Molecular partners of hNOT/ALG3, the human counterpart of the Drosophila NOT and yeast ALG3 gene, suggest its involvement in distinct cellular processes relevant to congenital disorders of glycosylation, cancer, neurodegeneration and a variety of further pathologies

Molecular partners of hNOT/ALG3, the human counterpart of the Drosophila NOT and yeast ALG3 gene,... Abstract This study provides first insights into the involvement of hNOT/ALG3, the human counterpart of the Drosophila Neighbour of TID and yeast ALG3 gene, in various putative molecular networks. HNOT/ALG3 encodes two translated transcripts encoding precursor proteins differing in their N-terminus and showing 33% identity with the yeast asparagine-linked glycosylation 3 (ALG3) protein. Experimental evidence for the functional homology of the proteins of fly and man in the N-glycosylation has still to be provided. In this study, using the yeast two-hybrid technique we identify 17 molecular partners of hNOT-1/ALG3–1. We disclose the building of hNOT/ALG3 homodimers and provide experimental evidence for its in vivo interaction with the functionally linked proteins OSBP, OSBPL9 and LRP1, the SYPL1 protein and the transcription factor CREB3. Regarding the latter, we show that the 55 kDa N-glycosylated hNOT-1/ALG3–1 molecule binds the N-glycosylated CREB3 precursor but does not interact with CREB3’s proteolytic products specific to the endoplasmic reticulum and to the nucleus. The interaction between the two partners is a prerequisite for the proteolytic activation of CREB3. In case of the further binding partners, our data suggest that hNOT-1/ALG3–1 interacts with both OSBPs and with their direct targets LRP1 and VAMP/VAP-A. Moreover, our results show that various partners of hNOT-1/ALG3–1 interact with its diverse post translationally processed products destined to distinct cellular compartments. Generally, our data suggest the involvement of hNOT-1/ALG3–1 in various molecular contexts determining essential processes associated with distinct cellular machineries and related to various pathologies, such as cancer, viral infections, neuronal and immunological disorders and CDG. Introduction HNOT/ALG3 is the human counterpart of the Neighbour of TID (NOT) gene, which was originally identified in the fruit fly Drosophila melanogaster (Dmel) (1,2) and its distant relative Drosophila virilis (Dvir) (3). As described previously, sequence comparison of the Dmel and Dvir NOT proteins revealed an identity score of 71% (3). The identity score between the proteins Dmel NOT56 (2) and hNOT-1/ALG3–1 was estimated at 48% (4). Both proteins show a 33% identity with the Saccharomyces cerevisiae non-essential asparagine (Asn)-linked glycosylation 3 (ALG3) protein, a dolichol-PP-Man: Man5GlcNAc2-dolichyl-PP mannosyltransferase acting in the asparagine-linked/N-linked glycosylation (5). Because of the structural homology, a putative association of hNOT/ALG3 with the autosomal recessive multi-systemic congenital disorders of glycosylation (CDG), which involves the defective synthesis of N-glycans and under glycosylation of glycoproteins (6,7), was concluded. However, unambiguous evidence for both Dmel NOT and its human counterpart as essential components of the N-glycosylation machinery has not been provided yet (4). The discovery of mutated hNOT/ALG3 transcripts in CDG patients (8–15) suggested this functional aspect to be of relevance and justifies research on the role of hNOT/ALG3 in the CDG pathology. Our recent study concerning the genomic organization of the gene in question and its transcription in diverse normal and tumorous cells clearly revealed that some of the mutations previously identified in CDG patients are common erratic products of the transcription/splicing machinery and, thus, can be excluded as pathologically relevant (4). Furthermore, CDG is not the only disease the gene must be considered as relevant to. Recent studies identified hNOT/ALG3 as a novel cancer biomarker (4,16–18) and putative target molecule in mental retardation (MR) not associated with CDG (19). In this study, we provide first insights into the complex biology and diversity of the cellular actions of the hNOT/ALG3 gene. Using the yeast two-hybrid (Y2H) technique (20), we identify the following 17 putative direct interaction partners of hNOT-1/ALG3–1: synaptophysin-like protein 1 (SYPL1) (21,22), low-density lipoprotein receptor-related protein 1 (LRP1) (23,24), vesicle-associated membrane protein-associated protein A (VAP-A) (25), sushi-repeat containing protein (SRPX) (26), FK506 binding protein 8 (FKBP8) (27,28), guanylate binding protein 1 (GBP1) (29,30), heme oxygenase 2 (HO-2) (31), BCL2/adenovirus E1B19 kDa interacting protein 3 (BNIP3) (32–34), oxysterol-binding protein (OSBP) (35), oxysterol-binding protein-like 9 (36), cluster of differentiation 74 (CD74) (37,38), smoothelin (SMTN) (39), Sec 16 homolog leucine zipper transcription regulator 2 (SEC16 B/LZTR2) (40,41), N-Myc downstream regulated 2 protein (NDRG2) (42), inverted-formin 2 (INF-2) (43,44), cytochrome c oxidase subunit 3 (COX3) (45,46) and c-AMP responsive element-binding protein 3 (CREB3) (47). Furthermore, using immunoprecipitation (IP) we provide experimental evidence for the in vivo binding of the protein in question with its partners OSBP, OSBPL9, LRP1, SYPL1 and CREB3, which are associated with the endoplasmic reticulum (ER). Considering the homology of hNOT/ALG3 with the ALG3 dolichol-PP-Man: Man5GlcNAc2-dolichyl-PP mannosyltransferase and the confirmed action of the yeast ALG3 protein as N-glycosyltransferase (5), we analysed the 17 isolated molecules with respect to their N-glycosylation status using diverse bioinformatical tools. These tools were also used to identify protein–protein binding-sites/domains common for both the hNOT/ALG3 proteins and their ligands. Generally, the data described herein are in congruence with recent reports implying hNOT/ALG3 to be a multifunctional player acting in concert with many molecules involved in essential molecular machineries determining cellular processes such as proliferation, differentiation, apoptosis and immune responses. Furthermore, the data suggest its relevance to distinct pathologies, not only CDG. Results Molecular partners of hNOT-1/ALG3–1 As described previously, the HNOT/ALG3 gene encodes 17 transcripts, but only the two main forms hNOT-1/ALG3–1 and hNOT-4/ALG3–4 are translated (4). The remaining 15 forms that are not translated are pathologically not relevant common truncated derivatives resulting from aberrant alternative splicing of the two main forms (4). The two full-length precursor proteins hNOT-1/ALG3–1, 438 amino acids (aa) long, and hNOT-4/ALG3–4, 390 aa long, share the region corresponding to the aa 67–438 of hNOT-1/ALG3–1 and differ in their N-terminus which determines their distinct subcellular location (4). The cytosolic hNOT-4/ALG3–4 molecule lacks the N-terminal 67 aa of hNOT-1/ALG3–1, which is equipped with the di-arginine retention/retrieval signal and further functional motifs associated with the location of the latter in the ER (4). To get preliminary insights into the molecular contexts, the proteins encoded by hNOT/ALG3 (4) are associated with we performed a search for putative physiological partners of hNOT-1/ALG3–1 using the Y2H technique (20). A recombinant expression vector pAS2–1-NOT-11–438 encoding the full-length hNOT-1/ALG3–1 molecule (4) was generated and used as a bait to screen the Human Mammary Gland Matchmaker™ cDNA Library (BD Clontech GmbH) which was cloned into the pACT2 vector (cf. Materials and Methods). A total of 6.8×105 clones was screened under highest stringency conditions (cf. Material and Methods). At least 17 clones verified as positive using the β-Gal filter assay (Fig. 1A and B) were sequenced. In Table 1, we present the proteins they encode, their subcellular location and the main functions known to date. Interestingly, many of the identified putative physiological partners of hNOT-1/ALG3–1—LRP1 (23,24), VAPA/VAMP (25), FKBP8 (27,28), HO-2 (31), BNIP3 (32–34), OSBP (35), OSBPL9 (36), CD74 (37,38), SEC16 B (40,41), INF-2 (43,44) and CREB3 (47)—are located in the ER (Table 1). Furthermore, the proteins SYPL and VAMP/VAPA (49,50), VAMP and OSBP (51), OSBPL9 (52) and FKBP8 (54) are known to be functionally linked (cf. Table 1). Table 1. Molecular partners of hNOT-1/ALG3-1 isolated using the Y2H technique Binding partner Gene ID/Acc.Nr.a Size (aa)/Isolated region Cellular location; protein class; main function(s)b and associated pathology SYPL (synaptophysin-like protein 1)/Pan (pantophysin) ID: 6856/NM_006754 (I1)c NM_182715 (I2) I1: 259/173-259 I2: 241/155-241 vesicle membrane; synaptophysin family member; multifunctional role in vesicle biogenesis and transport; trafficking of the insulin-responsive GLUT4 glucose transporter from intracellular vesicles to plasma membrane (21); up-regulation in the prefrontal cortex of chronic alcoholics (22) LRP1 (low-density lipoprotein receptor-related protein 1)/LDL (low-density lipoprotein/CD91 ID: 4035/NM_002332 4544/4280-4530 (cytoplasmic domain) membrane, ER; LDL receptor superfamily member; action in endocytosis, signal transduction, modulation of activity of transmembrane receptors, lipoprotein metabolism, activation of lysosomal enzymes and cellular entry of bacterial toxins and viruses; determination of cell-survival/-migration/-differentiation/-adhesion, vascular permeability, angiogenesis, inflammation and phagocytosis; maintaining blood brain barrier; control of trafficking of neuronal prion protein (PrPC) (24); cancer progression and metastasis; atherosclerosis; Alzheimer (23) VAMP (vesicle-associated membrane protein-associated protein A)/VAPA/Synaptobrevin ID: 9218/NM_194434 (I1)3 249/117-249 membrane, synaptic vesicles, ER, Golgi, microtubules; secretory