The altered RNA content of sperm could however modify postfertilization events and development, which may have effects in offspring later in life. A hypothesis describing this phenomenon is called the predictive adaptive response (PAR) (Bateson et al., 2014), in which it is stated that a fetus adapts to perceived environmental cues, which reach the fetus via the placenta during pregnancy but possibly also via the content of sperm. If this PAR predicts the postnatal environment correctly, it may be advantageous in later life because, due to its plasticity, the developing fetus adapts to the anticipated environmental cues. Since B[a]P is predominantly metabolized in the liver, a PAR after paternal exposure to B[a]P may especially result in adaptation of the liver. We thus hypothesized that paternal B[a]P exposure could change gene and protein expression in the liver of offspring. We first performed a lead finding study, in which the proteome of liver of 3-week-old offspring of male C57BL6 mice that were exposed to B[a]P was analyzed by 2D-gel electrophoresis. Down-regulation of several mitochondria-related proteins involved in metabolism and DNA repair was observed. We subsequently studied mitochondrial DNA copy number, gene-expression and miRNA expression and oxidative stress-related DNA damage in more detail in both male and female offspring. MATERIALS AND METHODS Animal exposure and breeding Mice were bred and maintained in a 12-h light-dark cycle at the animal facilities of the Netherlands Vaccine Institute (NVI, Bilthoven, the Netherlands) and received food and water ad libitum. Experiments were approved by the Institute’s Animal Ethics Committee and were carried out according to their guidelines. Male C57BL/6 mice were exposed for 6 weeks to B[a]P (3 times per week, 13 mg/kg bw dissolved in sunflower oil) by oral gavage. Sunflower oil was used as solvent, because of the lipophilicity of B[a]P and the dose of 13 mg/kg bw was based on previous studies in which it induced detectable DNA adduct levels in testis and sperm (Verhofstad et al., 2010). Control male mice received sunflower oil 3 times per week for 6 weeks. Six weeks after the last exposure, all mice (6 mice per group) were subsequently crossed with 2 unexposed Balb/c wildtype female mice in order to obtain offspring. This 6-week break ensured that the effects in the F1 originate from spermatogonial stem cells and dividing spermatogonia (note that it takes ∼6 weeks for sperm cells to reach the epididymis/ejaculate after the first mitotic division of a spermatogonial stem cell). Offspring was euthanized 3 weeks after birth and liver tissues were snap frozen in liquid nitrogen and stored at −80 °C. Proteome analysis by 2D-gel electrophoresis Liver tissues were crushed in liquid nitrogen to obtain a homogenized sample for protein extraction. Eight liver samples of male offspring mice (4 of exposed fathers, 4 of control fathers) were lysed in lysis buffer (40 mM Tris, 7 M urea, 4% CHAPS and 100 mM DTT). Chemicals were purchased from Sigma-Aldrich unless stated otherwise. Cells were further lysed by 3 cycles of quick freezing in liquid nitrogen and subsequent thawing. DNA was digested by adding DNase. The homogenate was vortexed for 1 min and centrifuged at 20 000 × g for 30 min at 10 °C. The protein concentration of the supernatants was determined by a Bradford based protein assay and an albumin calibration curve. Aliquots were stored at −80 °C. The 2D-gel-electrophoresis was essentially performed as described previously (de Roos et al., 2008). Total protein (200 µg) was loaded for the first dimension in 500 μl with 0.5% v/v IPG Biolyte buffer 3–11 nonlinear. Immobiline Dry Strips (pH 3–11, nonlinear, 18 cm long) were rehydrated for 12 h in 8 M urea, 2% w/v CHAPS, 65 mM DTT, 0.5% v/v IPG buffer at 30 V. Then the isoelectric focusing was performed on an IPGphor electrophoresis unit (Amersham Biosciences) at 20 °C (12-h rehydration 20 °C 50 µA, 2 h 500 V, 2 h 1000 V Gradient, 3.5 h 8000 V Gradient and a focusing step of 32 000 Vh at 8000 V). After iso-electric focusing, IPG strips were equilibrated for 15 min in 50 mM Tris-HCl, pH 6.8, 6 M urea, 30% v/v glycerol, 2% w/v SDS, 1% w/v DTT and for 15 min in 50 mM Tris-HCl, pH 6.8, 6 M urea, 30% v/v glycerol, 2% w/v SDS, 2.5% w/v iodoacetamide, and were placed onto a 12.5% SDS-PAGE gel and sealed with a 0.5% w/v agarose solution in Laemmli buffer with a trace of bromophenol blue. Electrophoresis was conducted at a constant voltage of 200 V for 5 h in a Dodeca system (Bio-Rad). Gels were removed from the casting plates and fixed for at least 30 min in 10% v/v Methanol, 7% v/v Acetic Acid. After fixation, the gels were stained in SYPRO RUBY protein gel stain (BioRad). The scanning was performed using a fluorescent laser scanner (BioRad Personal Molecular Imager FX) using the Quantity One software (Version 4.6.5 Build 094). All gels were analyzed using the PDQuest software (Version 8.0.1 Build 055). Protein identification by mass spectrometry Spots of interest (ie, 2-fold change in abundance combined with a t-test value of <0.05) were manually excised from the gel and processed on a MassPREP digestion robot (Waters, Manchester UK). A solution of 50 mM ammonium bicarbonate in 50% v/v acetonitrile was used for destaining. Cysteines were reduced with 10 mM DTT in 100 mM ammonium bicarbonate for 30 min followed by alkylation with 55 mM iodoacetamide in 100 mM ammonium bicarbonate for 20 min. Spots were washed with 100 mM ammonium bicarbonate to remove excess reagents and were subsequently dehydrated with 100% acetonitrile. Trypsin (6 ng/ml) in 50 mM ammonium bicarbonate was added to the gel plug and incubated at 37 °C for 5 h. The peptides were extracted with 1% v/v formic acid/2% v/v acetonitrile. Proteins were identified by MALDI-TOF- mass spectrometry (MS) (M@LDI-LR mass spectrometer, Waters, Manchester, UK) or LC-MS (nanoflow HPLC instrument [Dionex ultimate 300] with a C18-reversed phase column [Thermo Scientific Acclaim PepMap C18 column, 75 μm inner diameter × 15 cm, 5 μm particle size] coupled on-line to a Q Exactive [Thermo Scientific] with a nanoelectrospray Flex ion source [Proxeon]). The peptide mass list was searched with ProteinLynx GlobalServer (Micromass, UK Manchester) against the Swiss-Prot database (http://expasy.ch/sprot) for