NLRP3 Inflammasome Activation Mediates Zika Virus–Associated Inflammation

NLRP3 Inflammasome Activation Mediates Zika Virus–Associated Inflammation Abstract Zika virus (ZIKV) is a mosquito-borne virus that has been identified as a cause of several severe disease manifestations, including congenital microcephaly and Guillain-Barré syndrome, meningoencephalitis, and myelitis. Previous studies showed that ZIKV-infected patients exhibited elevated plasma levels of interleukin 1β (IL-1β), indicating that ZIKV may activate inflammasomes. However, the molecular basis for its viral pathogenesis remains poorly understood. In this current study, we found that ZIKV infection caused severe inflammatory pathological changes and promoted IL-1β production in vitro and in vivo. We here demonstrate that the maturation and secretion of IL-1β during ZIKV infection was mediated by NLRP3 inflammasome activation and that ZIKV nonstructural protein 5 (NS5) facilitated the assembly of the NLRP3 inflammasome complex, leading to IL-1β activation through interaction with NLRP3 and induction of reactive oxygen species production. Collectively, our data identify NLRP3 inflammasome–derived IL-1β production as a critical feature of inflammation during ZIKV infection. These findings offer new insights into inflammasome-mediated diseases and may provide new therapeutic options for ZIKV-associated diseases. Zika virus, NS5, NLRP3 inflammasome, interleukin-1 beta Zika virus (ZIKV) belongs to the family Flaviviridae (genus Flavivirus) and is transmitted by Aedes mosquitoes. Although symptomatic ZIKV infection in humans generally involves a mild, self-limited acute febrile illness associated with rash, arthralgia, and conjunctivitis, some patients develop more-severe neurological complications, such as congenital microcephaly and Guillain-Barré syndrome, meningoencephalitis, and myelitis [1–4]. Recent studies have revealed an increase in the levels of proinflammatory cytokines, such as interleukin 1β (IL-1β), interferon γ (IFN-γ), interleukin 6 (IL-6), and interleukin 8 (IL-8), in ZIKV-infected patients, compared with healthy people [5]. These observations indicate that the inflammatory response may contribute to the ZIKV-associated diseases. However, the mechanisms by which ZIKV stimulates inflammatory signaling are not defined. The proinflammatory cytokine IL-1β is a central component of the cytokine milieu and plays an important role in fever, septic shock, and inflammatory diseases. The generation of mature active IL-1β requires cleavage of the precursor, pro–IL-1β, by the inflammasome [6]. The inflammasome is a large multiprotein complex that senses infection or danger stimuli in the cell and controls the maturation and secretion of IL-1β and IL-18 [6]. Several types of inflammasomes have been identified, of which the nucleotide and oligomerization domain, leucine-rich repeat-containing protein family, pyrin-containing domain 3 (NLRP3) inflammasome is the most studied and best characterized [7]. Upon activation and oligomerization, NLRP3 interacts with the caspase-recruitment domain (CARD) molecule known as adaptor molecule apoptosis-associated speck-like protein containing CARD (ASC). Clustered ASCs in turn recruit pro–caspase 1 via a CARD-CARD interaction and induce the autoproteolytic conversion of the proenzyme into active caspase 1 [8]. Activated caspase 1 leads to the cleavage and release of mature IL-1β and IL-18 [9]. Activation of the NLRP3 inflammasome and IL-1β release mediate host protection against pathogen invasions. However, hyperactivation of the NLRP3 inflammasome contributes to the pathogenesis of inflammatory diseases, such as viral encephalitis and viral fulminant hepatitis [10–12]. Activation of the NLRP3 inflammasome requires signals at both the transcriptional and posttranslational levels. The first signal leads to synthesis of pro–IL-1β and other components of the inflammasome, such as NLRP3, through the Toll-like receptor/nuclear factor κB pathway. The second signal is transduced by various pathogen-associated molecular patterns and damage-associated molecular patterns to activate the assembly of the NLRP3 inflammasome, caspase 1 activation, and IL-1β secretion [13]. Several molecular mechanisms have been indicated for NLRP3 activation to induce caspase 1 activation and IL-1β maturation. These include the generation of mitochondrial reactive oxygen species (ROS), the efflux of potassium (K+), and the influx of calcium ions (Ca2+) [14]. In the present study, we show that mice infected with ZIKV exhibited severe inflammatory pathology and high levels of IL-1β in the serum and brain. We also show that the maturation and secretion of IL-1β during ZIKV infection was mediated by NLRP3 inflammasome activation. In addition, ZIKV nonstructural protein 5 (NS5) was identified to interact with NLRP3 and facilitate the assembly of the NLRP3 inflammasome complex and lead to IL-1β activation. Moreover, the generation of ROS was critical for NLRP3 inflammasome activation during ZIKV infection. Thus, our findings reveal the physiopathologic relevance of the NLRP3 inflammasome during ZIKV infection, which may provide therapeutic targets for anti-ZIKV treatment. MATERIALS AND METHODS Mice Type I IFN receptor–deficient (Ifnar1−/−) mice and Nlrp3−/− mice with the C57BL/6 background were bred in pathogen-free animal facilities at Sun Yat-Sen University (SYSU). Mice approximately 5 weeks of age were used for these experiments. Ethics Statement All animal studies were approved by the SYSU Institutional Animal Care and Use Committee (SYSU IACUC) under the protocol number 2017–118, and all animal experiments were performed in accordance with Animal Research: Reporting of In Vivo Experiments guidelines and guidelines approved by SYSU IACUC and were conducted in a laboratory designed to ensure biological safety. Cell Culture The human monocytic cell line THP-1 (purchased from the Cell Bank of the Chinese Academy of Sciences, Shanghai, China) was cultured at 37°C in 5% CO2 in Roswell Park Memorial Institute 1640 medium supplemented with 10% fetal bovine serum (FBS; Gibco, Carlsbad, CA). THP-1 cells were differentiated into macrophages by exposure to 100 ng/mL phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich, St. Louis, MO) for 24 hours, and cells were cultured for 24 hours without PMA. 293T cells and Vero cells (both obtained from the Cell Bank of the Chinese Academy of Sciences) and 293FT cells (Invitrogen, Carlsbad, CA) were maintained at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium supplemented with 10% FBS, 2 mM L-glutamine, 100 μg/mL streptomycin, and 100 U/mL penicillin (Gibco). Aedes albopictus C6/36 cells (ATCC CRL-1660) were maintained at 28°C in 5% CO2 in Dulbecco’s modified Eagle’s medium supplemented with 10% FBS. Bone marrow–derived macrophages (BMDMs) were prepared as previously described [24] and were cultured in Roswell Park Memorial Institute 1640 medium with 10% FBS and recombinant mouse macrophage colony-stimulating factor (50 ng/mL; Novus, Littleton, CO). Virus and Infection The Asian lineage ZIKV SZ01 strain (GenBank accession number KU866423) was amplified in C6/36 cells. For preparation of UV ray–inactivated ZIKV, the virus was dispersed in a tissue culture dish, and a compact UV lamp was placed directly above the dish for 30 minutes. Heat-inactivated ZIKV was prepared by incubating the virus at 65°C for 30 minutes to completely inhibit ZIKV activity. Virus stocks were titrated by standard plaque assays on Vero cells [25]. To inhibit caspase 1 and NLRP3 activation, cells were pretreated with AC-YVAD-CHO (Cayman Chemical, Ann Arbor, MI) and glyburide (Target Molecule, Boston, MA), respectively, for 30 minutes. The cells were then infected with ZIKV in the presence of AC-YVAD-CHO or glyburide for 1 hour at 37 ℃, washed with phosphate-buffered saline (PBS), and cultured with medium containing AC-YVAD-CHO or glyburide. In Vivo Murine Infections Mice were infected intraperitoneally according to a previously described method [25]. Briefly, 1 × 105 plaque-forming units of ZIKV in a volume of 100 μL was injected intraperitoneally into 5-week-old Ifnar1−/− mice, which were monitored daily for morbidity and mortality. Mice with neurological changes were evaluated as previously described to assess their clinical scores, which were graded according to the severity of illness, as follows: 0 for healthy; 1 for minor illness, including weight loss, reduced mobility, and a hunchbacked body orientation; 2 for limbic seizure; 3 for moving with difficulty and anterior limb or posterior limb weakness; 4 for paralysis; and 5 for death [26]. Histological Analysis Mouse brain tissues were harvested and fixed in 4% paraformaldehyde for 24 hours at room temperature. The fixed tissues were dehydrated, embedded in paraffin, sectioned, rehydrated, and stained with hematoxylin and eosin (H/E). The H/E-stained sections were evaluated for viral-induced neuropathology. Plasmid Construction The lentivirus vector pSin4-EF2-IRES-Pur was modified by introducing certain restriction enzyme cutting sites (BamHI-EcoRI-BstbI-NdeI-NheI-SpeI) into the multiple cloning site. To generate lentiviruses expressing Flag-tagged ZIKV C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5 proteins, the full-length complementary DNA encoding each viral protein was amplified by reverse-transcription polymerase chain reaction (RT-PCR) analysis and cloned into the pSin4-EF2-IRES-Pur vector. A plasmid encoding human NLRP3 with an N-terminal Myc epitope tag was amplified by RT-PCR and cloned into the KpnI and XbaI sites of the pcDNA3.1 vector. Full-length ZIKV NS5 and its truncated forms, the methyltransferase domain and the RNA-dependent RNA polymerase (RdRp) domain, with N-terminal 6×His epitope tags were amplified by PCR and cloned into the KpnI and XbaI sites of the pcDNA3.1 vector. All constructs were verified by DNA sequencing. Lentivirus Production and Infection For virus production, a pSin4-EF2-IRES-Pur vector encoding each viral protein was transfected into 293FT cells together with the packaging plasmid psPAX2 and the envelope-coding plasmid pMD2.G, using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. Forty-eight hours after transfection, the supernatants were collected, centrifuged at 500×g for 10 minutes, and filtered through 0.45-μm filters. Cells were infected overnight with the supernatants containing lentiviral particles. Culture supernatants were collected 24 hours after infection and assayed for IL-1β by an enzyme-linked immunosorbent assay (ELISA). ELISA Concentrations of human and murine cytokines were determined according to the manufacturers’ instructions with following ELISA kits from eBiosciences (San Diego, CA), for IL-1β and IL-18; Raybiotech (Norcross, GA), for TNF-α and IL-6; and R&D Systems (Minneapolis, MN), for monocyte chemoattractant protein 1. Western Blotting Tissue specimens obtained from mouse brains or cells were lysed with RIPA lysis buffer (Millipore, Bedford, MA) containing a cocktail of protease and phosphatase inhibitors (Sigma-Aldrich). Protein samples were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto a polyvinylidene difluoride membrane. The membranes were probed with the following primary antibodies: anti-IL-1β, anti-NLRP3, and anti-caspase 1 (all from Cell Signaling, Danvers, MA); anti-ZIKV envelope protein and anti-ZIKV NS5 (both from BioFront Technologies, Tallahassee, FL); anti-ASC (Santa Cruz Biotechnology, Dallas, TX); anti-human