Novel environmental class 1 integrons and cassette arrays recovered from an on-farm bio-purification plant

Novel environmental class 1 integrons and cassette arrays recovered from an on-farm... Abstract Rapid dissemination and emergence of novel antibiotic resistance genes among bacteria are rising problems worldwide. Since their discovery in clinical isolates in the late 1980s, class 1 integrons have been found in a wide range of bacterial genera and have been extensively studied as contributors to dissemination of antibiotic resistance. The present study aimed to investigate the presence and structure of class 1 integrons in plasmid-carrying bacterial isolates obtained from a biopurification system used for decontamination of pesticide-contaminated water as well as their possible role as reservoir of antimicrobial resistance gene cassettes. A total of 35 representative isolates were screened for the presence of class 1 integron integrase encoded by intI1. PCR and DNA sequencing revealed the presence of six class 1 integrons with four variable regions: 5΄CS-aadA1b-3΄CS, 5΄CS-aadA2-3΄CS, 5΄CS-aadA11cΔ-3΄CS and 5΄CS-dfrB3-aadA1di-catB2-aadA6k-3΄CS, the last two being unseen arrays of antimicrobial resistance gene cassettes associated with novel environmental alleles of intI1. These four class 1 integrons were identified as being present in four different genera, including Ochrobactrum, and Variovorax, where class 1 integrons have not been previously reported. The results provide evidence of the biopurification systems as a tank of class 1 integron carrying strains and novel environmental class 1 integron integrases associated with antimicrobial resistance gene cassette arrays. integron, antimicrobial resistance, plasmid, biopurification system, lateral gene transfer, agriculture INTRODUCTION The overuse of antibiotics in both clinical and farming contexts has increased the spread of resistance determinants not only in clinical settings but also in the environment (Angebault and Andremont 2013; Fletcher 2015). While many studies have focused on the dissemination of antibiotic resistance genes (ARGs) in hospitals, some reports have recently described their spread in the environment (Allen et al.2010; Davies and Davies 2010; Nardelli et al.2012; Cantas et al.2013; von Wintersdorff et al.2016). There is evidence suggesting that clinical resistance genes have an environmental origin (Martínez 2012; Berendonk et al.2015; Berglund 2015) and even that some of them can also be captured by active environmental class 1 integron integrases (Chamosa et al.2017). The knowledge about the directionality of the flux of antimicrobial resistance genes between the environment and the clinic, and vice-versa (Gomez-Alvarez et al.2016) and the steps involved in the acquisition of novel ARGs from the open environment are interesting and active subjects of study. Mobile genetic elements (MGEs) enhance the transmission of ARGs between bacteria via lateral genetic transfer (de la Cruz and Davies 2000). The so called mobile integrons (MIs) and conjugative (i.e. self-transmissible) or mobilizable plasmids that can carry genes conferring resistance to one or more antibiotics are among the most studied and relevant MGEs in bacteria isolated from clinics. Integrons are genetic assembly platforms that allow the capture and expression of exogenous gene cassettes (Stokes et al.2006; Gillings 2014). Among MIs, class 1 integrons play a major role in the flow of ARG cassettes and antiseptic resistance determinants between pathogenic and non-pathogenic bacteria in clinical settings (Perry and Wright 2013; Gillings 2014). Although these integrons were first identified in clinical isolates, there is evidence proving that these platforms originated in natural (i.e. non-clinical) environments (Rowe-Magnus et al.2001; Mazel 2006). Class 1 integrons are linked to some environments with a certain degree of contamination (Gillings et al.2008; Nardelli et al.2012), and their presence has even been proposed as an indicator of anthropogenic pollution (Amos et al.2015; Gillings et al.2015). In the past years, researchers paid particular attention to the study of the presence and dissemination of class 1 integrons in non-antibiotic polluted environments (Rosser and Young 1999; Stokes et al.2006; Hardwick et al.2008; Gillings, Holley and Stokes 2009; Nardelli et al.2012; Koczura et al.2016), since it could help to understand the evolution of these elements as well as their role in the spread of antibiotic and antiseptic resistance determinants in nature. The molecular features of class 1 integrons as a genetic tool for studying the flux of antimicrobial resistance genes are based on the different alleles of intI1 found in both habitats, the clinic and the open environment, which led to the identification of sources of both ‘environmental’ and ‘clinical’ class 1 integrons (Gillings et al.2008). Based on this point of view, the type of allele of intI1 has been used as a marker to infer the directionality of the strains (Gillings et al.2008; Nardelli et al.2012; Gomez-Alvarez et al.2016). The success of class 1 integrons is mainly due to their mechanism for gene cassette acquisition and expression as well as to their frequent association with transposons and plasmids, which enhance their dissemination (Stokes et al.2006; Gillings et al.2008; Nardelli et al.2012). Plasmids are one of the most abundant and promiscuous MGEs and have been identified as the main vehicles for lateral gene transfer in bacteria via conjugation (Garcillán-Barcia, Francia and de La Cruz 2009; Harrison and Brockhurst 2012). It has been demonstrated that plasmids carrying diverse genes can be mobilized among bacteria, even those belonging to different phyla (Klümper et al.2015; Shintani, Sanchez, and Kimbara 2015). Recently, we isolated a collection of 35 plasmid-carrying bacteria from an on-farm biopurification system (BPS) used for the remediation of pesticide-contaminated waters in Kortrijk, Belgium (Martini et al.2015). These environmental isolates belong to 14 genera, including both Gram-negative and Gram-positive bacteria. In particular, this plasmid-carrying bacteria collection harbors more than 50 high molecular weight plasmids. Previous studies on this BPS have demonstrated the presence of class 1 integrons in a total DNA sample of this BPS community (Dealtry et al.2014b), and have described the bacterial community composition and the IncP-1 mobilome changes in response to linuron addition as well (Dealtry et al.2016; Nour et al.2017). BPSs receive pesticides at relatively high concentrations for extended periods of time that in consequence generate a strong and long-term selective pressure for the persistence and growth of pesticide-tolerant or -degrading bacteria (Sniegowski et al.2011). In an attempt to investigate the impact of selective pressures exerted by pesticides on bacteria carrying class 1 integrons in the BPS and their possible role as reservoirs of ARG cassettes, we firstly analyzed the presence of these elements and subsequently characterized the intI1 (‘clinical’ or ‘environmental’), along with the complete variable region of such integrons. MATERIALS AND METHODS Strains used in this study The bacterial isolates used in this study were previously obtained from a BPS used for pesticide removal from contaminated water located in Kortrijk, Belgium (Martini et al.2015) operational since 2008, and containing a biomix composed of agricultural soil (25 vol%), composted material (25 vol%) and straw mixed with stable manure originating from a nearby horse manege (50 vol%). The BPS was used for water contaminated with different types of pesticides (see Dealtry et al. 2014a) from spillage and residue water collected when cleaning the spraying equipment. The following pesticides were found by chemical analysis of the BPS samples: azoxystrobin, bentazone, diflufenican, diuron, epoxiconazole, ethofumesate, fenpropimorph, fluroxypyr, flufenacete, metamitron, metribuzine, propiconazole, S-metolachlor, tebuconazole and terbuthylazine (Dealtry et al.2014a). The measurements of these pesticides were previously performed (Monkiedje et al.2007; Sukul et al.2010). In addition to the pesticides detected in the BPS, a previous study reported the application of several other active pesticide compounds to the BPS (Dealtry et al.2014a). More than of 1400 isolates obtained from the BPS (Martini et al.2015) were screened by the in situ lysis assay (Eckhardt 1978) to investigate their plasmid content. A total of 75 plasmid-containing bacteria were identified. The in situ lysis technique allowed the classification of the isolates in 35 representative groups, according to their plasmid profiles (i.e. plasmid number and plasmid size). The 35 representative isolates, that comprised at least 50 high molecular weight plasmids, were further characterized. The isolates presented different tolerance profiles to several antibiotics and metals tested (for more details, see Martini et al.2015). Bacteria were grown on LB medium at 28°C. The strain Proteus mirabilis PR9 containing a complex class 1 integron (Arduino et al.2002) was used as a positive control for intI1, qacE/qacEΔ1, sul1 and ISCR1 genes in PCR. Molecular analysis Total DNA from each isolate was extracted and used for PCR amplifications. For regular size amplifications (up to 2 Kb), PCR was carried out using 1X PCR buffer (50 mM KCl, 20 mM Tris-HCl, pH 8.0), 200 μM dNTP, 3 mM MgCl2, 2 μl DNA template and 1 U T-free DNA polymerase (Inbio-Highway, Tandil, Argentina). For amplification of large fragments (variable regions of integrons), LongAmp DNA polymerase from New England Biolabs (Massachusetts, United States) was used. PCR was performed as follows: an initial denaturation step at 94°C for 4 min, followed by 35 cycles of denaturation at 94°C for 20 s, annealing at 50°C –60°C (depending on the primers used; see Table 1 for references) for 30 s and extension at 65°C for LongAmp polymerase or 72°C for Taq polymerase (1 min per 1Kb of DNA). Then, a final extension at 65°C /72°C for 10 min was used. Table 1. Primers used in this study. Primer name  Target  Primer sequence  Amplicon size (bp)  Reference  5΄and 3΄conserved genes  int1FP  intI1  gggtcaaggatctggatttcg  483  Mazel et al.2000  int1FR    acatgcgtgtaaatcatcgtcg    Mazel et al.2000  Inti1F  intI1  cgaggcatagactgtac  925  Quiroga et al. (2007)  Inti1R    ttcgaatgtcgtaaccgc    Quiroga et al. (2007)  Orf513F  ISCR1  atggtttcatgcgggtt  474  Arduino et al. (2003)  Orf513R    ctgagggtgtgagcgag    Orman et al. (2002)  Sul1 lower  sul1  tttgaaggttcgacagc  580  Barbolla et al. (2004)  Sul1 upper    gacggtgttcggcattct    Barbolla et al. (2004)  QaceR  qacE/ qacEΔ1  gcgaagtaatcgcaacatcc  240  Arduino et al. (2003)  QaceF    agccccatacctacaaagcc    Arduino et al. (2003)  Variable regions  sulpro3    gcctgacgatgcgtgga  Variable  Lévesque et al. (1995)  qacEDelta1B    gcgataacaagaaaaagcc    Quiroga et al. (2013)  Primer name  Target  Primer sequence  Amplicon size (bp)  Reference  5΄and 3΄conserved genes  int1FP  intI1  gggtcaaggatctggatttcg  483  Mazel et al.2000  int1FR    acatgcgtgtaaatcatcgtcg    Mazel et al.2000  Inti1F  intI1  cgaggcatagactgtac  925  Quiroga et al. (2007)  Inti1R    ttcgaatgtcgtaaccgc    Quiroga et al. (2007)  Orf513F  ISCR1  atggtttcatgcgggtt  474  Arduino et al. (2003)  Orf513R    ctgagggtgtgagcgag    Orman et al. (2002)  Sul1 lower  sul1  tttgaaggttcgacagc  580  Barbolla et al. (2004)  Sul1 upper    gacggtgttcggcattct    Barbolla et al. (2004)  QaceR  qacE/ qacEΔ1  gcgaagtaatcgcaacatcc  240  Arduino et al. (2003)  QaceF    agccccatacctacaaagcc    Arduino et al. (2003)  Variable regions  sulpro3    gcctgacgatgcgtgga  Variable  Lévesque et al. (1995)  qacEDelta1B    gcgataacaagaaaaagcc    Quiroga et al. (2013)  View Large For the detection of the intI1 alleles, two strategies were used by amplifying a PCR fragment of 925 bp (representing the whole gene) and another of 483 bp that included the additional motif that it is conserved among integron integrases (Messier and Roy 2001; Gravel et al.1998; Nield et al.2001). Variable regions of class 1 integrons were analyzed in positive intI1 strains by PCR and sequencing reactions with sulpro3 and qacEDelta1B primers (Table 1). Primers for PCR amplification of genetic determinants ISCR1, qacE/qacEΔ1 and sul1 are also listed in Table 1. Amplicon sequencing, assembly and analysis In order to identify the amplified DNA fragments, PCR products were purified using AccuPrep PCR Purification Kit (Bioneer, Daejeaon, Korea) and were then sequenced at Macrogen (Korea) following standard procedures. The resulting sequences were compared with those found in the GenBank database for identity assignment. Contig Express (Invitrogen, Carlsbad, USA) was used for sequence assembly. A function prediction was computed using standard bioinformatic tools such as Blast V2.0 software (http://www.ncbi.nlm.nih.gov/BLAST/). Protein identity values were determined using BLASTp. Based on sequence analysis, the completeness of the integron sequence was established. Genetic localization of identified integrons In situ lysis gel electrophoresis was performed to obtain further information on the genomic location of class 1 integrons by analyzing the DNA of the bands corresponding to plasmid(s) or chromosome, as described by Martini et al. (2015). The visualized bands were purified using the AccuPrep Gel Purification Kit (Bioneer, Daejeon, Korea). Then, a PCR for the 483 bp intI1 fragment was carried out using the purified samples. In order to exclude the amplification of contaminating DNA, several controls were included in the PCR with DNA recovered from randomly selected positions of the agarose gel. Nucleotide sequence accession numbers Integrons were manually curated and genes were annotated using the best BLASTp hit at National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih.gov/). The nucleotide sequences of the complete class 1 integrons described in this work were deposited at GenBank as accession numbers KY047413- KY047415 and KY047417. The two novel integron arrangements were submitted to the INTEGRALL database as In1368 and In1369 (http://integrall.bio.ua.pt). RESULTS Class 1 integrons were found in different genera To determine if class 1 integrons were present in the plasmid-carrying bacteria studied from the BPS system, the amplification of a 483 bp fragment of intI1 was performed by PCR (Table 1); in order to analyze the variants of the intI1 alleles, the 925 bp amplification product obtained with primers Inti1F and Inti1R was sequenced. Six out of the 35 analyzed isolates (see Table 2 for taxonomic classification) were positive for intI1, indicating a high frequency (17%) of this element in the BPS bacterial collection in comparison to those obtained in previous studies (Stokes et al.2006; Rosewarne et al.2010; Nardelli et al. 2012). Interestingly, besides Pseudomonas spp. (two isolates) and Alcaligenes sp., the intI1 was found in genera such as Ochrobactrum and Microbacterium as well as in Variovorax, where they have not been described previously. This finding represents one more piece of evidence of how class 1 integrons successfully disseminate among genomes and habitats. Table 2. Presence of the intI1 and class 1 integron-related genetic determinants in the studied isolates. Since qacE and sul1 can occur independently of integrons, the amplicons obtained for Sulpro3/QaceF and QaceR/Sul1 lower were sequenced, confirming that both genetic determinants are linked to the class 1 integrons in the isolates studied. ªTruncated intI1. NC: not corresponds. Isolate  Taxonomic class  intI1  qacE/qacEΔ1  sul1  Sulpro3/QaceF  QaceR/Sul1 lower  ISCR1  BF02  Ochrobactrum sp.  α-proteobacteria  +  +  +  +  +  –  BF13  Ochrobactrum sp.  α-proteobacteria  –  –  –  NC  NC  –  BF14  Cellulosimicrobium cellulans  Actinobacteria  –  –  –  NC  NC  –  BF15  Ochrobactrum sp.  α-proteobacteria  –  –  –  NC  NC  –  BF19  Variovorax sp.  β-proteobacteria  +(a)  +  +  +  +  –  BF21  Paenibacillus sp.  Bacilli  –  –  +  NC  NC  –  BF22  Paenibacillus tundrae  Bacilli  –  –  +  NC  NC  –  BF25  Pseudomonas putida  γ-proteobacteria  +  +  +  +  +  –  BF27  Pseudomonas sp.  γ-proteobacteria  +  +  +  +  +  –  BF28  Paenibacillus xylanexedens  Bacilli  –  –  +  NC  NC  –  BF30  Bordetella sp.  β-proteobacteria  –  –  –  NC  NC  –  BF31  Cellulosimicrobium sp.  Actinobacteria  –  +  –  NC  NC  –  BF33  Pseudomonas putida  γ-proteobacteria  –  –  –  NC  NC  –  BF36  Microbacterium sp.  Actinobacteria  –  –  –  NC  NC  –  BF37  Serratia sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF42  Alcaligenes sp.  β-proteobacteria  +  +  +  +  +  –  BF43  Serratia sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF44  Microbacterium oxydans  Actinobacteria  +  +  +  +  +  –  BF46  Serratia sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF48  Microbacterium sp.  Actinobacteria  –  +  +  NC  NC  –  BF52  Brevibacterium sp.  Actinobacteria  –  –  –  NC  NC  –  BF53  Agromyces cerinus  Actinobacteria  –  –  –  NC  NC  –  BF55  Pseudomonas putida  γ-proteobacteria  –  +  –  NC  NC  –  BF56  Acinetobacter sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF58  Pseudomonas sp.  γ-proteobacteria  –  –  +  NC  NC  –  BF59  Sphingobacterium sp.  Sphingobacteria  –  –  –  NC  NC  –  BF60  Sphingobacterium sp.  Sphingobacteria  –  –  +  NC  NC  –  BF61  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF62  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF67  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF68  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF70  Bacillus pumilus  Bacilli  –  –  –  NC  NC  –  BF71  Bacillus sp.  Bacilli  –  –  –  NC  NC  –  BF73  Bacillus megaterium  Bacilli  –  –  –  NC  NC  –  BF75  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  Isolate  Taxonomic class  intI1  qacE/qacEΔ1  sul1  Sulpro3/QaceF  QaceR/Sul1 lower  ISCR1  BF02  Ochrobactrum sp.  α-proteobacteria  +  +  +  +  +  –  BF13  Ochrobactrum sp.  α-proteobacteria  –  –  –  NC  NC  –  BF14  Cellulosimicrobium cellulans  Actinobacteria  –  –  –  NC  NC  –  BF15  Ochrobactrum sp.  α-proteobacteria  –  –  –  NC  NC  –  BF19  Variovorax sp.  β-proteobacteria  +(a)  +  +  +  +  –  BF21  Paenibacillus sp.  Bacilli  –  –  +  NC  NC  –  BF22  Paenibacillus tundrae  Bacilli  –  –  +  NC  NC  –  BF25  Pseudomonas putida  γ-proteobacteria  +  +  +  +  +  –  BF27  Pseudomonas sp.  γ-proteobacteria  +  +  +  +  +  –  BF28  Paenibacillus xylanexedens  Bacilli  –  –  +  NC  NC  –  BF30  Bordetella sp.  β-proteobacteria  –  –  –  NC  NC  –  BF31  Cellulosimicrobium sp.  Actinobacteria  –  +  –  NC  NC  –  BF33  Pseudomonas putida  γ-proteobacteria  –  –  –  NC  NC  –  BF36  Microbacterium sp.  Actinobacteria  –  –  –  NC  NC  –  BF37  Serratia sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF42  Alcaligenes sp.  β-proteobacteria  +  +  +  +  +  –  BF43  Serratia sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF44  Microbacterium oxydans  Actinobacteria  +  +  +  +  +  –  BF46  Serratia sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF48  Microbacterium sp.  Actinobacteria  –  +  +  NC  NC  –  BF52  Brevibacterium sp.  Actinobacteria  –  –  –  NC  NC  –  BF53  Agromyces cerinus  Actinobacteria  –  –  –  NC  NC  –  BF55  Pseudomonas putida  γ-proteobacteria  –  +  –  NC  NC  –  BF56  Acinetobacter sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF58  Pseudomonas sp.  γ-proteobacteria  –  –  +  NC  NC  –  BF59  Sphingobacterium sp.  Sphingobacteria  –  –  –  NC  NC  –  BF60  Sphingobacterium sp.  Sphingobacteria  –  –  +  NC  NC  –  BF61  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF62  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF67  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF68  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF70  Bacillus pumilus  Bacilli  –  –  –  NC  NC  –  BF71  Bacillus sp.  Bacilli  –  –  –  NC  NC  –  BF73  Bacillus megaterium  Bacilli  –  –  –  NC  NC  –  BF75  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  View Large ‘Clinical’ and novel ‘environmental’ alleles of intI1 were detected in the plasmid-carrying bacteria A 925 bp fragment of intI1 (Table 1) was found by PCR in all isolates with the exception of Variovorax sp. BF19, where no PCR product was obtained with these primers but it was positive the amplification of 483 bp. This result suggests the presence of a truncated intI1 in this isolate as previously described in other environmental samples (Nardelli et al.2012). Complete sequence of the intI1 was identified in Alphaproteobacteria, Betaproteobacteria and Actinobacteria. Five sequenced intI1 belonged to two different alleles, a ‘clinical’ one and a novel ‘environmental’ allele that presented differences in two nucleotide positions (see alignment in Fig. S1, Supporting Information). The ‘clinical’ intI1 allele (AF313471) was identified in BF25 and BF27 isolates which belonged to Pseudomonas. This allele had been previously found in other Gram-negative pathogenic bacteria such as Escherichia coli, Klebsiella pneumoniae, Shigella dysenteriae and Aeromonas salmonicida (accession numbers KU043115, CP018819, KX646543, KX364409, respectively). In turn, the novel ‘environmental’ intI1 allele was identified in the present study for the first time in Ochrobactrum and Microbacterium genus. Novel variable regions of class 1 integrons were found To identify the variable region of class 1 integrons found in the six isolates, total DNA from each strain was PCR-amplified by using standard primers (see Table 1) and sequenced. As deduced from the sequences, four different gene cassette arrangements were found in the variable region of the six isolates: 5’CS-aadA11cΔ-3’CS, 5’CS-aadA1b-3’CS, 5’CS-aadA2-3’CS and 5’CS-dfrB3-aadA1di-catB2-aadA6k-3’CS (Fig. 1). Interestingly, the bioinformatic analysis of the gene cassette sequences revealed the presence of unique ARG cassette arrangements within the variable region, which were named In1368 and In1369 in INTEGRALL http://integrall.bio.ua.pt/ (Fig. 1). The remaining gene cassette arrangements were the already described 5’CS-aadA1b-3’CS (In93) and 5’CS-aadA2-3’CS (In127), with the same gene cassette alleles identified in the reference sequences AN: CP000645 and EU089667, respectively (http://integrall.bio.ua.pt/; Fig. 1). Class 1 integrons identified in Ochrobactrum sp. BF02, Variovorax sp. BF19, Pseudomonas putida BF25 and Pseudomonas spp. BF27 isolates contained each a single gene cassette related to the aadA1 gene cassette family, with 92% (In1369, AN: KY047413), 99% (In93, AN: KY047414) and 89% identity (In127, AN: KY047415 and KY047416) with the reference aadA1a from In2 (AN: AF071413), while class 1 integrons from Alcaligenes sp. BF42 and Microbacterium oxydans BF44 contained 5’CS-dfrB3-aadA1di-catB2-aadA6k-3’CS (In1369, AN: KY047417 and KY047418, respectively), the same novel arrangement of ARG cassette (Fig. 1). This latter arrangement harbors two different aadA variants, the catB2 gene cassette that encodes for chloramphenicol acetyltransferase previously described in Tn2424 (Parent and Roy 1992), and the dfrB3 gene cassette that encodes for a dihydrofolate reductase previously found in class 1 integrons that mediate antibiotic resistance in the fish pathogen Aeromonas salmonicida worldwide, and also in multiresistant Enterobacteriaceae isolates from Bogota hospitals (accession numbers AF327729 and GQ150744, respectively). The first aadA variant in In1369 shows 99% identity with aadA1a, with three point mutations GAC→AAC, AAA→AGA and GTC→GTT at positions 205, 602 and 750, respectively. The first two codify for D69N and K149R, respectively, but the third one is a silent mutation. Following the nomenclature currently accepted (Novick et al.1976; Partridge et al.2009; INTEGRALL) and due to the high number of aadA1 variants, a double-letter suffix is assigned to correctly identify the new ones (e.g. aadA1a … aadA1z, aadA1aa … aadA1az, aadA1ba, etc.); which in the case described above, the mutations lead to a new variant called aadA1di. The second aadA variant in this integron is aadA6k, with 99% identity to aadA6 from In51 (AN: AF140629.1). It shows two point mutations, GAT→AAT and GAA→GAG at positions 175 and 243, respectively. The first mutation codifies for D59N and the second is silent. Sequence analysis of the other novel class 1 integron (In1368, AN: KY047413) showed maximal nucleotide identity (99%) with aadA11c (In720 AN: JN894689). The variant present in In1369 shows two point mutations, the insertion of a C and an A at positions 610 and 775, respectively. The first mutation is silent for the specific codon (CCG→CCC that codifies for a proline at position 204), but generates a frameshift leading to a change in the remaining 21 amino acids codified plus a premature stop codon that truncates the last 38 amino acids of the resulting protein. This last characteristic is highlighted by the Δ suffix in the aadA11cΔ variant present in this integron. Figure 1. View largeDownload slide Schematic representation of regions surrounding class 1 integrons detected among the bacterial pool analyzed in the present study. (A) Representation of the typical structure of a class 1 integron. (B) Structure of the four integrons described in this study. VR: variable region. Figure 1. View largeDownload slide Schematic representation of regions surrounding class 1 integrons detected among the bacterial pool analyzed in the present study. (A) Representation of the typical structure of a class 1 integron. (B) Structure of the four integrons described in this study. VR: variable region. Localization of integrons in bacterial genomes Class 1 integrons correspond to functional platforms that are physically associated with mobile DNA elements as transposons which in turn can be carried by conjugative plasmids. Determination of the chromosomal or plasmid location of class 1 integrons was performed by PCR using intI1 as a marker gene and DNA recovered from plasmids or chromosome, obtained as mentioned in Materials and Methods. Class 1 integrons were found in plasmids of five out of six isolates (Ochrobactrum sp. BF02, P. putida BF25, Pseudomonas sp. BF27, Alcaligenes sp. BF42 and M. oxydans BF44), while in Variovorax sp. BF19, the integron was located on the bacterial chromosome (data not shown). This is the first report of a class 1 integron in the Variovorax genus, although a chromosome-located class 1 integron has been previously reported in Acidovorax (Stokes et al.2006) and in Comamonas testosteroni (AN: NC_013446.1), two genera belonging to the same family as Variovorax (Comamonadaceae). In the case of the Variovorax BF19 isolate, the IntI1 was truncated in the N-terminal domain, thus suggesting a lack of recombinational activity. On the other hand, the intI1 found in plasmids of the other five isolates was