protein identification. One mis-cleavage was tolerated, carbamido-methylation and oxidation of methionine were regarded as optional modifications. The peptide mass tolerance was set to 100 ppm. No restrictions were made on the protein molecular weight and the isoelectric point (pI). A protein was regarded identified with at least 5 peptide mass hits or sequence coverage of 30% of the complete protein sequence. Additionally, the data were searched using Sequest HT Proteome Discoverer 1.4 search engine (Thermo Scientific), against the Uniprot database. The false discovery rate was set to 0.01 for proteins and peptides, which had to have a minimum length of 6 amino acids. The precursor mass tolerance was set at 10 ppm and the fragment tolerance at 0.2 Da. One miss-cleavage was tolerated, oxidation of methionine was set as a dynamic modification and carbamido-methylation of cysteines was a fixed modification. Enzyme activity assay A tissue homogenate was prepared by dispersion (5% wt/vol, using a Polytron PT 1600 E; Kinematica, Lucerne, Switzerland) in 250 mM sucrose, 2 mM EDTA, and 10 mM Tris (pH 7.4), followed by 1 min sonication (Branson 2210; Branson Ultrasonics). Samples were centrifuged (10 min, 10 000 × g, 4 °C) and the supernatant was used for enzyme activity assays of β-hydroxyacyl-CoA dehydrogenase (HADH) and citrate synthase (CS) (Gosker et al., 2002, 2006). Enzyme activity levels were corrected for total protein content. Total protein content was determined using a detergent compatible protein determination assay (Bio-Rad, Hercules, California). Protein extraction and western blotting Pieces of liver were powdered and homogenized in 400 μl IP lysis buffer (50 mM Tris, 150 mM NaCl, 10% glycerol, 0.5% Nonidet P40, 1 mM EDTA, 1 mM Na3VO4, 5 mM NaF, 10 mM β-glycerophosphate, 1 mM Na4O7P2, 1 mM DTT, 10 μg/μl leupeptin, 1% apropeptin, 1 mM PMSF, pH 7.4) with a tissue homogenizer (Polytron PT 1600 E; Kinematica). Lysates were incubated while rotating for 15-60 min, and subsequently centrifuged at 20 000 × g for 30 min at 4 °C. Protein concentrations were determined using the Pierce BCA Protein Assay Kit (Thermo Scientific, Landsmeer, Netherlands) according to the manufacturer’s protocol. Lysate (1 μg/μl) was aliquoted in sample buffer (0.25 M Tris-HCl, 8% (w/v) SDS, 40% (v/v) glycerol, 0.4 M DTT, 0.04% (w/v) bromophenol blue, pH 6.8) and boiled for 5 min at 95 °C. 10 µg of protein per sample was run on a Criterion 26-wells 12% precast gel (Bio-Rad Laboratories B.V., Veenendaal, Netherlands) in 1x MES buffer (Bio-Rad Laboratories B.V., Veenendaal, The Netherlands) at 100 V, and was subsequently blotted on a Nitrocellulose membrane (Bio-Rad Laboratories B.V., Veenendaal, The Netherlands) by electroblotting in TBS-Tween-20 (0.05%). At least 2 protein ladders were loaded on each gel (Precision Plus Protein All Blue Standards, Bio-Rad Laboratories B.V.). Membranes were incubated in Ponceau S (Bio-Rad Laboratories B.V., Veenendaal, The Netherlands) for 5 min and washed with milliQ before they were photographed using the AmershamImager 600 (GE Healthcare Life Sciences, Eindhoven, Netherlands). Ponceau S quantification was used as correction for loading. Subsequently, membranes were destained by repeated washing with TBS-Tween-20 (0.05%), blocked with 3% nonfat dried milk (NFDM (non-fat, dried milk) (Campina, Amersfoort, Netherlands) in TBS-Tween-20 (0.05%) for 1 h, washed, and incubated overnight at 4 °C with different protein-specific primary antibodies against: oxidative phosphorylation (OXPHOS) (Mitoscience, Eugene), mitochondrial transcription factor A (Tfam; Merck Millipore, Amsterdam, The Netherlands), nuclear respiratory factor 1 (NRF-1; Abcam, Cambridge, U.K.) and peroxisome proliferator-activated receptor gamma co-activator (PGC)-1α (Cell Signaling, Danvers), which were all diluted in 3% NFDM/BSA in TBS-Tween-20. Membranes were washed and incubated with Horseradish Peroxidase-labeled, primary antibody-specific, secondary antibody (Vector Laboratories, Amsterdam, The Netherlands) (1: 10 000 diluted in 3% milk in TBS-Tween20) for 1 h at room temperature. Membranes were washed and incubated with either 0.5× SuperSignal West Pico Chemiluminescent Substrate or 0.25× SuperSignal West Femto Chemiluminescent Substrate (Thermo Scientific, Landsmeer, The Netherlands) for 5 min, depending on the expected signal strength. Photographs were taken with the LAS-3000 or AmershamImager 600 and analyzed with ImageQuant TL software (GE Healthcare Life Sciences, Eindhoven, The Netherlands). Specific protein band intensity was corrected for Ponceau S intensity before statistical analysis. Gene-expression and mitochondrial copy number analysis by PCR RNA was isolated from crushed liver samples using an AllPrep DNA/RNA Mini Kit (Qiagen), which included DNase treatment. cDNA was subsequently synthesized using an iScript kit (bio-rad 170-8891) according to the manufacturer’s protocol. For the SYBR Green Q-PCR analyses, a 25-μl reaction mixture was prepared containing PCR buffer, 0.2 mM deoxynucleotide triphosphates, 0.5 mM MgCl2, 1.25 U of Taq-polymerase, and 200 ng of template DNA (for analysis of mt copy number) or cDNA (for analysis of gene expression). The final primer concentrations were 0.1 μM. PCR was performed with an initial denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 16 s, 60 °C for 15 s, and 72 °C for 10 s. The genes that were analyzed and the corresponding primers can be found in Table 1. Data were analyzed by using MyiQ Software system (BioRad) and were expressed as relative gene expression (fold change) using the 2−ΔΔCt method (Schmittgen and Livak, 2008). The Ct-value of the house-keeping gene Gapdh was calculated for all samples and used as reference Ct-value. Table 1. Overview of the Primers Used in the PCR Experiments for Mitochondrial Copy Number and Gene Expression Gene  Full Name  Type  Sequence 5′→3′  MtCo1  mt-Co1 Mitochondrial gene  Forward  CAGTCTAATGCTTACTCAGC  Reverse  GGGCAGTTACGATAACATTG  Gapdh  Glyceraldehyde-3-phosphate dehydrogenase  Forward  GGGAAGCCCATCACCATCTTC  Reverse  AGAGGGGCCATCCACAGTCT  Ogg1  8-oxoguanine Glycosylase 1  Forward  TGGCACTGGCACGTACATAG  Reverse  TATCATGGCTTCCCAAACCT  Sod2  Superoxide dismutase 2  Forward  GCTTGATAGCCTCCAGCAAC  Reverse  ACTGAAGTTCAATGGTGGGG  Aldh2  Aldehyde dehydrogenase 2  