β-actin (Sigma-Aldrich). Membranes were incubated with horseradish peroxidase–conjugated secondary antibodies, and signals were detected by enhanced chemiluminescence, using a commercial kit (Thermo Fisher Scientific, Rockford, IL) according to the manufacturer’s suggested protocols. ASC Oligomerization Detection ASC pyroptosomes were detected as previously reported [27]. Briefly, cells were pelleted by centrifugation and resuspended in 0.5 mL of ice-cold buffer containing 50 mM Tris (pH 7.5), 150 mM NaCl, 1% NP40, 5 mM ethylenediaminetetraacetic acid (EDTA), and 10% glycerol. The cell lysates were then centrifuged at 6000×g for 15 minutes at 4°C, and the supernatants were mixed with sodium dodecyl sulfate loading buffer for Western blotting. The pellets were washed 3 times with PBS and resuspended in 500 μL of PBS. Next, the resuspended pellets were cross-linked with fresh disuccinimidyl suberate (4 mM; Sigma-Aldrich) at 37°C for 30 minutes. The cross-linked samples were then centrifuged and mixed with sodium dodecyl sulfate loading buffer for Western blotting. Viral RNA Isolation and Transfection Viral RNA was extracted from the supernatant of ZIKV-infected or mock-infected C6/36 cells 48 hours after infection, using a QIAamp Viral RNA Kit (Qiagen, Hilden, Germany). The concentration of the viral RNA was determined by a NanoDrop spectrophotometer (Thermo Fisher Scientific). PMA-differentiated human THP-1 macrophages were transfected with RNA from infected or mock-infected C6/36 cells or with poly(dA:dT) (10 μg/mL; Invivogen, San Diego, CA) using Lipofectamine 3000 (Invitrogen). The concentrations of IL-1β in the cell-free supernatants were measured 24 hours after transfection. Small Interfering RNA (siRNA) Synthesis and Transfection Control siRNA and gene-specific siRNAs were purchased from RiBoBio (Guangzhou, China). The targeting sequences of siRNA for human NLRP3, ASC, and caspase 1 were CAGGTTTGACTATCTGTTCT, GATGCGGAAGCTCTTCAGTTTCA, and GTGAAGAGATCCTTCTGTA, respectively. The siRNA was delivered into the cells by using Lipofectamine 3000 transfection reagent (Invitrogen). Measurement of ROS Production Intracellular ROS levels were measured by staining cells with 5-(and-6)-chloromethyl-2’,7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA) dye (Sigma-Aldrich). An ROS inhibitor, diphenyleneiodonium chloride (DPI; Sigma-Aldrich), was used as the control. Briefly, cells were incubated with or without 1 μM DPI for 4 hours, followed by vector-virus infection. Twenty-four hours after challenge, the cells were stained with a solution containing CM-H2DCFDA dye (5 μM). Cells were then observed under a Zeiss Axio Imager Z2 microscope and analyzed with ZEN software (Carl Zeiss MicroImaging, Jena, Germany). Coimmunoprecipitation Assay 293T cells transfected with vector plasmids were lysed with protein lysis buffer containing 25 mM HEPES, 150 mM NaCl, 1 mM EDTA, 2% glycerol, 1% NP40, and a cocktail of protease and phosphatase inhibitors (Sigma-Aldrich). Lysates were incubated with the anti-His antibody (Abcam, Cambridge, MA) or mouse immunoglobulin G antibody overnight at 4°C. Subsequently, precipitates were washed 5 times with wash buffer containing 20 mM HEPES, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 2% glycerol, and 0.1% NP-40; resuspended in sampling buffer; and examined by Western blotting. Statistical Analyses The results are expressed as mean values (±standard deviations). Statistical analyses were performed on triplicate experiments, using a 2-tailed Student t test. RESULTS ZIKV Infection Causes Severe Pathology That Precedes Lethality in Mice To study the interplay between ZIKV and the host immune system, we used Ifnar1−/− mice to generate a ZIKV infection model in vivo. ZIKV was injected intraperitoneally into 5-week-old mice. The survival rate in the ZIKV-infected mice was 33% on day 8 after infection, and all the mice died by day 9 after infection (Figure 1A). In addition, during ZIKV infection, significant loss of body weight occurred by day 5 after infection (Figure 1B). Moreover, mice infected with ZIKV developed neurological disease symptoms, including lethargy, hunched posture, hind limb weakness, and paralysis (Figure 1C), and high viral loads were noted, indicating a strong neurotropism of ZIKV (Figure 1D). Histopathological examination showed diffuse meningeal infiltration by a mixture of neutrophils and mononuclear cells in the cerebrum. Several perivascular cuffs of mononuclear cells, microglial cells, and vasculitis were widely observed in the neuropil of the cerebral cortex (Figure 2). These findings indicate progressive meningoencephalitis caused by ZIKV infection. Figure 1. View largeDownload slide Zika virus (ZIKV) infection causes lethality in mice. A, Ifnar1−/− mice were infected with 1 × 105 plaque-forming units of ZIKV strain SZ01 intraperitoneally and monitored for survival over 10 days (n = 6). B and C, Changes in weight (B) and clinical score (C) were calculated daily for ZIKV- and mock-infected mice. D, Plaque assays for viral titers in the brain tissues of mice were performed on day 8 after infection (n = 4). Figure 1. View largeDownload slide Zika virus (ZIKV) infection causes lethality in mice. A, Ifnar1−/− mice were infected with 1 × 105 plaque-forming units of ZIKV strain SZ01 intraperitoneally and monitored for survival over 10 days (n = 6). B and C, Changes in weight (B) and clinical score (C) were calculated daily for ZIKV- and mock-infected mice. D, Plaque assays for viral titers in the brain tissues of mice were performed on day 8 after infection (n = 4). Figure 2. View largeDownload slide Zika virus (ZIKV) infection triggers severe pathology in the brain. Histopathological changes were evaluated in the cerebral cortex. Brain tissue sections obtained from ZIKV-infected mice showed meningoencephalitis characterized by infiltration of immune cells in the meninges (black arrows) and perivascular cuffing (PC). Original magnification, 100× (upper panels) and 400× (lower panels). Figure 2. View largeDownload slide Zika virus (ZIKV) infection triggers severe pathology in the brain. Histopathological changes were evaluated in the cerebral cortex. Brain tissue sections obtained from ZIKV-infected mice showed meningoencephalitis characterized by infiltration of immune cells in the meninges (black arrows) and perivascular cuffing (PC). Original magnification, 100× (upper panels) and 400× (lower panels). ZIKV Infection Induces IL-1β Secretion In Vivo and In Vitro We next examined whether the proinflammatory cytokines were induced by ZIKV infection. Notably, a significant increase in IL-1β levels was observed in both brain tissue and serum samples from infected mice (Figure 3A and B). In addition, the levels of IL-6, IL-18, TNF-α, and monocyte chemoattractant protein 1 were also assessed in both sample types (Supplemental Figure 1). Because IL-1β is a central component of the cytokine milieu and plays an important role in many immune reactions, we next used PMA-differentiated human THP-1 macrophages to verify the induction of IL-1β production by ZIKV infection. As shown in Figure 3C, the amount of IL-1β secretion increased in a multiplicity of infection–dependent manner. Lipopolysaccharide (LPS)/ATP stimuli served as a positive control in these experiments. Furthermore, time-course assays showed increased IL-1β secretion (Figure 3D). Overall, the above results indicated that ZIKV infection induces IL-1β production both in vivo and in vitro. Figure 3. View largeDownload slide Zika virus (ZIKV) infection induces interleukin 1β (IL-1β) production in vivo and in vitro. A and B, Examination of IL-1β expression in mock- and ZIKV-infected brain tissue (A) and serum (B) samples obtained from mice 5 days after infection (n = 4 per group), as determined by an enzyme-linked immunosorbent assay (ELISA). Expression of mature IL-1β in the supernatants of PMA-differentiated human THP-1 macrophages infected with ZIKV at multiplicities of infection of 1, 5, and 10 (C) or at different time points (D), as determined by an ELISA. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. LPS, lipopolysaccharide. *P < .05 and **P < .01. Figure 3. View largeDownload slide Zika virus (ZIKV) infection induces interleukin 1β (IL-1β) production in vivo and in vitro. A and B, Examination of IL-1β expression in mock- and ZIKV-infected brain tissue (A) and serum (B) samples obtained from mice 5 days after infection (n = 4 per group), as determined by an enzyme-linked immunosorbent assay (ELISA). Expression of mature IL-1β in the supernatants of PMA-differentiated human THP-1 macrophages infected with ZIKV at multiplicities of infection of 1, 5, and 10 (C) or at different time points (D), as determined by an ELISA. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. LPS, lipopolysaccharide. *P < .05 and **P < .01. NLRP3 Inflammasome Is Involved in ZIKV-Induced IL-1β Secretion Previous studies have demonstrated that IL-1β maturation and secretion are mediated by cleavage of caspase 1 under the control of the inflammasome [6]. We next determined the direct indicators of inflammasome activation, caspase 1 cleavage and ASC pyroptosome formation, in ZIKV-infected cells. As shown in Figure 4A, there was a ZIKV-induced increase in cleaved caspase 1 levels and mature IL-1β levels. An ASC oligomer was formed after ZIKV infection (Figure 4A). LPS/ATP stimuli served as a positive control in these experiments. Moreover, we observed that the caspase 1 inhibitor AC-YVAD-CHO and the NLRP3 inhibitor glyburide significantly reduced ZIKV-induced IL-1β production, suggesting that ZIKV-induced IL-1β production was dependent on caspase 1 and NLRP3 (Figure 4B). The above results were further confirmed by using siRNAs to silence the expression of NLRP3, ASC, and caspase 1 in cells before ZIKV infection (Figure 4C). Moreover, mouse BMDMs deficient for NLRP3 exhibited decreased secretion of IL-1β, compared with wild-type cells, when infected with ZIKV (Figure 4D). Western blotting confirmed knockdown of genes encoding NLRP3, ASC, and caspase 1 and knockout of NLRP3 at the protein level (Supplementary Figure 2). Together, these data suggest that ZIKV infection activates the NLRP3 inflammasome and that the activity of NLRP3 is required for ZIKV-induced IL-1β secretion. Figure 4. View largeDownload slide Zika virus (ZIKV) infection triggers NLRP3 inflammasome activation and interleukin 1β (IL-1β) maturation. A, Examination of mature IL-1β in the supernatants (Sup) and caspase 1 in the cell lysates (Lys) of THP-1 macrophages treated with ZIKV or lipopolysaccharide (LPS)/ATP, using Western blotting. ASC oligomerization in THP-1 macrophages infected with ZIKV or treated with lipopolysaccharide (LPS)/ATP was determined by Western blotting. B, THP-1 macrophages were infected with ZIKV or treated with LPS/ATP in the presence or absence of AC-YVAD-CHO (yVAD; 5 or 50 μM) or glyburide (2.5 or 25 μg/mL) for 48 hours. Sup were harvested for the detection of IL-1β with an enzyme-linked immunosorbent assay (ELISA). C, Release of IL-1β in Sup of THP-1 macrophages transfected with small interfering RNAs (siRNAs) targeting NLRP3, caspase 1, and ASC after ZIKV infection was evaluated by an ELISA. Stimulation with 1 μg/mL LPS and 5 mM ATP (LPS/ATP) served as a positive control. D, Bone marrow–derived macrophages (BMDMs) prepared from bone marrow cells from C57BL/6 wild-type (WT) and Nlrp3−/− mice were infected with ZIKV at a multiplicity of infection of 1. Sup were collected 24 hours after infection, and IL-1β was analyzed with an ELISA. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. Abbreviation: IB, immunoblotting. Figure 4. View largeDownload slide Zika virus (ZIKV) infection triggers NLRP3 inflammasome activation and interleukin 1β (IL-1β) maturation. A, Examination of mature IL-1β in the supernatants (Sup) and caspase 1 in the cell lysates (Lys) of THP-1 macrophages treated with ZIKV or lipopolysaccharide (LPS)/ATP, using Western blotting. ASC oligomerization in THP-1 macrophages infected with ZIKV or treated with lipopolysaccharide (LPS)/ATP was determined by Western blotting. B, THP-1 macrophages were infected with ZIKV or treated with LPS/ATP in the presence or absence of AC-YVAD-CHO (yVAD; 5 or 50 μM) or glyburide (2.5 or 25 μg/mL) for 48 hours. Sup were harvested for the detection of IL-1β with an enzyme-linked immunosorbent assay (ELISA). C, Release of IL-1β in Sup of THP-1 macrophages transfected with small interfering RNAs (siRNAs) targeting NLRP3, caspase 1, and ASC after ZIKV infection was evaluated by an ELISA. Stimulation with 1 μg/mL LPS and 5 mM ATP (LPS/ATP) served as a positive control. D, Bone marrow–derived macrophages (BMDMs) prepared from bone marrow cells from C57BL/6 wild-type (WT) and Nlrp3−/− mice were infected with ZIKV at a multiplicity of infection of 1. Sup were collected 24 hours after infection, and IL-1β was analyzed with an ELISA. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. Abbreviation: IB, immunoblotting. ZIKV NS5 Is Sufficient to Trigger Inflammasome Activation We next investigated whether viral replication is required for NLRP3 inflammasome activation by ZIKV. As shown in Figure 5A, UV ray– or heat-inactivated ZIKV failed to induce IL-1β secretion from THP-1 macrophages, indicating that ZIKV replication is required to activate the NLRP3 inflammasome. Additionally, we stimulated cells with control RNA, ZIKV genomic RNA, and, as a positive control, poly(dA:dT). The investigation showed that ZIKV genomic RNA transfection failed to induce IL-1β production (Figure 5A). To further determine whether the ZIKV protein activated the NLRP3 inflammasome, we transduced THP-1 macrophages with lentiviruses expressing the 10 ZIKV proteins separately. We found that IL-1β was significantly induced by NS5 but not by the other proteins tested (Figure 5B). Moreover, we found that THP-1 macrophages transduced with the NS5-expressing lentivirus triggered an increase in cleaved caspase 1 levels and mature IL-1β levels (Figure 5C) and the formation of ASC oligomer (Figure 5D). LPS/ATP stimulation served as a positive control in these experiments. Thus, these findings indicate that the expression of ZIKV NS5 is sufficient to activate the NLRP3 inflammasome. Figure 5. View largeDownload slide Zika virus (ZIKV) NS5 protein promotes inflammasome activation. A, Interleukin 1β (IL-1β) expression in the supernatants (Sup) of THP-1 macrophages that were incubated with UV-inactivated ZIKV, heat-inactivated ZIKV, or live ZIKV. THP-1 macrophages were transfected with control RNA from uninfected C6/36 Sup (Ctrl RNA; 10 μg/mL), ZIKV genomic RNA from infected C6/36 Sup (ZIKV RNA; 10 μg/mL), or 10 μg/mL poly(dA:dT) (positive Ctrl) for 24 hours. Sup were collected and used for the detection of IL-1β secretion by an enzyme-linked immunosorbent assay (ELISA). B, THP-1 macrophages were infected with lentivirus expressing ZIKV C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5, or vector Ctrl. Sup were collected 24 hours after infection and analyzed for IL-1β by an ELISA. C, THP-1 macrophages were infected with lentivirus expressing ZIKV NS5 or a vector Ctrl for 24 hours. The mature IL-1β in Sup and cleaved caspase 1, pro–IL-1β, pro–caspase 1, and viral NS5 in cell lysates (Lys) were analyzed by Western blotting. D, ASC oligomerization in THP-1 macrophages infected with vector Ctrl or ZIKV NS5-encoding lentivirus was determined by Western blotting. Stimulation with 1 μg/mL lipopolysaccharide (LPS) and 5 mM ATP (LPS/ATP) served as a positive Ctrl. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. Abbreviation: IB, immunoblotting. Figure 5. View largeDownload slide Zika virus (ZIKV) NS5 protein promotes inflammasome activation. A, Interleukin 1β (IL-1β) expression in the supernatants (Sup) of THP-1 macrophages that were incubated with UV-inactivated ZIKV, heat-inactivated ZIKV, or live ZIKV. THP-1 macrophages were transfected with control RNA from uninfected C6/36 Sup (Ctrl RNA; 10 μg/mL), ZIKV genomic RNA from infected C6/36 Sup (ZIKV RNA; 10 μg/mL), or 10 μg/mL poly(dA:dT) (positive Ctrl) for 24 hours. Sup were collected and used for the detection of IL-1β secretion by an enzyme-linked immunosorbent assay (ELISA). B, THP-1 macrophages were infected with lentivirus expressing ZIKV C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5, or vector Ctrl. Sup were collected 24 hours after infection and analyzed for IL-1β by an ELISA. C, THP-1 macrophages were infected with lentivirus expressing ZIKV NS5 or a vector Ctrl for 24 hours. The mature IL-1β in Sup and cleaved caspase 1, pro–IL-1β, pro–caspase 1, and viral NS5 in cell lysates (Lys) were analyzed by Western blotting. D, ASC oligomerization in THP-1 macrophages infected with vector Ctrl or ZIKV NS5-encoding lentivirus was determined by Western blotting. Stimulation with 1 μg/mL lipopolysaccharide (LPS) and 5 mM ATP (LPS/ATP) served as a positive Ctrl. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. Abbreviation: IB, immunoblotting. ZIKV NS5 Binds with NLRP3 Through Its RdRp Domain Further, we examined whether ZIKV NS5 could induce IL-1β secretion in Nlrp3−/− cells. As shown in Figure 6A, lentivirus expressing ZIKV NS5 triggered an increase of IL-1β secretion in BMDMs of C57BL/6 WT mice but not in those of Nlrp3−/− mice. We next performed coimmunoprecipitation assays to investigate whether ZIKV NS5 activates the NLRP3 inflammasome through interaction with NLRP3. We observed that ZIKV NS5 bound to NLRP3 (Figure 6B). To further map the NS5 domains involved in NLRP3 binding, we generated constructs that contain the methyltransferase domain and the RdRp domain of NS5. Our coimmunoprecipitation assays showed that RdRp could pull down NLRP3 (Figure 6C), suggesting that ZIKV NS5 interacts with NLRP3 through its RdRp domain. Figure 6. View largeDownload slide Zika virus (ZIKV) NS5 interacts with NLRP3 through its RdRp domain. A, Bone marrow–derived macrophages (BMDMs) prepared from bone marrow cells of C57BL/6 wild-type (WT) and Nlrp3−/− mice were infected with lentivirus expressing ZIKV NS5 or vector control. Supernatants were collected 24 hours after infection and analyzed for interleukin 1β (IL-1β), using an enzyme-linked immunosorbent assay. B, 293T cells cotransfected with plasmids encoding 6×His-tagged NS5 and Myc-tagged NLRP3 were used in a coimmunoprecipitation assay. Cell lysates were precipitated with anti-Myc antibody (Ab) or control mouse immunoglobulin G (IgG), and immunocomplexes were analyzed with the indicated Abs by Western blotting. C, 293T cells were transfected with Myc-tagged NLRP3 along with vectors expressing the indicated 6×His-tagged NS5 truncation forms or full-length NS5. An empty control vector was used as a negative control. Cell lysates were precipitated with anti-His Ab, and immunocomplexes were analyzed with the indicated Abs by Western blotting. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. Abbreviation: IB, immunoblotting. Figure 6. View largeDownload slide Zika virus (ZIKV) NS5 interacts with NLRP3 through its RdRp domain. A, Bone marrow–derived macrophages (BMDMs) prepared from bone marrow cells of C57BL/6 wild-type (WT) and Nlrp3−/− mice were infected with lentivirus expressing ZIKV NS5 or vector control. Supernatants were collected 24 hours after infection and analyzed for interleukin 1β (IL-1β), using an enzyme-linked immunosorbent assay. B, 293T cells cotransfected with plasmids encoding 6×His-tagged NS5 and Myc-tagged NLRP3 were used in a coimmunoprecipitation assay. Cell lysates were precipitated with anti-Myc antibody (Ab) or control mouse immunoglobulin G (IgG), and immunocomplexes were analyzed with the indicated Abs by Western blotting. C, 293T cells were transfected with Myc-tagged NLRP3 along with vectors expressing the indicated 6×His-tagged NS5 truncation forms or full-length NS5. An empty control vector was used as a negative control. Cell lysates were precipitated with anti-His Ab, and immunocomplexes were analyzed with the indicated Abs by Western blotting. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. Abbreviation: IB, immunoblotting. ROS Generation Is Required for ZIKV-Driven Maturation of IL-1β As previously reported, one widely acknowledged mechanism mediating the activation of NLRP3 inflammasome is mitochondrial ROS production. ROS production by mitochondria leads to the dissociation of thioredoxin (TRX) from TRX-interacting protein, which associates with NLRP3 to facilitate inflammasome formation [15]. We therefore investigated whether the ROS production is required for inflammasome activation during ZIKV infection. As shown in Figure 7A, ZIKV infection increased ROS production in a multiplicity of infection–dependent manner. By contrast, treatment with DPI, a potent ROS inhibitor, significantly decreased ZIKV-induced ROS levels and IL-1β production (Figure 7A and B). Moreover, we found that cells transduced with the NS5-expressing lentivirus triggered an increase in ROS production (Figure 7C). These data suggest that the generation of ROS during ZIKV infection might act as a stress signal for inflammasome activation, which in turn is crucial for IL-1β production. Figure 7. View largeDownload slide Reactive oxygen species (ROS) generation is required for Zika virus (ZIKV)–mediated NLPR3 inflammasome activation. THP-1 macrophages were infected with ZIKV in the presence or absence of the ROS inhibitor DPI (1 μM). A, Intracellular ROS levels were measured by staining cells with the CM-H2DCFDA probe (green) and visualized using a fluorescence microscope. Representative images of ROS staining. Original magnification, 200×. ROS fluorescence intensity is shown in the histogram. B, Supernatants were harvested to quantify interleukin 1β (IL-1β), using an enzyme-linked immunosorbent assay. C, Representative images of ROS production in THP-1 macrophages infected with lentivirus expressing ZIKV NS5 or a vector control. Original magnification, 200×. ROS fluorescence intensity is shown in the histogram. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. D, Schematic model of ZIKV-induced IL-1β secretion. After infection, the newly synthesized viral polyprotein is cleaved by cellular and viral proteases. The viral NS5 protein promotes NLRP3 inflammasome activation via interacting with NLRP3 and inducing mitochondrial ROS generation. The activated caspase 1 catalyzes proteolytic processing of pro–IL-1β into its mature form, leading to IL-1β secretion. BF, bright field; MOI, multiplicity of infection; NF-κB, nuclear factor κB. Figure 7. View largeDownload slide Reactive oxygen species (ROS) generation is required for Zika virus (ZIKV)–mediated NLPR3 inflammasome activation. THP-1 macrophages were infected with ZIKV in the presence or absence of the ROS inhibitor DPI (1 μM). A, Intracellular ROS levels were measured by staining cells with the CM-H2DCFDA probe (green) and visualized using a fluorescence microscope. Representative images of ROS staining. Original magnification, 200×. ROS fluorescence intensity is shown in the histogram. B, Supernatants were harvested to quantify interleukin 1β (IL-1β), using an enzyme-linked immunosorbent assay. C, Representative images of ROS production in THP-1 macrophages infected with lentivirus expressing ZIKV NS5 or a vector control. Original magnification, 200×. ROS fluorescence intensity is shown in the histogram. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. D, Schematic model of ZIKV-induced IL-1β secretion. After infection, the newly synthesized viral polyprotein is cleaved by cellular and viral proteases. The viral NS5 protein promotes NLRP3 inflammasome activation via interacting with NLRP3 and inducing mitochondrial ROS generation. The activated caspase 1 catalyzes proteolytic processing of pro–IL-1β into its mature form, leading to IL-1β secretion. BF, bright field; MOI, multiplicity of infection; NF-κB, nuclear factor κB. DISCUSSION The main finding of our present study is that ZIKV, a positive-strand RNA virus, triggers NLRP3 inflammasome–mediated IL-1β production by interacting with NLRP3 and inducing ROS generation through the action of the virus-encoded NS5 protein. (Figure 7D). Our data reveal the physiopathologic relevance of the NLRP3 inflammasome during ZIKV infection, which may provide therapeutic targets along these pathways for novel anti-ZIKV treatment. ZIKV has been recognized to cause more-severe neurological complications, such as congenital microcephaly and Guillain-Barré syndrome, meningoencephalitis, and myelitis [1–4]. Recent studies have revealed an increase in the levels of IL-1β in ZIKV-infected patients and human primary microglia cells infected with ZIKV [5, 16]. Because IL-1β has been implicated in neuroinflammation associated with several neurological diseases, including viral encephalitis, Parkinson disease, and Alzheimer disease [10, 17–19], understanding the pathway leading to IL-1β secretion may be valuable for developing therapies to reduce neuroinflammation and neurological diseases. NLRP3 inflammasomes are multiprotein complexes that mediate the activation of caspase 1, which promotes the secretion of the proinflammatory cytokines IL-1β and IL-18. Previous studied have revealed that a variety of viruses can activate the NLRP3 inflammasome, including influenza virus, Japanese encephalitis virus, encephalomyocarditis virus, human immunodeficiency virus type 1, and enterovirus 71 [11, 17, 20–22]. We report here that ZIKV also activates the NLRP3 inflammasome, leading to the cleavage of caspase 1 and the release of IL-1β. In addition, we further demonstrate that UV ray– or heat-inactivated ZIKV failed to induce IL-1β secretion, indicating that ZIKV replication is required to activate the NLRP3 inflammasome. Viral proteins, such as human immunodeficiency virus type 1 Vpr, encephalomyocarditis virus 2B, and enterovirus 71 3D proteins, play a stimulatory role in the regulation of the NLRP3 inflammasome [21–23]. In this study, we identified that the ZIKV NS5 protein is sufficient to activate the NLRP3 inflammasome. Our results demonstrated that ZIKV NS5 could promote NLRP3 inflammasome activation by interacting with NLRP3. Our work extends the functions of NS5 by showing that it plays a role in regulating the NLRP3 inflammasome and IL-1β production. Activation of the NLRP3 inflammasome requires a posttranscriptional signal that is transduced by a wide range of pathogen-associated molecular patterns and damage-associated molecular patterns. Several molecular mechanisms have been implicated in NLRP3 activation, including production of ROS from damaged mitochondria. In this study, we report that ZIKV infection or NS5 expression triggers an increase in ROS production. However, treatment of ROS inhibitor significantly decreased ZIKV-induced ROS levels. These data indicate that the generation of ROS during ZIKV infection might act as a stress signal for inflammasome activation, which in turn is crucial for IL-1β production. Further investigation of how NS5 promotes ROS production is warranted. In summary, the current study shows that ZIKV infection triggers severe inflammatory pathology and high levels of IL-1β in vivo. We also show that the maturation and secretion of IL-1β during ZIKV infection is mediated by NLRP3 inflammasome activation. ZIKV NS5 protein was found to facilitate the assembly of the NLRP3 inflammasome complex and lead to IL-1β activation through binding NLRP3 and inducing ROS production. These results reveal a novel mechanism for the ZIKV-mediated inflammatory response, which may provide therapeutic targets along these pathways for novel strategies to treat ZIKV-associated diseases. Supplementary Data Supplementary materials are available at The Journal of Infectious Diseases online. Consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author. Notes Acknowledgments. We thank Prof Xi Huang, Prof Gucheng Zeng of Sun Yat-sen University, and Prof Zhong Pei of the First Affiliated Hospital of Sun Yat-sen University, for providing the ZIKV SZ01 strain, Ifnar1−/− mice, and the Nlrp3−/− mice essential for this work. Disclaimer. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Financial support. This work was supported by the National Mega Project on Major Infectious Disease Prevention (2017ZX10103011), the Natural Science Foundation of China (81501744, 81571992, and 81330058), Guangdong Natural Science Funds for Distinguished Young Scholars (2014A030306023), Fundamental Research Funds for the Central Universities (16ykzd16), and the Young Talent of Science and Technology Project of the Guangdong Te Zhi Program (2015TQ01R281). Potential conflicts of interest. All authors: No reported conflicts of interest. All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of the manuscript have been disclosed. References 1. Mlakar J , Korva M , Tul N , et al. Zika virus associated with microcephaly . N Engl J Med 2016 ; 374 : 951 – 8 . Google Scholar CrossRef Search ADS PubMed 2. Dos Santos T , Rodriguez A , Almiron M , et al. Zika Virus and the Guillain-Barré syndrome - case series from seven countries . N Engl J Med 2016 ; 375 : 1598 – 601 . Google Scholar CrossRef Search ADS PubMed 3. Soares CN , Brasil P , Carrera RM , et al. Fatal encephalitis associated with Zika virus infection in an adult . J Clin Virol 2016 ; 83 : 63 – 5 . Google Scholar CrossRef Search ADS PubMed 4. Carteaux G , Maquart M , Bedet A , et al. Zika virus associated with meningoencephalitis . N Engl J Med 2016 ; 374 : 1595 – 6 . Google Scholar CrossRef Search ADS PubMed 5. Tappe D , Pérez-Girón JV , Zammarchi L , et al. Cytokine kinetics of Zika virus-infected patients from acute to reconvalescent phase . Med Microbiol Immunol 2016 ; 205 : 269 – 73 . Google Scholar CrossRef Search ADS PubMed 6. Lamkanfi M , Dixit VM . Inflammasomes and their roles in health and disease . Annu Rev Cell Dev Biol 2012 ; 28 : 137 – 61 . Google Scholar CrossRef Search ADS PubMed 7. Lamkanfi M , Dixit VM . Mechanisms and functions of inflammasomes . Cell 2014 ; 157 : 1013 – 22 . Google Scholar CrossRef Search ADS PubMed 8. Walsh JG , Muruve DA , Power C . Inflammasomes in the CNS . Nat Rev Neurosci 2014 ; 15 : 84 – 97 . Google Scholar CrossRef Search ADS PubMed 9. Fink SL , Cookson BT . Apoptosis, pyroptosis, and necrosis: mechanistic description of dead and dying eukaryotic cells . Infect Immun 2005 ; 73 : 1907 – 16 . Google Scholar CrossRef Search ADS PubMed 10. Zhao ML , Kim MO , Morgello S , Lee SC . Expression of inducible nitric oxide synthase, interleukin-1 and caspase-1 in HIV-1 encephalitis . J Neuroimmunol 2001 ; 115 : 182 – 91 . Google Scholar CrossRef Search ADS PubMed 11. Das S , Mishra MK , Ghosh J , Basu A . Japanese Encephalitis Virus infection induces IL-18 and IL-1beta in microglia and astrocytes: correlation with in vitro cytokine responsiveness of glial cells and subsequent neuronal death . J Neuroimmunol 2008 ; 195 : 60 – 72 . Google Scholar CrossRef Search ADS PubMed 12. Guo S , Yang C , Diao B , et al. The NLRP3 inflammasome and IL-1β accelerate immunologically mediated pathology in experimental viral fulminant hepatitis . PLoS Pathog 2015 ; 11 : e1005155 . Google Scholar CrossRef Search ADS PubMed 13. Jo EK , Kim JK , Shin DM , Sasakawa C . Molecular mechanisms regulating NLRP3 inflammasome activation . Cell Mol Immunol 2016 ; 13 : 148 – 59 . Google Scholar CrossRef Search ADS PubMed 14. Shrivastava G , León-Juárez M , García-Cordero J , Meza-Sánchez DE , Cedillo-Barrón L . Inflammasomes and its importance in viral infections . Immunol Res 2016 ; 64 : 1101 – 17 . Google Scholar CrossRef Search ADS PubMed 15. Zhou R , Tardivel A , Thorens B , Choi I , Tschopp J . Thioredoxin-interacting protein links oxidative stress to inflammasome activation . Nat Immunol 2010 ; 11 : 136 – 40 . Google Scholar CrossRef Search ADS PubMed 16. Lum FM , Low DK , Fan Y , et al. Zika virus infects human fetal brain microglia and induces inflammation . Clin Infect Dis 2017 ; 64 : 914 – 20 . Google Scholar CrossRef Search ADS PubMed 17. Kaushik DK , Gupta M , Kumawat KL , Basu A . NLRP3 inflammasome: key mediator of neuroinflammation in murine Japanese encephalitis . PLoS One 2012 ; 7 : e32270 . Google Scholar CrossRef Search ADS PubMed 18. Codolo G , Plotegher N , Pozzobon T , et al. Triggering of inflammasome by aggregated α-synuclein, an inflammatory response in synucleinopathies . PLoS One 2013 ; 8 : e55375 . Google Scholar CrossRef Search ADS PubMed 19. Halle A , Hornung V , Petzold GC , et al. The NALP3 inflammasome is involved in the innate immune response to amyloid-beta . Nat Immunol 2008 ; 9 : 857 – 65 . Google Scholar CrossRef Search ADS PubMed 20. Schmitz N , Kurrer M , Bachmann MF , Kopf M . Interleukin-1 is responsible for acute lung immunopathology but increases survival of respiratory influenza virus infection . J Virol 2005 ; 79 : 6441 – 8 . Google Scholar CrossRef Search ADS PubMed 21. Mamik MK , Hui E , Branton WG , et al. HIV-1 viral protein R activates NLRP3 inflammasome in microglia: implications for HIV-1 associated neuroinflammation . J Neuroimmune Pharmacol 2017 ; 12 : 233 – 48 . Google Scholar CrossRef Search ADS PubMed 22. Wang W , Xiao F , Wan P , et al. EV71 3D protein binds with NLRP3 and enhances the assembly of inflammasome complex . PLoS Pathog 2017 ; 13 : e1006123 . Google Scholar CrossRef Search ADS PubMed 23. Ito M , Yanagi Y , Ichinohe T . Encephalomyocarditis virus viroporin 2B activates NLRP3 inflammasome . PLoS Pathog 2012 ; 8 : e1002857 . Google Scholar CrossRef Search ADS PubMed 24. Trouplin V , Boucherit N , Gorvel L , Conti F , Mottola G , Ghigo E . Bone marrow-derived macrophage production . J Vis Exp 2013 ; 81: e50966 . 25. Aliota MT , Caine EA , Walker EC , Larkin KE , Camacho E , Osorio JE . Characterization of lethal Zika virus infection in AG129 mice . PLoS Negl Trop Dis 2016 ; 10 : e0004682 . Google Scholar CrossRef Search ADS PubMed 26. Tsai TT , Chen CL , Lin YS , et al. Microglia retard dengue virus-induced acute viral encephalitis . Sci Rep 2016 ; 6 : 27670 . Google Scholar CrossRef Search ADS PubMed 27. Mao K , Chen S , Chen M , et al. Nitric oxide suppresses NLRP3 inflammasome activation and protects against LPS-induced septic shock . Cell Res 2013 ; 23 : 201 – 12 . Google Scholar CrossRef Search ADS PubMed © The Author(s) 2018. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The Journal of Infectious Diseases Oxford University Press

NLRP3 Inflammasome Activation Mediates Zika Virus–Associated Inflammation

Loading next page...