probably complete (944 bp in length). Independent spread of qacE/qacEΔ1 and sul1 genes in the BPS The incidence of ISCR1, sul1 and qacE/qacEΔ1 genes, usually associated with class 1 integrons, was investigated in our plasmid-containing isolate collection. Identification of ISCR1, which is a marker for complex class 1 integrons (Quiroga et al.2013), was performed with conventional primers (see Table 2). The qacE/qacEΔ1 gene confers resistance towards multiple chemical classes of biocides, including quaternary ammonium compounds, biguanides, acridines, diamidines, xanthenes and phenanthridines, while sul1 confers resistance to sulphonamides. In addition to the six class 1 integron-containing isolates, another three and six isolates resulted positive for sul1 and qacE/qacEΔ1, respectively, in the collection (Table 2). Consistent with the findings from previous studies (Wang et al.2007; Nardelli et al.2012; Hoa et al.2008; Wu et al.2010), sul1 and qacE/qacEΔ1 spread independently of class 1 integrons among bacterial genomes in the BPS bacterial community as well as in a variety of bacterial habitats. DISCUSSION In this work, novel environmental class 1 integrons were found spread in a collection of plasmid-carrying bacteria belonging to different genera from an on-farm BPS, a useful device of environmental and agricultural interest. As reported by Dealtry et al. (2016), the BPS in Kortrijk, Belgium, is a system that was set up in 2008 and treats about 15,000 liters of pesticide-contaminated water annually. The biomix of the BPS contains soil and manure (straw and animal feces). The influent water is contaminated with a broad variety of pesticides. No data are available on the actual amount and composition of the different pesticides in the influent water but approximately 70 different pesticides, mainly herbicides were added to the BPS with contaminated water. An overview of the pesticides detectable in BPS material was provided previously by Dealtry et al. (2014a) and Holmsgaard et al. (2017). The analysis of both allelic variants of intI1 and ARG cassettes within their corresponding variable regions has been recognized as a useful tool for understanding the capture and transit of antimicrobial resistance determinants from the environment by human anthropogenic habitats. It is accepted that antimicrobial resistance determinants found in clinical isolates come from extra clinical environments (Davies and Davies 2010; Cantas et al.2013; Berglund 2015; von Wintersdorff et al.2016). In this regard, class 1 integrons both play a major role in adaptation in clinically relevant bacteria and are not limited to clinical settings, thus representing an adequate model system to evaluate the flow of antimicrobial resistance determinants (Álvarez et al.2016; Gomez-Alvarez et al.2016; Chamosa et al.2017). While it is known that these elements are more prevalent in bacteria that live in niches under antibiotic pressure, the distribution of class 1 integrons has been studied in different environments (Rosser and Young 1999; Nandi et al.2004; Nemergut, Martin and Schmidt 2004; Gaze et al.2005; Gillings 2017). There is increasing evidence proving that these elements are highly distributed outside the clinic, even in environments with a low human impact (Hardwick et al.2008; Wright et al.2008; Gaze et al.2011; Nardelli et al.2012. Jones-Dias et al. 2016; Chamosa et al2017; Gillings 2017). Class 1 integrons have been shown to be involved in the process of swapping genetic material and in the spread of antibiotic resistance genes in environmental bacteria (Stalder et al.2012; Alvarez et al.2016; Chamosa et al.2017). In this regard, class 1 integrons played an important role in the diversification of the broad-host range plasmids belonging to the IncP-1ε group as previously shown by Heuer et al. (2012). In addition, IncP1ε plasmids are important vectors for horizontal transfer of antibiotic resistance in manure slurries and in agricultural soils. Among the analyzed isolates Alcaligenes sp. BF42 carries an IncP-1 plasmid and Pseudomonas putida BF25 carries an IncP-7 plasmid (Martini et al.2015), these types of plasmids have previously been found to be abundantly present in pesticide-polluted environments (Dunon et al.2013; Jechalke et al.2013). Moreover, previous reports have shown the BPS as a ‘hot spot’ for these type of plasmids (Dealtry et al.2014a). Little is known concerning how novel ARG cassettes within integrons and/or novel alleles of intI1 are selected in clinical samples. The study of integrons presence and structures in diverse environments is an important challenge. Since scarce attention has been paid to pesticide-amended agricultural environments, and the few reported studies have been limited to investigate the sole presence of class 1 integrons but not their structure and composition (Jechalke et al.2014; Dealtry et al.2014b), this work represents the first study showing a detailed bioinformatics-based analysis of class 1 integrons in this type of environment. The analysis based on the detection of intI1 and subsequent flanking sequences revealed the presence of four class 1 integrons in six out of the 35 isolates analyzed. Each one of these four class 1 integrons harbors at least one aadA-like gene cassette. These results are in agreement with two previous reports (Jechalke et al.2014; Dealtry et al.2014b) that identified the presence of intI1 as well as aadA-like gene cassettes by using total DNA from a BPS biomix sample exposed to different pesticides. None of these studies, however, aimed at investigating either the alleles of such genes or the type of intI1 allele. The finding of four class 1 integrons (In93, In127, In1368 and In1369) and six ARG cassettes in our plasmid-containing bacterial isolates indicates that not only aadA-like gene cassettes but indeed a variety of AGR cassettes in different arrangements can be present in the BPS bacterial communities. The finding of four aadA alleles in our bacteria collection also highlights the possible role of the BPS as reservoirs related to aadA-like genes. It would be interesting to investigate whether the function conferred by the aadA family of genes which encodes an aminoglycoside-3΄-adenylyltransferase that confers resistance to streptomycin and spectinomycin by adenylation is involved in some processes inherent to the rates of sorption or biodegradation in the on-farm BPS. One point that deserves to be underlined is the finding of class 1 integron In1369 in the Gram-positive Microbacterium oxydans BF44 isolate. Only a few class 1 integrons have been reported in Gram-positive bacterial genera, including Corynebacterium, Streptococcus, Enterococcus, Staphylococcus, Aerococcus and Brevibacterium (Deng et al.2015). Interestingly, the same class 1 integron In1369 was also found in Alcaligenes spp. BF42 in the present study, an event that is likely the result of lateral antimicrobial resistance genetic transfer among Gram-negative and Gram-positive strains, indicating how active can the transfer of DNA be even among non-related taxa. Since only the truncated intI1 in Variovorax BF19 was found located on the chromosome, probably plasmids from the environment are playing a significant role in the dissemination of complete intI1, as evidenced in this study. Both types of clinical and environmental alleles of the intI1 were detected in our plasmid-carrying bacteria collection. The class 1 integron In29 bearing a same ‘clinical’ allele (AF313471) was identified in the strains BF025 and BF27 which probably belonged to two different species of the genus Pseudomonas, evidencing another lateral antimicrobial resistance genetic transfer event in the BPS system. Both Pseudomonas isolates have not only the same ‘clinical’ allele, but also they carry the aadA2 gene cassette with the typical 3΄-CS which is usually found in clinical samples suggesting that probably come nosocomial samples or from human or animal microbiota. The finding of the novel ‘environmental’ intI1 allele for the first time in Ochrobactrum, Alcaligenes and Microbacterium genus harboring different variable regions (Fig. 1) evidence how the resistome works in several steps: novel ‘environmental’ intI1 alleles spread among non-clinical strains (as in Ochrobactrum, Alcaligenes or Microbacterium from this work), until they are selected and maintained in a particular habitat (such as the BPS), where again they can disseminate among different species (certainly among Ochrobactrum, Alcaligenes and Microbacterium in the BPS from this work). From the time when two arrays of ARG cassettes were found associated with the novel intI1 allele, it is likely that the rearrangement of ARG cassettes occurred in the BPS. In addition, considering that these novel ‘environmental’ intI1 alleles are associated with ARG cassettes in the variable region, it can be supposed that these variants of class 1 integrons could be later disseminated to clinical habitats. On the other hand, since In1368 and In1369 possess the typical 3΄-CS, it can be also presumed that part of the integron come from clinical samples released into the environment, where in turn it has picked up an uncommon aadA gene cassette, followed by some form of rearrangement that lead to the finding of a novel intI1 allele. Whatever the events that led to the formation of these new integrons, the fact is that the environment is polluted with clinical integrons. These findings show BPSs as potential reservoirs of novel-class 1 ARG cassette-containing integrons. Interestingly, integrons that are contaminating the inputs for the BPS appear to be undergoing further change in the BPS: acquisition and swapping of ARG cassettes, movement of integrons between different genera and movement of ARG cassettes into chromosomal class 1 integrons. In addition, the incidence of intI1 in bacterial isolates from the BPS was relatively high (17%) in comparison with previous works analyzing non-clinical settings (Rosewarne et al.2010; Nardelli et al.2012). Future studies on deeper bacterial DNA sequencing or a complete metagenomic sequencing analysis will probably help to better understand and predict the roles of different bacterial and plasmids groups in the potential of integrons dissemination and on the pesticides biodegradation processes in the BPS. SUPPLEMENTARY DATA Supplementary data are available at FEMSEC online. Acknowledgements The authors are grateful to Paula Giménez and Silvana Tongiani for excellent technical assistance. Author contributions: All authors listed, have made substantial, direct and intellectual contribution to the work, and approved it for publication. DC and MD conceived the study, and supervised conduct of the trial. AL, MP and MM supervised the data collection. MM and MD drafted the manuscript. MQ and DC contributed substantially to the revision. FUNDING This work was supported by the National Scientific and Technical Research Council of Argentina (Consejo Nacional de Investigaciones Científicas y Técnicas—CONICET, Argentina) [PIP2015-0700] and the Ministry of Science, Technology and Productive Innovation (Ministerio de Ciencia, Tecnolología e Innovación Productiva—MinCyT, Argentina) [PICT2012-102 and PICT2012-0014] and partly by the European Commission's 7th Framework Programme (grant number: MetaExplore 222625). MM was supported by fellowships from CONICET. MP, AL, MQ, DC and MD are researchers at CONICET. Conflict of interest. None declared. REFERENCES Álvarez VE, Quiroga MP, Castro GA et al.   Molecular ecology of Class 1 Integrons in Patagonia as model system for understanding the rise of antibiotic resistance isolates around the world. In: Olivera NL, Libkind D, Donati E (eds). Biology and Biotechnology of Patagonian Microorganisms . Springer, 2016, 111– 25. Google Scholar CrossRef Search ADS   Allen HK, Donato J, Wang HH et al.   Call of the wild: antibiotic resistance genes in natural environments. Nat Rev Microbiol  2010; 8: 251– 9. Google Scholar CrossRef Search ADS PubMed  Amos GCA, Gozzard E, Carter CE et al.   Validated predictive modelling of the environmental resistome. ISME J  2015; 9: 1467– 76. Google Scholar CrossRef Search ADS PubMed  Angebault C, Andremont A. Antimicrobial agent exposure and the emergence and spread of resistant microorganisms: issues associated with study design. Eur J Clin Microbiol  2013; 32: 581– 95. Google Scholar CrossRef Search ADS   Arduino SM, Roy PH, Jacoby GA et al.   blaCTX-M-2 is located in an unusual class 1 integron (In35) which includes Orf513. Antimicrob Agents Ch  2002; 46: 2303– 6. Google Scholar CrossRef Search ADS   Arduino SM, Catalano M, Orman BE et al.   Molecular epidemiology of orf513-bearing class 1 integrons in multiresistant clinical isolates from Argentinean hospitals. Antimicrob Agents Chemother  2003; 47: 3945– 9. Google Scholar CrossRef Search ADS PubMed  Barbolla R, Catalano M, Orman BE et al.   Class 1 integrons increase trimethoprim-sulfamethoxazole MICs against epidemiologically unrelated Stenotrophomonas maltophilia isolates. Antimicrob Agents Chemother  2004; 48: 666– 9 Google Scholar CrossRef Search ADS PubMed  Berendonk TU, Manaia CM, Merlin C et al.   Tackling antibiotic resistance: the environmental framework. Nat Rev Microbiol  2015; 13: 310– 17. Berglund B. Environmental dissemination of antibiotic resistance genes and correlation to anthropogenic contamination with antibiotics. Infect Ecol Epidemiol  2015; 5: 28564. Google Scholar CrossRef Search ADS PubMed  Cantas L, Shah SQA, Cavaco LM et al.   