Forward  GATGACCTCCCCTGTGGAA  Reverse  AGCCTGAGGTCTTCTGCAAC  Actb  Beta-actin  Forward  ATGGAGGGGAATACAGCCC  Reverse  TTCTTTGCAGCTCCTTCGTT  Cat  Catalase  Forward  GACTGACCAGGGCATCAAAAA  Reverse  CGGATGCCATAGTCAGGATCTT  Gene  Full Name  Type  Sequence 5′→3′  MtCo1  mt-Co1 Mitochondrial gene  Forward  CAGTCTAATGCTTACTCAGC  Reverse  GGGCAGTTACGATAACATTG  Gapdh  Glyceraldehyde-3-phosphate dehydrogenase  Forward  GGGAAGCCCATCACCATCTTC  Reverse  AGAGGGGCCATCCACAGTCT  Ogg1  8-oxoguanine Glycosylase 1  Forward  TGGCACTGGCACGTACATAG  Reverse  TATCATGGCTTCCCAAACCT  Sod2  Superoxide dismutase 2  Forward  GCTTGATAGCCTCCAGCAAC  Reverse  ACTGAAGTTCAATGGTGGGG  Aldh2  Aldehyde dehydrogenase 2  Forward  GATGACCTCCCCTGTGGAA  Reverse  AGCCTGAGGTCTTCTGCAAC  Actb  Beta-actin  Forward  ATGGAGGGGAATACAGCCC  Reverse  TTCTTTGCAGCTCCTTCGTT  Cat  Catalase  Forward  GACTGACCAGGGCATCAAAAA  Reverse  CGGATGCCATAGTCAGGATCTT  Analysis of microRNA expression microRNA (miRNA) of interest were selected from Brevik et al. (2012a) in which changes of miRNA expression were studied in early developmental stages after paternal exposure to B[a]P. Proteomics analysis and PCR analysis showed that genes and proteins related to mitochondrial homeostasis were altered in a gender-specific manner (see “Results” section). Therefore, the miRNA for analysis by dedicated PCR was selected on basis of (1) the miRNA should have predicted targets in the regulation of gene transcription and translation of proteins that were identified by our lead finding proteomics analysis. Targets were predicted by miRWalk (Dweep and Gretz, 2015); (2) the miRNA was found to be regulated by B[a]P exposure and gender in previous publications, and (3) the miRNA is involved in mitochondrial function. The cDNA synthesis and miRNA profiling was carried as describe previously (Aarem et al., 2016). In brief, cDNA from 0.5 μg of RNA was synthesized using the miScript II RT kit including 5× miScript HiSpec Buffer (for selective conversion of mature miRNA into cDNA) according to the manufacturers protocol (Qiagen, Norway). A no reverse transcriptase control (NRT) was included and samples were incubated at 37 °C for 60 min and 95 °C for 5 min. All cDNA samples were stored at −20 °C prior to gene expression analysis. The miRNA profiling was carried out in 384-well PCR plates using miScript SYBR Green PCR Kit according to the manufacturer’s protocol (Qiagen, Norway) on a CFX384 TouchReal-Time PCR Detection System (Bio-Rad, Norway). Serial dilutions of cDNA were prepared to determine the optimal dilution. A 1: 10 dilution of cDNA from each sample was run in triplicate for each miRNA of interest. The expression levels of the following 10 miRNAs (mmu-miR-107-3p, mmu-miR-107-5p, mmu-miR-122-3p, mmu-miR-122-5p, mmu-miR-129-1-3p, mmu-miR-129-2-3p, mmu-miR-129-5p, mmu-miR-1941-3p, mmu-miR-1941-5p and mmu-miR-34a,), and 3 small nuclear RNAs (snRNA; RNU6, RNU43 and RNU1), were measured. The quantification cycle (Cq) values were recorded with CFX ManagerSoftware (Bio-Rad, Norway). Target miRNAs were normalized by the average of 3 stably expressed reference genes (RNU6, RNU43 and RNU1); this is given by ΔCq; where ΔCq (sample) = Cq (target miRNA) – Cq (reference snRNAs). The ΔΔCq values were generated by subtracting the ΔCq-value for the reference samples (calibrators; untreated controls) from the ΔCq-value of the samples [ΔΔCq = ΔCq (sample) − ΔCq (calibrator); fold change = 2−ΔΔCq] (Brevik et al., 2012a). Oxidative stress-related genetic damage Oxidatively-induced DNA damage was measured by assessing both 8-oxo-dG and malondialdehyde (MDA)-dG adducts in liver DNA. DNA was obtained from crushed liver tissue by a standard phenol extraction that was optimized to minimize artificial induction of 8-oxo-dG (ESCODD [European Standards Committee on Oxidative DNA Damage], 2002), by using radical-free phenol, minimizing exposure to oxygen, and adding 1 mM deferoxamine mesylate (metal chelator) and 20 mM 2, 2, 6, 6-tetramethylpiperidine-N-oxyl. DNA concentrations were spectrophotometrically quantified at 260 nm. 8-oxo-dG was assessed by HPLC-electrochemical detection (ECD) as previously described by van Helden et al. (2009). A total of 30 µg DNA was digested to deoxyribonucleosides by addition of 6 µl 0.5 M NaAc, 9 µl 10 mM ZnCl2 and 1.5 µl nuclease P1 (NP1, stock: 1 U/µl) and incubation for 90 min at 37 °C. Subsequently, 30 µl 0.5 M Tris–HCl (pH 7.4) and 1.5 µl alkaline phosphatase (0.014 U/µl) were added followed by incubation at 37 °C for 45 min. The digest was then analysed by HPLC-ECD on a SupelcosilTM LC-18 S column (250 mm × 4.6 mm) (Supelco Park, Bellefonte, Pennsylvania) in combination with a DECADE electrochemical detector (Antec, Leiden, The Netherlands). The ECD-signal was first stabilized with mobile phase (94 mM KH2PO4, 13 mM K2HPO4, 26 mM KCl and 0.5 mM EDTA, 10% methanol) for approximately 3 h at a flow rate of 1 ml/min. After stabilization, 8-oxo-dG was detected at a potential of 400 mV and dG was simultaneously monitored by UV absorption at 260 nm. Malondialdehyde-dG adducts (M1-dG) were determined by 32P-postlabelling as previously described by Peluso et al. (2013). In short, DNA was hydrolyzed by incubation with micrococcal nuclease (21.45 mU/μl) and spleen phosphodiesterase (6.0 mU/μl) in 5.0 mM Sodium succinate, 2.5 mM calcium chloride, pH 6.0, at 37 °C for 4.5 h. Hydrolyzed samples were treated with NP1 (0.1 U/μl) in 46.6 mM sodium acetate, pH 5.0, and 0.24 mM ZnCl2 at 37 °C for 30 min. After NP1 treatment, 1.8 μl of 0.16 mM Tris base was added and samples were incubated with 7–25 μCi of carrier-free [γ-32 P]ATP (3000 Ci/mM) and polynucleotide kinase T4 (0.75 U/μl) to generate 32 P-labelled DNA adducts in bicine buffer (20 mM bicine, 10 mM MgCl2, 10 mM dithiotreithol, 0.5 mM spermidine, pH 9.0) at 37 °C for 30 min. 32 P-labeled samples were applied to polyethyleneimine cellulose thin layer chromatography plates (Macherey-Nagel, Germany) and resolved in a low-urea solvent system as described. Detection and quantification of M1–dG adducts and normal nucleotides (ie, diluted samples that were not treated with NP1), were performed by storage phosphor imaging techniques employing intensifying screens from Molecular Dynamics (Sunnyvale, California). Levels of M1-dG adducts were expressed as relative adduct labeling = pixels in