 
/lp/ou_press/nlrp3-inflammasome-activation-mediates-zika-virus-associated-GkxsCvdl24
Publisher
Oxford University Press
Copyright
© The Author(s) 2018. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
ISSN
0022-1899
eISSN
1537-6613
D.O.I.
10.1093/infdis/jiy129
Publisher site
See Article on Publisher Site

Abstract

Abstract Zika virus (ZIKV) is a mosquito-borne virus that has been identified as a cause of several severe disease manifestations, including congenital microcephaly and Guillain-Barré syndrome, meningoencephalitis, and myelitis. Previous studies showed that ZIKV-infected patients exhibited elevated plasma levels of interleukin 1β (IL-1β), indicating that ZIKV may activate inflammasomes. However, the molecular basis for its viral pathogenesis remains poorly understood. In this current study, we found that ZIKV infection caused severe inflammatory pathological changes and promoted IL-1β production in vitro and in vivo. We here demonstrate that the maturation and secretion of IL-1β during ZIKV infection was mediated by NLRP3 inflammasome activation and that ZIKV nonstructural protein 5 (NS5) facilitated the assembly of the NLRP3 inflammasome complex, leading to IL-1β activation through interaction with NLRP3 and induction of reactive oxygen species production. Collectively, our data identify NLRP3 inflammasome–derived IL-1β production as a critical feature of inflammation during ZIKV infection. These findings offer new insights into inflammasome-mediated diseases and may provide new therapeutic options for ZIKV-associated diseases. Zika virus, NS5, NLRP3 inflammasome, interleukin-1 beta Zika virus (ZIKV) belongs to the family Flaviviridae (genus Flavivirus) and is transmitted by Aedes mosquitoes. Although symptomatic ZIKV infection in humans generally involves a mild, self-limited acute febrile illness associated with rash, arthralgia, and conjunctivitis, some patients develop more-severe neurological complications, such as congenital microcephaly and Guillain-Barré syndrome, meningoencephalitis, and myelitis [1–4]. Recent studies have revealed an increase in the levels of proinflammatory cytokines, such as interleukin 1β (IL-1β), interferon γ (IFN-γ), interleukin 6 (IL-6), and interleukin 8 (IL-8), in ZIKV-infected patients, compared with healthy people [5]. These observations indicate that the inflammatory response may contribute to the ZIKV-associated diseases. However, the mechanisms by which ZIKV stimulates inflammatory signaling are not defined. The proinflammatory cytokine IL-1β is a central component of the cytokine milieu and plays an important role in fever, septic shock, and inflammatory diseases. The generation of mature active IL-1β requires cleavage of the precursor, pro–IL-1β, by the inflammasome [6]. The inflammasome is a large multiprotein complex that senses infection or danger stimuli in the cell and controls the maturation and secretion of IL-1β and IL-18 [6]. Several types of inflammasomes have been identified, of which the nucleotide and oligomerization domain, leucine-rich repeat-containing protein family, pyrin-containing domain 3 (NLRP3) inflammasome is the most studied and best characterized [7]. Upon activation and oligomerization, NLRP3 interacts with the caspase-recruitment domain (CARD) molecule known as adaptor molecule apoptosis-associated speck-like protein containing CARD (ASC). Clustered ASCs in turn recruit pro–caspase 1 via a CARD-CARD interaction and induce the autoproteolytic conversion of the proenzyme into active caspase 1 [8]. Activated caspase 1 leads to the cleavage and release of mature IL-1β and IL-18 [9]. Activation of the NLRP3 inflammasome and IL-1β release mediate host protection against pathogen invasions. However, hyperactivation of the NLRP3 inflammasome contributes to the pathogenesis of inflammatory diseases, such as viral encephalitis and viral fulminant hepatitis [10–12]. Activation of the NLRP3 inflammasome requires signals at both the transcriptional and posttranslational levels. The first signal leads to synthesis of pro–IL-1β and other components of the inflammasome, such as NLRP3, through the Toll-like receptor/nuclear factor κB pathway. The second signal is transduced by various pathogen-associated molecular patterns and damage-associated molecular patterns to activate the assembly of the NLRP3 inflammasome, caspase 1 activation, and IL-1β secretion [13]. Several molecular mechanisms have been indicated for NLRP3 activation to induce caspase 1 activation and IL-1β maturation. These include the generation of mitochondrial reactive oxygen species (ROS), the efflux of potassium (K+), and the influx of calcium ions (Ca2+) [14]. In the present study, we show that mice infected with ZIKV exhibited severe inflammatory pathology and high levels of IL-1β in the serum and brain. We also show that the maturation and secretion of IL-1β during ZIKV infection was mediated by NLRP3 inflammasome activation. In addition, ZIKV nonstructural protein 5 (NS5) was identified to interact with NLRP3 and facilitate the assembly of the NLRP3 inflammasome complex and lead to IL-1β activation. Moreover, the generation of ROS was critical for NLRP3 inflammasome activation during ZIKV infection. Thus, our findings reveal the physiopathologic relevance of the NLRP3 inflammasome during ZIKV infection, which may provide therapeutic targets for anti-ZIKV treatment. MATERIALS AND METHODS Mice Type I IFN receptor–deficient (Ifnar1−/−) mice and Nlrp3−/− mice with the C57BL/6 background were bred in pathogen-free animal facilities at Sun Yat-Sen University (SYSU). Mice approximately 5 weeks of age were used for these experiments. Ethics Statement All animal studies were approved by the SYSU Institutional Animal Care and Use Committee (SYSU IACUC) under the protocol number 2017–118, and all animal experiments were performed in accordance with Animal Research: Reporting of In Vivo Experiments guidelines and guidelines approved by SYSU IACUC and were conducted in a laboratory designed to ensure biological safety. Cell Culture The human monocytic cell line THP-1 (purchased from the Cell Bank of the Chinese Academy of Sciences, Shanghai, China) was cultured at 37°C in 5% CO2 in Roswell Park Memorial Institute 1640 medium supplemented with 10% fetal bovine serum (FBS; Gibco, Carlsbad, CA). THP-1 cells were differentiated into macrophages by exposure to 100 ng/mL phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich, St. Louis, MO) for 24 hours, and cells were cultured for 24 hours without PMA. 293T cells and Vero cells (both obtained from the Cell Bank of the Chinese Academy of Sciences) and 293FT cells (Invitrogen, Carlsbad, CA) were maintained at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium supplemented with 10% FBS, 2 mM L-glutamine, 100 μg/mL streptomycin, and 100 U/mL penicillin (Gibco). Aedes albopictus C6/36 cells (ATCC CRL-1660) were maintained at 28°C in 5% CO2 in Dulbecco’s modified Eagle’s medium supplemented with 10% FBS. Bone marrow–derived macrophages (BMDMs) were prepared as previously described [24] and were cultured in Roswell Park Memorial Institute 1640 medium with 10% FBS and recombinant mouse macrophage colony-stimulating factor (50 ng/mL; Novus, Littleton, CO). Virus and Infection The Asian lineage ZIKV SZ01 strain (GenBank accession number KU866423) was amplified in C6/36 cells. For preparation of UV ray–inactivated ZIKV, the virus was dispersed in a tissue culture dish, and a compact UV lamp was placed directly above the dish for 30 minutes. Heat-inactivated ZIKV was prepared by incubating the virus at 65°C for 30 minutes to completely inhibit ZIKV activity. Virus stocks were titrated by standard plaque assays on Vero cells [25]. To inhibit caspase 1 and NLRP3 activation, cells were pretreated with AC-YVAD-CHO (Cayman Chemical, Ann Arbor, MI) and glyburide (Target Molecule, Boston, MA), respectively, for 30 minutes. The cells were then infected with ZIKV in the presence of AC-YVAD-CHO or glyburide for 1 hour at 37 ℃, washed with phosphate-buffered saline (PBS), and cultured with medium containing AC-YVAD-CHO or glyburide. In Vivo Murine Infections Mice were infected intraperitoneally according to a previously described method [25]. Briefly, 1 × 105 plaque-forming units of ZIKV in a volume of 100 μL was injected intraperitoneally into 5-week-old Ifnar1−/− mice, which were monitored daily for morbidity and mortality. Mice with neurological changes were evaluated as previously described to assess their clinical scores, which were graded according to the severity of illness, as follows: 0 for healthy; 1 for minor illness, including weight loss, reduced mobility, and a hunchbacked body orientation; 2 for limbic seizure; 3 for moving with difficulty and anterior limb or posterior limb weakness; 4 for paralysis; and 5 for death [26]. Histological Analysis Mouse brain tissues were harvested and fixed in 4% paraformaldehyde for 24 hours at room temperature. The fixed tissues were dehydrated, embedded in paraffin, sectioned, rehydrated, and stained with hematoxylin and eosin (H/E). The H/E-stained sections were evaluated for viral-induced neuropathology. Plasmid Construction The lentivirus vector pSin4-EF2-IRES-Pur was modified by introducing certain restriction enzyme cutting sites (BamHI-EcoRI-BstbI-NdeI-NheI-SpeI) into the multiple cloning site. To generate lentiviruses expressing Flag-tagged ZIKV C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5 proteins, the full-length complementary DNA encoding each viral protein was amplified by reverse-transcription polymerase chain reaction (RT-PCR) analysis and cloned into the pSin4-EF2-IRES-Pur vector. A plasmid encoding human NLRP3 with an N-terminal Myc epitope tag was amplified by RT-PCR and cloned into the KpnI and XbaI sites of the pcDNA3.1 vector. Full-length ZIKV NS5 and its truncated forms, the methyltransferase domain and the RNA-dependent RNA polymerase (RdRp) domain, with N-terminal 6×His epitope tags were amplified by PCR and cloned into the KpnI and XbaI sites of the pcDNA3.1 vector. All constructs were verified by DNA sequencing. Lentivirus Production and Infection For virus production, a pSin4-EF2-IRES-Pur vector encoding each viral protein was transfected into 293FT cells together with the packaging plasmid psPAX2 and the envelope-coding plasmid pMD2.G, using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. Forty-eight hours after transfection, the supernatants were collected, centrifuged at 500×g for 10 minutes, and filtered through 0.45-μm filters. Cells were infected overnight with the supernatants containing lentiviral particles. Culture supernatants were collected 24 hours after infection and assayed for IL-1β by an enzyme-linked immunosorbent assay (ELISA). ELISA Concentrations of human and murine cytokines were determined according to the manufacturers’ instructions with following ELISA kits from eBiosciences (San Diego, CA), for IL-1β and IL-18; Raybiotech (Norcross, GA), for TNF-α and IL-6; and R&D Systems (Minneapolis, MN), for monocyte chemoattractant protein 1. Western Blotting Tissue specimens obtained from mouse brains or cells were lysed with RIPA lysis buffer (Millipore, Bedford, MA) containing a cocktail of protease and phosphatase inhibitors (Sigma-Aldrich). Protein samples were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto a polyvinylidene difluoride membrane. The membranes were probed with the following primary antibodies: anti-IL-1β, anti-NLRP3, and anti-caspase 1 (all from Cell Signaling, Danvers, MA); anti-ZIKV envelope protein