A brief multi-disciplinary review on antimicrobial resistance in medicine and its linkage to the global environmental microbiota. Front Microbiol  2013; 4, DOI: https://doi.org/10.3389/fmicb.2013.00096. Chamosa LS, Álvarez VE, Nardelli M et al.   Lateral Antimicrobial Resistance Genetic Transfer is active in the open environment. Sci Rep  2017; 7: 513. Google Scholar CrossRef Search ADS PubMed  Davies J, Davies D. Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev  2010; 74: 417– 33. Google Scholar CrossRef Search ADS PubMed  Dealtry S, Ding G-C, Weichelt V et al.   Cultivation-independent screening revealed hot spots of IncP-1, IncP-7 and IncP-9 plasmid occurrence in different environmental habitats. PLoS One  2014a; 9: e89922. Google Scholar CrossRef Search ADS   Dealtry S, Holmsgaard PN, Dunon V et al.   Shifts in abundance and diversity of mobile genetic elements after the introduction of diverse pesticides into an on-farm biopurification system over the course of a year. Appl Environ Microb  2014b; 80: 4012– 20. Google Scholar CrossRef Search ADS   Dealtry S, Nour EH, Holmsgaard PN et al.   Exploring the complex response to linuron of bacterial communities from biopurification systems by means of cultivation-independent methods. FEMS Microbiol Ecol  2016; 92, DOI: https://doi.org/10.1093/femsec/fiv157. de la Cruz F, Davies J. Horizontal gene transfer and the origin of species: lessons from bacteria. Trends Microbiol  2000; 8: 128– 33. Google Scholar CrossRef Search ADS PubMed  Deng Y, Bao X, Ji L et al.   Resistance integrons: class 1, 2 and 3 integrons. Ann Clin Microb Anti  2015; 14: 45. Google Scholar CrossRef Search ADS   Dunon V, Sniegowski K, Bers K et al.   High prevalence of IncP-1 plasmids and IS1071 insertion sequences in on-farm biopurification systems and other pesticide-polluted environments. FEMS Microbiol Ecol  2013; 86: 415– 31. Google Scholar CrossRef Search ADS PubMed  Eckhardt T. A rapid method for the identification of plasmid deoxyribonucleic acid in bacteria. Plasmid  1978; 1: 584– 588. Google Scholar CrossRef Search ADS PubMed  Fletcher S. Understanding the contribution of environmental factors in the spread of antimicrobial resistance. Environ Health Prev  2015; 20: 243– 52. Google Scholar CrossRef Search ADS   Garcillán-Barcia MP, Francia MV, de La Cruz F. The diversity of conjugative relaxases and its application in plasmid classification. FEMS Microbiol Rev  2009; 33: 657– 87. Google Scholar CrossRef Search ADS PubMed  Gaze WH, Abdouslam N, Hawkey PM et al.   Incidence of class 1 integrons in a quaternary ammonium compound-polluted environment. Antimicrob Agents Ch  2005; 49: 1802– 7. Google Scholar CrossRef Search ADS   Gaze WH, Zhang L, Abdouslam NA et al.   Impacts of anthropogenic activity on the ecology of class 1 integrons and integron-associated genes in the environment. ISME J  2011; 5: 1253– 61. Google Scholar CrossRef Search ADS PubMed  Gillings M, Boucher Y, Labbate M et al.   The evolution of class 1 integrons and the rise of antibiotic resistance. J Bacteriol  2008; 190: 5095– 100. Google Scholar CrossRef Search ADS PubMed  Gillings MR. Integrons: past, present, and future. Microbiol Mol Biol Rev  2014; 78: 257– 77. Google Scholar CrossRef Search ADS PubMed  Gillings MR. Class 1 integrons as invasive species. Curr Opin Microbiol  2017; 38: 10– 5. Google Scholar CrossRef Search ADS PubMed  Gillings MR, Gaze WH, Pruden A et al.   Using the class 1 integron-integrase gene as a proxy for anthropogenic pollution. ISME J  2015; 9: 1269– 79. Google Scholar CrossRef Search ADS PubMed  Gillings MR, Holley MP, Stokes HW. Evidence for dynamic exchange of qac gene cassettes between class 1 integrons and other integrons in freshwater biofilms. FEMS Microbiol Lett  2009; 296: 282– 8. Google Scholar CrossRef Search ADS PubMed  Gomez-Alvarez V, Pfaller S, Pressman JG et al.   Resilience of microbial communities in a simulated drinking water distribution system subjected to disturbances: role of conditionally rare taxa and potential implications for antibiotic-resistant bacteria. Environ Sci-Wat Res  2016; 2: 645– 57. Gravel A, Fournier B, Roy PH. DNA complexes obtained with the integron integrase IntI1 at the attI1 site. Nucleic Acids Res  1998; 26: 4347– 55. Google Scholar CrossRef Search ADS PubMed  Hardwick SA, Stokes HW, Findlay S et al.   Quantification of class 1 integron abundance in natural environments using real-time quantitative PCR. FEMS Microbiol Lett  2008; 278: 207– 12. Google Scholar CrossRef Search ADS PubMed  Harrison E, Brockhurst MA. Plasmid-mediated horizontal gene transfer is a coevolutionary process. Trends Microbiol  2012; 20: 262– 7. Google Scholar CrossRef Search ADS PubMed  Heuer H, Binh CT, Jechalke S et al.   IncP-1ε plasmids are important vectors of antibiotic resistance genes in agricultural systems: diversification driven by Class 1 Integron gene cassettes. Front Microbiol  2012; 3: 2. Google Scholar CrossRef Search ADS PubMed  Hoa PT, Nonaka L, Viet PH, Suzuki S. Detection of the sul1, sul2, and sul3 genes in sulfonamide-resistant bacteria from wastewater and shrimp ponds of north Vietnam. Sci Total Environ  2008; 405: 377– 84. Google Scholar CrossRef Search ADS PubMed  Holmsgaard PN, Dealtry S, Dunon V et al.   Response of the bacterial community in an on-farm biopurification system, to which diverse pesticides are introduced over an agricultural season. Environ Pollut  2017; 229: 854– 62. Google Scholar CrossRef Search ADS PubMed  Jechalke S, Schreiter S, Wolters B et al.   Widespread dissemination of class 1 integron components in soils and related ecosystems as revealed by cultivation-independent analysis. Front Microbiol  2013; 4: 420. Google Scholar PubMed  Jechalke S, Schreiter S, Wolters B et al.   Widespread dissemination of class 1 integron components in soils and related ecosystems as revealed by cultivation-independent analysis. Front Microbiol  2014; 4: 420. Google Scholar CrossRef Search ADS PubMed  Jones-Dias D, Manageiro V, Ferreira E et al.   Architecture of class 1, 2, and 3 integrons from gram negative bacteria recovered among fruits and vegetables. Frontiers in microbiology  2016; 7, Doi: https://doi.org/10.3389/fmicb.2016.01400. Klümper U, Riber L, Dechesne A et al.   Broad host range plasmids can invade an unexpectedly diverse fraction of a soil bacterial community. ISME J  2015; 9: 934– 45. Google Scholar CrossRef Search ADS PubMed  Koczura R, Mokracka J, Taraszewska A et al.   Abundance of Class 1 integron-integrase and sulfonamide resistance genes in river water and sediment is affected by anthropogenic pressure and environmental factors. Microb Ecol  2016; 72: 909– 16. Google Scholar CrossRef Search ADS PubMed  Martínez JL. Natural antibiotic resistance and contamination by antibiotic resistance determinants: the two ages in the evolution of resistance to antimicrobials. Front Microbiol  2012; 3: 1. Google Scholar CrossRef Search ADS PubMed  Martini MC, Albicoro FJ, Nour E et al.   Characterization of a collection of plasmid-containing bacteria isolated from an on-farm biopurification system used for pesticide removal. Plasmid  2015; 80: 16– 23. Google Scholar CrossRef Search ADS PubMed  Mazel D, Dychinco B, Webb VA, Davies J. Antibiotic resistance in the ECOR collection: integrons and identification of a novel aad gene. Antimicrob Agents Chemother  2000; 44: 1568– 74. Google Scholar CrossRef Search ADS PubMed  Mazel D. Integrons: agents of bacterial evolution. Nat Rev Microbiol  2006; 4: 608– 20. Google Scholar CrossRef Search ADS PubMed  Messier N, Roy PH. Integron integrases possess a unique additional domain necessary for activity. J Bacteriol  2001; 183: 6699– 706. Google Scholar CrossRef Search ADS PubMed  Monkiedje A, Zuehlke S, Maniepi SJN et al.   Elimination of racemic and enantioenriched metalaxyl based fungicides under tropical conditions in the field. Chemosphere  2007; 69: 655– 63. Google Scholar CrossRef Search ADS PubMed  Nandi S, Maurer JJ, Hofacre C et al.   Gram-positive bacteria are a major reservoir of Class 1 antibiotic resistance integrons in poultry litter. P Natl Acad Sci USA  2004; 101: 7118– 22. Google Scholar CrossRef Search ADS   Nardelli M, Scalzo PM, Ramírez MS et al.   Class 1 integrons in environments with different degrees of urbanization. PLoS One  2012; 7: e39223. Google Scholar CrossRef Search ADS PubMed  Nemergut DR, Martin AP, Schmidt SK. Integron diversity in heavy-metal-contaminated mine tailings and inferences about integron evolution. Appl Environ Microb  2004; 70: 1160– 8. Google Scholar CrossRef Search ADS   Nield BS, Holmes AJ, Gillings MR et al.   Recovery of new integron classes from environmental DNA. FEMS Microbiol Lett , 2001; 195: 59– 65 Google Scholar CrossRef Search ADS PubMed  Novick RP, Clowes RC, Cohen SN et al.   Uniform nomenclature for bacterial plasmids: a proposal. Bacteriol Rev  1976; 40: 168– 89. Google Scholar PubMed  Nour EH, Elsayed TR, Springael D et al.   Comparable dynamics of linuron catabolic genes and IncP-1 plasmids in biopurification systems (BPSs) as a response to linuron spiking. Appl Microbiol Biot  2017; 101: 4815– 25. Google Scholar CrossRef Search ADS   Orman BE, Pineiro SA, Arduino S et al.   Evolution of multiresistance in nontyphoid Salmonella serovars from 1984 to 1998 in Argentina. Antimicrob Agents Chemother  2002, 46: 3963– 70. Google Scholar CrossRef Search ADS PubMed  Parent R, Roy PH. The chloramphenicol acetyltransferase gene of Tn2424: a new breed of cat. J Bacteriol  1992; 174: 2891– 7. Google Scholar CrossRef Search ADS PubMed  Partridge SR, Tsafnat G, Coiera E et al.   Gene cassettes and cassette arrays in mobile resistance integrons. FEMS Microbiol Rev  2009; 33: 757– 84. Google Scholar CrossRef Search ADS PubMed  Perry J, Wright G. The antibiotic resistance “mobilome”: searching for the link between environment and clinic. Front Microbiol  2013; 4: 138. Google Scholar CrossRef Search ADS PubMed  Quiroga MP, Andres P, Petroni A et al.   Complex Class 1 Integrons with Diverse Variable Regions, Including aac(6')-Ib-cr, and a Novel Allele, qnrB10, Associated with ISCR1 in Clinical Enterobacterial Isolates from Argentina. Antimicrob Agents Chemother  2007; 51: 4466– 70. Google Scholar CrossRef Search ADS PubMed  Quiroga MP, Arduino SM, Merkier AK et al.   Distribution and functional identification of complex class 1 integrons. Infect Genet Evol  2013; 19: 88– 96. Google Scholar CrossRef Search ADS PubMed  Rosewarne CP, Pettigrove V, Stokes HW et al.   Class 1 integrons in benthic bacterial communities: abundance, association with Tn402-like transposition modules and evidence for coselection with heavy-metal resistance. FEMS Microbiol Ecol  2010; 72: 35– 46. Google Scholar CrossRef Search ADS PubMed  Rosser SJ, Young H-K. Identification and characterization of class 1 integrons in bacteria from an aquatic environment. J Antimicrob Chemoth  1999; 44: 11– 8. Google Scholar CrossRef Search ADS   Rowe-Magnus DA, Guerout AM, Ploncard P et al.   The evolutionary history of chromosomal super-integrons provides an ancestry for multiresistant integrons. P Natl Acad Sci USA  2001; 98: 652– 7. Google Scholar CrossRef Search ADS   Shintani M, Sanchez ZK, Kimbara K. Genomics of microbial plasmids: classification and identification based on replication and transfer systems and host taxonomy. Front Microbiol  2015; 6: 242. Google Scholar CrossRef Search ADS PubMed  Sniegowski K, Bers K, Van Goetem K et al.   Improvement of pesticide mineralization in on-farm biopurification systems by bioaugmentation with pesticide-primed soil. FEMS Microbiol Ecol  2011; 76: 64– 73. Google Scholar CrossRef Search ADS PubMed  Stalder T, Barraud O, Casellas M et al.   Integron involvement in environmental spread of antibiotic resistance. Front Microbiol  2012; 3: 119. Google Scholar CrossRef Search ADS PubMed  Stokes HW, Nesbø CL, Holley M et al.   Class 1 integrons potentially predating the association with Tn402-like transposition genes are present in a sediment microbial community. J Bacteriol  2006; 188: 5722– 30. Google Scholar CrossRef Search ADS PubMed  Sukul P, Zühlke S, Lamshöft M et al.   Dissipation and metabolism of 14 C-spiroxamine in soil under laboratory condition. Environ Pollut  2010; 158: 1542– 50. Google Scholar CrossRef Search ADS PubMed  von Wintersdorff CJH, Penders J, van Niekerk JM et al.   Dissemination of antimicrobial resistance in microbial ecosystems through horizontal gene transfer. Front Microbiol  2016; 7, DOI: https://doi.org/10.3389/fmicb.2016.00173. Wang C, Cai P, Guo Y et al.   Distribution of the antiseptic-resistance genes qacEΔ1 in 331 clinical isolates of Pseudomonas aeruginosa in China. J Hosp Infect  2007; 66: 93– 5. Google Scholar CrossRef Search ADS PubMed  Wright MS, Baker-Austin C, Lindell AH et al.   Influence of industrial contamination on mobile genetic elements: class 1 integron abundance and gene cassette structure in aquatic bacterial communities. ISME J  2008; 2: 417– 28. Google Scholar CrossRef Search ADS PubMed  Wu S, Dalsgaard A, Hammerum AM et al.   Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human. Acta Vet Scand  2010, 52: 47. Google Scholar CrossRef Search ADS PubMed  © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png FEMS Microbiology Ecology Oxford University Press

Novel environmental class 1 integrons and cassette arrays recovered from an on-farm bio-purification plant

Loading next page...