adducted nucleotides/pixel in normal nucleotides. The levels of M1–dG adducts were corrected across experiments based on the recovery of an MDA-treated DNA adduct standard. Statistics Data are presented as average and standard error of the mean. Differences between offspring of B[a]P-exposed fathers and non-exposed fathers were tested for male and female offspring separately by the nonparametric Mann-Whitney U-test, considering p < .05 as statistically significant. To prevent litter-effects, all analyses were performed on individuals originating from different litters, ie, no brothers/sisters were analyzed in a specific analysis. RESULTS 2D-Gel Electrophoresis and Identification of Proteins of Interest Analysis of the liver by 2D-gel electrophoresis revealed a total of 265 protein spots that were detectable in all livers studied. From these, 3 spots were >2 fold up-regulated and 18 spots were >2-fold downregulated in offspring liver of B(a)P-exposed fathers when compared with offspring of fathers that were not exposed. Only the spots that were downregulated met the criterion of statistical significance (p < .05), and 9 spots could subsequently be identified by mass spectroscopy (MS). The 2 strongest down regulated proteins were centromere protein A and aldehyde dehydrogenase 2 (Aldh2). Eight out of the nine proteins identified by 2D-gel electrophoresis could be linked to mitochondrial function (Figure 1) , which included aldehyde dehydrogenase 2 (Aldh2, fold change compared with control [FC]: 0.26), carbamoyl-phosphate synthase (Cps1, found in 2 protein spots with FC = 0.32 and FC = 0.43), medium Chain Acyl-coA dehydrogenase (Mcad, FC = 0.33), 8-oxo-dG glycosylase (Ogg1, found in 2 protein spots with FC = 0.40 and FC = 0.45) and glyoxylate reductase/hydroxypyruvate reductase (Grhpr, FC = 0.49). Figure 1. View largeDownload slide Typical result of 2D-gel electrophoresis. Spots with a different intensity in offspring of B[a]P-exposed fathers versus unexposed fathers (>2-fold and p < .05) that could also be identified by MS are indicated with a number. The identity (name) and role of these proteins in mitochondria are indicated. In 2 occasions, 2 protein spots appeared to have the same identity, which could represent a shift in pI due to small structural changes (Cps1, spots 3 and 6) or a shift in mass, possibly due to the presence of different isoforms (Ogg1, spots 5 and 7). Figure 1. View largeDownload slide Typical result of 2D-gel electrophoresis. Spots with a different intensity in offspring of B[a]P-exposed fathers versus unexposed fathers (>2-fold and p < .05) that could also be identified by MS are indicated with a number. The identity (name) and role of these proteins in mitochondria are indicated. In 2 occasions, 2 protein spots appeared to have the same identity, which could represent a shift in pI due to small structural changes (Cps1, spots 3 and 6) or a shift in mass, possibly due to the presence of different isoforms (Ogg1, spots 5 and 7). Mitochondrial DNA Copy Number and Activity of Mitochondrial Enzymes The decreased expression of mitochondrial proteins in male offspring of B[a]P–exposed fathers could be related to either a lower number of mitochondria or to a lower concentration of these proteins per mitochondrion. One strategy to obtain information about the number of mitochondria is to assess the mitochondrial DNA copy number relative to nuclear DNA in both male and female offspring of exposed and unexposed fathers. The mitochondrial copy number was approximately 50% lower in male offspring of fathers that were exposed to B[a]P when compared with offspring of control fathers, whereas no significant change was found in female offspring (Figure 2A). Figure 2. View largeDownload slide A, Mitochondrial DNA copy number in male and female offspring of fathers that were exposed to vehicle only (white bars) or B[a]P (black bars). Offspring of fathers that were not exposed to B[a]P were used as control and set to 1. B, Enzyme activity of CS and HADH activity in homogenized liver samples of male offspring whose fathers were exposed to vehicle only (white bars) or B[a]P (black bars). C, Two examples of Western Blot analysis of OXPHOS subunits, PGC-1α, Nrf1 and Tfam in homogenized liver samples in male offspring whose fathers were exposed to vehicle only or B[a]P (protein bands of all samples were very similar in intensity and therefore only 2 representative samples are shown here), and their quantitation in D, Offspring of fathers that were exposed to vehicle only (white bars) or B[a]P (black bars). Indicated are means and SE, n = 8, *statistically different from unexposed, p < .05. Figure 2. View largeDownload slide A, Mitochondrial DNA copy number in male and female offspring of fathers that were exposed to vehicle only (white bars) or B[a]P (black bars). Offspring of fathers that were not exposed to B[a]P were used as control and set to 1. B, Enzyme activity of CS and HADH activity in homogenized liver samples of male offspring whose fathers were exposed to vehicle only (white bars) or B[a]P (black bars). C, Two examples of Western Blot analysis of OXPHOS subunits, PGC-1α, Nrf1 and Tfam in homogenized liver samples in male offspring whose fathers were exposed to vehicle only or B[a]P (protein bands of all samples were very similar in intensity and therefore only 2 representative samples are shown here), and their quantitation in D, Offspring of fathers that were exposed to vehicle only (white bars) or B[a]P (black bars). Indicated are means and SE, n = 8, *statistically different from unexposed, p < .05. Similarly, subsequent analyses of CS and beta-hydroxyacyl-CoA dehydrogenase enzyme activity in male offspring (Figure 2B) indicated that these were decreased in offspring whose fathers were exposed to B[a]P (only CS activity was significantly decreased from 51.3 to 29.4 µmol/min, p < .05). On the other hand, the protein abundance of subunits of mitochondrial OXPHOS complexes 1, 2, 3, and 5 were not different between the groups (Figs. 2C and D). Since mitochondrial biogenesis is regulated via Pgc-1α, Nrf1, and Tfam, we additionally studied the abundance of these proteins, but none of them were differentially expressed in liver of offspring whose fathers were exposed to B[a]P (Figure 2C). Gene Expression of Relevant Genes mRNA expression