and anti-ZIKV NS5 (both from BioFront Technologies, Tallahassee, FL); anti-ASC (Santa Cruz Biotechnology, Dallas, TX); anti-human β-actin (Sigma-Aldrich). Membranes were incubated with horseradish peroxidase–conjugated secondary antibodies, and signals were detected by enhanced chemiluminescence, using a commercial kit (Thermo Fisher Scientific, Rockford, IL) according to the manufacturer’s suggested protocols. ASC Oligomerization Detection ASC pyroptosomes were detected as previously reported [27]. Briefly, cells were pelleted by centrifugation and resuspended in 0.5 mL of ice-cold buffer containing 50 mM Tris (pH 7.5), 150 mM NaCl, 1% NP40, 5 mM ethylenediaminetetraacetic acid (EDTA), and 10% glycerol. The cell lysates were then centrifuged at 6000×g for 15 minutes at 4°C, and the supernatants were mixed with sodium dodecyl sulfate loading buffer for Western blotting. The pellets were washed 3 times with PBS and resuspended in 500 μL of PBS. Next, the resuspended pellets were cross-linked with fresh disuccinimidyl suberate (4 mM; Sigma-Aldrich) at 37°C for 30 minutes. The cross-linked samples were then centrifuged and mixed with sodium dodecyl sulfate loading buffer for Western blotting. Viral RNA Isolation and Transfection Viral RNA was extracted from the supernatant of ZIKV-infected or mock-infected C6/36 cells 48 hours after infection, using a QIAamp Viral RNA Kit (Qiagen, Hilden, Germany). The concentration of the viral RNA was determined by a NanoDrop spectrophotometer (Thermo Fisher Scientific). PMA-differentiated human THP-1 macrophages were transfected with RNA from infected or mock-infected C6/36 cells or with poly(dA:dT) (10 μg/mL; Invivogen, San Diego, CA) using Lipofectamine 3000 (Invitrogen). The concentrations of IL-1β in the cell-free supernatants were measured 24 hours after transfection. Small Interfering RNA (siRNA) Synthesis and Transfection Control siRNA and gene-specific siRNAs were purchased from RiBoBio (Guangzhou, China). The targeting sequences of siRNA for human NLRP3, ASC, and caspase 1 were CAGGTTTGACTATCTGTTCT, GATGCGGAAGCTCTTCAGTTTCA, and GTGAAGAGATCCTTCTGTA, respectively. The siRNA was delivered into the cells by using Lipofectamine 3000 transfection reagent (Invitrogen). Measurement of ROS Production Intracellular ROS levels were measured by staining cells with 5-(and-6)-chloromethyl-2’,7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA) dye (Sigma-Aldrich). An ROS inhibitor, diphenyleneiodonium chloride (DPI; Sigma-Aldrich), was used as the control. Briefly, cells were incubated with or without 1 μM DPI for 4 hours, followed by vector-virus infection. Twenty-four hours after challenge, the cells were stained with a solution containing CM-H2DCFDA dye (5 μM). Cells were then observed under a Zeiss Axio Imager Z2 microscope and analyzed with ZEN software (Carl Zeiss MicroImaging, Jena, Germany). Coimmunoprecipitation Assay 293T cells transfected with vector plasmids were lysed with protein lysis buffer containing 25 mM HEPES, 150 mM NaCl, 1 mM EDTA, 2% glycerol, 1% NP40, and a cocktail of protease and phosphatase inhibitors (Sigma-Aldrich). Lysates were incubated with the anti-His antibody (Abcam, Cambridge, MA) or mouse immunoglobulin G antibody overnight at 4°C. Subsequently, precipitates were washed 5 times with wash buffer containing 20 mM HEPES, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 2% glycerol, and 0.1% NP-40; resuspended in sampling buffer; and examined by Western blotting. Statistical Analyses The results are expressed as mean values (±standard deviations). Statistical analyses were performed on triplicate experiments, using a 2-tailed Student t test. RESULTS ZIKV Infection Causes Severe Pathology That Precedes Lethality in Mice To study the interplay between ZIKV and the host immune system, we used Ifnar1−/− mice to generate a ZIKV infection model in vivo. ZIKV was injected intraperitoneally into 5-week-old mice. The survival rate in the ZIKV-infected mice was 33% on day 8 after infection, and all the mice died by day 9 after infection (Figure 1A). In addition, during ZIKV infection, significant loss of body weight occurred by day 5 after infection (Figure 1B). Moreover, mice infected with ZIKV developed neurological disease symptoms, including lethargy, hunched posture, hind limb weakness, and paralysis (Figure 1C), and high viral loads were noted, indicating a strong neurotropism of ZIKV (Figure 1D). Histopathological examination showed diffuse meningeal infiltration by a mixture of neutrophils and mononuclear cells in the cerebrum. Several perivascular cuffs of mononuclear cells, microglial cells, and vasculitis were widely observed in the neuropil of the cerebral cortex (Figure 2). These findings indicate progressive meningoencephalitis caused by ZIKV infection. Figure 1. View largeDownload slide Zika virus (ZIKV) infection causes lethality in mice. A, Ifnar1−/− mice were infected with 1 × 105 plaque-forming units of ZIKV strain SZ01 intraperitoneally and monitored for survival over 10 days (n = 6). B and C, Changes in weight (B) and clinical score (C) were calculated daily for ZIKV- and mock-infected mice. D, Plaque assays for viral titers in the brain tissues of mice were performed on day 8 after infection (n = 4). Figure 1. View largeDownload slide Zika virus (ZIKV) infection causes lethality in mice. A, Ifnar1−/− mice were infected with 1 × 105 plaque-forming units of ZIKV strain SZ01 intraperitoneally and monitored for survival over 10 days (n = 6). B and C, Changes in weight (B) and clinical score (C) were calculated daily for ZIKV- and mock-infected mice. D, Plaque assays for viral titers in the brain tissues of mice were performed on day 8 after infection (n = 4). Figure 2. View largeDownload slide Zika virus (ZIKV) infection triggers severe pathology in the brain. Histopathological changes were evaluated in the cerebral cortex. Brain tissue sections obtained from ZIKV-infected mice showed meningoencephalitis characterized by infiltration of immune cells in the meninges (black arrows) and perivascular cuffing (PC). Original magnification, 100× (upper panels) and 400× (lower panels). Figure 2. View largeDownload slide Zika virus (ZIKV) infection triggers severe pathology in the brain. Histopathological changes were evaluated in the cerebral cortex. Brain tissue sections obtained from ZIKV-infected mice showed meningoencephalitis characterized by infiltration of immune cells in the meninges (black arrows) and perivascular cuffing (PC). Original magnification, 100× (upper panels) and 400× (lower panels). ZIKV Infection Induces IL-1β Secretion In Vivo and In Vitro We next examined whether the proinflammatory cytokines were induced by ZIKV infection. Notably, a significant increase in IL-1β levels was observed in both brain tissue and serum samples from infected mice (Figure 3A and B). In addition, the levels of IL-6, IL-18, TNF-α, and monocyte chemoattractant protein 1 were also assessed in both sample types (Supplemental Figure 1). Because IL-1β is a central component of the cytokine milieu and plays an important role in many immune reactions, we next used PMA-differentiated human THP-1 macrophages to verify the induction of IL-1β production by ZIKV infection. As shown in Figure 3C, the amount of IL-1β secretion increased in a multiplicity of infection–dependent manner. Lipopolysaccharide (LPS)/ATP stimuli served as a positive control in these experiments. Furthermore, time-course assays showed increased IL-1β secretion (Figure 3D). Overall, the above results indicated that ZIKV infection induces IL-1β production both in vivo and in vitro. Figure 3. View largeDownload slide Zika virus (ZIKV) infection induces interleukin 1β (IL-1β) production in vivo and in vitro. A and B, Examination of IL-1β expression in mock- and ZIKV-infected brain tissue (A) and serum (B) samples obtained from mice 5 days after infection (n = 4 per group), as determined by an enzyme-linked immunosorbent assay (ELISA). Expression of mature IL-1β in the supernatants of PMA-differentiated human THP-1 macrophages infected with ZIKV at multiplicities of infection of 1, 5, and 10 (C) or at different time points (D), as determined by an ELISA. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. LPS, lipopolysaccharide. *P < .05 and **P < .01. Figure 3. View largeDownload slide Zika virus (ZIKV) infection induces interleukin 1β (IL-1β) production in vivo and in vitro. A and B, Examination of IL-1β expression in mock- and ZIKV-infected brain tissue (A) and serum (B) samples obtained from mice 5 days after infection (n = 4 per group), as determined by an enzyme-linked immunosorbent assay (ELISA). Expression of mature IL-1β in the supernatants of PMA-differentiated human THP-1 macrophages infected with ZIKV at multiplicities of infection of 1, 5, and 10 (C) or at different time points (D), as determined by an ELISA. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. LPS, lipopolysaccharide. *P < .05 and **P < .01. NLRP3 Inflammasome Is Involved in ZIKV-Induced IL-1β Secretion Previous studies have demonstrated that IL-1β maturation and secretion are mediated by cleavage of caspase 1 under the control of the inflammasome [6]. We next determined the direct indicators of inflammasome activation, caspase 1 cleavage and ASC pyroptosome formation, in ZIKV-infected cells. As shown in Figure 4A, there was a ZIKV-induced increase in cleaved caspase 1 levels and mature IL-1β levels. An ASC oligomer was formed after ZIKV infection (Figure 4A). LPS/ATP stimuli served as a positive control in these experiments. Moreover, we observed that the caspase 1 inhibitor AC-YVAD-CHO and the NLRP3 inhibitor glyburide significantly reduced ZIKV-induced IL-1β production, suggesting that ZIKV-induced IL-1β production was dependent on caspase 1 and NLRP3 (Figure 4B). The above results were further confirmed by using siRNAs to silence the expression of NLRP3, ASC, and caspase 1 in cells before ZIKV infection (Figure 4C). Moreover, mouse BMDMs deficient for NLRP3 exhibited decreased secretion of IL-1β, compared with wild-type cells, when infected with ZIKV (Figure 4D). Western blotting confirmed knockdown of genes encoding NLRP3, ASC, and caspase 1 and knockout of NLRP3 at the protein level (Supplementary Figure 2). Together, these data suggest that ZIKV infection activates the NLRP3 inflammasome and that the activity of NLRP3 is required for ZIKV-induced IL-1β secretion. Figure 4. View largeDownload slide Zika virus (ZIKV) infection triggers NLRP3 inflammasome activation and interleukin 1β (IL-1β) maturation. A, Examination of mature IL-1β in the supernatants (Sup) and caspase 1 in the cell lysates (Lys) of THP-1 macrophages treated with ZIKV or lipopolysaccharide (LPS)/ATP, using Western blotting. ASC oligomerization in THP-1 macrophages infected with ZIKV or treated with lipopolysaccharide (LPS)/ATP was determined by Western blotting. B, THP-1 macrophages were infected with ZIKV or treated with LPS/ATP in the presence or absence of AC-YVAD-CHO (yVAD; 5 or 50 μM) or glyburide (2.5 or 25 μg/mL) for 48 hours. Sup were harvested for the detection of IL-1β with an enzyme-linked immunosorbent assay (ELISA). C, Release of IL-1β in Sup of THP-1 macrophages transfected with small interfering RNAs (siRNAs) targeting NLRP3, caspase 1, and ASC after ZIKV infection was evaluated by an ELISA. Stimulation with 1 μg/mL LPS and 5 mM ATP (LPS/ATP) served as a positive control. D, Bone marrow–derived macrophages (BMDMs) prepared from bone marrow cells from C57BL/6 wild-type (WT) and Nlrp3−/− mice were infected with ZIKV at a multiplicity of infection of 1. Sup were collected 24 hours after infection, and IL-1β was analyzed with an ELISA. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. Abbreviation: IB, immunoblotting. Figure 4. View largeDownload slide Zika virus (ZIKV) infection triggers NLRP3 inflammasome activation and interleukin 1β (IL-1β) maturation. A, Examination of mature IL-1β in the supernatants (Sup) and caspase 1 in the cell lysates (Lys) of THP-1 macrophages treated with ZIKV or lipopolysaccharide (LPS)/ATP, using Western blotting. ASC oligomerization in THP-1 macrophages infected with ZIKV or treated with lipopolysaccharide (LPS)/ATP was determined by Western blotting. B, THP-1 macrophages were infected with ZIKV or treated with LPS/ATP in the presence or absence of AC-YVAD-CHO (yVAD; 5 or 50 μM) or glyburide (2.5 or 25 μg/mL) for 48 hours. Sup were harvested for the detection of IL-1β with an enzyme-linked immunosorbent assay (ELISA). C, Release of IL-1β in Sup of THP-1 macrophages transfected with small interfering RNAs (siRNAs) targeting NLRP3, caspase 1, and ASC after ZIKV infection was evaluated by an ELISA. Stimulation with 1 μg/mL LPS and 5 mM ATP (LPS/ATP) served as a positive control. D, Bone marrow–derived macrophages (BMDMs) prepared from bone marrow cells from C57BL/6 wild-type (WT) and Nlrp3−/− mice were infected with ZIKV at a multiplicity of infection of 1. Sup were collected 24 hours after infection, and IL-1β was analyzed with an ELISA. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. Abbreviation: IB, immunoblotting. ZIKV NS5 Is Sufficient to Trigger Inflammasome Activation We next investigated whether viral replication is required for NLRP3 inflammasome activation by ZIKV. As shown in Figure 5A, UV ray– or heat-inactivated ZIKV failed to induce IL-1β secretion from THP-1 macrophages, indicating that ZIKV replication is required to activate the NLRP3 inflammasome. Additionally, we stimulated cells with control RNA, ZIKV genomic RNA, and, as a positive control, poly(dA:dT). The investigation showed that ZIKV genomic RNA transfection failed to induce IL-1β production (Figure 5A). To further determine whether the ZIKV protein activated the NLRP3 inflammasome, we transduced THP-1 macrophages with lentiviruses expressing the 10 ZIKV proteins separately. We found that IL-1β was significantly induced by NS5 but not by the other proteins tested (Figure 5B). Moreover, we found that THP-1 macrophages transduced with the NS5-expressing lentivirus triggered an increase in cleaved caspase 1 levels and mature IL-1β levels (Figure 5C) and the formation of ASC oligomer (Figure 5D). LPS/ATP stimulation served as a positive control in these experiments. Thus, these findings indicate that the expression of ZIKV NS5 is sufficient to activate the NLRP3 inflammasome. Figure 5. View largeDownload slide Zika virus (ZIKV) NS5 protein promotes inflammasome activation. A, Interleukin 1β (IL-1β) expression in the supernatants (Sup) of THP-1 macrophages that were incubated with UV-inactivated ZIKV, heat-inactivated ZIKV, or live ZIKV. THP-1 macrophages were transfected with control RNA from uninfected C6/36 Sup (Ctrl RNA; 10 μg/mL), ZIKV genomic RNA from infected C6/36 Sup (ZIKV RNA; 10 μg/mL), or 10 μg/mL poly(dA:dT) (positive Ctrl) for 24 hours. Sup were collected and used for the detection of IL-1β secretion by an enzyme-linked immunosorbent assay (ELISA). B, THP-1 macrophages were infected with lentivirus expressing ZIKV C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5, or vector Ctrl. Sup were collected 24 hours after infection and analyzed for IL-1β by an ELISA. C, THP-1 macrophages were infected with lentivirus expressing ZIKV NS5 or a vector Ctrl for 24 hours. The mature IL-1β in Sup and cleaved caspase 1, pro–IL-1β, pro–caspase 1, and viral NS5 in cell lysates (Lys) were analyzed by Western blotting. D, ASC oligomerization in THP-1 macrophages infected with vector Ctrl or ZIKV NS5-encoding lentivirus was determined by Western blotting. Stimulation with 1 μg/mL lipopolysaccharide (LPS) and 5 mM ATP (LPS/ATP) served as a positive Ctrl. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. Abbreviation: IB, immunoblotting. Figure 5. View largeDownload slide Zika virus (ZIKV) NS5 protein promotes inflammasome activation. A, Interleukin 1β (IL-1β) expression in the supernatants (Sup) of THP-1 macrophages that were incubated with UV-inactivated ZIKV, heat-inactivated ZIKV, or live ZIKV. THP-1 macrophages were transfected with control RNA from uninfected C6/36 Sup (Ctrl RNA; 10 μg/mL), ZIKV genomic RNA from infected C6/36 Sup (ZIKV RNA; 10 μg/mL), or 10 μg/mL poly(dA:dT) (positive Ctrl) for 24 hours. Sup were collected and used for the detection of IL-1β secretion by an enzyme-linked immunosorbent assay (ELISA). B, THP-1 macrophages were infected with lentivirus expressing ZIKV C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5, or vector Ctrl. Sup were collected 24 hours after infection and analyzed for IL-1β by an ELISA. C, THP-1 macrophages were infected with lentivirus expressing ZIKV NS5 or a vector Ctrl for 24 hours. The mature IL-1β in Sup and cleaved caspase 1, pro–IL-1β, pro–caspase 1, and viral NS5 in cell lysates (Lys) were analyzed by Western blotting. D, ASC oligomerization in THP-1 macrophages infected with vector Ctrl or ZIKV NS5-encoding lentivirus was determined by Western blotting. Stimulation with 1 μg/mL lipopolysaccharide (LPS) and 5 mM ATP (LPS/ATP) served as a positive Ctrl. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. Abbreviation: IB, immunoblotting. ZIKV NS5 Binds with NLRP3 Through Its RdRp Domain Further, we examined whether ZIKV NS5 could induce IL-1β secretion in Nlrp3−/− cells. As shown in Figure 6A, lentivirus expressing ZIKV NS5 triggered an increase of IL-1β secretion in BMDMs of C57BL/6 WT mice but not in those of Nlrp3−/− mice. We next performed coimmunoprecipitation assays to investigate whether ZIKV NS5 activates the NLRP3 inflammasome through interaction with NLRP3. We observed that ZIKV NS5 bound to NLRP3 (Figure 6B). To further map the NS5 domains involved in NLRP3 binding, we generated constructs that contain the methyltransferase domain and the RdRp domain of NS5. Our coimmunoprecipitation assays showed that RdRp could pull down NLRP3 (Figure 6C), suggesting that ZIKV NS5 interacts with NLRP3 through its RdRp domain. Figure 6. View largeDownload slide Zika virus (ZIKV) NS5 interacts with NLRP3 through its RdRp domain. A, Bone marrow–derived macrophages (BMDMs) prepared from bone marrow cells of C57BL/6 wild-type (WT) and Nlrp3−/− mice were infected with lentivirus expressing ZIKV NS5 or vector control. Supernatants were collected 24 hours after infection and analyzed for interleukin 1β (IL-1β), using an enzyme-linked immunosorbent assay. B, 293T cells cotransfected with plasmids encoding 6×His-tagged NS5 and Myc-tagged NLRP3 were used in a coimmunoprecipitation assay. Cell lysates were precipitated with anti-Myc antibody (Ab) or control mouse immunoglobulin G (IgG), and immunocomplexes were analyzed with the indicated Abs by Western blotting. C, 293T cells were transfected with Myc-tagged NLRP3 along with vectors expressing the indicated 6×His-tagged NS5 truncation forms or full-length NS5. An empty control vector was used as a negative control. Cell lysates were precipitated with anti-His Ab, and immunocomplexes were analyzed with the indicated Abs by Western blotting. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. Abbreviation: IB, immunoblotting. Figure 6. View largeDownload slide Zika virus (ZIKV) NS5 interacts with NLRP3 through its RdRp domain. A, Bone marrow–derived macrophages (BMDMs) prepared from bone marrow cells of C57BL/6 wild-type (WT) and Nlrp3−/− mice were infected with lentivirus expressing ZIKV NS5 or vector control. Supernatants were collected 24 hours after infection and analyzed for interleukin 1β (IL-1β), using an enzyme-linked immunosorbent assay. B, 293T cells cotransfected with plasmids encoding 6×His-tagged NS5 and Myc-tagged NLRP3 were used in a coimmunoprecipitation assay. Cell lysates were precipitated with anti-Myc antibody (Ab) or control mouse immunoglobulin G (IgG), and immunocomplexes were analyzed with the indicated Abs by Western blotting. C, 293T cells were transfected with Myc-tagged NLRP3 along with vectors expressing the indicated 6×His-tagged NS5 truncation forms or full-length NS5. An empty control vector was used as a negative control. Cell lysates were precipitated with anti-His Ab, and immunocomplexes were analyzed with the indicated Abs by Western blotting. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. Abbreviation: IB, immunoblotting. ROS Generation Is Required for ZIKV-Driven Maturation of IL-1β As previously reported, one widely acknowledged mechanism mediating the activation of NLRP3 inflammasome is mitochondrial ROS production. ROS production by mitochondria leads to the dissociation of thioredoxin (TRX) from TRX-interacting protein, which associates with NLRP3 to facilitate inflammasome formation [15]. We therefore investigated whether the ROS production is required for inflammasome activation during ZIKV infection. As shown in Figure 7A, ZIKV infection increased ROS production in a multiplicity of infection–dependent manner. By contrast, treatment with DPI, a potent ROS inhibitor, significantly decreased ZIKV-induced ROS levels and IL-1β production (Figure 7A and B). Moreover, we found that cells transduced with the NS5-expressing lentivirus triggered an increase in ROS production (Figure 7C). These data suggest that the generation of ROS during ZIKV infection might act as a stress signal for inflammasome activation, which in turn is crucial for IL-1β production. Figure 7. View largeDownload slide Reactive oxygen species (ROS) generation is required for Zika virus (ZIKV)–mediated NLPR3 inflammasome activation. THP-1 macrophages were infected with ZIKV in the presence or absence of the ROS inhibitor DPI (1 μM). A, Intracellular ROS levels were measured by staining cells with the CM-H2DCFDA probe (green) and visualized using a fluorescence microscope. Representative images of ROS staining. Original magnification, 200×. ROS fluorescence intensity is shown in the histogram. B, Supernatants were harvested to quantify interleukin 1β (IL-1β), using an enzyme-linked immunosorbent assay. C, Representative images of ROS production in THP-1 macrophages infected with lentivirus expressing ZIKV NS5 or a vector control. Original magnification, 200×. ROS fluorescence intensity is shown in the histogram. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. D, Schematic model of ZIKV-induced IL-1β secretion. After infection, the newly synthesized viral polyprotein is cleaved by cellular and viral proteases. The viral NS5 protein promotes NLRP3 inflammasome activation via interacting with NLRP3 and inducing mitochondrial ROS generation. The activated caspase 1 catalyzes proteolytic processing of pro–IL-1β into its mature form, leading to IL-1β secretion. BF, bright field; MOI, multiplicity of infection; NF-κB, nuclear factor κB. Figure 7. View largeDownload slide Reactive oxygen species (ROS) generation is required for Zika virus (ZIKV)–mediated NLPR3 inflammasome activation. THP-1 macrophages were infected with ZIKV in the presence or absence of the ROS inhibitor DPI (1 μM). A, Intracellular ROS levels were measured by staining cells with the CM-H2DCFDA probe (green) and visualized using a fluorescence microscope. Representative images of ROS staining. Original magnification, 200×. ROS fluorescence intensity is shown in the histogram. B, Supernatants were harvested to quantify interleukin 1β (IL-1β), using an enzyme-linked immunosorbent assay. C, Representative images of ROS production in THP-1 macrophages infected with lentivirus expressing ZIKV NS5 or a vector control. Original magnification, 200×. ROS fluorescence intensity is shown in the histogram. Data are mean values (±SDs) derived from experiments performed 3 times under identical conditions. **P < .01. D, Schematic model of ZIKV-induced IL-1β secretion. After infection, the newly synthesized viral polyprotein is cleaved by cellular and viral proteases. The viral NS5 protein promotes NLRP3 inflammasome activation via interacting with NLRP3 and inducing mitochondrial ROS generation. The activated caspase 1 catalyzes proteolytic processing of pro–IL-1β into its mature form, leading to IL-1β secretion. BF, bright field; MOI, multiplicity of infection; NF-κB, nuclear factor κB. DISCUSSION The main finding of our present study is that ZIKV, a positive-strand RNA virus, triggers NLRP3 inflammasome–mediated IL-1β production by interacting with NLRP3 and inducing ROS generation through the action of the virus-encoded NS5 protein. (Figure 7D). Our data reveal the physiopathologic relevance of the NLRP3 inflammasome during ZIKV infection, which may provide therapeutic targets along these pathways for novel anti-ZIKV treatment. ZIKV has been recognized to cause more-severe neurological complications, such as congenital microcephaly and Guillain-Barré syndrome, meningoencephalitis, and myelitis [1–4]. Recent studies have revealed an increase in the levels of IL-1β in ZIKV-infected patients and human primary microglia cells infected with ZIKV [5, 16]. Because IL-1β has been implicated in neuroinflammation associated with several neurological diseases, including viral encephalitis, Parkinson disease, and Alzheimer disease [10, 17–19], understanding the pathway leading to IL-1β secretion may be valuable for developing therapies to reduce neuroinflammation and neurological diseases. NLRP3 inflammasomes are multiprotein complexes that mediate the activation of caspase 1, which promotes the secretion of the proinflammatory cytokines IL-1β and IL-18. Previous studied have revealed that a variety of viruses can activate the NLRP3 inflammasome, including influenza virus, Japanese encephalitis virus, encephalomyocarditis virus, human immunodeficiency virus type 1, and enterovirus 71 [11, 17, 20–22]. We report here that ZIKV also activates the NLRP3 inflammasome, leading to the cleavage of caspase 1 and the release of IL-1β. In addition, we further demonstrate that UV ray– or heat-inactivated ZIKV failed to induce IL-1β secretion, indicating that ZIKV replication is required to activate the NLRP3 inflammasome. Viral proteins, such as human immunodeficiency virus type 1 Vpr, encephalomyocarditis virus 2B, and enterovirus 71 3D proteins, play a stimulatory role in the regulation of the NLRP3 inflammasome [21–23]. In this study, we identified that the ZIKV NS5 protein is sufficient to activate the NLRP3 inflammasome. Our results demonstrated that ZIKV NS5 could promote NLRP3 inflammasome activation by interacting with NLRP3. Our work extends the functions of NS5 by showing that it plays a role in regulating the NLRP3 inflammasome and IL-1β production. Activation of the NLRP3 inflammasome requires a posttranscriptional signal that is transduced by a wide range of pathogen-associated molecular patterns and damage-associated molecular patterns. Several molecular mechanisms have been implicated in NLRP3 activation, including production of ROS from damaged mitochondria. In this study, we report that ZIKV infection or NS5 expression triggers an increase in ROS production. However, treatment of ROS inhibitor significantly decreased ZIKV-induced ROS levels. These data indicate that the generation of ROS during ZIKV infection might act as a stress signal for inflammasome activation, which in turn is crucial for IL-1β production. Further investigation of how NS5 promotes ROS production is warranted. In summary, the current study shows that ZIKV infection triggers severe inflammatory pathology and high levels of IL-1β in vivo. We also show that the maturation and secretion of IL-1β during ZIKV infection is mediated by NLRP3 inflammasome activation. ZIKV NS5 protein was found to facilitate the assembly of the NLRP3 inflammasome complex and lead to IL-1β activation through binding NLRP3 and inducing ROS production. These results reveal a novel mechanism for the ZIKV-mediated inflammatory response, which may provide therapeutic targets along these pathways for novel strategies to treat ZIKV-associated diseases. Supplementary Data Supplementary materials are available at The Journal of Infectious Diseases online. Consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author. Notes Acknowledgments. We thank Prof Xi Huang, Prof Gucheng Zeng of Sun Yat-sen University, and Prof Zhong Pei of the First Affiliated Hospital of Sun Yat-sen University, for providing the ZIKV SZ01 strain, Ifnar1−/− mice, and the Nlrp3−/− mice essential for this work. Disclaimer. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Financial support. This work was supported by the National Mega Project on Major Infectious Disease Prevention (2017ZX10103011), the Natural Science Foundation of China (81501744, 81571992, and 81330058), Guangdong Natural Science Funds for Distinguished Young Scholars (2014A030306023), Fundamental Research Funds for the Central Universities (16ykzd16), and the Young Talent of Science and Technology Project of the Guangdong Te Zhi Program (2015TQ01R281). Potential conflicts of interest. All authors: No reported conflicts of interest. All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of the manuscript have been disclosed. References 1. Mlakar J , Korva M , Tul N , et al. Zika virus associated with microcephaly . N Engl J Med 2016 ; 374 : 951 – 8 . Google Scholar CrossRef Search ADS PubMed 2. Dos Santos T , Rodriguez A , Almiron M , et al. Zika Virus and the Guillain-Barré syndrome - case series from seven countries . N Engl J Med 2016 ; 375 : 1598 – 601 . Google Scholar CrossRef Search ADS PubMed 3. Soares CN , Brasil P , Carrera RM , et al. Fatal encephalitis associated with Zika virus infection in an adult . J Clin Virol 2016 ; 83 : 63 – 5 . Google Scholar CrossRef Search ADS PubMed 4. Carteaux G , Maquart M , Bedet A , et al. Zika virus associated with meningoencephalitis . N Engl J Med 2016 ; 374 : 1595 – 6 . Google Scholar CrossRef Search ADS PubMed 5. Tappe D , Pérez-Girón JV , Zammarchi L , et al. Cytokine kinetics of Zika virus-infected patients from acute to reconvalescent phase . Med Microbiol Immunol 2016 ; 205 : 269 – 73 . Google Scholar CrossRef Search ADS PubMed 6. Lamkanfi M , Dixit VM . Inflammasomes and their roles in health and disease . Annu Rev Cell Dev Biol 2012 ; 28 : 137 – 61 . Google Scholar CrossRef Search ADS PubMed 7. Lamkanfi M , Dixit VM . Mechanisms and functions of inflammasomes . Cell 2014 ; 157 : 1013 – 22 . Google Scholar CrossRef Search ADS PubMed 8. Walsh JG , Muruve DA , Power C . Inflammasomes in the CNS . Nat Rev Neurosci 2014 ; 15 : 84 – 97 . Google Scholar CrossRef Search ADS PubMed 9. Fink SL , Cookson BT . Apoptosis, pyroptosis, and necrosis: mechanistic description of dead and dying eukaryotic cells . Infect Immun 2005 ; 73 : 1907 – 16 . Google Scholar CrossRef Search ADS PubMed 10. Zhao ML , Kim MO , Morgello S , Lee SC . Expression of inducible nitric oxide synthase, interleukin-1 and caspase-1 in HIV-1 encephalitis . J Neuroimmunol 2001 ; 115 : 182 – 91 . Google Scholar CrossRef Search ADS PubMed 11. Das S , Mishra MK , Ghosh J , Basu A . Japanese Encephalitis Virus infection induces IL-18 and IL-1beta in microglia and astrocytes: correlation with in vitro cytokine responsiveness of glial cells and subsequent neuronal death . J Neuroimmunol 2008 ; 195 : 60 – 72 . Google Scholar CrossRef Search ADS PubMed 12. Guo S , Yang C , Diao B , et al. The NLRP3 inflammasome and IL-1β accelerate immunologically mediated pathology in experimental viral fulminant hepatitis . PLoS Pathog 2015 ; 11 : e1005155 . Google Scholar CrossRef Search ADS PubMed 13. Jo EK , Kim JK , Shin DM , Sasakawa C . Molecular mechanisms regulating NLRP3 inflammasome activation . Cell Mol Immunol 2016 ; 13 : 148 – 59 . Google Scholar CrossRef Search ADS PubMed 14. Shrivastava G , León-Juárez M , García-Cordero J , Meza-Sánchez DE , Cedillo-Barrón L . Inflammasomes and its importance in viral infections . Immunol Res 2016 ; 64 : 1101 – 17 . Google Scholar CrossRef Search ADS PubMed 15. Zhou R , Tardivel A , Thorens B , Choi I , Tschopp J . Thioredoxin-interacting protein links oxidative stress to inflammasome activation . Nat Immunol 2010 ; 11 : 136 – 40 . Google Scholar CrossRef Search ADS PubMed 16. Lum FM , Low DK , Fan Y , et al. Zika virus infects human fetal brain microglia and induces inflammation . Clin Infect Dis 2017 ; 64 : 914 – 20 . Google Scholar CrossRef Search ADS PubMed 17. Kaushik DK , Gupta M , Kumawat KL , Basu A . NLRP3 inflammasome: key mediator of neuroinflammation in murine Japanese encephalitis . PLoS One 2012 ; 7 : e32270 . Google Scholar CrossRef Search ADS PubMed 18. Codolo G , Plotegher N , Pozzobon T , et al. Triggering of inflammasome by aggregated α-synuclein, an inflammatory response in synucleinopathies . PLoS One 2013 ; 8 : e55375 . Google Scholar CrossRef Search ADS PubMed 19. Halle A , Hornung V , Petzold GC , et al. The NALP3 inflammasome is involved in the innate immune response to amyloid-beta . Nat Immunol 2008 ; 9 : 857 – 65 . Google Scholar CrossRef Search ADS PubMed 20. Schmitz N , Kurrer M , Bachmann MF , Kopf M . Interleukin-1 is responsible for acute lung immunopathology but increases survival of respiratory influenza virus infection . J Virol 2005 ; 79 : 6441 – 8 . Google Scholar CrossRef Search ADS PubMed 21. Mamik MK , Hui E , Branton WG , et al. HIV-1 viral protein R activates NLRP3 inflammasome in microglia: implications for HIV-1 associated neuroinflammation . J Neuroimmune Pharmacol 2017 ; 12 : 233 – 48 . Google Scholar CrossRef Search ADS PubMed 22. Wang W , Xiao F , Wan P , et al. EV71 3D protein binds with NLRP3 and enhances the assembly of inflammasome complex . PLoS Pathog 2017 ; 13 : e1006123 . Google Scholar CrossRef Search ADS PubMed 23. Ito M , Yanagi Y , Ichinohe T . Encephalomyocarditis virus viroporin 2B activates NLRP3 inflammasome . PLoS Pathog 2012 ; 8 : e1002857 . Google Scholar CrossRef Search ADS PubMed 24. Trouplin V , Boucherit N , Gorvel L , Conti F , Mottola G , Ghigo E . Bone marrow-derived macrophage production . J Vis Exp 2013 ; 81: e50966 . 25. Aliota MT , Caine EA , Walker EC , Larkin KE , Camacho E , Osorio JE . Characterization of lethal Zika virus infection in AG129 mice . PLoS Negl Trop Dis 2016 ; 10 : e0004682 . Google Scholar CrossRef Search ADS PubMed 26. Tsai TT , Chen CL , Lin YS , et al. Microglia retard dengue virus-induced acute viral encephalitis . Sci Rep 2016 ; 6 : 27670 . Google Scholar CrossRef Search ADS PubMed 27. Mao K , Chen S , Chen M , et al. Nitric oxide suppresses NLRP3 inflammasome activation and protects against LPS-induced septic shock . Cell Res 2013 ; 23 : 201 – 12 . Google Scholar CrossRef Search ADS PubMed © The Author(s) 2018. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

The Journal of Infectious DiseasesOxford University Press

Published: Mar 6, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off