 
/lp/ou_press/novel-environmental-class-1-integrons-and-cassette-arrays-recovered-WTlxRNDgeX
Publisher
Oxford University Press
Copyright
© FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
0168-6496
eISSN
1574-6941
D.O.I.
10.1093/femsec/fix190
Publisher site
See Article on Publisher Site

Abstract

Abstract Rapid dissemination and emergence of novel antibiotic resistance genes among bacteria are rising problems worldwide. Since their discovery in clinical isolates in the late 1980s, class 1 integrons have been found in a wide range of bacterial genera and have been extensively studied as contributors to dissemination of antibiotic resistance. The present study aimed to investigate the presence and structure of class 1 integrons in plasmid-carrying bacterial isolates obtained from a biopurification system used for decontamination of pesticide-contaminated water as well as their possible role as reservoir of antimicrobial resistance gene cassettes. A total of 35 representative isolates were screened for the presence of class 1 integron integrase encoded by intI1. PCR and DNA sequencing revealed the presence of six class 1 integrons with four variable regions: 5΄CS-aadA1b-3΄CS, 5΄CS-aadA2-3΄CS, 5΄CS-aadA11cΔ-3΄CS and 5΄CS-dfrB3-aadA1di-catB2-aadA6k-3΄CS, the last two being unseen arrays of antimicrobial resistance gene cassettes associated with novel environmental alleles of intI1. These four class 1 integrons were identified as being present in four different genera, including Ochrobactrum, and Variovorax, where class 1 integrons have not been previously reported. The results provide evidence of the biopurification systems as a tank of class 1 integron carrying strains and novel environmental class 1 integron integrases associated with antimicrobial resistance gene cassette arrays. integron, antimicrobial resistance, plasmid, biopurification system, lateral gene transfer, agriculture INTRODUCTION The overuse of antibiotics in both clinical and farming contexts has increased the spread of resistance determinants not only in clinical settings but also in the environment (Angebault and Andremont 2013; Fletcher 2015). While many studies have focused on the dissemination of antibiotic resistance genes (ARGs) in hospitals, some reports have recently described their spread in the environment (Allen et al.2010; Davies and Davies 2010; Nardelli et al.2012; Cantas et al.2013; von Wintersdorff et al.2016). There is evidence suggesting that clinical resistance genes have an environmental origin (Martínez 2012; Berendonk et al.2015; Berglund 2015) and even that some of them can also be captured by active environmental class 1 integron integrases (Chamosa et al.2017). The knowledge about the directionality of the flux of antimicrobial resistance genes between the environment and the clinic, and vice-versa (Gomez-Alvarez et al.2016) and the steps involved in the acquisition of novel ARGs from the open environment are interesting and active subjects of study. Mobile genetic elements (MGEs) enhance the transmission of ARGs between bacteria via lateral genetic transfer (de la Cruz and Davies 2000). The so called mobile integrons (MIs) and conjugative (i.e. self-transmissible) or mobilizable plasmids that can carry genes conferring resistance to one or more antibiotics are among the most studied and relevant MGEs in bacteria isolated from clinics. Integrons are genetic assembly platforms that allow the capture and expression of exogenous gene cassettes (Stokes et al.2006; Gillings 2014). Among MIs, class 1 integrons play a major role in the flow of ARG cassettes and antiseptic resistance determinants between pathogenic and non-pathogenic bacteria in clinical settings (Perry and Wright 2013; Gillings 2014). Although these integrons were first identified in clinical isolates, there is evidence proving that these platforms originated in natural (i.e. non-clinical) environments (Rowe-Magnus et al.2001; Mazel 2006). Class 1 integrons are linked to some environments with a certain degree of contamination (Gillings et al.2008; Nardelli et al.2012), and their presence has even been proposed as an indicator of anthropogenic pollution (Amos et al.2015; Gillings et al.2015). In the past years, researchers paid particular attention to the study of the presence and dissemination of class 1 integrons in non-antibiotic polluted environments (Rosser and Young 1999; Stokes et al.2006; Hardwick et al.2008; Gillings, Holley and Stokes 2009; Nardelli et al.2012; Koczura et al.2016), since it could help to understand the evolution of these elements as well as their role in the spread of antibiotic and antiseptic resistance determinants in nature. The molecular features of class 1 integrons as a genetic tool for studying the flux of antimicrobial resistance genes are based on the different alleles of intI1 found in both habitats, the clinic and the open environment, which led to the identification of sources of both ‘environmental’ and ‘clinical’ class 1 integrons (Gillings et al.2008). Based on this point of view, the type of allele of intI1 has been used as a marker to infer the directionality of the strains (Gillings et al.2008; Nardelli et al.2012; Gomez-Alvarez et al.2016). The success of class 1 integrons is mainly due to their mechanism for gene cassette acquisition and expression as well as to their frequent association with transposons and plasmids, which enhance their dissemination (Stokes et al.2006; Gillings et al.2008; Nardelli et al.2012). Plasmids are one of the most abundant and promiscuous MGEs and have been identified as the main vehicles for lateral gene transfer in bacteria via conjugation (Garcillán-Barcia, Francia and de La Cruz 2009; Harrison and Brockhurst 2012). It has been demonstrated that plasmids carrying diverse genes can be mobilized among bacteria, even those belonging to different phyla (Klümper et al.2015; Shintani, Sanchez, and Kimbara 2015). Recently, we isolated a collection of 35 plasmid-carrying bacteria from an on-farm biopurification system (BPS) used for the remediation of pesticide-contaminated waters in Kortrijk, Belgium (Martini et al.2015). These environmental isolates belong to 14 genera, including both Gram-negative and Gram-positive bacteria. In particular, this plasmid-carrying bacteria collection harbors more than 50 high molecular weight plasmids. Previous studies on this BPS have demonstrated the presence of class 1 integrons in a total DNA sample of this BPS community (Dealtry et al.2014b), and have described the bacterial community composition and the IncP-1 mobilome changes in response to linuron addition as well (Dealtry et al.2016; Nour et al.2017). BPSs receive pesticides at relatively high concentrations for extended periods of time that in consequence generate a strong and long-term selective pressure for the persistence and growth of pesticide-tolerant or -degrading bacteria (Sniegowski et al.2011). In an attempt to investigate the impact of selective pressures exerted by pesticides on bacteria carrying class 1 integrons in the BPS and their possible role as reservoirs of ARG cassettes, we firstly analyzed the presence of these elements and subsequently characterized the intI1 (‘clinical’ or ‘environmental’), along with the complete variable region of such integrons. MATERIALS AND METHODS Strains used in this study The bacterial isolates used in this study were previously obtained from a BPS used for pesticide removal from contaminated water located in Kortrijk, Belgium (Martini et al.2015) operational since 2008, and containing a biomix composed of agricultural soil (25 vol%), composted material (25 vol%) and straw mixed with stable manure originating from a nearby horse manege (50 vol%). The BPS was used for water contaminated with different types of pesticides (see Dealtry et al. 2014a) from spillage and residue water collected when cleaning the spraying equipment. The following pesticides were found by chemical analysis of the BPS samples: azoxystrobin, bentazone, diflufenican, diuron, epoxiconazole, ethofumesate, fenpropimorph, fluroxypyr, flufenacete, metamitron, metribuzine, propiconazole, S-metolachlor, tebuconazole and terbuthylazine (Dealtry et al.2014a). The measurements of these pesticides were previously performed (Monkiedje et al.2007; Sukul et al.2010). In addition to the pesticides detected in the BPS, a previous study reported the application of several other active pesticide compounds to the BPS (Dealtry et al.2014a). More than of 1400 isolates obtained from the BPS (Martini et al.2015) were screened by the in situ lysis assay (Eckhardt 1978) to investigate their plasmid content. A total of 75 plasmid-containing bacteria were identified. The in situ lysis technique allowed the classification of the isolates in 35 representative groups, according to their plasmid profiles (i.e. plasmid number and plasmid size). The 35 representative isolates, that comprised at least 50 high molecular weight plasmids, were further characterized. The isolates presented different tolerance profiles to several antibiotics and metals tested (for more details, see Martini et al.2015). Bacteria were grown on LB medium at 28°C. The strain Proteus mirabilis PR9 containing a complex class 1 integron (Arduino et al.2002) was used as a positive control for intI1, qacE/qacEΔ1, sul1 and ISCR1 genes in PCR. Molecular analysis Total DNA from each isolate was extracted and used for PCR amplifications. For regular size amplifications (up to 2 Kb), PCR was carried out using 1X PCR buffer (50 mM KCl, 20 mM Tris-HCl, pH 8.0), 200 μM dNTP, 3 mM MgCl2, 2 μl DNA template and 1 U T-free DNA polymerase (Inbio-Highway, Tandil, Argentina). For amplification of large fragments (variable regions of integrons), LongAmp DNA polymerase from New England Biolabs (Massachusetts, United States) was used. PCR was performed as follows: an initial denaturation step at 94°C for 4 min, followed by 35 cycles of denaturation at 94°C for 20 s, annealing at 50°C –60°C (depending on the primers used; see Table 1 for references) for 30 s and extension at 65°C for LongAmp polymerase or 72°C for Taq polymerase (1 min per 1Kb of DNA). Then, a final extension at 65°C /72°C for 10 min was used. Table 1. Primers used in this study. Primer name  Target  Primer sequence  Amplicon size (bp)  Reference  5΄and 3΄conserved genes  int1FP  intI1  gggtcaaggatctggatttcg  483  Mazel et al.2000  int1FR    acatgcgtgtaaatcatcgtcg    Mazel et al.2000  Inti1F  intI1  cgaggcatagactgtac  925  Quiroga et al. (2007)  Inti1R    ttcgaatgtcgtaaccgc    Quiroga et al. (2007)  Orf513F  ISCR1  atggtttcatgcgggtt  474  Arduino et al. (2003)  Orf513R    ctgagggtgtgagcgag    Orman et al. (2002)  Sul1 lower  sul1  tttgaaggttcgacagc  580  Barbolla et al. (2004)  Sul1 upper    gacggtgttcggcattct    Barbolla et al. (2004)  QaceR  qacE/ qacEΔ1  gcgaagtaatcgcaacatcc  240  Arduino et al. (2003)  QaceF    agccccatacctacaaagcc    Arduino et al. (2003)  Variable regions  sulpro3    gcctgacgatgcgtgga  Variable  Lévesque et al. (1995)  qacEDelta1B    gcgataacaagaaaaagcc    Quiroga et al. (2013)  Primer name  Target  Primer sequence  Amplicon size (bp)  Reference  5΄and 3΄conserved genes  int1FP  intI1  gggtcaaggatctggatttcg  483  Mazel et al.2000  int1FR    acatgcgtgtaaatcatcgtcg    Mazel et al.2000  Inti1F  intI1  cgaggcatagactgtac  925  Quiroga et al. (2007)  Inti1R    ttcgaatgtcgtaaccgc    Quiroga et al. (2007)  Orf513F  ISCR1  atggtttcatgcgggtt  474  Arduino et al. (2003)  Orf513R    ctgagggtgtgagcgag    Orman et al. (2002)  Sul1 lower  sul1  tttgaaggttcgacagc  580  Barbolla et al. (2004)  Sul1 upper    gacggtgttcggcattct    Barbolla et al. (2004)  QaceR  qacE/ qacEΔ1  gcgaagtaatcgcaacatcc  240  Arduino et al. (2003)  QaceF    agccccatacctacaaagcc    Arduino et al. (2003)  Variable regions  sulpro3    gcctgacgatgcgtgga  Variable  Lévesque et al. (1995)  qacEDelta1B    gcgataacaagaaaaagcc    Quiroga et al. (2013)  View Large For the detection of the intI1 alleles, two strategies were used by amplifying a PCR fragment of 925 bp (representing the whole gene) and another of 483 bp that included the additional motif that it is conserved among integron integrases (Messier and Roy 2001; Gravel et al.1998; Nield et al.2001). Variable regions of class 1 integrons were analyzed in positive intI1 strains by PCR and sequencing reactions with sulpro3 and qacEDelta1B primers (Table 1). Primers for PCR amplification of genetic determinants ISCR1, qacE/qacEΔ1 and sul1 are also listed in Table 1. Amplicon sequencing, assembly and analysis In order to identify the amplified DNA fragments, PCR products were purified using AccuPrep PCR Purification Kit (Bioneer, Daejeaon, Korea) and were then sequenced at Macrogen (Korea) following standard procedures. The resulting sequences were compared with those found in the GenBank database for identity assignment. Contig Express (Invitrogen, Carlsbad, USA) was used for sequence assembly. A function prediction was computed using standard bioinformatic tools such as Blast V2.0 software (http://www.ncbi.nlm.nih.gov/BLAST/). Protein identity values were determined using BLASTp. Based on sequence analysis, the completeness of the integron sequence was established. Genetic localization of identified integrons In situ lysis gel electrophoresis was performed to obtain further information on the genomic location of class 1 integrons by analyzing the DNA of the bands corresponding to plasmid(s) or chromosome, as described by Martini