pathway component; vesicle docking, fusion and transport to tight junctions (25); mediation of exocytosis of neutrophils- and tertiary-granules/innate immune response against infection (48); direct binding partner of synaptophysin (49); regulation of GLUT4 translocation (50); regulation of ceramide trafficking from ER to Golgi (35); modification of protein export from ER in concert with OSBP (51); regulation of OSBPL9 partitioning between ER and Golgi (52); formation of the HCV RNA replication complex (53); regulation of subcellular localization of protrudin/stimulation of neurite formation (54); transportation of prestin inside outer hair cells (OHCs) (55); promotion of O-glycosylation of synaptotagmin1 (56) SRPX X-linked (sushi repeat-containing protein) ID: 8406 NP_006298 (I1)3 NP_00164222 (I3) NP_00164223 (I4) I1: 465/1-82 I3: 405/1-82 I4: 379/1-82 extracellular, cytoplasm; chondroitin sulfate proteoglycan (26); X-linked secretory (classical) pathway component; mediator of angiogenesis and endothelial remodeling (57); promotion of cell migration and adhesion; tumor suppressor in diverse cancers (26,58); suppressor of v-src transformation (59); loss of function in retinitis pigmentosa (60); rolandic seizures disorders (61) FKBP8 (FK506 binding protein 8) ID: 23770/NM_012181 (I2)3 413/1-250 ER, mitochondrial membrane; immunophilin family member, peptidyl prolyl cis/trans isomerase (PPIase), multifunctional calmodulin (CaM)-Ca2+dependent chaperone; regulator of Bcl-2 and Bcl-XL-activity and -dependent apoptosis (27,28); maturation and trafficking of the HERG potassium channel/cardiac Long QT syndrome (62); anchoring the 26S proteasome to the organelle membrane (63); regulation of tuberous sclerosis (TSC)-mediated cell size (64); control of neural tube patterning via regulation of sonic hedgehog signalling (65); regulation of subcellular localization of protruding neurite formation (54); regulation of Hepatitis C virus (HCV) replication (66) GBP1 (guanylate binding protein 1) ID: 2633/NP_002044 592/449-592 extracellular; GTPase of the dynamin superfamily (29); interferon-γ, IL-1-, TNF-α- and LPS-inducible secretory (non-classical) pathway; antiviral and antimicrobial activities (30); tumor suppressor in colorectal cancer (67); regulator of the anti-angiogenic response of endothelial cells (ECs) (68) HO-2 (heme oxygenase 2), Ib ID: 3163/NP_001120676 316/1-226 ER, endosomes, lysosomes; heme catabolism/regulation of heme-dependent protein synthesis; regulation of O2 sensing and response to hypoxia; neuro-, inflammatory-, immune- and microvascular-pathology (31) BNIP3 (BCL2/adenovirus E1B 19 kDa interacting protein 3 ID: 664/AAH80643 228/1-126 mitochondria, ER; stress sensor; promotion of apoptotic and non-apoptotic (autophagy) cell death; induction of caspase-independent necrosis (32–34); maintaining hematopoietic homeostasis; prognosis marker in diverse cancers; causal in cardiomyopathies following ischemic and non-ischemic injuries (69) OSBP (oxysterol-binding protein) ID: 5007/NM_002556 807/195-474 ER, Golgi; cholesterol derivate; transcriptional and post-transcriptional regulation and transport of cholesterol; lipid metabolism; synthesis of bile acids and steroid hormones; activation of ceramide transport in concert with VAPA (35); Hh signalling and associated pathology; atherosclerosis; age-associated macular degeneration; Alzheimer (70); HCV infection (71); cancer (72) OSBPL9 (oxysterol binding protein-like 9) ID: 114883 NM_148906 (Ib) NM_024586 (Ie) EAX06812 (CRA_c)3 EAX06815 (CRA_f) Ib: 719/55-310 Ie: 736/72-327 CRA_c: 754/ 90-345 CRA_f: 738/72-327 ER, Golgi; member of the OSBP family; cholesterol transfer protein regulating Golgi structure and function (36); its partitioning between ER and Golgi is regulated by VAMP (52); negative regulator of Akt phosphorylation (73) CD74 (cluster of differentiation) ID: 972/NP_004346 (Ib) 232/10-232 intracellular, ER, Golgi; type-2 glycoprotein; multiple roles in B-, T- and antigen-presenting-cells actions/chaperoning MHC class II molecules (74,37); receptor for macrophage migration inhibitory factor (MMIF) and Helicobacter pylori (H.pylori) (75); overexpression in hematologic and non-hematologic tumours and immunologic diseases (76); therapeutic target for gastrointestinal cancer and ulcerative colitis (76) SMTN (smoothelin) ID: 6525/EAW59932 (I CRA_h) 944/25-798 cytoplasm, cytoskeleton; exclusive expression in contractile smooth muscle cells/differentiation marker (39); deficiency is causal in coronary heart disease/stroke (77); aberrant expression in diverse cancers/marker for staging of colon adenocarcinoma (78) SEC16 B/LZTR2 (leucine zipper transcription regulator 2) ID: 89866/EAW91013 (ICRA_c) 733/519-737 ER; organization and cargo-export (40,41); coordination of circadian clock/involvement in affective disorders such as schizophrenia, bipolar disorder, restless leg syndrome (79) and obesity (80) NDRG2 (N-Myc downstream regulated 2 protein) ID: 57447/NP_057334 (I b) 357/26-263 cytoplasm, cell membrane, adherent junctions, nucleus (42); insulin signalling in skeletal muscle (81), Myc-repressed tumour suppressor; regulator of proliferation/differentiation/apoptosis/ER stress response via diverse oncogenic signalling pathways/cancer genesis and progression (42,82); differentiation of dendritic cells (DCs) and maintenance of their impact on T-cell activation (83); upregulation in Alzheimer’s disease (84) INF-2 (inverted formin-2) ID: 64423/NP_071934 (I1) 1249/567-849 ER; regulation of actin dynamics (43,44); causal in hereditary glomerulosclerosis (FSGS), the nephrotic syndrome (85,86) and in Charcot-Marie-Tooth (CMT) neuropathy (87) COX3 (cytochrome c oxidase subunit 3) ID: 4514/YP_003024032 261/151-261 mitochondrial membrane; subunit 3 of cytochrome c oxidase; deficiency results in respiratory chain defects such as MELAS (mitochondrial encephalomyopathy, lactic acidosis, stroke-like episodes), myoglobinuria, Leigh syndrome (45,46); aging, neuro-degenerative diseases and hypertrophic cardiomyopathy (88) CREB3/LZIP (cyclic AMP-responsive element-binding protein 3) ID: 10488/BC009402 (I2) 371/1-253 ER, Golgi-membrane, cytosol, nucleus; CREB/ATF transcription factors (TF) family member (47); major regulator of protein secretion (89); activation of the unfolded protein response (UPR)-associated transcription and the ER-associated degradation (ERAD) machinery (90); negative regulator of HIV-1 replication (91); positive regulator of NF-kB (92); negative regulator of the glucocorticoid receptor (93) Binding partner Gene ID/Acc.Nr.a Size (aa)/Isolated region Cellular location; protein class; main function(s)b and associated pathology SYPL (synaptophysin-like protein 1)/Pan (pantophysin) ID: 6856/NM_006754 (I1)c NM_182715 (I2) I1: 259/173-259 I2: 241/155-241 vesicle membrane; synaptophysin family member; multifunctional role in vesicle biogenesis and transport; trafficking of the insulin-responsive GLUT4 glucose transporter from intracellular vesicles to plasma membrane (21); up-regulation in the prefrontal cortex of chronic alcoholics (22) LRP1 (low-density lipoprotein receptor-related protein 1)/LDL (low-density lipoprotein/CD91 ID: 4035/NM_002332 4544/4280-4530 (cytoplasmic domain) membrane, ER; LDL receptor superfamily member; action in endocytosis, signal transduction, modulation of activity of transmembrane receptors, lipoprotein metabolism, activation of lysosomal enzymes and cellular entry of bacterial toxins and viruses; determination of cell-survival/-migration/-differentiation/-adhesion, vascular permeability, angiogenesis, inflammation and phagocytosis; maintaining blood brain barrier; control of trafficking of neuronal prion protein (PrPC) (24); cancer progression and metastasis; atherosclerosis; Alzheimer (23) VAMP (vesicle-associated membrane protein-associated protein A)/VAPA/Synaptobrevin ID: 9218/NM_194434 (I1)3 249/117-249 membrane, synaptic vesicles, ER, Golgi, microtubules; secretory pathway component; vesicle docking, fusion and transport to tight junctions (25); mediation of exocytosis of neutrophils- and tertiary-granules/innate immune response against infection (48); direct binding partner of synaptophysin (49); regulation of GLUT4 translocation (50); regulation of ceramide trafficking from ER to Golgi (35); modification of protein export from ER in concert with OSBP (51); regulation of OSBPL9 partitioning between ER and Golgi (52); formation of the HCV RNA replication complex (53); regulation of subcellular localization of protrudin/stimulation of neurite formation (54); transportation of prestin inside outer hair cells (OHCs) (55); promotion of O-glycosylation of synaptotagmin1 (56) SRPX X-linked (sushi repeat-containing protein) ID: 8406 NP_006298 (I1)3 NP_00164222 (I3) NP_00164223 (I4) I1: 465/1-82 I3: 405/1-82 I4: 379/1-82 extracellular, cytoplasm; chondroitin sulfate proteoglycan (26); X-linked secretory (classical) pathway component; mediator of angiogenesis and endothelial remodeling (57); promotion of cell migration and adhesion; tumor suppressor in diverse cancers (26,58); suppressor of v-src transformation (59); loss of function in retinitis pigmentosa (60); rolandic seizures disorders (61) FKBP8 (FK506 binding protein 8) ID: 23770/NM_012181 (I2)3 413/1-250 ER, mitochondrial membrane; immunophilin family member, peptidyl prolyl cis/trans isomerase (PPIase), multifunctional calmodulin (CaM)-Ca2+dependent chaperone; regulator of Bcl-2 and Bcl-XL-activity and -dependent apoptosis (27,28); maturation and trafficking of the HERG potassium channel/cardiac Long QT syndrome (62); anchoring the 26S proteasome to the organelle membrane (63); regulation of tuberous sclerosis (TSC)-mediated cell size (64); control of neural tube patterning via regulation of sonic hedgehog signalling (65); regulation of subcellular