of genes that were differentially expressed at the protein level was assessed by qPCR (Figure 3). Although the protein levels of Ogg1, Actb and Aldh2 were downregulated, as assessed by 2D-gel electrophoresis, their mRNA levels were respectively 2.1 ± 0.4-fold, 2.5 ± 0.7 fold, and 3.2- ± 0.7-fold up-regulated (p < .05), again in a gender-specific manner, because no changes were observed in female offspring. We also studied 2 mitochondrial anti-oxidant enzymes, i.e. Catalase (Cat) and Superoxide dismutase 2 (Sod2), and mRNA expression of both was also significantly up-regulated: Cat: 3.5- ± 0.7-fold and Sod2 1.8- ± 0.3-fold; both p < .05) (Figure 3). Figure 3. View largeDownload slide mRNA expression of selected mitochondria-related genes, relative to male offspring of control fathers. Gapdh was used as reference gene and expression was related to the expression in male offspring of unexposed fathers (reference = 1). Indicated are means and SE, n = 6,*statistically different from unexposed, p < .05; **p < .01. Figure 3. View largeDownload slide mRNA expression of selected mitochondria-related genes, relative to male offspring of control fathers. Gapdh was used as reference gene and expression was related to the expression in male offspring of unexposed fathers (reference = 1). Indicated are means and SE, n = 6,*statistically different from unexposed, p < .05; **p < .01. miRNA Expression The discrepancy between protein concentrations (downregulated in offspring of exposed fathers) and gene expression changes (up-regulated in offspring of exposed fathers) in male offspring, prompted us to analyze miRNA levels that could regulate the translation process of 4 gene products (Aldh2, Actb, Cat, and Ogg1). Therefore, the following miRNA’s, known to be involved in the regulation of the above-mentioned genes were selected: (1) mu-mir-122 which was previously found to be altered after B[a]P exposure (Halappanavar et al., 2011) and it is predicted to regulate Ogg1. miR122 was reported to be involved in mitochondrial function and it targets CS mRNA (Jin et al., 2014). Moreover, it is liver-specific and seems to be regulated by testosterone (Delić et al., 2010); (2) mmu-mir-129 which is predicted to regulate a number of genes that were identified in our proteomics and PCR analysis, including Ogg1, Cat, and Actb; (3) mmu-mir-107 is predicted to be involved in the regulation of Aldh2, which was identified in both our proteomics and gene expression analyses; (4) mmu-mir-1941 which regulates Aldh2 and is significantly and strongly up-regulated in the blastocyst stage (Brevik et al., 2012a); (5) mmu-miR-34a was included as control. Of these selected miRNA’s, mmu-miR-122-3p, mmu-miR-122-5p, mmu-miR-129-3p, mmu-miR-1941-3p, and mmu-miR-1941-5p, were all significantly up-regulated in male offspring whose father was exposed to B[a]P, but not in female offspring (Figure 4). The strongest up-regulation was found for mmu-miR-122-5p, which was 3.7- ± 0.5-fold increased in male offspring of exposed fathers. Figure 4. View largeDownload slide Expression of selected miRNA in male (ME) and female (FE) offspring of B[a]P-exposed fathers. The expression in offspring of unexposed fathers was used as reference and set at 1.0. This reference is indicated with a horizontal dashed line. Indicated are means and SE, n = 6, *p < .05 **p < .005 compared with respective unexposed controls. Figure 4. View largeDownload slide Expression of selected miRNA in male (ME) and female (FE) offspring of B[a]P-exposed fathers. The expression in offspring of unexposed fathers was used as reference and set at 1.0. This reference is indicated with a horizontal dashed line. Indicated are means and SE, n = 6, *p < .05 **p < .005 compared with respective unexposed controls. Oxidative Stress in Liver Mitochondria are a major source of intracellular oxidative stress. The lower number of mitochondria and the lower activity of CS in male offspring of B[a]P-exposed fathers may therefore lead to lower levels of oxidative stress. On the other hand, if these mitochondria have to ‘work harder’ to meet the energy requirements, it may theoretically also increase oxidative stress and associated oxidative cell damage. Especially, since several anti-oxidant and DNA repair enzymes were downregulated at the protein level (Ogg1 and Aldh2). However, analysis of the oxidative stress-related DNA damages 8-oxo-dG and M1dG indicated that both were decreased in male offspring of B[a]P exposed fathers (Figure 5); 8-Oxo-dG levels were 35.7 ± 3.7 adducts per 106 dG in offspring of unexposed males, and 25.2 ± 3.0 adducts per 106 dG in offspring of exposed fathers (p < .05). Similarly, M1dG levels were 0.62 ± 0.14 adducts per 107 nucleotides in offspring of unexposed males, and 0.11 ± 0.15 adducts per 107 nucleotides in offspring of exposed males (p < .05). Figure 5. View largeDownload slide Oxidative DNA damage assessed by 8-oxo-dG (A) and M1-dG (B) in liver of offspring mice, whose fathers were exposed to B[a]P (Black bars). Offspring of unexposed fathers (white bars) were used as gender-specific control (ie, 100%). Indicated are means and SD, n = 6, *statistically different from unexposed, p < .05. Figure 5. View largeDownload slide Oxidative DNA damage assessed by 8-oxo-dG (A) and M1-dG (B) in liver of offspring mice, whose fathers were exposed to B[a]P (Black bars). Offspring of unexposed fathers (white bars) were used as gender-specific control (ie, 100%). Indicated are means and SD, n = 6, *statistically different from unexposed, p < .05. DISCUSSION The PAR hypothesis describes a form of developmental plasticity in which environmental cues can influence the development of the fetus in such a way that the offspring is better equipped for the environmental conditions later in life (Bateson et al., 2014). Although it is well studied that these cues can be transferred to the offspring via the placenta during pregnancy, it is also possible that these environmental cues are transferred via the gametes of both parents (Vanhees et al., 2014). The male spermatocytes contain, next to the genetic material, epigenetic marks that could have long lasting effects in the developing fetus (Rando, 2016). In this experiment, we studied whether paternal exposure to the environmental contaminant B[a]P can have such programming effects