et al. (2015). The visualized bands were purified using the AccuPrep Gel Purification Kit (Bioneer, Daejeon, Korea). Then, a PCR for the 483 bp intI1 fragment was carried out using the purified samples. In order to exclude the amplification of contaminating DNA, several controls were included in the PCR with DNA recovered from randomly selected positions of the agarose gel. Nucleotide sequence accession numbers Integrons were manually curated and genes were annotated using the best BLASTp hit at National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih.gov/). The nucleotide sequences of the complete class 1 integrons described in this work were deposited at GenBank as accession numbers KY047413- KY047415 and KY047417. The two novel integron arrangements were submitted to the INTEGRALL database as In1368 and In1369 (http://integrall.bio.ua.pt). RESULTS Class 1 integrons were found in different genera To determine if class 1 integrons were present in the plasmid-carrying bacteria studied from the BPS system, the amplification of a 483 bp fragment of intI1 was performed by PCR (Table 1); in order to analyze the variants of the intI1 alleles, the 925 bp amplification product obtained with primers Inti1F and Inti1R was sequenced. Six out of the 35 analyzed isolates (see Table 2 for taxonomic classification) were positive for intI1, indicating a high frequency (17%) of this element in the BPS bacterial collection in comparison to those obtained in previous studies (Stokes et al.2006; Rosewarne et al.2010; Nardelli et al. 2012). Interestingly, besides Pseudomonas spp. (two isolates) and Alcaligenes sp., the intI1 was found in genera such as Ochrobactrum and Microbacterium as well as in Variovorax, where they have not been described previously. This finding represents one more piece of evidence of how class 1 integrons successfully disseminate among genomes and habitats. Table 2. Presence of the intI1 and class 1 integron-related genetic determinants in the studied isolates. Since qacE and sul1 can occur independently of integrons, the amplicons obtained for Sulpro3/QaceF and QaceR/Sul1 lower were sequenced, confirming that both genetic determinants are linked to the class 1 integrons in the isolates studied. ªTruncated intI1. NC: not corresponds. Isolate  Taxonomic class  intI1  qacE/qacEΔ1  sul1  Sulpro3/QaceF  QaceR/Sul1 lower  ISCR1  BF02  Ochrobactrum sp.  α-proteobacteria  +  +  +  +  +  –  BF13  Ochrobactrum sp.  α-proteobacteria  –  –  –  NC  NC  –  BF14  Cellulosimicrobium cellulans  Actinobacteria  –  –  –  NC  NC  –  BF15  Ochrobactrum sp.  α-proteobacteria  –  –  –  NC  NC  –  BF19  Variovorax sp.  β-proteobacteria  +(a)  +  +  +  +  –  BF21  Paenibacillus sp.  Bacilli  –  –  +  NC  NC  –  BF22  Paenibacillus tundrae  Bacilli  –  –  +  NC  NC  –  BF25  Pseudomonas putida  γ-proteobacteria  +  +  +  +  +  –  BF27  Pseudomonas sp.  γ-proteobacteria  +  +  +  +  +  –  BF28  Paenibacillus xylanexedens  Bacilli  –  –  +  NC  NC  –  BF30  Bordetella sp.  β-proteobacteria  –  –  –  NC  NC  –  BF31  Cellulosimicrobium sp.  Actinobacteria  –  +  –  NC  NC  –  BF33  Pseudomonas putida  γ-proteobacteria  –  –  –  NC  NC  –  BF36  Microbacterium sp.  Actinobacteria  –  –  –  NC  NC  –  BF37  Serratia sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF42  Alcaligenes sp.  β-proteobacteria  +  +  +  +  +  –  BF43  Serratia sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF44  Microbacterium oxydans  Actinobacteria  +  +  +  +  +  –  BF46  Serratia sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF48  Microbacterium sp.  Actinobacteria  –  +  +  NC  NC  –  BF52  Brevibacterium sp.  Actinobacteria  –  –  –  NC  NC  –  BF53  Agromyces cerinus  Actinobacteria  –  –  –  NC  NC  –  BF55  Pseudomonas putida  γ-proteobacteria  –  +  –  NC  NC  –  BF56  Acinetobacter sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF58  Pseudomonas sp.  γ-proteobacteria  –  –  +  NC  NC  –  BF59  Sphingobacterium sp.  Sphingobacteria  –  –  –  NC  NC  –  BF60  Sphingobacterium sp.  Sphingobacteria  –  –  +  NC  NC  –  BF61  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF62  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF67  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF68  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF70  Bacillus pumilus  Bacilli  –  –  –  NC  NC  –  BF71  Bacillus sp.  Bacilli  –  –  –  NC  NC  –  BF73  Bacillus megaterium  Bacilli  –  –  –  NC  NC  –  BF75  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  Isolate  Taxonomic class  intI1  qacE/qacEΔ1  sul1  Sulpro3/QaceF  QaceR/Sul1 lower  ISCR1  BF02  Ochrobactrum sp.  α-proteobacteria  +  +  +  +  +  –  BF13  Ochrobactrum sp.  α-proteobacteria  –  –  –  NC  NC  –  BF14  Cellulosimicrobium cellulans  Actinobacteria  –  –  –  NC  NC  –  BF15  Ochrobactrum sp.  α-proteobacteria  –  –  –  NC  NC  –  BF19  Variovorax sp.  β-proteobacteria  +(a)  +  +  +  +  –  BF21  Paenibacillus sp.  Bacilli  –  –  +  NC  NC  –  BF22  Paenibacillus tundrae  Bacilli  –  –  +  NC  NC  –  BF25  Pseudomonas putida  γ-proteobacteria  +  +  +  +  +  –  BF27  Pseudomonas sp.  γ-proteobacteria  +  +  +  +  +  –  BF28  Paenibacillus xylanexedens  Bacilli  –  –  +  NC  NC  –  BF30  Bordetella sp.  β-proteobacteria  –  –  –  NC  NC  –  BF31  Cellulosimicrobium sp.  Actinobacteria  –  +  –  NC  NC  –  BF33  Pseudomonas putida  γ-proteobacteria  –  –  –  NC  NC  –  BF36  Microbacterium sp.  Actinobacteria  –  –  –  NC  NC  –  BF37  Serratia sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF42  Alcaligenes sp.  β-proteobacteria  +  +  +  +  +  –  BF43  Serratia sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF44  Microbacterium oxydans  Actinobacteria  +  +  +  +  +  –  BF46  Serratia sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF48  Microbacterium sp.  Actinobacteria  –  +  +  NC  NC  –  BF52  Brevibacterium sp.  Actinobacteria  –  –  –  NC  NC  –  BF53  Agromyces cerinus  Actinobacteria  –  –  –  NC  NC  –  BF55  Pseudomonas putida  γ-proteobacteria  –  +  –  NC  NC  –  BF56  Acinetobacter sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF58  Pseudomonas sp.  γ-proteobacteria  –  –  +  NC  NC  –  BF59  Sphingobacterium sp.  Sphingobacteria  –  –  –  NC  NC  –  BF60  Sphingobacterium sp.  Sphingobacteria  –  –  +  NC  NC  –  BF61  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF62  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF67  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF68  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  BF70  Bacillus pumilus  Bacilli  –  –  –  NC  NC  –  BF71  Bacillus sp.  Bacilli  –  –  –  NC  NC  –  BF73  Bacillus megaterium  Bacilli  –  –  –  NC  NC  –  BF75  Pseudomonas sp.  γ-proteobacteria  –  –  –  NC  NC  –  View Large ‘Clinical’ and novel ‘environmental’ alleles of intI1 were detected in the plasmid-carrying bacteria A 925 bp fragment of intI1 (Table 1) was found by PCR in all isolates with the exception of Variovorax sp. BF19, where no PCR product was obtained with these primers but it was positive the amplification of 483 bp. This result suggests the presence of a truncated intI1 in this isolate as previously described in other environmental samples (Nardelli et al.2012). Complete sequence of the intI1 was identified in Alphaproteobacteria, Betaproteobacteria and Actinobacteria. Five sequenced intI1 belonged to two different alleles, a ‘clinical’ one and a novel ‘environmental’ allele that presented differences in two nucleotide positions (see alignment in Fig. S1, Supporting Information). The ‘clinical’ intI1 allele (AF313471) was identified in BF25 and BF27 isolates which belonged to Pseudomonas. This allele had been previously found in other Gram-negative pathogenic bacteria such as Escherichia coli, Klebsiella pneumoniae, Shigella dysenteriae and Aeromonas salmonicida (accession numbers KU043115, CP018819, KX646543, KX364409, respectively). In turn, the novel ‘environmental’ intI1 allele was identified in the present study for the first time in Ochrobactrum and Microbacterium genus. Novel variable regions of class 1 integrons were found To identify the variable region of class 1 integrons found in the six isolates, total DNA from each strain was PCR-amplified by using standard primers (see Table 1) and sequenced. As deduced from the sequences, four different gene cassette arrangements were found in the variable region of the six isolates: 5’CS-aadA11cΔ-3’CS, 5’CS-aadA1b-3’CS, 5’CS-aadA2-3’CS and 5’CS-dfrB3-aadA1di-catB2-aadA6k-3’CS (Fig. 1). Interestingly, the bioinformatic analysis of the gene cassette sequences revealed the presence of unique ARG cassette arrangements within the variable region, which were named In1368 and In1369 in INTEGRALL http://integrall.bio.ua.pt/ (Fig. 1). The remaining gene cassette arrangements were the already described 5’CS-aadA1b-3’CS (In93) and 5’CS-aadA2-3’CS (In127), with the same gene cassette alleles identified in the reference sequences AN: CP000645 and EU089667, respectively (http://integrall.bio.ua.pt/; Fig. 1). Class 1 integrons identified in Ochrobactrum sp. BF02, Variovorax sp. BF19, Pseudomonas putida BF25 and Pseudomonas spp. BF27 isolates contained each a single gene cassette related to the aadA1 gene cassette family, with 92% (In1369, AN: KY047413), 99% (In93, AN: KY047414) and 89% identity (In127, AN: KY047415 and KY047416) with the reference aadA1a from In2 (AN: AF071413), while class 1 integrons from Alcaligenes sp. BF42 and Microbacterium oxydans BF44 contained 5’CS-dfrB3-aadA1di-catB2-aadA6k-3’CS (In1369, AN: KY047417 and KY047418, respectively), the same novel arrangement of ARG cassette (Fig. 1). This latter arrangement harbors two different aadA variants, the catB2 gene cassette that encodes for chloramphenicol acetyltransferase previously described in Tn2424 (Parent and Roy 1992), and the dfrB3 gene cassette that encodes for a dihydrofolate reductase previously found in class 1 integrons that mediate antibiotic resistance in the fish pathogen Aeromonas salmonicida worldwide, and also in multiresistant Enterobacteriaceae isolates from Bogota hospitals (accession numbers AF327729 and GQ150744, respectively). The first aadA variant in In1369 shows 99% identity with aadA1a, with three point mutations GAC→AAC, AAA→AGA and GTC→GTT at positions 205, 602 and 750, respectively. The first two codify for D69N and K149R, respectively, but the third one is a silent mutation. Following the nomenclature currently accepted (Novick et al.1976; Partridge et al.2009; INTEGRALL) and due to the high number of aadA1 variants, a double-letter suffix is assigned to correctly identify the new ones (e.g. aadA1a … aadA1z, aadA1aa … aadA1az, aadA1ba, etc.); which in the case described above, the mutations lead to a new variant called aadA1di. The second aadA variant in this integron is aadA6k, with 99% identity to aadA6 from In51 (AN: AF140629.1). It shows two point mutations, GAT→AAT and GAA→GAG at positions 175 and 243, respectively. The first mutation codifies for D59N and the second is silent. Sequence analysis of the other novel class 1 integron (In1368, AN: KY047413) showed maximal nucleotide identity (99%) with aadA11c (In720 AN: JN894689). The variant present in In1369 shows two point mutations, the insertion of a C and an A at positions 610 and 775, respectively. The first mutation is silent for the specific codon (CCG→CCC that codifies for a proline at position 204), but generates a frameshift leading to a change in the remaining 21 amino acids codified plus a premature stop codon that truncates the last 38 amino acids of the resulting protein. This last characteristic is highlighted by the Δ suffix in the aadA11cΔ variant present in this integron. Figure 1. View largeDownload slide Schematic representation of regions surrounding class 1 integrons detected among the bacterial pool analyzed in the present study. (A) Representation of the typical structure of a class 1 integron. (B) Structure of the four integrons described in this study. VR: variable region. Figure 1. View largeDownload slide Schematic representation of regions surrounding class 1 integrons detected among the bacterial pool analyzed in the present study. (A) Representation of the typical structure of a class 1 integron. (B) Structure of the four integrons described in this study. VR: variable region. Localization of integrons in bacterial genomes Class 1 integrons correspond to functional platforms that are physically associated with mobile DNA elements as transposons which in turn can be carried by conjugative plasmids. Determination of the chromosomal or plasmid location of class 1 integrons was performed by PCR using intI1 as a marker gene and DNA recovered from plasmids or chromosome, obtained as mentioned in Materials and Methods. Class 1 integrons were found in plasmids of five out of six isolates (Ochrobactrum sp. BF02, P. putida BF25, Pseudomonas sp. BF27, Alcaligenes sp. BF42 and M. oxydans BF44), while in Variovorax sp. BF19, the integron was located on the bacterial chromosome (data not shown). This is the first report of a class 1 integron in the Variovorax genus, although a chromosome-located class 1 integron has been previously reported in Acidovorax (Stokes et al.2006) and in Comamonas testosteroni (AN: NC_013446.1), two genera belonging to the same family as Variovorax (Comamonadaceae). In the case of the Variovorax BF19 isolate, the IntI1 was truncated in the N-terminal domain, thus suggesting a lack of