localization of protruding neurite formation (54); regulation of Hepatitis C virus (HCV) replication (66) GBP1 (guanylate binding protein 1) ID: 2633/NP_002044 592/449-592 extracellular; GTPase of the dynamin superfamily (29); interferon-γ, IL-1-, TNF-α- and LPS-inducible secretory (non-classical) pathway; antiviral and antimicrobial activities (30); tumor suppressor in colorectal cancer (67); regulator of the anti-angiogenic response of endothelial cells (ECs) (68) HO-2 (heme oxygenase 2), Ib ID: 3163/NP_001120676 316/1-226 ER, endosomes, lysosomes; heme catabolism/regulation of heme-dependent protein synthesis; regulation of O2 sensing and response to hypoxia; neuro-, inflammatory-, immune- and microvascular-pathology (31) BNIP3 (BCL2/adenovirus E1B 19 kDa interacting protein 3 ID: 664/AAH80643 228/1-126 mitochondria, ER; stress sensor; promotion of apoptotic and non-apoptotic (autophagy) cell death; induction of caspase-independent necrosis (32–34); maintaining hematopoietic homeostasis; prognosis marker in diverse cancers; causal in cardiomyopathies following ischemic and non-ischemic injuries (69) OSBP (oxysterol-binding protein) ID: 5007/NM_002556 807/195-474 ER, Golgi; cholesterol derivate; transcriptional and post-transcriptional regulation and transport of cholesterol; lipid metabolism; synthesis of bile acids and steroid hormones; activation of ceramide transport in concert with VAPA (35); Hh signalling and associated pathology; atherosclerosis; age-associated macular degeneration; Alzheimer (70); HCV infection (71); cancer (72) OSBPL9 (oxysterol binding protein-like 9) ID: 114883 NM_148906 (Ib) NM_024586 (Ie) EAX06812 (CRA_c)3 EAX06815 (CRA_f) Ib: 719/55-310 Ie: 736/72-327 CRA_c: 754/ 90-345 CRA_f: 738/72-327 ER, Golgi; member of the OSBP family; cholesterol transfer protein regulating Golgi structure and function (36); its partitioning between ER and Golgi is regulated by VAMP (52); negative regulator of Akt phosphorylation (73) CD74 (cluster of differentiation) ID: 972/NP_004346 (Ib) 232/10-232 intracellular, ER, Golgi; type-2 glycoprotein; multiple roles in B-, T- and antigen-presenting-cells actions/chaperoning MHC class II molecules (74,37); receptor for macrophage migration inhibitory factor (MMIF) and Helicobacter pylori (H.pylori) (75); overexpression in hematologic and non-hematologic tumours and immunologic diseases (76); therapeutic target for gastrointestinal cancer and ulcerative colitis (76) SMTN (smoothelin) ID: 6525/EAW59932 (I CRA_h) 944/25-798 cytoplasm, cytoskeleton; exclusive expression in contractile smooth muscle cells/differentiation marker (39); deficiency is causal in coronary heart disease/stroke (77); aberrant expression in diverse cancers/marker for staging of colon adenocarcinoma (78) SEC16 B/LZTR2 (leucine zipper transcription regulator 2) ID: 89866/EAW91013 (ICRA_c) 733/519-737 ER; organization and cargo-export (40,41); coordination of circadian clock/involvement in affective disorders such as schizophrenia, bipolar disorder, restless leg syndrome (79) and obesity (80) NDRG2 (N-Myc downstream regulated 2 protein) ID: 57447/NP_057334 (I b) 357/26-263 cytoplasm, cell membrane, adherent junctions, nucleus (42); insulin signalling in skeletal muscle (81), Myc-repressed tumour suppressor; regulator of proliferation/differentiation/apoptosis/ER stress response via diverse oncogenic signalling pathways/cancer genesis and progression (42,82); differentiation of dendritic cells (DCs) and maintenance of their impact on T-cell activation (83); upregulation in Alzheimer’s disease (84) INF-2 (inverted formin-2) ID: 64423/NP_071934 (I1) 1249/567-849 ER; regulation of actin dynamics (43,44); causal in hereditary glomerulosclerosis (FSGS), the nephrotic syndrome (85,86) and in Charcot-Marie-Tooth (CMT) neuropathy (87) COX3 (cytochrome c oxidase subunit 3) ID: 4514/YP_003024032 261/151-261 mitochondrial membrane; subunit 3 of cytochrome c oxidase; deficiency results in respiratory chain defects such as MELAS (mitochondrial encephalomyopathy, lactic acidosis, stroke-like episodes), myoglobinuria, Leigh syndrome (45,46); aging, neuro-degenerative diseases and hypertrophic cardiomyopathy (88) CREB3/LZIP (cyclic AMP-responsive element-binding protein 3) ID: 10488/BC009402 (I2) 371/1-253 ER, Golgi-membrane, cytosol, nucleus; CREB/ATF transcription factors (TF) family member (47); major regulator of protein secretion (89); activation of the unfolded protein response (UPR)-associated transcription and the ER-associated degradation (ERAD) machinery (90); negative regulator of HIV-1 replication (91); positive regulator of NF-kB (92); negative regulator of the glucocorticoid receptor (93) a NCBI: gb-admin@ncbi.nlm.hih.gov. b Functions linked to a further of the isolated partner(s) are in bold; aa: amino acid; Isolated region: fragment isolated in the Y2H screen; I(s): isoform(s). c Isoform analysed using the ELM database for functional motifs/domains common with NOT/ALG3 (cf. Tables 2 and 3). Table 1. Molecular partners of hNOT-1/ALG3-1 isolated using the Y2H technique Binding partner Gene ID/Acc.Nr.a Size (aa)/Isolated region Cellular location; protein class; main function(s)b and associated pathology SYPL (synaptophysin-like protein 1)/Pan (pantophysin) ID: 6856/NM_006754 (I1)c NM_182715 (I2) I1: 259/173-259 I2: 241/155-241 vesicle membrane; synaptophysin family member; multifunctional role in vesicle biogenesis and transport; trafficking of the insulin-responsive GLUT4 glucose transporter from intracellular vesicles to plasma membrane (21); up-regulation in the prefrontal cortex of chronic alcoholics (22) LRP1 (low-density lipoprotein receptor-related protein 1)/LDL (low-density lipoprotein/CD91 ID: 4035/NM_002332 4544/4280-4530 (cytoplasmic domain) membrane, ER; LDL receptor superfamily member; action in endocytosis, signal transduction, modulation of activity of transmembrane receptors, lipoprotein metabolism, activation of lysosomal enzymes and cellular entry of bacterial toxins and viruses; determination of cell-survival/-migration/-differentiation/-adhesion, vascular permeability, angiogenesis, inflammation and phagocytosis; maintaining blood brain barrier; control of trafficking of neuronal prion protein (PrPC) (24); cancer progression and metastasis; atherosclerosis; Alzheimer (23) VAMP (vesicle-associated membrane protein-associated protein A)/VAPA/Synaptobrevin ID: 9218/NM_194434 (I1)3 249/117-249 membrane, synaptic vesicles, ER, Golgi, microtubules; secretory pathway component; vesicle docking, fusion and transport to tight junctions (25); mediation of exocytosis of neutrophils- and tertiary-granules/innate immune response against infection (48); direct binding partner of synaptophysin (49); regulation of GLUT4 translocation (50); regulation of ceramide trafficking from ER to Golgi (35); modification of protein export from ER in concert with OSBP (51); regulation of OSBPL9 partitioning between ER and Golgi (52); formation of the HCV RNA replication complex (53); regulation of subcellular localization of protrudin/stimulation of neurite formation (54); transportation of prestin inside outer hair cells (OHCs) (55); promotion of O-glycosylation of synaptotagmin1 (56) SRPX X-linked (sushi repeat-containing protein) ID: 8406 NP_006298 (I1)3 NP_00164222 (I3) NP_00164223 (I4) I1: 465/1-82 I3: 405/1-82 I4: 379/1-82 extracellular, cytoplasm; chondroitin sulfate proteoglycan (26); X-linked secretory (classical) pathway component; mediator of angiogenesis and endothelial remodeling (57); promotion of cell migration and adhesion; tumor suppressor in diverse cancers (26,58); suppressor of v-src transformation (59); loss of function in retinitis pigmentosa (60); rolandic seizures disorders (61) FKBP8 (FK506 binding protein 8) ID: 23770/NM_012181 (I2)3 413/1-250 ER, mitochondrial membrane; immunophilin family member, peptidyl prolyl cis/trans isomerase (PPIase), multifunctional calmodulin (CaM)-Ca2+dependent chaperone; regulator of Bcl-2 and Bcl-XL-activity and -dependent apoptosis (27,28); maturation and trafficking of the HERG potassium channel/cardiac Long QT syndrome (62); anchoring the 26S proteasome to the organelle membrane (63); regulation of tuberous sclerosis (TSC)-mediated cell size (64); control of neural tube patterning via regulation of sonic hedgehog signalling (65); regulation of subcellular localization of protruding neurite formation (54); regulation of Hepatitis C virus (HCV) replication (66) GBP1 (guanylate binding protein 1) ID: 2633/NP_002044 592/449-592 extracellular; GTPase of the dynamin superfamily (29); interferon-γ, IL-1-, TNF-α- and LPS-inducible secretory (non-classical) pathway; antiviral and antimicrobial activities (30); tumor suppressor in colorectal cancer (67); regulator of the anti-angiogenic response of endothelial cells (ECs) (68) HO-2 (heme oxygenase 2), Ib ID: 3163/NP_001120676 316/1-226 ER, endosomes, lysosomes; heme catabolism/regulation of heme-dependent protein synthesis; regulation of O2 sensing and response to hypoxia; neuro-, inflammatory-, immune- and microvascular-pathology (31) BNIP3 (BCL2/adenovirus E1B 19 kDa interacting protein 3 ID: 664/AAH80643 228/1-126 mitochondria, ER; stress sensor; promotion of apoptotic and non-apoptotic (autophagy) cell death; induction of caspase-independent necrosis (32–34); maintaining hematopoietic homeostasis; prognosis marker in diverse cancers; causal in cardiomyopathies following ischemic and non-ischemic injuries (69) OSBP (oxysterol-binding protein) ID: 5007/NM_002556 807/195-474 ER, Golgi; cholesterol derivate; transcriptional and post-transcriptional regulation and transport of cholesterol; lipid metabolism; synthesis of bile acids and steroid hormones; activation of ceramide transport in concert with VAPA (35); Hh signalling and associated pathology; atherosclerosis; age-associated macular