and lead to changes to the offspring’s phenotype. Although this study is descriptive in nature, we clearly show that exposures of the father can have unexpected consistent effects in offspring. Specifically, we uncovered changes in mitochondrial protein abundance and enzyme activity as well as decreases in mitochondrial DNA copy number, but in the liver of male offspring only. This was unexpected because mitochondria are maternally inherited. Oocytes possess large numbers of mitochondria at fertilization and there is no biogenesis of mitochondria until postimplantation. Each newly formed cell within the preimplantation embryo will possess fewer mitochondria until the blastocyst stage, because during each cell division the mitochondria are distributed over each daughter cell (Shoubridge and Wai, 2007; Thundathil et al., 2005). After implantation, the biogenesis of mitochondria is initiated in a cell type specific manner and is tightly regulated during development to meet the metabolic demands of cells (Moyes et al., 1998; Williams, 1986). Interestingly, in our study, abundance of proteins known to be involved in the regulation of mitochondrial biogenesis, Pgc1α, Nrf1, and Tfam, were not significantly altered in offspring. Whether or not these proteins were differentially expressed during development of B[a]P-exposed offspring or whether or not other processes were altered that are involved in the regulation of mitochondrial content, eg, selective clearing of mitochondria by mitophagy, remains to be established. In addition, it could also be speculated that the differences found in mitochondrial content in our study do not originate from alterations in mitochondrial biogenesis, but from alterations in early phases of development in which mitochondria need to be equally distributed over daughter cells. To coordinate this distribution, interaction of mitochondria with microtubules, B- and F-actin during cytokinesis is important (Li et al., 2004; Boldogh and Pon, 2007). Interestingly, B-actin was differentially expressed at both protein and mRNA level. In 2 occasions, 2 protein spots appeared to have the same identity, which could represent a shift in pI due to small structural posttranslational changes (Cps1, spots 3 and 6) or a shift in mass, possibly due to the presence of different isoforms (Ogg1, spots 5 and 7). Since we found gender-specific differences in mtDNA copy numbers and mitochondrial enzyme activity in liver of offspring of fathers that were exposed to B[a]P, the sperm likely contained a factor that impacted mitochondrial content. It is unknown which factors are involved, but these could include DNA methylation, histone modifications or a number of noncoding RNA’s including short non-coding RNA’s and long noncoding RNA’s. A known example of involvement of long noncoding RNA’s in transgenerational effects is the X-inactivation in female offspring (Maclary et al., 2014). Additionally, there are examples of transgenerational passage of epigenetic information through RNA as well as chromatin proteins (Rando, 2016; Rassoulzadegan et al., 2006). In our study, there was a discrepancy between gene expression (up-regulated) and subsequent protein levels (downregulated). Analysis of the expression of miRNA expression levels was therefore a logical next step, because miRNA inhibit the production of proteins by blocking translation. In our case, we identified miRNA122 as a potential mediator of altered mitochondrial content. It is regulated in a gender-specific manner, because its expression is controlled by testosterone (Delić et al., 2010) and it was previously found to be differentially expressed after B[a]P exposure (Halappanavar et al., 2011). More interestingly, miR122 was reported to be involved in mitochondrial function (Jin et al., 2014). It should be noted however, that miR122 is not necessarily the sperm-related factor that transmitted the effect, but it is at least differentially regulated in early development of the fetus (Brevik et al., 2012a,b) after paternal exposure to B[a]P. Is this actually a PAR? Exposure to B[a]P via cigarette smoke is known to increase the level of oxidative stress and subsequent DNA strand breaks in the male germ line (Laubenthal et al., 2012; Sipinen et al., 2010). Therefore, the offspring may ‘predict’ that it may encounter more oxidative stress later in life and adapts to that by downscaling its own production of radicals from mitochondria or by upregulating the expression of anti-oxidant enzymes. Expression of anti-oxidant enzymes was indeed upregulated at the level of mRNA, but was not confirmed by protein or activity analysis. Still, this idea is also in line with decreased levels of the oxidative stress-related DNA damage (8-hydroxy-deoxyguanosine and M1-dG) in liver DNA. However, it remains unclear why this would only occur in male offspring. When the predicted and actual environment differs; this mismatch between the individual's phenotype and the environmental exposures can have adverse consequences for health. In our case, lowered mitochondrial content and possibly impaired metabolism in mitochondria may become problematic if for instance energy intake is too high due to a Western type of diet. Indeed, an epidemiological study showed that sons but not daughters of fathers that initiated smoking behavior early in life, have an increased risk of obesity (Northstone et al. 2014). Therefore, this concept could also explain inter-individual differences in how people react to environmental triggers later in life. Smoking was also found to increase DNA damage in sperm (Linschooten et al., 2011), which may by itself be a programming factor, because damaged sperm DNA may initiate DNA repair processes in early development, which could lead to different developmental paths that eventually affect for instance the maintenance of genetic integrity later in life. We previously showed that paternal preconceptional smoking (ie, exposure to B[a]P via cigarette smoke) increased DNA damage in blood cells of newborns (Laubenthal et al., 2012). This is not in line with the decreased levels of DNA damage in the liver of offspring as observed in this study. In conclusion, paternal exposure to the genotoxic agent B[a]P changed the male offspring’s hepatic oxidative stress levels, likely as a result from decreased