recombinational activity. On the other hand, the intI1 found in plasmids of the other five isolates was probably complete (944 bp in length). Independent spread of qacE/qacEΔ1 and sul1 genes in the BPS The incidence of ISCR1, sul1 and qacE/qacEΔ1 genes, usually associated with class 1 integrons, was investigated in our plasmid-containing isolate collection. Identification of ISCR1, which is a marker for complex class 1 integrons (Quiroga et al.2013), was performed with conventional primers (see Table 2). The qacE/qacEΔ1 gene confers resistance towards multiple chemical classes of biocides, including quaternary ammonium compounds, biguanides, acridines, diamidines, xanthenes and phenanthridines, while sul1 confers resistance to sulphonamides. In addition to the six class 1 integron-containing isolates, another three and six isolates resulted positive for sul1 and qacE/qacEΔ1, respectively, in the collection (Table 2). Consistent with the findings from previous studies (Wang et al.2007; Nardelli et al.2012; Hoa et al.2008; Wu et al.2010), sul1 and qacE/qacEΔ1 spread independently of class 1 integrons among bacterial genomes in the BPS bacterial community as well as in a variety of bacterial habitats. DISCUSSION In this work, novel environmental class 1 integrons were found spread in a collection of plasmid-carrying bacteria belonging to different genera from an on-farm BPS, a useful device of environmental and agricultural interest. As reported by Dealtry et al. (2016), the BPS in Kortrijk, Belgium, is a system that was set up in 2008 and treats about 15,000 liters of pesticide-contaminated water annually. The biomix of the BPS contains soil and manure (straw and animal feces). The influent water is contaminated with a broad variety of pesticides. No data are available on the actual amount and composition of the different pesticides in the influent water but approximately 70 different pesticides, mainly herbicides were added to the BPS with contaminated water. An overview of the pesticides detectable in BPS material was provided previously by Dealtry et al. (2014a) and Holmsgaard et al. (2017). The analysis of both allelic variants of intI1 and ARG cassettes within their corresponding variable regions has been recognized as a useful tool for understanding the capture and transit of antimicrobial resistance determinants from the environment by human anthropogenic habitats. It is accepted that antimicrobial resistance determinants found in clinical isolates come from extra clinical environments (Davies and Davies 2010; Cantas et al.2013; Berglund 2015; von Wintersdorff et al.2016). In this regard, class 1 integrons both play a major role in adaptation in clinically relevant bacteria and are not limited to clinical settings, thus representing an adequate model system to evaluate the flow of antimicrobial resistance determinants (Álvarez et al.2016; Gomez-Alvarez et al.2016; Chamosa et al.2017). While it is known that these elements are more prevalent in bacteria that live in niches under antibiotic pressure, the distribution of class 1 integrons has been studied in different environments (Rosser and Young 1999; Nandi et al.2004; Nemergut, Martin and Schmidt 2004; Gaze et al.2005; Gillings 2017). There is increasing evidence proving that these elements are highly distributed outside the clinic, even in environments with a low human impact (Hardwick et al.2008; Wright et al.2008; Gaze et al.2011; Nardelli et al.2012. Jones-Dias et al. 2016; Chamosa et al2017; Gillings 2017). Class 1 integrons have been shown to be involved in the process of swapping genetic material and in the spread of antibiotic resistance genes in environmental bacteria (Stalder et al.2012; Alvarez et al.2016; Chamosa et al.2017). In this regard, class 1 integrons played an important role in the diversification of the broad-host range plasmids belonging to the IncP-1ε group as previously shown by Heuer et al. (2012). In addition, IncP1ε plasmids are important vectors for horizontal transfer of antibiotic resistance in manure slurries and in agricultural soils. Among the analyzed isolates Alcaligenes sp. BF42 carries an IncP-1 plasmid and Pseudomonas putida BF25 carries an IncP-7 plasmid (Martini et al.2015), these types of plasmids have previously been found to be abundantly present in pesticide-polluted environments (Dunon et al.2013; Jechalke et al.2013). Moreover, previous reports have shown the BPS as a ‘hot spot’ for these type of plasmids (Dealtry et al.2014a). Little is known concerning how novel ARG cassettes within integrons and/or novel alleles of intI1 are selected in clinical samples. The study of integrons presence and structures in diverse environments is an important challenge. Since scarce attention has been paid to pesticide-amended agricultural environments, and the few reported studies have been limited to investigate the sole presence of class 1 integrons but not their structure and composition (Jechalke et al.2014; Dealtry et al.2014b), this work represents the first study showing a detailed bioinformatics-based analysis of class 1 integrons in this type of environment. The analysis based on the detection of intI1 and subsequent flanking sequences revealed the presence of four class 1 integrons in six out of the 35 isolates analyzed. Each one of these four class 1 integrons harbors at least one aadA-like gene cassette. These results are in agreement with two previous reports (Jechalke et al.2014; Dealtry et al.2014b) that identified the presence of intI1 as well as aadA-like gene cassettes by using total DNA from a BPS biomix sample exposed to different pesticides. None of these studies, however, aimed at investigating either the alleles of such genes or the type of intI1 allele. The finding of four class 1 integrons (In93, In127, In1368 and In1369) and six ARG cassettes in our plasmid-containing bacterial isolates indicates that not only aadA-like gene cassettes but indeed a variety of AGR cassettes in different arrangements can be present in the BPS bacterial communities. The finding of four aadA alleles in our bacteria collection also highlights the possible role of the BPS as reservoirs related to aadA-like genes. It would be interesting to investigate whether the function conferred by the aadA family of genes which encodes an aminoglycoside-3΄-adenylyltransferase that confers resistance to streptomycin and spectinomycin by adenylation is involved in some processes inherent to the rates of sorption or biodegradation in the on-farm BPS. One point that deserves to be underlined is the finding of class 1 integron In1369 in the Gram-positive Microbacterium oxydans BF44 isolate. Only a few class 1 integrons have been reported in Gram-positive bacterial genera, including Corynebacterium, Streptococcus, Enterococcus, Staphylococcus, Aerococcus and Brevibacterium (Deng et al.2015). Interestingly, the same class 1 integron In1369 was also found in Alcaligenes spp. BF42 in the present study, an event that is likely the result of lateral antimicrobial resistance genetic transfer among Gram-negative and Gram-positive strains, indicating how active can the transfer of DNA be even among non-related taxa. Since only the truncated intI1 in Variovorax BF19 was found located on the chromosome, probably plasmids from the environment are playing a significant role in the dissemination of complete intI1, as evidenced in this study. Both types of clinical and environmental alleles of the intI1 were detected in our plasmid-carrying bacteria collection. The class 1 integron In29 bearing a same ‘clinical’ allele (AF313471) was identified in the strains BF025 and BF27 which probably belonged to two different species of the genus Pseudomonas, evidencing another lateral antimicrobial resistance genetic transfer event in the BPS system. Both Pseudomonas isolates have not only the same ‘clinical’ allele, but also they carry the aadA2 gene cassette with the typical 3΄-CS which is usually found in clinical samples suggesting that probably come nosocomial samples or from human or animal microbiota. The finding of the novel ‘environmental’ intI1 allele for the first time in Ochrobactrum, Alcaligenes and Microbacterium genus harboring different variable regions (Fig. 1) evidence how the resistome works in several steps: novel ‘environmental’ intI1 alleles spread among non-clinical strains (as in Ochrobactrum, Alcaligenes or Microbacterium from this work), until they are selected and maintained in a particular habitat (such as the BPS), where again they can disseminate among different species (certainly among Ochrobactrum, Alcaligenes and Microbacterium in the BPS from this work). From the time when two arrays of ARG cassettes were found associated with the novel intI1 allele, it is likely that the rearrangement of ARG cassettes occurred in the BPS. In addition, considering that these novel ‘environmental’ intI1 alleles are associated with ARG cassettes in the variable region, it can be supposed that these variants of class 1 integrons could be later disseminated to clinical habitats. On the other hand, since In1368 and In1369 possess the typical 3΄-CS, it can be also presumed that part of the integron come from clinical samples released into the environment, where in turn it has picked up an uncommon aadA gene cassette, followed by some form of rearrangement that lead to the finding of a novel intI1 allele. Whatever the events that led to the formation of these new integrons, the fact is that the environment is polluted with clinical integrons. These findings show BPSs as potential reservoirs of novel-class 1 ARG cassette-containing integrons. Interestingly, integrons that are contaminating the inputs for the BPS appear to be undergoing further change in the BPS: acquisition and swapping of ARG cassettes, movement of integrons between different genera and movement of ARG cassettes into chromosomal class 1 integrons. In addition, the incidence of intI1 in bacterial isolates from the BPS was relatively high (17%) in comparison with previous works analyzing non-clinical settings (Rosewarne et al.2010; Nardelli et al.2012). Future studies on deeper bacterial DNA sequencing or a complete metagenomic sequencing analysis will probably help to better understand and predict the roles of different bacterial and plasmids groups in the potential of integrons dissemination and on the pesticides biodegradation processes in the BPS. SUPPLEMENTARY DATA Supplementary data are available at FEMSEC online. Acknowledgements The authors are grateful to Paula Giménez and Silvana Tongiani for excellent technical assistance. Author contributions: All authors listed, have made substantial, direct and intellectual contribution to the work, and approved it for publication. DC and MD conceived the study, and supervised conduct of the trial. AL, MP and MM supervised the data collection. MM and MD drafted the manuscript. MQ and DC contributed substantially to the revision. FUNDING This work was supported by the National Scientific and Technical Research Council of Argentina (Consejo Nacional de Investigaciones Científicas y Técnicas—CONICET, Argentina) [PIP2015-0700] and the Ministry of Science, Technology and Productive Innovation (Ministerio de Ciencia, Tecnolología e Innovación Productiva—MinCyT, Argentina) [PICT2012-102 and PICT2012-0014] and partly by the European Commission's 7th Framework Programme (grant number: MetaExplore 222625). MM was supported by fellowships from CONICET. MP, AL, MQ, DC and MD are researchers at CONICET. Conflict of interest. None declared. REFERENCES Álvarez VE, Quiroga MP, Castro GA et al.   Molecular ecology of Class 1 Integrons in Patagonia as model system for understanding the rise of antibiotic resistance isolates around the world. In: Olivera NL, Libkind D, Donati E (eds). Biology and Biotechnology of Patagonian Microorganisms . Springer, 2016, 111– 25. Google Scholar CrossRef Search ADS   Allen HK, Donato J, Wang HH et al.   Call of the wild: antibiotic resistance genes in natural environments. Nat Rev Microbiol  2010; 8: 251– 9. Google Scholar CrossRef Search ADS PubMed  Amos GCA, Gozzard E, Carter CE et al.   Validated predictive modelling of the environmental resistome. ISME J  2015; 9: 1467– 76. Google Scholar CrossRef Search ADS PubMed  Angebault C, Andremont A. Antimicrobial agent exposure and the emergence and spread of resistant microorganisms: issues associated with study design. Eur J Clin Microbiol  2013; 32: 581– 95. Google Scholar CrossRef Search ADS   Arduino SM, Roy PH, Jacoby GA et al.   blaCTX-M-2 is located in an unusual class 1 integron (In35) which includes Orf513. Antimicrob Agents Ch  2002; 46: 2303– 6. Google Scholar CrossRef Search ADS   Arduino SM, Catalano M, Orman BE et al.   Molecular epidemiology of orf513-bearing class 1 integrons in multiresistant clinical isolates from Argentinean hospitals. Antimicrob Agents Chemother  2003; 47: 3945– 9. Google Scholar CrossRef Search ADS PubMed  Barbolla R, Catalano M, Orman BE et al.   Class 1 integrons increase trimethoprim-sulfamethoxazole MICs against epidemiologically unrelated Stenotrophomonas maltophilia isolates. Antimicrob Agents Chemother  2004; 48: 666– 9 Google Scholar CrossRef Search ADS PubMed  Berendonk TU, Manaia CM, Merlin C et al.   Tackling antibiotic resistance: the environmental framework. Nat Rev Microbiol  2015; 13: 310– 17. Berglund B. Environmental dissemination of antibiotic resistance genes and correlation to anthropogenic contamination with antibiotics. Infect Ecol Epidemiol  2015; 5: 28564. Google Scholar CrossRef Search ADS PubMed  Cantas L, Shah SQA, Cavaco LM et al.   