degeneration; Alzheimer (70); HCV infection (71); cancer (72) OSBPL9 (oxysterol binding protein-like 9) ID: 114883 NM_148906 (Ib) NM_024586 (Ie) EAX06812 (CRA_c)3 EAX06815 (CRA_f) Ib: 719/55-310 Ie: 736/72-327 CRA_c: 754/ 90-345 CRA_f: 738/72-327 ER, Golgi; member of the OSBP family; cholesterol transfer protein regulating Golgi structure and function (36); its partitioning between ER and Golgi is regulated by VAMP (52); negative regulator of Akt phosphorylation (73) CD74 (cluster of differentiation) ID: 972/NP_004346 (Ib) 232/10-232 intracellular, ER, Golgi; type-2 glycoprotein; multiple roles in B-, T- and antigen-presenting-cells actions/chaperoning MHC class II molecules (74,37); receptor for macrophage migration inhibitory factor (MMIF) and Helicobacter pylori (H.pylori) (75); overexpression in hematologic and non-hematologic tumours and immunologic diseases (76); therapeutic target for gastrointestinal cancer and ulcerative colitis (76) SMTN (smoothelin) ID: 6525/EAW59932 (I CRA_h) 944/25-798 cytoplasm, cytoskeleton; exclusive expression in contractile smooth muscle cells/differentiation marker (39); deficiency is causal in coronary heart disease/stroke (77); aberrant expression in diverse cancers/marker for staging of colon adenocarcinoma (78) SEC16 B/LZTR2 (leucine zipper transcription regulator 2) ID: 89866/EAW91013 (ICRA_c) 733/519-737 ER; organization and cargo-export (40,41); coordination of circadian clock/involvement in affective disorders such as schizophrenia, bipolar disorder, restless leg syndrome (79) and obesity (80) NDRG2 (N-Myc downstream regulated 2 protein) ID: 57447/NP_057334 (I b) 357/26-263 cytoplasm, cell membrane, adherent junctions, nucleus (42); insulin signalling in skeletal muscle (81), Myc-repressed tumour suppressor; regulator of proliferation/differentiation/apoptosis/ER stress response via diverse oncogenic signalling pathways/cancer genesis and progression (42,82); differentiation of dendritic cells (DCs) and maintenance of their impact on T-cell activation (83); upregulation in Alzheimer’s disease (84) INF-2 (inverted formin-2) ID: 64423/NP_071934 (I1) 1249/567-849 ER; regulation of actin dynamics (43,44); causal in hereditary glomerulosclerosis (FSGS), the nephrotic syndrome (85,86) and in Charcot-Marie-Tooth (CMT) neuropathy (87) COX3 (cytochrome c oxidase subunit 3) ID: 4514/YP_003024032 261/151-261 mitochondrial membrane; subunit 3 of cytochrome c oxidase; deficiency results in respiratory chain defects such as MELAS (mitochondrial encephalomyopathy, lactic acidosis, stroke-like episodes), myoglobinuria, Leigh syndrome (45,46); aging, neuro-degenerative diseases and hypertrophic cardiomyopathy (88) CREB3/LZIP (cyclic AMP-responsive element-binding protein 3) ID: 10488/BC009402 (I2) 371/1-253 ER, Golgi-membrane, cytosol, nucleus; CREB/ATF transcription factors (TF) family member (47); major regulator of protein secretion (89); activation of the unfolded protein response (UPR)-associated transcription and the ER-associated degradation (ERAD) machinery (90); negative regulator of HIV-1 replication (91); positive regulator of NF-kB (92); negative regulator of the glucocorticoid receptor (93) Binding partner Gene ID/Acc.Nr.a Size (aa)/Isolated region Cellular location; protein class; main function(s)b and associated pathology SYPL (synaptophysin-like protein 1)/Pan (pantophysin) ID: 6856/NM_006754 (I1)c NM_182715 (I2) I1: 259/173-259 I2: 241/155-241 vesicle membrane; synaptophysin family member; multifunctional role in vesicle biogenesis and transport; trafficking of the insulin-responsive GLUT4 glucose transporter from intracellular vesicles to plasma membrane (21); up-regulation in the prefrontal cortex of chronic alcoholics (22) LRP1 (low-density lipoprotein receptor-related protein 1)/LDL (low-density lipoprotein/CD91 ID: 4035/NM_002332 4544/4280-4530 (cytoplasmic domain) membrane, ER; LDL receptor superfamily member; action in endocytosis, signal transduction, modulation of activity of transmembrane receptors, lipoprotein metabolism, activation of lysosomal enzymes and cellular entry of bacterial toxins and viruses; determination of cell-survival/-migration/-differentiation/-adhesion, vascular permeability, angiogenesis, inflammation and phagocytosis; maintaining blood brain barrier; control of trafficking of neuronal prion protein (PrPC) (24); cancer progression and metastasis; atherosclerosis; Alzheimer (23) VAMP (vesicle-associated membrane protein-associated protein A)/VAPA/Synaptobrevin ID: 9218/NM_194434 (I1)3 249/117-249 membrane, synaptic vesicles, ER, Golgi, microtubules; secretory pathway component; vesicle docking, fusion and transport to tight junctions (25); mediation of exocytosis of neutrophils- and tertiary-granules/innate immune response against infection (48); direct binding partner of synaptophysin (49); regulation of GLUT4 translocation (50); regulation of ceramide trafficking from ER to Golgi (35); modification of protein export from ER in concert with OSBP (51); regulation of OSBPL9 partitioning between ER and Golgi (52); formation of the HCV RNA replication complex (53); regulation of subcellular localization of protrudin/stimulation of neurite formation (54); transportation of prestin inside outer hair cells (OHCs) (55); promotion of O-glycosylation of synaptotagmin1 (56) SRPX X-linked (sushi repeat-containing protein) ID: 8406 NP_006298 (I1)3 NP_00164222 (I3) NP_00164223 (I4) I1: 465/1-82 I3: 405/1-82 I4: 379/1-82 extracellular, cytoplasm; chondroitin sulfate proteoglycan (26); X-linked secretory (classical) pathway component; mediator of angiogenesis and endothelial remodeling (57); promotion of cell migration and adhesion; tumor suppressor in diverse cancers (26,58); suppressor of v-src transformation (59); loss of function in retinitis pigmentosa (60); rolandic seizures disorders (61) FKBP8 (FK506 binding protein 8) ID: 23770/NM_012181 (I2)3 413/1-250 ER, mitochondrial membrane; immunophilin family member, peptidyl prolyl cis/trans isomerase (PPIase), multifunctional calmodulin (CaM)-Ca2+dependent chaperone; regulator of Bcl-2 and Bcl-XL-activity and -dependent apoptosis (27,28); maturation and trafficking of the HERG potassium channel/cardiac Long QT syndrome (62); anchoring the 26S proteasome to the organelle membrane (63); regulation of tuberous sclerosis (TSC)-mediated cell size (64); control of neural tube patterning via regulation of sonic hedgehog signalling (65); regulation of subcellular localization of protruding neurite formation (54); regulation of Hepatitis C virus (HCV) replication (66) GBP1 (guanylate binding protein 1) ID: 2633/NP_002044 592/449-592 extracellular; GTPase of the dynamin superfamily (29); interferon-γ, IL-1-, TNF-α- and LPS-inducible secretory (non-classical) pathway; antiviral and antimicrobial activities (30); tumor suppressor in colorectal cancer (67); regulator of the anti-angiogenic response of endothelial cells (ECs) (68) HO-2 (heme oxygenase 2), Ib ID: 3163/NP_001120676 316/1-226 ER, endosomes, lysosomes; heme catabolism/regulation of heme-dependent protein synthesis; regulation of O2 sensing and response to hypoxia; neuro-, inflammatory-, immune- and microvascular-pathology (31) BNIP3 (BCL2/adenovirus E1B 19 kDa interacting protein 3 ID: 664/AAH80643 228/1-126 mitochondria, ER; stress sensor; promotion of apoptotic and non-apoptotic (autophagy) cell death; induction of caspase-independent necrosis (32–34); maintaining hematopoietic homeostasis; prognosis marker in diverse cancers; causal in cardiomyopathies following ischemic and non-ischemic injuries (69) OSBP (oxysterol-binding protein) ID: 5007/NM_002556 807/195-474 ER, Golgi; cholesterol derivate; transcriptional and post-transcriptional regulation and transport of cholesterol; lipid metabolism; synthesis of bile acids and steroid hormones; activation of ceramide transport in concert with VAPA (35); Hh signalling and associated pathology; atherosclerosis; age-associated macular degeneration; Alzheimer (70); HCV infection (71); cancer (72) OSBPL9 (oxysterol binding protein-like 9) ID: 114883 NM_148906 (Ib) NM_024586 (Ie) EAX06812 (CRA_c)3 EAX06815 (CRA_f) Ib: 719/55-310 Ie: 736/72-327 CRA_c: 754/ 90-345 CRA_f: 738/72-327 ER, Golgi; member of the OSBP family; cholesterol transfer protein regulating Golgi structure and function (36); its partitioning between ER and Golgi is regulated by VAMP (52); negative regulator of Akt phosphorylation (73) CD74 (cluster of differentiation) ID: 972/NP_004346 (Ib) 232/10-232 intracellular, ER, Golgi; type-2 glycoprotein; multiple roles in B-, T- and antigen-presenting-cells actions/chaperoning MHC class II molecules (74,37); receptor for macrophage migration inhibitory factor (MMIF) and Helicobacter pylori (H.pylori) (75); overexpression in hematologic and non-hematologic tumours and immunologic diseases (76); therapeutic target for gastrointestinal cancer and ulcerative colitis (76) SMTN (smoothelin) ID: 6525/EAW59932 (I CRA_h) 944/25-798 cytoplasm, cytoskeleton; exclusive expression in contractile smooth muscle cells/differentiation marker (39); deficiency is causal in coronary heart disease/stroke (77); aberrant expression in diverse cancers/marker for staging of colon adenocarcinoma (78) SEC16 B/LZTR2 (leucine zipper transcription regulator 2) ID: 89866/EAW91013 (ICRA_c) 733/519-737 ER; organization and cargo-export (40,41); coordination of circadian clock/involvement in affective disorders such as schizophrenia, bipolar disorder, restless leg syndrome (79) and obesity (80) NDRG2 (N-Myc downstream regulated 2 protein) ID: 57447/NP_057334 (I b) 357/26-263 cytoplasm, cell membrane, adherent junctions, nucleus (42); insulin signalling in skeletal muscle (81), Myc-repressed tumour suppressor; regulator of proliferation/differentiation/apoptosis/ER stress response via diverse oncogenic signalling