mitochondrial numbers, however further research is needed to understand the origins of these phenotypic changes and the health consequences later in life. ACKNOWLEDGMENT The authors thank the biotechnicians of the animal facility of The Netherlands Vaccine Institute (The Netherlands) for their skillful assistance in this study. REFERENCES Aarem J., Brunborg G., Aas K. K., Harbak K., Taipale M. M., Magnus P., Knudsen G. P., Duale N. ( 2016). Comparison of blood RNA isolation methods from samples stabilized in Tempus tubes and stored at a large human biobank. BMC Res. Notes  9, 430. Google Scholar CrossRef Search ADS PubMed  Anway M. D., Cupp A. S., Uzumcu M., Skinner M. K. ( 2005). Epigenetic transgenerational actions of endocrine disruptors and male fertility. Science (New York, N.Y.)  308, 1466– 1469. Google Scholar CrossRef Search ADS PubMed  Bateson P., Gluckman P., Hanson M. ( 2014). The biology of developmental plasticity and the predictive adaptive response hypothesis. J. Physiol.gy  592, 2357– 2368. http://dx.doi.org/10.1113/jphysiol.2014.271460 Google Scholar CrossRef Search ADS   Boldogh I. R., Pon L. A. ( 2007). Mitochondria on the move. Trends Cell Biol . 17, 502– 510. http://dx.doi.org/10.1016/j.tcb.2007.07.008 Google Scholar CrossRef Search ADS PubMed  Brevik A., Lindeman B., Brunborg G., Duale N. ( 2012). Paternal Benzo[a]pyrene exposure modulates MicroRNA expression patterns in the developing mouse embryo. Int. J. Cell Biol . 2012, 1– 11. Google Scholar CrossRef Search ADS   Brevik A., Lindeman B., Rusnakova V., Olsen A.-K., Brunborg G., Duale N. ( 2012). Paternal benzo[a]pyrene exposure affects gene expression in the early developing mouse embryo. Toxicol. Sci . 129, 157– 165. Google Scholar CrossRef Search ADS PubMed  Chaby L. E. ( 2016). Why are there lasting effects from exposure to stress during development? An analysis of current models of early stress. Physiol. Behav . 164, 164– 181. http://dx.doi.org/10.1016/j.physbeh.2016.05.032 Google Scholar CrossRef Search ADS PubMed  de Roos B., Duthie S. J., Polley A. C. J., Mulholland F., Bouwman F. G., Heim C., Rucklidge G. J., Johnson I. T., Mariman E. C., Daniel H., et al.   ( 2008). Proteomic methodological recommendations for studies involving human plasma, platelets, and peripheral blood mononuclear cells. J. Proteome Res . 7, 2280– 2290. Google Scholar CrossRef Search ADS PubMed  Delić D., Grosser C., Dkhil M., Al-Quraishy S., Wunderlich F. ( 2010). Testosterone-induced upregulation of miRNAs in the female mouse liver. Steroids  75, 998– 1004. Google Scholar CrossRef Search ADS PubMed  Dweep H., Gretz N. ( 2015). miRWalk2.0: A comprehensive atlas of microRNA-target interactions. Nat. Methods  12, 697–697. http://dx.doi.org/10.1038/nmeth.3485 Google Scholar CrossRef Search ADS   ESCODD (European Standards Committee on Oxidative DNA Damage). ( 2002). Comparative analysis of baseline 8-oxo-7, 8-dihydroguanine in mammalian cell DNA, by different methods in different laboratories: An approach to consensus. Carcinogenesis  23, 2129– 2133. CrossRef Search ADS PubMed  Filkowski J. N., Ilnytskyy Y., Tamminga J., Koturbash I., Golubov A., Bagnyukova T., Pogribny I. P., Kovalchuk O. ( 2010). Hypomethylation and genome instability in the germline of exposed parents and their progeny is associated with altered miRNA expression. Carcinogenesis  31, 1110– 1115. Google Scholar CrossRef Search ADS PubMed  Gapp K., Jawaid A., Sarkies P., Bohacek J., Pelczar P., Prados J., Farinelli L., Miska E., Mansuy I. M. ( 2014). Implication of sperm RNAs in transgenerational inheritance of the effects of early trauma in mice. Nat. Neurosci . 17, 667– 669. Google Scholar CrossRef Search ADS PubMed  Godschalk R. W. L., Verhofstad N., Verheijen M., Yauk C. L., Linschooten J. O., van Steeg H., van Oostrom C. T., van Benthem J., van Schooten F. J. ( 2015). Effects of benzo[a]pyrene on mouse germ cells: Heritable DNA mutation, testicular cell hypomethylation and their interaction with nucleotide excision repair. Toxicol. Res . 4, 718. Google Scholar CrossRef Search ADS   Gosker H. R., Schrauwen P., Broekhuizen R., Hesselink M. K. C., Moonen-Kornips E., Ward K. A., Schols A. M. W. J. ( 2006). Exercise training restores uncoupling protein-3 content in limb muscles of patients with chronic obstructive pulmonary disease. Endocrinol. Metab . 290, E976– E981. Gosker H. R., van Mameren H., van Dijk P. J., Engelen M. P. K. J., van der Vusse G. J., Wouters E. F. M., Schols A. M. W. J. ( 2002). Skeletal muscle fibre-type shifting and metabolic profile in patients with chronic obstructive pulmonary disease. Eur. Respir. J . 19, 617– 625. Google Scholar CrossRef Search ADS PubMed  Grandjean V., Gounon P., Wagner N., Martin L., Wagner K. D., Bernex F., Cuzin F., Rassoulzadegan M. ( 2009). The miR-124-Sox9 paramutation: RNA-mediated epigenetic control of embryonic and adult growth. Development  136, 3647– 3655. http://dx.doi.org/10.1242/dev.041061 Google Scholar CrossRef Search ADS PubMed  Halappanavar S., Wu D., Williams A., Kuo B., Godschalk R. W., Van Schooten F. J., Yauk C. L. ( 2011). Pulmonary gene and microRNA expression changes in mice exposed to benzo(a)pyrene by oral gavage. Toxicology  285, 133– 141. Google Scholar CrossRef Search ADS PubMed  Jin J.-C., Zhang X., Jin X.-L., Qian C.-S., Jiang H., Ruan Y. ( 2014). MicroRNA-122 regulation of the morphology and cytoarchitecture of hepatoma carcinoma cells. Mol. Med. Rep . 9, 1376– 1380. Google Scholar CrossRef Search ADS PubMed  Laubenthal J., Zlobinskaya O., Poterlowicz K., Baumgartner A., Gdula M. R., Fthenou E., Keramarou M., Hepworth S. J., Kleinjans J. C. S., van Schooten F.-J., et al.   ( 2012). Cigarette smoke-induced transgenerational alterations in genome stability in cord blood of human F1 offspring. FASEB J . 26, 3946– 3956. Google Scholar CrossRef Search ADS PubMed  Li J., Li Q., Xie C., Zhou H., Wang Y., Zhang N., Han J. ( 2004). actin is required for mitochondria clustering and ROS generation in TNF-induced, caspase-independent cell death. J. Cell Sci . 117, 4673– 4680. http://dx.doi.org/10.1242/jcs.01339 Google Scholar CrossRef Search ADS PubMed  Linschooten J. O., Laubenthal J., Cemeli E., Baumgartner A., Anderson D., Sipinen V. E., Brunborg G., Haenen G. R. M. M., Fthenou E., Briedé J. J., et al.   ( 2011). Incomplete protection of genetic integrity of mature spermatozoa against oxidative stress. Reprod. Toxicol . 32, 106– 111. Google Scholar CrossRef Search ADS PubMed  Linschooten J. O., Van Schooten F. J., Baumgartner A., Cemeli E., van Delft J., Anderson D., Godschalk R. W. L. ( 2009). Use of spermatozoal mRNA profiles to study gene–environment interactions in human germ cells. Mutat. Res. Fund. Mol. Mech. Mutagen . 667, 70– 76. Google Scholar CrossRef Search ADS   Maclary E., Buttigieg E., Hinten M., Gayen S., Harris C., Sarkar M. K., Purushothaman S., Kalantry S. ( 2014). Differentiation-dependent requirement of Tsix long non-coding RNA in imprinted X-chromosome inactivation. Nat. Commun . 5, e1002212. http://doi.org/10.1038/ncomms5209 Google Scholar CrossRef Search ADS   McPherson N. O., Fullston T., Aitken R. J., Lane M. ( 2014). Paternal obesity, interventions, and mechanistic pathways to impaired health in offspring. Ann. Nutr. Metab . 64, 231– 238. http://dx.doi.org/10.1159/000365026 Google Scholar CrossRef Search ADS PubMed  Moyes C. D., Battersby B. J., Leary S. C. ( 1998). Regulation of muscle mitochondrial design. J. Exp. Biol . 201(Pt 3), 299– 307. Nettle D., Bateson M. ( 2015). Adaptive developmental plasticity: What is it, how can we recognize it and when can it evolve? Proc. R. Soc. B Biol. Sci . 282, 20151005. http://dx.doi.org/10.1098/rspb.2015.1005 Google Scholar CrossRef Search ADS   Ng S.-F., Lin R. C. Y., Laybutt D. R., Barres R., Owens J. A., Morris M. J. ( 2010). Chronic high-fat diet in fathers programs β-cell dysfunction in female rat offspring. Nature  467, 963– 966. Google Scholar CrossRef Search ADS PubMed  Northstone K., Golding J., Davey Smith G., Miller L. L., Pembrey M. ( 2014). Prepubertal start of father’s smoking and increased body fat in his sons: Further characterisation of paternal transgenerational responses. Eur. J. Hum. Genet . 22, 1382– 1386. Google Scholar CrossRef Search ADS PubMed  Peluso M., Munnia A., Ceppi M., Giese R. W., Catelan D., Rusconi F., Godschalk R. W. L., Biggeri A. ( 2013). Malondialdehyde-deoxyguanosine and bulky DNA adducts in schoolchildren resident in the proximity of the Sarroch industrial estate on Sardinia Island, Italy. Mutagenesis  28, 315– 321. Google Scholar CrossRef Search ADS PubMed  Rando O. J. ( 2016). Intergenerational transfer of epigenetic information in sperm. Cold Spring Harb. Perspect. Med . 6, a022988. http://dx.doi.org/10.1101/cshperspect.a022988 Google Scholar CrossRef Search ADS PubMed  Rassoulzadegan M., Grandjean V., Gounon P., Vincent S., Gillot I., Cuzin F. ( 2006). RNA-mediated non-mendelian inheritance of an epigenetic change in the mouse. Nature  441, 469– 474. Google Scholar CrossRef Search ADS PubMed  Schmittgen T. D., Livak K. J. ( 2008). Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc . 3, 1101– 1108. http://dx.doi.org/10.1038/nprot.2008.73 Google Scholar CrossRef Search ADS PubMed  Shoubridge E. A., Wai T. ( 2007). Mitochondrial DNA and the mammalian oocyte. Curr. Top. Dev. Biol . 77, 87– 111. Google Scholar CrossRef Search ADS PubMed  Sipinen V., Laubenthal J., Baumgartner A., Cemeli E., Linschooten J. O., Godschalk R. W. L., Van Schooten F. J., Anderson D., Brunborg G. ( 2010). In vitro evaluation of baseline and induced DNA damage in human sperm exposed to benzo[a]pyrene or its metabolite benzo[a]pyrene-7, 8-diol-9, 10-epoxide, using the comet assay. Mutagenesis  25, 417– 425. Google Scholar CrossRef Search ADS PubMed  Straubinger K., Paul S., Prazeres da Costa O., Ritter M., Buch T., Busch D. H., Layland L. E., Prazeres da Costa C. U. ( 2014). Maternal immune response to helminth infection during pregnancy determines offspring susceptibility to allergic airway inflammation. J. Allergy Clin. Immunol . 134, 1271– 1279.e10. Google Scholar CrossRef Search ADS PubMed  Thundathil J., Filion F., Smith L. C. ( 2005). Molecular control of mitochondrial function in preimplantation mouse embryos. Mol. Reprod. Dev . 71, 405– 413. http://dx.doi.org/10.1002/mrd.20260 Google Scholar CrossRef Search ADS PubMed  van Helden Y. G. J., Keijer J., Heil S. G., Pico C., Palou A., Oliver P., Munnia A., Briede J. J., Peluso M., Franssen-van Hal N. L., et al.   ( 2009). Beta-carotene affects oxidative stress-related DNA damage in lung epithelial cells and in ferret lung. Carcinogenesis  30, 2070– 2076. Google Scholar CrossRef Search ADS PubMed  Vanhees K., Vonhögen I. G. C., van Schooten F. J., Godschalk R. W. L. ( 2014). You are what you eat, and so are your children: The impact of micronutrients on the epigenetic programming of offspring. Cell. Mol. Life Sci . 71, 271– 285. Google Scholar CrossRef Search ADS PubMed  Verhofstad N., van Oostrom C. T. M., van Benthem J., van Schooten F. J., van Steeg H., Godschalk R. W. L. ( 2010). DNA adduct kinetics in reproductive tissues of DNA repair proficient and deficient male mice after oral exposure to benzo(a)pyrene. Environ. Mol. Mutagen . 51, 123– 129. Google Scholar PubMed  Verhofstad N., van Oostrom C. T. M., Zwart E., Maas L. M., van Benthem J., van Schooten F. J., van Steeg H., Godschalk R. W. L. ( 2011). Evaluation of benzo(a)pyrene-induced gene mutations in male germ cells. Toxicol. Sci.  119, 218– 223. Google Scholar CrossRef Search ADS PubMed  Wagner K. D., Wagner N., Ghanbarian H., Grandjean V., Gounon P., Cuzin F., Rassoulzadegan M. ( 2008). RNA induction and inheritance of epigenetic cardiac hypertrophy in the mouse. Dev. Cell  14, 962– 969. Google Scholar CrossRef Search ADS PubMed  Wattez J. S., Delmont A., Bouvet M., Beseme O., Goers S., Delahaye F., Pinet F. ( 2015). Maternal perinatal undernutrition modifies lactose and serotranferrin in milk: Relevance to the programming of metabolic diseases? Am. J. Physiol. Endocrinol. Metab . 308, E393– E401. Google Scholar CrossRef Search ADS PubMed  Wells J. C. ( 2012). A critical appraisal of the predictive adaptive response hypothesis. Int. J. Epidemiol . 41, 229– 235. http://dx.doi.org/10.1093/ije/dyr239 Google Scholar CrossRef Search ADS PubMed  Williams R. S. ( 1986). Mitochondrial gene expression in mammalian striated muscle. Evidence that variation in gene dosage is the major regulatory event. J. Biol. Chem . 261, 12390– 12394. Google Scholar PubMed  © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Journal

Toxicological SciencesOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off