A brief multi-disciplinary review on antimicrobial resistance in medicine and its linkage to the global environmental microbiota. Front Microbiol  2013; 4, DOI: https://doi.org/10.3389/fmicb.2013.00096. Chamosa LS, Álvarez VE, Nardelli M et al.   Lateral Antimicrobial Resistance Genetic Transfer is active in the open environment. Sci Rep  2017; 7: 513. Google Scholar CrossRef Search ADS PubMed  Davies J, Davies D. Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev  2010; 74: 417– 33. Google Scholar CrossRef Search ADS PubMed  Dealtry S, Ding G-C, Weichelt V et al.   Cultivation-independent screening revealed hot spots of IncP-1, IncP-7 and IncP-9 plasmid occurrence in different environmental habitats. PLoS One  2014a; 9: e89922. Google Scholar CrossRef Search ADS   Dealtry S, Holmsgaard PN, Dunon V et al.   Shifts in abundance and diversity of mobile genetic elements after the introduction of diverse pesticides into an on-farm biopurification system over the course of a year. Appl Environ Microb  2014b; 80: 4012– 20. Google Scholar CrossRef Search ADS   Dealtry S, Nour EH, Holmsgaard PN et al.   Exploring the complex response to linuron of bacterial communities from biopurification systems by means of cultivation-independent methods. FEMS Microbiol Ecol  2016; 92, DOI: https://doi.org/10.1093/femsec/fiv157. de la Cruz F, Davies J. Horizontal gene transfer and the origin of species: lessons from bacteria. Trends Microbiol  2000; 8: 128– 33. Google Scholar CrossRef Search ADS PubMed  Deng Y, Bao X, Ji L et al.   Resistance integrons: class 1, 2 and 3 integrons. Ann Clin Microb Anti  2015; 14: 45. Google Scholar CrossRef Search ADS   Dunon V, Sniegowski K, Bers K et al.   High prevalence of IncP-1 plasmids and IS1071 insertion sequences in on-farm biopurification systems and other pesticide-polluted environments. FEMS Microbiol Ecol  2013; 86: 415– 31. Google Scholar CrossRef Search ADS PubMed  Eckhardt T. A rapid method for the identification of plasmid deoxyribonucleic acid in bacteria. Plasmid  1978; 1: 584– 588. Google Scholar CrossRef Search ADS PubMed  Fletcher S. Understanding the contribution of environmental factors in the spread of antimicrobial resistance. Environ Health Prev  2015; 20: 243– 52. Google Scholar CrossRef Search ADS   Garcillán-Barcia MP, Francia MV, de La Cruz F. The diversity of conjugative relaxases and its application in plasmid classification. FEMS Microbiol Rev  2009; 33: 657– 87. Google Scholar CrossRef Search ADS PubMed  Gaze WH, Abdouslam N, Hawkey PM et al.   Incidence of class 1 integrons in a quaternary ammonium compound-polluted environment. Antimicrob Agents Ch  2005; 49: 1802– 7. Google Scholar CrossRef Search ADS   Gaze WH, Zhang L, Abdouslam NA et al.   Impacts of anthropogenic activity on the ecology of class 1 integrons and integron-associated genes in the environment. ISME J  2011; 5: 1253– 61. Google Scholar CrossRef Search ADS PubMed  Gillings M, Boucher Y, Labbate M et al.   The evolution of class 1 integrons and the rise of antibiotic resistance. J Bacteriol  2008; 190: 5095– 100. Google Scholar CrossRef Search ADS PubMed  Gillings MR. Integrons: past, present, and future. Microbiol Mol Biol Rev  2014; 78: 257– 77. Google Scholar CrossRef Search ADS PubMed  Gillings MR. Class 1 integrons as invasive species. Curr Opin Microbiol  2017; 38: 10– 5. Google Scholar CrossRef Search ADS PubMed  Gillings MR, Gaze WH, Pruden A et al.   Using the class 1 integron-integrase gene as a proxy for anthropogenic pollution. ISME J  2015; 9: 1269– 79. Google Scholar CrossRef Search ADS PubMed  Gillings MR, Holley MP, Stokes HW. Evidence for dynamic exchange of qac gene cassettes between class 1 integrons and other integrons in freshwater biofilms. FEMS Microbiol Lett  2009; 296: 282– 8. Google Scholar CrossRef Search ADS PubMed  Gomez-Alvarez V, Pfaller S, Pressman JG et al.   Resilience of microbial communities in a simulated drinking water distribution system subjected to disturbances: role of conditionally rare taxa and potential implications for antibiotic-resistant bacteria. Environ Sci-Wat Res  2016; 2: 645– 57. Gravel A, Fournier B, Roy PH. DNA complexes obtained with the integron integrase IntI1 at the attI1 site. Nucleic Acids Res  1998; 26: 4347– 55. Google Scholar CrossRef Search ADS PubMed  Hardwick SA, Stokes HW, Findlay S et al.   Quantification of class 1 integron abundance in natural environments using real-time quantitative PCR. FEMS Microbiol Lett  2008; 278: 207– 12. Google Scholar CrossRef Search ADS PubMed  Harrison E, Brockhurst MA. Plasmid-mediated horizontal gene transfer is a coevolutionary process. Trends Microbiol  2012; 20: 262– 7. Google Scholar CrossRef Search ADS PubMed  Heuer H, Binh CT, Jechalke S et al.   IncP-1ε plasmids are important vectors of antibiotic resistance genes in agricultural systems: diversification driven by Class 1 Integron gene cassettes. Front Microbiol  2012; 3: 2. Google Scholar CrossRef Search ADS PubMed  Hoa PT, Nonaka L, Viet PH, Suzuki S. Detection of the sul1, sul2, and sul3 genes in sulfonamide-resistant bacteria from wastewater and shrimp ponds of north Vietnam. Sci Total Environ  2008; 405: 377– 84. Google Scholar CrossRef Search ADS PubMed  Holmsgaard PN, Dealtry S, Dunon V et al.   Response of the bacterial community in an on-farm biopurification system, to which diverse pesticides are introduced over an agricultural season. Environ Pollut  2017; 229: 854– 62. Google Scholar CrossRef Search ADS PubMed  Jechalke S, Schreiter S, Wolters B et al.   Widespread dissemination of class 1 integron components in soils and related ecosystems as revealed by cultivation-independent analysis. Front Microbiol  2013; 4: 420. Google Scholar PubMed  Jechalke S, Schreiter S, Wolters B et al.   Widespread dissemination of class 1 integron components in soils and related ecosystems as revealed by cultivation-independent analysis. Front Microbiol  2014; 4: 420. Google Scholar CrossRef Search ADS PubMed  Jones-Dias D, Manageiro V, Ferreira E et al.   Architecture of class 1, 2, and 3 integrons from gram negative bacteria recovered among fruits and vegetables. Frontiers in microbiology  2016; 7, Doi: https://doi.org/10.3389/fmicb.2016.01400. Klümper U, Riber L, Dechesne A et al.   Broad host range plasmids can invade an unexpectedly diverse fraction of a soil bacterial community. ISME J  2015; 9: 934– 45. Google Scholar CrossRef Search ADS PubMed  Koczura R, Mokracka J, Taraszewska A et al.   Abundance of Class 1 integron-integrase and sulfonamide resistance genes in river water and sediment is affected by anthropogenic pressure and environmental factors. Microb Ecol  2016; 72: 909– 16. Google Scholar CrossRef Search ADS PubMed  Martínez JL. Natural antibiotic resistance and contamination by antibiotic resistance determinants: the two ages in the evolution of resistance to antimicrobials. Front Microbiol  2012; 3: 1. Google Scholar CrossRef Search ADS PubMed  Martini MC, Albicoro FJ, Nour E et al.   Characterization of a collection of plasmid-containing bacteria isolated from an on-farm biopurification system used for pesticide removal. Plasmid  2015; 80: 16– 23. Google Scholar CrossRef Search ADS PubMed  Mazel D, Dychinco B, Webb VA, Davies J. Antibiotic resistance in the ECOR collection: integrons and identification of a novel aad gene. Antimicrob Agents Chemother  2000; 44: 1568– 74. Google Scholar CrossRef Search ADS PubMed  Mazel D. Integrons: agents of bacterial evolution. Nat Rev Microbiol  2006; 4: 608– 20. Google Scholar CrossRef Search ADS PubMed  Messier N, Roy PH. Integron integrases possess a unique additional domain necessary for activity. J Bacteriol  2001; 183: 6699– 706. Google Scholar CrossRef Search ADS PubMed  Monkiedje A, Zuehlke S, Maniepi SJN et al.   Elimination of racemic and enantioenriched metalaxyl based fungicides under tropical conditions in the field. Chemosphere  2007; 69: 655– 63. Google Scholar CrossRef Search ADS PubMed  Nandi S, Maurer JJ, Hofacre C et al.   Gram-positive bacteria are a major reservoir of Class 1 antibiotic resistance integrons in poultry litter. P Natl Acad Sci USA  2004; 101: 7118– 22. Google Scholar CrossRef Search ADS   Nardelli M, Scalzo PM, Ramírez MS et al.   Class 1 integrons in environments with different degrees of urbanization. PLoS One  2012; 7: e39223. Google Scholar CrossRef Search ADS PubMed  Nemergut DR, Martin AP, Schmidt SK. Integron diversity in heavy-metal-contaminated mine tailings and inferences about integron evolution. Appl Environ Microb  2004; 70: 1160– 8. Google Scholar CrossRef Search ADS   Nield BS, Holmes AJ, Gillings MR et al.   Recovery of new integron classes from environmental DNA. FEMS Microbiol Lett , 2001; 195: 59– 65 Google Scholar CrossRef Search ADS PubMed  Novick RP, Clowes RC, Cohen SN et al.   Uniform nomenclature for bacterial plasmids: a proposal. Bacteriol Rev  1976; 40: 168– 89. Google Scholar PubMed  Nour EH, Elsayed TR, Springael D et al.   Comparable dynamics of linuron catabolic genes and IncP-1 plasmids in biopurification systems (BPSs) as a response to linuron spiking. Appl Microbiol Biot  2017; 101: 4815– 25. Google Scholar CrossRef Search ADS   Orman BE, Pineiro SA, Arduino S et al.   Evolution of multiresistance in nontyphoid Salmonella serovars from 1984 to 1998 in Argentina. Antimicrob Agents Chemother  2002, 46: 3963– 70. Google Scholar CrossRef Search ADS PubMed  Parent R, Roy PH. The chloramphenicol acetyltransferase gene of Tn2424: a new breed of cat. J Bacteriol  1992; 174: 2891– 7. Google Scholar CrossRef Search ADS PubMed  Partridge SR, Tsafnat G, Coiera E et al.   Gene cassettes and cassette arrays in mobile resistance integrons. FEMS Microbiol Rev  2009; 33: 757– 84. Google Scholar CrossRef Search ADS PubMed  Perry J, Wright G. The antibiotic resistance “mobilome”: searching for the link between environment and clinic. Front Microbiol  2013; 4: 138. Google Scholar CrossRef Search ADS PubMed  Quiroga MP, Andres P, Petroni A et al.   Complex Class 1 Integrons with Diverse Variable Regions, Including aac(6')-Ib-cr, and a Novel Allele, qnrB10, Associated with ISCR1 in Clinical Enterobacterial Isolates from Argentina. Antimicrob Agents Chemother  2007; 51: 4466– 70. Google Scholar CrossRef Search ADS PubMed  Quiroga MP, Arduino SM, Merkier AK et al.   Distribution and functional identification of complex class 1 integrons. Infect Genet Evol  2013; 19: 88– 96. Google Scholar CrossRef Search ADS PubMed  Rosewarne CP, Pettigrove V, Stokes HW et al.   Class 1 integrons in benthic bacterial communities: abundance, association with Tn402-like transposition modules and evidence for coselection with heavy-metal resistance. FEMS Microbiol Ecol  2010; 72: 35– 46. Google Scholar CrossRef Search ADS PubMed  Rosser SJ, Young H-K. Identification and characterization of class 1 integrons in bacteria from an aquatic environment. J Antimicrob Chemoth  1999; 44: 11– 8. Google Scholar CrossRef Search ADS   Rowe-Magnus DA, Guerout AM, Ploncard P et al.   The evolutionary history of chromosomal super-integrons provides an ancestry for multiresistant integrons. P Natl Acad Sci USA  2001; 98: 652– 7. Google Scholar CrossRef Search ADS   Shintani M, Sanchez ZK, Kimbara K. Genomics of microbial plasmids: classification and identification based on replication and transfer systems and host taxonomy. Front Microbiol  2015; 6: 242. Google Scholar CrossRef Search ADS PubMed  Sniegowski K, Bers K, Van Goetem K et al.   Improvement of pesticide mineralization in on-farm biopurification systems by bioaugmentation with pesticide-primed soil. FEMS Microbiol Ecol  2011; 76: 64– 73. Google Scholar CrossRef Search ADS PubMed  Stalder T, Barraud O, Casellas M et al.   Integron involvement in environmental spread of antibiotic resistance. Front Microbiol  2012; 3: 119. Google Scholar CrossRef Search ADS PubMed  Stokes HW, Nesbø CL, Holley M et al.   Class 1 integrons potentially predating the association with Tn402-like transposition genes are present in a sediment microbial community. J Bacteriol  2006; 188: 5722– 30. Google Scholar CrossRef Search ADS PubMed  Sukul P, Zühlke S, Lamshöft M et al.   Dissipation and metabolism of 14 C-spiroxamine in soil under laboratory condition. Environ Pollut  2010; 158: 1542– 50. Google Scholar CrossRef Search ADS PubMed  von Wintersdorff CJH, Penders J, van Niekerk JM et al.   Dissemination of antimicrobial resistance in microbial ecosystems through horizontal gene transfer. Front Microbiol  2016; 7, DOI: https://doi.org/10.3389/fmicb.2016.00173. Wang C, Cai P, Guo Y et al.   Distribution of the antiseptic-resistance genes qacEΔ1 in 331 clinical isolates of Pseudomonas aeruginosa in China. J Hosp Infect  2007; 66: 93– 5. Google Scholar CrossRef Search ADS PubMed  Wright MS, Baker-Austin C, Lindell AH et al.   Influence of industrial contamination on mobile genetic elements: class 1 integron abundance and gene cassette structure in aquatic bacterial communities. ISME J  2008; 2: 417– 28. Google Scholar CrossRef Search ADS PubMed  Wu S, Dalsgaard A, Hammerum AM et al.   Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human. Acta Vet Scand  2010, 52: 47. Google Scholar CrossRef Search ADS PubMed  © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Journal

FEMS Microbiology EcologyOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off