pathways/cancer genesis and progression (42,82); differentiation of dendritic cells (DCs) and maintenance of their impact on T-cell activation (83); upregulation in Alzheimer’s disease (84) INF-2 (inverted formin-2) ID: 64423/NP_071934 (I1) 1249/567-849 ER; regulation of actin dynamics (43,44); causal in hereditary glomerulosclerosis (FSGS), the nephrotic syndrome (85,86) and in Charcot-Marie-Tooth (CMT) neuropathy (87) COX3 (cytochrome c oxidase subunit 3) ID: 4514/YP_003024032 261/151-261 mitochondrial membrane; subunit 3 of cytochrome c oxidase; deficiency results in respiratory chain defects such as MELAS (mitochondrial encephalomyopathy, lactic acidosis, stroke-like episodes), myoglobinuria, Leigh syndrome (45,46); aging, neuro-degenerative diseases and hypertrophic cardiomyopathy (88) CREB3/LZIP (cyclic AMP-responsive element-binding protein 3) ID: 10488/BC009402 (I2) 371/1-253 ER, Golgi-membrane, cytosol, nucleus; CREB/ATF transcription factors (TF) family member (47); major regulator of protein secretion (89); activation of the unfolded protein response (UPR)-associated transcription and the ER-associated degradation (ERAD) machinery (90); negative regulator of HIV-1 replication (91); positive regulator of NF-kB (92); negative regulator of the glucocorticoid receptor (93) a NCBI: gb-admin@ncbi.nlm.hih.gov. b Functions linked to a further of the isolated partner(s) are in bold; aa: amino acid; Isolated region: fragment isolated in the Y2H screen; I(s): isoform(s). c Isoform analysed using the ELM database for functional motifs/domains common with NOT/ALG3 (cf. Tables 2 and 3). Figure 1. View largeDownload slide Β-Gal filter assay to confirm the interactions of hNOT-1/ALG3-1 with its 17 putative partners and to exclude the building of homodimers. (A) Growth of the yeast AH109 cells co-transformed with the pAS2–1-hNOT-11-438 bait and 19 clones (1–19) isolated as putative hNOT-1/ALG3-1 partners (cf. Materials and Methods). The cells were grown on a medium-medium (SD/-Leu/-Trp/-His) containing glucose and X-α-Gal. (B) Determination of β-Galactosidase using the β-Gal filter assay to confirm positive clones. The assay was applied to the co-transformants described in (A) grown on both a medium- and high stringency-medium (SD/-Leu/-Trp/-His/-Ade), both containing glucose and X-α-Gal. The clones 1-17 (blue) represent the sequenced putative hNOT-1/ALG3-1 binding partners (cf. Results and Table 1). The clones 18 and 19 are negative. Cells co-transformed with the bait and the pACT2-p53 vector (20) and cells co-transformed with the empty vectors pAS2-1 and pACT2 (21) served as negative controls. Cells transformed with the pC11 vector encoding GAL4 and cells co-transformed with the recombinant vectors pAS2-1-Ptc11143-1286 and pACT2-Tid206-318 (146,125) served as positive controls (22,23). (1: SYPL1; 2: LRP1; 3: VAPA; 4: SRPX; 5: FKBP8; 6: GBP1; 7: HMOX2; 8: BNIP3; 9: OSBP; 10: OSBPL9; 11: CD74; 12: SMTN; 13: Sec16B; 14: NDRG2; 15: INF2; 16: MT-CO3; 17: CREB3). (C) Colony blot of protein extracts isolated from yeast Y187 cells transformed with the pAS2-1-hNOT-11-438 vector equipped with the GAL4-BD domain and the pACT2-hNOT-11-438 vector equipped with the GAL4-AD domain. The expression of the recombinant proteins NOT-1-BD and NOT-1-AD was determined using domain specific antibodies (cf. Material and Methods). As negative controls lysates from Y187 cells transformed with the two empty vectors (C, -1) and with the recombinant pAS2-1-hNOT-11-438 and the pure pACT2 (C, -2) vector were used. As positive control lysates from yeast cells transformed with the pCL1 vector encoding the GAL4 factor (C, +) were used. Figure 1. View largeDownload slide Β-Gal filter assay to confirm the interactions of hNOT-1/ALG3-1 with its 17 putative partners and to exclude the building of homodimers. (A) Growth of the yeast AH109 cells co-transformed with the pAS2–1-hNOT-11-438 bait and 19 clones (1–19) isolated as putative hNOT-1/ALG3-1 partners (cf. Materials and Methods). The cells were grown on a medium-medium (SD/-Leu/-Trp/-His) containing glucose and X-α-Gal. (B) Determination of β-Galactosidase using the β-Gal filter assay to confirm positive clones. The assay was applied to the co-transformants described in (A) grown on both a medium- and high stringency-medium (SD/-Leu/-Trp/-His/-Ade), both containing glucose and X-α-Gal. The clones 1-17 (blue) represent the sequenced putative hNOT-1/ALG3-1 binding partners (cf. Results and Table 1). The clones 18 and 19 are negative. Cells co-transformed with the bait and the pACT2-p53 vector (20) and cells co-transformed with the empty vectors pAS2-1 and pACT2 (21) served as negative controls. Cells transformed with the pC11 vector encoding GAL4 and cells co-transformed with the recombinant vectors pAS2-1-Ptc11143-1286 and pACT2-Tid206-318 (146,125) served as positive controls (22,23). (1: SYPL1; 2: LRP1; 3: VAPA; 4: SRPX; 5: FKBP8; 6: GBP1; 7: HMOX2; 8: BNIP3; 9: OSBP; 10: OSBPL9; 11: CD74; 12: SMTN; 13: Sec16B; 14: NDRG2; 15: INF2; 16: MT-CO3; 17: CREB3). (C) Colony blot of protein extracts isolated from yeast Y187 cells transformed with the pAS2-1-hNOT-11-438 vector equipped with the GAL4-BD domain and the pACT2-hNOT-11-438 vector equipped with the GAL4-AD domain. The expression of the recombinant proteins NOT-1-BD and NOT-1-AD was determined using domain specific antibodies (cf. Material and Methods). As negative controls lysates from Y187 cells transformed with the two empty vectors (C, -1) and with the recombinant pAS2-1-hNOT-11-438 and the pure pACT2 (C, -2) vector were used. As positive control lysates from yeast cells transformed with the pCL1 vector encoding the GAL4 factor (C, +) were used. N-glycosylation status of the molecular partners of hNOT/ALG3 Considering the homology of the hNOT/ALG3 proteins with the ALG3 mannosyltransferase (4) which is known to act in the N-linked glycosylation (5), we analysed the glycosylation status of the 17 potential binding partners isolated (Table 1) using diverse bioinformatical tools (cf. Material and Methods). As shown in Table 2, with the exception of HO-2 and COX3 the remaining 15 binding partner candidates of hNOT-1/ALG3–1 (cf. Table 1) are equipped with putative sites for the N-glycosylation. However, the experimentally confirmed N-glycosylation and its biological role were described only for CD74 (94), LRP1 (95), CREB3 (47,96) and SRPX (26). In the case of CD74, LRP1 and CREB3, the N-glycosylation step is essential for the biological activation of the proteins. In the case of SRPX, no sites are present in the normal allele. In contrary, two mutations resulting in a gain of N-glycosylated forms, which are causal in rolandic seizure disorders, are described (61). These data and our previously described findings (4) support the hypothesis that the action of hNOT/ALG3 postulated on the basis of its ALG3 homology is not the only one. Table 2. Prediction of N-linked glycosylation sites in hNOT-1/ALG3-1 and the proteins isolated as its putative physiological partners using the databases Unipep, ELM and UniProt Protein/Acc-Nr.a Sites for N-linked glycosylation, aa (Ref.)/Biological role NOT-1/Y09022 83, 253 (1)/unknown CD74/NP_004346 130, 136 (1)/N-glycosylation prevents proteolysis (38,94) GBP1/NP_002044 111 (1)/unknown SEC16B/EAW91013 54, 87, 602 (2)/unknown SMTN/EAW59932 751, 877 (1) [39]/unknown INF2/NP_071934 375, 1240 (2)/unknown NDRG2/NP_057334 136, 342 (1)/unknown BNIP3/AAH80643 125, 181 (1)/unknown SRPX/NP_006298 no sites have been found using the data bases/the mutations N327S and Y72S result in a gain of N-glycosylated forms causal in rolandic seizure disorders (RSD) and MR (61) FKBP8/NM_012181 133, 340, 371 (1)/unknown SYPL1/NM_006754 71, 96 (1); 212, 243 (2)/unknown LRP1/NM_002332 114, 136, 185, 239, 274, 357, 446, 729, 805, 877, 918, 928, 1000, 1050, 1154, 1155, 1218, 1511, 1558, 1575, 1616, 1645, 1723, 1733, 1763, 1767, 1825, 1933, 1995, 2117, 2127, 2472, 2475, 2502, 2521, 2539, 2601, 2620, 2638, 2815, 2905, 2942, 3048, 3089, 3264, 3333, 3397, 3477, 3488, 3559, 3662, 3788, 3839, 3953, 4075, 4125, 4179, 4278, 4279, 4364 (1); 845, 4470, 4501 (1); 1195, 2048 (3)/N-glycosylation is associated with LDL maturation (95) VAPA/NM_194434 41, 105, 151, 223, 168 (1)/unknown OSBP/NM_002556 140, 380, 414 (1)/unknown OSBPL9/EAX06812 275, 295, 358, 363, 488, 598 (1)/unknown CREB3/BC009402 203, 222, 307, 348 (1)/N-linked glycosylation is required for optimal proteolytic activation (96) Protein/Acc-Nr.a Sites for N-linked glycosylation, aa (Ref.)/Biological role NOT-1/Y09022 83, 253 (1)/unknown CD74/NP_004346 130, 136 (1)/N-glycosylation prevents proteolysis (38,94) GBP1/NP_002044 111 (1)/unknown SEC16B/EAW91013 54, 87, 602 (2)/unknown SMTN/EAW59932 751, 877 (1) [39]/unknown INF2/NP_071934 375, 1240 (2)/unknown NDRG2/NP_057334 136, 342 (1)/unknown BNIP3/AAH80643 125, 181 (1)/unknown SRPX/NP_006298 no sites have been found using the data bases/the mutations N327S and Y72S result in a gain of N-glycosylated forms causal in rolandic seizure disorders (RSD) and MR (61) FKBP8/NM_012181 133, 340, 371 (1)/unknown SYPL1/NM_006754 71, 96 (1); 212, 243 (2)/unknown LRP1/NM_002332 114, 136, 185, 239, 274, 357, 446, 729, 805, 877, 918, 928, 1000, 1050, 1154, 1155, 1218, 1511, 1558, 1575, 1616, 1645, 1723, 1733, 1763, 1767, 1825, 1933, 1995, 2117, 2127, 2472, 2475, 2502, 2521, 2539, 2601, 2620, 2638, 2815, 2905, 2942, 3048, 3089, 3264, 3333, 3397, 3477, 3488, 3559, 3662, 3788, 3839, 3953, 4075, 4125, 4179, 4278, 4279, 4364 (1); 845, 4470, 4501 (1); 1195, 2048 (3)/N-glycosylation is associated with LDL maturation (95) VAPA/NM_194434 41, 105, 151, 223, 168 (1)/unknown OSBP/NM_002556 140, 380, 414 (1)/unknown OSBPL9/EAX06812 275, 295, 358, 363, 488, 598 (1)/unknown CREB3/BC009402 203, 222, 307, 348 (1)/N-linked glycosylation is required for optimal proteolytic activation (96) Ref.: Reference for site prediction: 1: Unipep (http://www.unipep.org/): ISB N-glycosylation peptide prediction server; 2: ELM (Eukaryotic Linear Motif—Database, http://elm.eu.org/); 3: UniProt (Universal Protein Resource, http://www.uniprot.org/). a NCBI data library (gb-admin@ncbi.nlm.hih.gov), cf. Table 1. Table 2. Prediction of N-linked glycosylation sites in hNOT-1/ALG3-1 and the proteins isolated as its putative physiological partners using the databases Unipep, ELM and UniProt Protein/Acc-Nr.a Sites for N-linked glycosylation, aa (Ref.)/Biological role NOT-1/Y09022 83, 253 (1)/unknown CD74/NP_004346 130, 136 (1)/N-glycosylation prevents proteolysis (38,94) GBP1/NP_002044 111 (1)/unknown SEC16B/EAW91013 54, 87, 602 (2)/unknown SMTN/EAW59932 751, 877 (1) [39]/unknown INF2/NP_071934 375, 1240 (2)/unknown NDRG2/NP_057334 136, 342 (1)/unknown BNIP3/AAH80643 125, 181 (1)/unknown SRPX/NP_006298 no sites have been found using the data bases/the mutations N327S and Y72S result in a gain of N-glycosylated forms causal in rolandic seizure disorders (RSD) and MR (61) FKBP8/NM_012181 133, 340, 371 (1)/unknown SYPL1/NM_006754 71, 96 (1); 212, 243 (2)/unknown LRP1/NM_002332 114, 136, 185, 239, 274, 357, 446, 729, 805, 877, 918, 928, 1000, 1050, 1154, 1155, 1218, 1511, 1558, 1575, 1616, 1645, 1723, 1733, 1763, 1767, 1825, 1933, 1995, 2117, 2127, 2472, 2475, 2502, 2521, 2539, 2601, 2620, 2638, 2815, 2905, 2942, 3048, 3089, 3264, 3333, 3397, 3477, 3488, 3559, 3662, 3788, 3839, 3953, 4075, 4125, 4179, 4278, 4279, 4364 (1); 845, 4470, 4501 (1); 1195, 2048 (3)/N-glycosylation is associated with LDL maturation (95) VAPA/NM_194434 41, 105, 151, 223, 168 (1)/unknown OSBP/NM_002556 140, 380, 414 (1)/unknown OSBPL9/EAX06812 275, 295, 358, 363, 488, 598 (1)/unknown CREB3/BC009402 203, 222, 307, 348 (1)/N-linked glycosylation is required for optimal proteolytic activation (96) Protein/Acc-Nr.a Sites for N-linked glycosylation, aa (Ref.)/Biological role NOT-1/Y09022 83, 253 (1)/unknown CD74/NP_004346 130, 136 (1)/N-glycosylation prevents proteolysis (38,94) GBP1/NP_002044 111 (1)/unknown SEC16B/EAW91013 54, 87, 602 (2)/unknown SMTN/EAW59932 751, 877 (1) [39]/unknown INF2/NP_071934 375, 1240 (2)/unknown NDRG2/NP_057334 136, 342 (1)/unknown BNIP3/AAH80643 125, 181 (1)/unknown SRPX/NP_006298 no sites have been found using the data bases/the mutations N327S and Y72S result in a gain of N-glycosylated forms causal in rolandic seizure disorders (RSD) and MR (61) FKBP8/NM_012181 133, 340, 371 (1)/unknown SYPL1/NM_006754 71, 96 (1); 212, 243 (2)/unknown LRP1/NM_002332 114, 136, 185, 239, 274, 357, 446, 729, 805, 877, 918, 928, 1000, 1050, 1154, 1155, 1218, 1511, 1558, 1575, 1616, 1645, 1723, 1733, 1763, 1767, 1825, 1933, 1995, 2117, 2127, 2472, 2475, 2502, 2521, 2539, 2601, 2620, 2638, 2815, 2905, 2942, 3048, 3089, 3264, 3333, 3397, 3477, 3488, 3559, 3662, 3788, 3839, 3953, 4075, 4125, 4179, 4278, 4279, 4364 (1); 845, 4470, 4501 (1); 1195, 2048 (3)/N-glycosylation is associated with LDL maturation (95) VAPA/NM_194434 41, 105, 151, 223, 168 (1)/unknown OSBP/NM_002556 140, 380, 414 (1)/unknown OSBPL9/EAX06812 275, 295, 358, 363, 488, 598 (1)/unknown CREB3/BC009402 203, 222, 307, 348 (1)/N-linked glycosylation is required for optimal proteolytic activation (96) Ref.: Reference for site prediction: 1: Unipep (http://www.unipep.org/): ISB N-glycosylation peptide prediction server; 2: ELM (Eukaryotic Linear Motif—Database, http://elm.eu.org/); 3: UniProt (Universal Protein Resource, http://www.uniprot.org/). a NCBI data library (gb-admin@ncbi.nlm.hih.gov), cf. Table 1. Bioinformatical analysis of the hNOT/ALG3 proteins and their ligands with regard to structural similarities relevant in the context of protein–protein binding Previously we described that the structural elements/sites of the full-length hNOT/ALG3 proteins associated with targeting to the ER, the signal-mediated sorting between the ER and the Golgi apparatus, the N-glycosylation and the post translational processing by sequential cleavage result in derivatives destined to distinct subcellular compartments (4). To get a preliminary idea of the molecular aspects of the interactions identified (Table 1, cf. Fig. 1), we extended the bioinformatical analysis described previously (4) with respect to structural elements relevant in the context of the biological functionality and protein–protein interactions. As shown in Table 3, both hNOT/ALG3 proteins are equipped with phosphorylation sites for diverse kinases, including protein kinase B (PKB) (97), protein kinase A (PKA) (98), glycogen synthase kinase 3 (GSK3) (99), PI3 kinase-related kinase (PIKK) (100), casein kinase I (CKI) (101), NIMA related kinase 2 (NEK2) (102), polo-like kinase (Plk) (103) and mitogen activated protein kinase (MAPK) (104). Furthermore, both are equipped with cyclin recognition sites known to increase phosphorylation (105) and with distinct protein binding domains (PBDs) relevant in the context of the putative biological/pathological impact of the molecular interactions they do undergo (Table 3). The N-terminal Inhibitor of Apoptosis Protein (IAP)-binding motif (IBM) MAAGL (aa 1–5)—specifically binding type II baculoviral IAP repeat (BIR) domains (106)—is hNOT-1/ALG3–1 specific. Common for both proteins in question (Table 3) are the structural domains further identified: KEN- and destruction (D)-box (107,108), forkhead-associated domain (FHA) (109), TNFR2 associated factor (TRAF2) (110), Src homology 2 and 3 (SH2, SH3) domain binding motifs (111), autophagy-related 8 (Atg8) proteins binding LIR motif (112), motifs binding phosphotyrosine binding domains (PTB) (113), proline rich motif binding to signal transduction class II EVH1 domains (114), Fxxx und Wxxx (115), calcineurin docking motif LxxP (116), BRCA1 carboxyl-terminal (BRCT) motif (117), C-terminal mode 2 recognition motif for 14–3-3- proteins (118), SUMO interacting motifs (119), class I Src homology 3 (SH3) domain recognition sites (120), p(S/T)P binding motif recognized by class IV WW domains (121) and Cks-1 (122). Table 3. Functional motifs in hNOT-1/ALG3-1 and hNOT-4/ALG3-4 relevant in the context of the identified molecular interactions and functional relationships Site/Motifa Position (aa) Functional class Sequence patternc (Reference) NOT-1b NOT-4b Phosphorylation sites RKRGRSGSA 6–14 Protein kinase B (PKB) phosphorylation site R.R.([ST])[^P]. (97) RGRSGSAQ 8–16 SRGTDIR 116–122 68–74 Protein kinase A (PKA) phosphorylation site .R.([ST])[^P]. (98) INGTYDYT 82–89 34–41 Glycogen synthase kinase 3 (GSK3) phosphorylation sites …([ST])…[ST] (99) ENPSGYLSQI 252–259 204–211 VSTLFT 337–344 289–296 IVSTLFTS 338–345 290–297 SWNTYPST 395–402 347–354 TYPSTSCS 398–405 350–357 YPSTSCSS 399–406 351–358 FPKSTQHS 427–434 379–386 YDYTQLQ 86–92 38–44 PI3 kinase-related kinase (PIKK) phosphorylation site …([ST])Q. (100) PKSTQHS 428–434 380–386 SRGTDIR 116–122 68–74 Casein kinase 1 (CK1) phosphorylation site S.([ST])… (101) SILSLLR 315–321 267–273 SWNTYPS 395–401 347–353 SCSSAAL 403–409 355–361 FHWTVN 270–275 222–227 NIMA related kinase 2 (NEK2) phosphorylation site [FLM][^P][^P]([ST])[^DEP][^DE] (102) LFTSNF 342–347 294–299 FSRSLH 352–357 304–309 IELSWNT 392–398 344–350 Polo-like kinase (Plk) phosphorylation site .[DE].([ST])[ILFWMVA]. (103) QPLTPNQ 331–337 283–289 Mitogen activated protein kinase (MAPK) phosphorylation site …([ST])P. (104) RRLLL▼ 32–36▼ 229–232 Cyclin recognition site known to increase phosphorylation by cyclin/cdk complexes [RK].L.{0, 1}[FYLIVMP] (105) RLLL▼ 33–36▼ 306–310 RFLP 277–280 337–341 RSLHY 354–358 RLLVL 385–389 Protein–protein binding domains/motifs MAAGL 1–5 Inhibitor of Apoptosis Protein (IAP)-binding motif (IBM) specifically binding type II baculoviral IAP repeat (BIR) domainsd ^M{0, 1}[AS]… (106) AKENA 6–10 KEN box binding to the APC/C subunit Cdh1e .KEN. (107, 108) FRGALPKLG 228–236 180–188 Destruction (D) box binding to APC/C subunits Cdh1 and Cdc20f GDTEIDW 17–23 Forkhead-associated (FHA) domain binding motif .(T).[DE]. (109) AWQE 28–31 Tumour necrosis factor receptor 2 (TNFR) associated factor (TRAF2) binding motif [PSAT].[QE]E (110) YTEI 66–69 STAT5 Src homology 2 (SH2) domain binding motifg (Y)[VLTFIC].(Y)[VLTFIC]. (111) YTQL 88–91 40–43 YLSR 257–260 209–212 TYDYTQL 85–91 37–43 Canonical LIR motif binding to autophagy-related 8 (Atg) Atg8 proteins [EDST].{0, 2}[WFY].[ILV] (112) DYTQL 87–91 39–43 TVNWRFL 273–279 225–231 TSNFIGI 344–350 296–302 SNFIGI 345–350 297–302 GVINGTY 80–86 32–38 Phosphotyrosine (PT)-dependent Shc-and IRS-like motif binding to PTB domainsh (.[^P].NP.(Y))|(.[ILVMFY].N.(Y))) GVINGTYD 80–87 32–39 Phosphotyrosine-independent Dab-like motif binding to PTB domainsh (.[^P].NP.[FY].)|(.[ILVMFY].N.[FY].) (113) PPFVF 150–154 102–106 Proline-rich motif binding to signal transduction class II EVH1 domainsi PP.F (114) FVFFF 152–156 104–108 Fxxx[WF] motif present in Pex19 F…[WF] (115) FLFHW 268–272 220–224 FTSNF 343–347 295–299 WGCCF 196–200 148–152 Wxxx[FY] motif present in Pex5 W…[FY] LGLP 245–248 197–200 Calcineurin docking motif LxvP/binding CNA and regulatory CNB subunits L.[LIVAPM]P (116) LSRSF 258–262 210–214 BRCA1 cyrboxyl-terminal (BRCT) motifj .(S).F (117) VSTLF 339–343 291–295 RTGESIL 311–317 263–269 C-terminal mode 2 recognition motif for 14-3-3 proteinsk R.[^P]([ST])[IVLM]. (118) Non-covalent SUMO-interacting motifs ESILSLLRD 314–322 266–274 antiparallel beta augmentation mode [DEST]{1, 10}.{0, 1}[VIL][DESTVILMA[VIL][VILM].[DEST]{0, 5} (119) SILSLLRD 315–322 267–274 GLIELS 390–395 342–347 parallel beta augmentation mode [DEST]{0, 5}.[VILPTM][VIL][DESTVILMA][VIL].{0, 1}[DEST]{1, 10} RKVPPQP 326–332 278–284 Class I Src homology 3 (SH3) domain recognition sitel [RKY].P.P (120) PPQPLTP 329–335 281–287 …[PV].P QPLTPN 331–336 283–288 p(S/T)P binding motif recognized by class IV WW domains …([ST])P. (121) PLTPNQ 332–337 284–289 Phospho-dependent Cks1-binding motif [MPVLIFWYQ].(T)P. (122) Site/Motifa Position (aa) Functional class Sequence patternc (Reference) NOT-1b NOT-4b Phosphorylation sites RKRGRSGSA 6–14 Protein kinase B (PKB) phosphorylation site R.R.([ST])[^P]. (97) RGRSGSAQ 8–16 SRGTDIR 116–122 68–74 Protein kinase A (PKA) phosphorylation site .R.([ST])[^P]. (98) INGTYDYT 82–89 34–41 Glycogen synthase kinase 3 (GSK3) phosphorylation sites …([ST])…[ST] (99) ENPSGYLSQI 252–259 204–211 VSTLFT 337–344 289–296 IVSTLFTS 338–345 290–297 SWNTYPST 395–402 347–354 TYPSTSCS 398–405 350–357 YPSTSCSS 399–406 351–358 FPKSTQHS 427–434 379–386 YDYTQLQ 86–92 38–44 PI3 kinase-related kinase (PIKK) phosphorylation site …([ST])Q. (100) PKSTQHS 428–434 380–386 SRGTDIR 116–122 68–74 Casein kinase 1 (CK1) phosphorylation site S.([ST])… (101) SILSLLR 315–321 267–273 SWNTYPS 395–401 347–353 SCSSAAL 403–409 355–361 FHWTVN 270–275 222–227 NIMA related kinase 2 (NEK2) phosphorylation site [FLM][^P][^P]([ST])[^DEP][^DE] (102) LFTSNF 342–347 294–299 FSRSLH 352–357 304–309 IELSWNT 392–398 344–350 Polo-like kinase (Plk) phosphorylation site .[DE].([ST])[ILFWMVA]. (103) QPLTPNQ 331–337 283–289 Mitogen activated protein kinase (MAPK) phosphorylation site …([ST])P. (104) RRLLL▼ 32–36▼ 229–232 Cyclin recognition site known to increase phosphorylation by cyclin/cdk complexes [RK].L.{0, 1}[FYLIVMP] (105) RLLL▼ 33–36▼ 306–310 RFLP 277–280 337–341 RSLHY 354–358 RLLVL 385–389 Protein–protein binding domains/motifs MAAGL 1–5 Inhibitor of Apoptosis Protein (IAP)-binding motif (IBM) specifically binding type II baculoviral IAP repeat (BIR) domainsd ^M{0, 1}[AS]… (106) AKENA 6–10 KEN box binding to the APC/C subunit Cdh1e .KEN. (107, 108) FRGALPKLG 228–236 180–188 Destruction (D) box binding to APC/C subunits Cdh1 and Cdc20f GDTEIDW 17–23 Forkhead-associated (FHA) domain binding motif .(T).[DE]. (109) AWQE 28–31 Tumour necrosis factor receptor 2 (TNFR) associated factor (TRAF2) binding motif [PSAT].[QE]E (110) YTEI 66–69 STAT5 Src homology 2 (SH2) domain binding motifg (Y)[VLTFIC].(Y)[VLTFIC]. (111) YTQL 88–91 40–43 YLSR 257–260 209–212 TYDYTQL 85–91 37–43 Canonical LIR motif binding to autophagy-related 8 (Atg) Atg8 proteins [EDST].{0, 2}[WFY].[ILV] (112) DYTQL 87–91 39–43 TVNWRFL 273–279 225–231 TSNFIGI 344–350 296–302 SNFIGI 345–350 297–302 GVINGTY 80–86 32–38 Phosphotyrosine (PT)-dependent Shc-and IRS-like motif binding to PTB domainsh (.[^P].NP.(Y))|(.[ILVMFY].N.(Y))) GVINGTYD 80–87 32–39 Phosphotyrosine-independent Dab-like motif binding to PTB domainsh (.[^P].NP.[FY].)|(.[ILVMFY].N.[FY].) (113) PPFVF 150–154 102–106 Proline-rich motif binding to signal transduction class II EVH1 domainsi PP.F (114) FVFFF 152–156 104–108 Fxxx[WF] motif present in Pex19 F…[WF] (115) FLFHW 268–272 220–224 FTSNF 343–347 295–299 WGCCF 196–200 148–152 Wxxx[FY] motif present in Pex5 W…[FY] LGLP 245–248 197–200 Calcineurin docking motif LxvP/binding CNA and regulatory CNB subunits L.[LIVAPM]P (116) LSRSF 258–262 210–214 BRCA1 cyrboxyl-terminal (BRCT) motifj .(S).F (117) VSTLF 339–343 291–295 RTGESIL 311–317 263–269 C-terminal mode 2 recognition motif for 14-3-3 proteinsk R.[^P]([ST])[IVLM]. (118) Non-covalent SUMO-interacting motifs ESILSLLRD 314–322 266–274 antiparallel beta augmentation mode [DEST]{1, 10}.{0, 1}[VIL][DESTVILMA[VIL][VILM].[DEST]{0, 5} (119) SILSLLRD 315–322 267–274 GLIELS 390–395 342–347 parallel beta augmentation mode [DEST]{0, 5}.[VILPTM][VIL][DESTVILMA][VIL].{0, 1}[DEST]{1, 10} RKVPPQP 326–332 278–284 Class I Src homology 3 (SH3) domain recognition sitel [RKY].P.P (120) PPQPLTP 329–335 281–287 …[PV].P QPLTPN 331–336 283–288 p(S/T)P binding motif recognized by class IV WW domains …([ST])P. (121) PLTPNQ 332–337 284–289 Phospho-dependent Cks1-binding motif [MPVLIFWYQ].(T)P. (122) a ELM Eukaryotic Linear Motif, http://elm.eu.org. b In the designation the ALG3 part has been omitted because of space. c The consensus sequences are presented according to the nomenclature suggested by Aasland et al. (123); ‘.’: aa allowed; ‘[…]’: aa listed are allowed; ‘[^…]’: aa listed are not allowed; ‘(…)’: 1used to mark positions of specific interest, 2used to group parts of the expression; ‘{min, max}’: min required, max allowed; ‘^’: matches aa terminal; ‘$’: matches the carboxyterminal; ‘|’: matches either expression it separates; ▼: indicate identical aa/positions. d The BIR binding motif is also present in the hNOT-1/ALG3-1 ligands SYPL1, VAPA, FKBP8, GBP1, HO-2, BNIP3, OSBP, OSBPL9, NDRG2 and INF2 (cf. Table 1). e The KEN-box is also present in the ligands HO-2, SMTN and INF2 (cf. Table 1). f The D-box is also present in the ligands LRP1, SRPX, FKBP8, GBP1, OSBP, OSBPL9, SMTN and SEC16B (cf. Table 1). g The STAT5 SH2 binding motif is also present in all hNOT-1/ALG3-1 ligands excepting LRP1 (cf. Table 1). h The PTB domains binding motif is also present in INF2 (cf. Table 1). i The EVH1 domains binding motif I is also present in BNIP3 (cf. Table 1). j The BRCT motif is also present in all identified ligands excepting VAPA, FKBP8, CD74 and CREB3 (cf. Table 1). k The Longer mode 2 interacting motif for 14–3-3 proteins is also present in the ligands LRP1, GBP1, OSBP, OSBPL9, SMTN, SEC16B, INF2 and CREB3 (cf. Table 1). l The SH3 domain recognition site is present in all isolated hNOT-1/ALG3–1 ligands (cf. Table 1). Table 3. Functional motifs in hNOT-1/ALG3-1 and hNOT-4/ALG3-4 relevant in the context of the identified molecular interactions and functional relationships Site/Motifa Position (aa) Functional class Sequence patternc (Reference) NOT-1b NOT-4b Phosphorylation sites RKRGRSGSA 6–14 Protein kinase B (PKB) phosphorylation site R.R.([ST])[^P]. (97) RGRSGSAQ 8–16 SRGTDIR 116–122 68–74 Protein kinase A (PKA) phosphorylation site .R.([ST])[^P]. (98) INGTYDYT 82–89 34–41 Glycogen synthase kinase 3 (GSK3) phosphorylation sites …([ST])…[ST] (99) ENPSGYLSQI 252–259 204–211 VSTLFT 337–344 289–296 IVSTLFTS 338–345 290–297 SWNTYPST 395–402 347–354 TYPSTSCS 398–405 350–357 YPSTSCSS 399–406 351–358 FPKSTQHS 427–434 379–386 YDYTQLQ 86–92 38–44 PI3 kinase-related kinase (PIKK) phosphorylation site …([ST])Q. (100) PKSTQHS 428–434 380–386 SRGTDIR 116–122 68–74 Casein kinase 1 (CK1) phosphorylation site S.([ST])… (101) SILSLLR 315–321 267–273 SWNTYPS 395–401 347–353 SCSSAAL 403–409 355–361 FHWTVN 270–275 222–227 NIMA related kinase 2 (NEK2) phosphorylation site [FLM][^P][^P]([ST])[^DEP][^DE] (102) LFTSNF 342–347 294–299 FSRSLH 352–357 304–309 IELSWNT 392–398 344–350 Polo-like kinase (Plk) phosphorylation site .[DE].([ST])[ILFWMVA]. (103) QPLTPNQ 331–337 283–289 Mitogen activated protein kinase (MAPK) phosphorylation site …([ST])P. (104) RRLLL▼ 32–36▼ 229–232 Cyclin recognition site known to increase phosphorylation by cyclin/cdk complexes [RK].L.{0, 1}[FYLIVMP] (105) RLLL▼ 33–36▼ 306–310 RFLP 277–280 337–341 RSLHY 354–358 RLLVL 385–389 Protein–protein binding domains/motifs MAAGL 1–5 Inhibitor of Apoptosis Protein (IAP)-binding motif (IBM) specifically binding type II baculoviral IAP repeat (BIR) domainsd ^M{0, 1}[AS]… (106) AKENA 6–10 KEN box binding to the APC/C subunit Cdh1e .KEN. (107, 108) FRGALPKLG 228–236 180–188 Destruction (D) box binding to APC/C subunits Cdh1 and Cdc20f GDTEIDW 17–23 Forkhead-associated (FHA) domain binding motif .(T).[DE]. (109) AWQE 28–31 Tumour necrosis factor receptor 2 (TNFR) associated factor (TRAF2) binding motif [PSAT].[QE]E (110) YTEI 66–69 STAT5 Src homology 2 (SH2) domain binding motifg (Y)[VLTFIC].(Y)[VLTFIC]. (111) YTQL 88–91 40–43 YLSR 257–260 209–212 TYDYTQL 85–91 37–43 Canonical LIR motif binding to autophagy-related 8 (Atg) Atg8 proteins [EDST].{0, 2}[WFY].[ILV] (112) DYTQL 87–91 39–43 TVNWRFL 273–279 225–231 TSNFIGI 344–350 296–302 SNFIGI 345–350 297–302 GVINGTY 80–86 32–38 Phosphotyrosine (PT)-dependent Shc-and IRS-like motif binding to PTB domainsh (.[^P].NP.(Y))|(.[ILVMFY].N.(Y))) GVINGTYD 80–87 32–39 Phosphotyrosine-independent Dab-like motif binding to PTB domainsh (.[^P].NP.[FY].)|(.[ILVMFY].N.[FY].) (113) PPFVF 150–154 102–106 Proline-rich motif binding to signal transduction class II EVH1 domainsi PP.F (114) FVFFF 152–156 104–108 Fxxx[WF] motif present in Pex19 F…[WF] (115) FLFHW 268–272 220–224 FTSNF 343–347 295–299 WGCCF 196–200 148–152 Wxxx[FY] motif present in Pex5 W…[FY] LGLP 245–248 197–200 Calcineurin docking motif LxvP/binding CNA and regulatory CNB subunits L.[LIVAPM]P (116) LSRSF 258–262 210–214 BRCA1 cyrboxyl-terminal (BRCT) motifj .(S).F (117) VSTLF 339–343 291–295 RTGESIL 311–317 263–269 C-terminal mode 2 recognition motif for 14-3-3 proteinsk R.[^P]([ST])[IVLM]. (118) Non-covalent SUMO-interacting motifs ESILSLLRD 314–322 266–274 antiparallel beta augmentation mode [DEST]{1, 10}.{0, 1}[VIL][DESTVILMA[VIL][VILM].[DEST]{0, 5} (119) SILSLLRD 315–322 267–274 GLIELS 390–395 342–347 parallel beta augmentation mode [DEST]{0, 5}.[VILPTM][VIL][DESTVILMA][VIL].{0, 1}[DEST]{1, 10} RKVPPQP 326–332 278–284 Class I Src homology 3 (SH3) domain recognition sitel [RKY].P.P (120) PPQPLTP 329–335 281–287 …[PV].P QPLTPN 331–336 283–288 p(S/T)P binding motif recognized by class IV WW domains …([ST])P. (121) PLTPNQ 332–337 284–289 Phospho-dependent Cks1-binding motif [MPVLIFWYQ].(T)P. (122) Site/Motifa Position (aa) Functional class Sequence patternc (Reference) NOT-1b NOT-4b Phosphorylation sites RKRGRSGSA 6–14 Protein kinase B (PKB) phosphorylation site R.R.([ST])[^P]. (97) RGRSGSAQ 8–16 SRGTDIR 116–122 68–74 Protein kinase A (PKA) phosphorylation site .R.([ST])[^P]. (98) INGTYDYT 82–89 34–41 Glycogen synthase kinase 3 (GSK3) phosphorylation sites …([ST])…[ST] (99) ENPSGYLSQI 252–259 204–211 VSTLFT 337–344 289–296 IVSTLFTS 338–345 290–297 SWNTYPST 395–402 347–354 TYPSTSCS 398–405 350–357 YPSTSCSS 399–406 351–358 FPKSTQHS 427–434 379–386 YDYTQLQ 86–92 38–44 PI3 kinase-related kinase (PIKK) phosphorylation site …([ST])Q. (100) PKSTQHS 428–434 380–386 SRGTDIR 116–122 68–74 Casein kinase 1 (CK1) phosphorylation site S.([ST])… (101) SILSLLR 315–321 267–273 SWNTYPS 395–401 347–353 SCSSAAL 403–409 355–361 FHWTVN 270–275 222–227 NIMA related kinase 2 (NEK2) phosphorylation site [FLM][^P][^P]([ST])[^DEP][^DE] (102) LFTSNF 342–347 294–299 FSRSLH 352–357 304–309 IELSWNT 392–398 344–350 Polo-like kinase (Plk) phosphorylation site .[DE].([ST])[ILFWMVA]. (103) QPLTPNQ 331–337 283–289 Mitogen activated protein kinase (MAPK) phosphorylation site …([ST])P. (104) RRLLL▼ 32–36▼ 229–232 Cyclin recognition site known to increase phosphorylation by cyclin/cdk complexes [RK].L.{0, 1}[FYLIVMP] (105) RLLL▼ 33–36▼ 306–310 RFLP 277–280 337–341 RSLHY 354–358 RLLVL 385–389 Protein–protein binding domains/motifs MAAGL 1–5 Inhibitor of Apoptosis Protein (IAP)-binding motif (IBM) specifically binding type II baculoviral IAP repeat (BIR) domainsd ^M{0, 1}[AS]… (106) AKENA 6–10 KEN box binding to the APC/C subunit Cdh1e .KEN. (107, 108) FRGALPKLG 228–236 180–188 Destruction (D) box binding to APC/C subunits Cdh1 and Cdc20f GDTEIDW 17–23 Forkhead-associated (FHA) domain binding motif .(T).[DE]. (109) AWQE 28–31 Tumour necrosis factor receptor 2 (TNFR) associated factor (TRAF2) binding motif [PSAT].[QE]E (110) YTEI 66–69 STAT5 Src homology 2 (SH2) domain binding motifg (Y)[VLTFIC].(Y)[VLTFIC]. (111) YTQL 88–91 40–43 YLSR 257–260 209–212 TYDYTQL 85–91 37–43 Canonical LIR motif binding to autophagy-related 8 (Atg) Atg8 proteins [EDST].{0, 2}[WFY].[ILV] (112) DYTQL 87–91 39–43 TVNWRFL 273–279 225–231 TSNFIGI 344–350 296–302 SNFIGI 345–350 297–302 GVINGTY 80–86 32–38 Phosphotyrosine (PT)-dependent Shc-and IRS-like motif binding to PTB domainsh (.[^P].NP.(Y))|(.[ILVMFY].N.(Y))) GVINGTYD 80–87 32–39 Phosphotyrosine-independent Dab-like motif binding to PTB domainsh (.[^P].NP.[FY].)|(.[ILVMFY].N.[FY].) (113) PPFVF 150–154 102–106 Proline-rich motif binding to signal transduction class II EVH1 domainsi PP.F (114) FVFFF 152–156 104–108 Fxxx[WF] motif present in Pex19 F…[WF] (115) FLFHW 268–272 220–224 FTSNF 343–347 295–299 WGCCF 196–200 148–152 Wxxx[FY] motif present in Pex5 W…[FY] LGLP 245–248 197–200 Calcineurin docking motif LxvP/binding CNA and regulatory CNB subunits L.[LIVAPM]P (116) LSRSF 258–262 210–214 BRCA1 cyrboxyl-terminal (BRCT) motifj .(S).F (117) VSTLF 339–343 291–295 RTGESIL 311–317 263–269 C-terminal mode 2 recognition motif for 14-3-3 proteinsk R.[^P]([ST])[IVLM]. (118) Non-covalent SUMO-interacting motifs ESILSLLRD 314–322 266–274 antiparallel beta augmentation mode [DEST]{1, 10}.{0, 1}[VIL][DESTVILMA[VIL][VILM].[DEST]{0, 5} (119) SILSLLRD 315–322 267–274 GLIELS 390–395 342–347 parallel beta augmentation mode [DEST]{0, 5}.[VILPTM][VIL][DESTVILMA][VIL].{0, 1}[DEST]{1, 10} RKVPPQP 326–332 278–284 Class I Src homology 3 (SH3) domain recognition sitel [RKY].P.P (120) PPQPLTP 329–335 281–287 …[PV].P QPLTPN 331–336 283–288 p(S/T)P binding motif recognized by class IV WW domains …([ST])P. (121) PLTPNQ 332–337 284–289 Phospho-dependent Cks1-binding motif [MPVLIFWYQ].(T)P. (122) a ELM Eukaryotic Linear Motif, http://elm.eu.org. b In the designation the ALG3 part has been omitted because of space. c The consensus sequences are presented according to the nomenclature suggested by Aasland et al. (123); ‘.’: aa allowed; ‘[…]’: aa listed are allowed; ‘[^…]’: aa listed are not allowed; ‘(…)’: 1used to mark positions of specific interest, 2used to group parts of the expression; ‘{min, max}’: min required, max allowed; ‘^’: matches aa terminal; ‘$’: matches the carboxyterminal; ‘|’: matches either expression it separates; ▼: indicate identical aa/positions. d The BIR binding motif is also present in the hNOT-1/ALG3-1 ligands SYPL1, VAPA, FKBP8, GBP1, HO-2, BNIP3, OSBP, OSBPL9, NDRG2 and INF2 (cf. Table 1). e The KEN-box is also present in the ligands HO-2, SMTN and INF2 (cf. Table 1). f The D-box is also present in the ligands LRP1, SRPX, FKBP8, GBP1, OSBP, OSBPL9, SMTN and SEC16B (cf. Table 1). g The STAT5 SH2 binding motif is also present in all hNOT-1/ALG3-1 ligands excepting LRP1 (cf. Table 1). h The PTB domains binding motif is also present in INF2 (cf. Table 1). i The EVH1 domains binding motif I is also present in BNIP3 (cf. Table 1). j The BRCT motif is also present in all identified ligands excepting VAPA, FKBP8, CD74 and CREB3 (cf. Table 1). k The Longer mode 2 interacting motif for 14–3-3 proteins is also present in the ligands LRP1, GBP1, OSBP, OSBPL9, SMTN, SEC16B, INF2 and CREB3 (cf. Table 1). l The SH3 domain recognition site is present in all isolated hNOT-1/ALG3–1 ligands (cf. Table 1). To address the question which of the PBDs identified in the hNOT/ALG3 proteins (Table 3) may be of relevance in the context of their binding with the ligands (Table 1), we analysed the latter for the presence of these binding elements. Interestingly, this analysis revealed the binding motif for class I SH3 domains (120) to be present in all hNOT-1/ALG3–1 ligands isolated (cf. Tables 1 and 3). The STAT5 SH2 domain binding motif (111, cf. Table 3) is present in all putative partners of hNOT/ALG3–1 with the exception of LRP1. The APC binding KEN-box (107; cf. Table 3) is present in the proteins HO-2, SMTN and INF2 and the D-box (108, cf. Table 3) in LRP1, SRPX, FKBP8, GBP1, OSBP, OSBPL9, SMTN, SEC16B. The proteins SYPL1, VAPA, FKBP8, GBP1, HO-2, BNIP3, NDRG2 and INF2 share with hNOT-1/ALG3–1 the IBM motif (106, cf. Tables 1 and 3). The BRCT motif (117, cf. Table 3) is present in all ligands of hNOT/ALG3 with the exception of the proteins VAPA, FKBP8, CD74 and CREB3. The PTB domain binding motif (113, cf. Table 3) is also present in INF2 (Table 1). The Longer mode 2 interacting motif for 14–3-3 proteins (118, cf. Table 3) is also present in the hNOT-1/ALG3–1 ligands LRP1, GBP1, OSBP, OSBPL9, SMTN, SEC16B, INF2 and CREB3 (Table 1). The proline-rich motif (114, cf. Table 3) is also present in the hNOT/ALG3 ligand BNIP3. Identification of cell lines suitable for confirmation of hNOT-1/ALG3–1 in vivo binding with selected ER associated ligands We described the expression profiles of the distinct transcripts and the proteins encoded by hNOT/ALG3 in diverse non-tumorous and tumorous human cells previously (4). To confirm the binding of hNOT-1/ALG3–1 (4) with its ER-associated ligands OSBP (35), OSBPL9 (36), LRP1 (23,24), SYPL (21,22) and CREB3 (47) (cf. Table 1) in vivo via IP we first quantified their expression in the same cells (Table 4). The quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis was performed according to previously described protocols (4,125) using ligand specific primers (Supplementary Material, Table S1). As shown in Table 4, the genes encoding the ligands of interest are transcribed in all cells previously identified as expressing HNOT-1/ALG3–1 (4). Thus, in the next step we determined the expression of the ligands relevant for this study in these cells via western blot (see later). This analysis revealed that with the exception of LRP1 all remaining proteins are present in all cells investigated (cf. Table 4). LRP1 was detected in the cells HaCaT, NHEK, T98G, HeLa, HEK 293, MDAMB and MCF-7. Table 4. Expression of selected hNOT/ALG3 ligands in diverse human cells Cell line Targeta HaCaT rel. c. E ± SD HT-29 rel. c. E ±SD T98G rel. c. E ± SD HeLa rel. c. E ± SD HEK-293 rel. c. E ± SD SKBr3 rel. c. E ± SD MDAMBb rel. c. E ± SD MCF-7 rel. c. E ± SD Jurkat rel. c. E ± SD RAPOc rel. c. E ± SD CREB3 50.3 114.1 154.8 111.0 22.4 327.2 94.0 267.6 97.9 61.1 I2 91 ± 3.6 94 ± 3.4 90 ± 1.1 90 ± 2.3 89 ± 1.4 92 ± 4.6 90 ± 1.1 91 ± 1.5 88 ± 2.8 88 ± 2.2 FKBP8 132.0 107.2 136.6 152.6 80.1 381.2 187.9 569.6 223.5 129.2 I1+I2+I38 92 ± 3.0 90 ± 2.5 90 ± 3.2 95 ± 2.7 93 ± 1.5 94 ± 4.3 92 ± 1.4 91 ± 1.7 90 ± 1.4 91 ± 2.3 FKBP8 94.6 80.1 184.0 107.9 64.2 214.4 148.5 386.4 152.6 87.1 I1+I2 93 ± 0.9 91 ± 2.6 92 ± 1.5 91 ± 1.8 92 ± 1.4 92 ± 0.5 91 ± 3.3 96 ± 1.7 91 ± 0.9 92 ± 2.1 SYPL1 168.2 156.9 107.2 98.6 54.3 1738.8 110.2 256.7 126.6 85.3 I1+I2 92 ± 1.9 94 ± 2.9 91 ± 1.8 92 ± 1.3 91 ± 2.3 90 ± 2.1 91 ± 6.0 89 ± 2.7 98 ± 2.8 92 ± 2.3 SYPL1 0.3 0.4 0.2 0.35 0.5 5.6 3.5 1.4 1.5 1.6 I1 90 ± 1.8 94 ± 3.3 92 ± 1.3 92 ± 2.6 93 ± 0.1 88 ± 1.0 94 ± 1.8 89 ± 1.2 94 ± 1.7 90 ± 1.2 VAPA 46.7 290.8 100.7 118.1 30.6 527.8 92.7 191.9 122.3 117.3 I1 86 ± 2.9 89 ± 2.2 89 ± 0.5 90 ± 1.1 87 ± 3.1 90 ± 1.5 91 ± 1.1 92 ± 2.9 92 ± 3.1 89 ± 2.8 OSBP 31.2 65.5 25.5 27.7 28.1 397.2 30.6 112.0 40.3 27.7 91 ± 1.1 90 ± 0.5 90 ± 2.8 92 ± 3.4 93 ± 1.8 95 ± 2.6 92 ± 1.4 91 ± 2.9 92 ± 3.0 95 ± 2.6 OSBPL9d 34.2 43.2 46.3 45.1 60.7 1123.6 64.6 262.1 36.3 22.5 93 ± 4.9 86 ±7.7 92 ± 1.1 92 ± 0.9 92 ± 0.8 91 ± 3.0 92 ± 1.1 89 ± 2.7 93 ± 1.9 89 ± 2.8 OSBPL9e 9.8 46.3 39.5 43.8 40.1 29.1 49.3 145.0 34.0 22.0 98 ± 1.4 91 ± 1.9 91 ± 2.2 90 ± 3.2 90 ± 2.7 87 ± 2.6 91 ± 3.0 91 ± 2.1 91 ± 0.6 93 ± 3.2 VAMP2 51.8 77.4 92.7 67.8 40.6 205.6 66.4 241.2 82.4 66.0 92 ± 2.3 90 ± 3.5 91 ± 0.9 90 ± 3.5 95 ± 1.9 92 ± 2.1 94 ± 1.2 90 ± 2.1 93 ± 1.1 92 ± 2.1 LRP1 49.3 35.4 81.8 28.7 2.9 27.7 33.0 120.6 6.2 1.6 92 ± 2.1 93 ± 2.9 92 ± 4.0 91 ± 3.4 93 ± 1.9 95 ± 3.4 94 ± 4.1 93 ± 1.5 93 ± 2.1 94 ± 5.7 HGPRT Ct ± SD 20.43±0.12 19.54±0.08 20.53±0.46 19.73±0.34 19.12±0.03 23.11±0.91 19.16±0.1 20.58±0.05 20.79±0.27 21.28±0.22 Cell line Targeta HaCaT rel. c. E ± SD HT-29 rel. c. E ±SD T98G rel. c. E ± SD HeLa rel. c. E ± SD HEK-293 rel. c. E ± SD SKBr3 rel. c. E ± SD MDAMBb rel. c. E ± SD MCF-7 rel. c. E ± SD Jurkat rel. c. E ± SD RAPOc rel. c. E ± SD CREB3 50.3 114.1 154.8 111.0 22.4 327.2 94.0 267.6 97.9 61.1 I2 91 ± 3.6 94 ± 3.4 90 ± 1.1 90 ± 2.3 89 ± 1.4 92 ± 4.6 90 ± 1.1 91 ± 1.5 88 ± 2.8 88 ± 2.2 FKBP8 132.0 107.2 136.6 152.6 80.1 381.2 187.9 569.6 223.5 129.2 I1+I2+I38 92 ± 3.0 90 ± 2.5 90 ± 3.2 95 ± 2.7 93 ± 1.5 94 ± 4.3 92 ± 1.4 91 ± 1.7 90 ± 1.4 91 ± 2.3 FKBP8 94.6 80.1 184.0 107.9 64.2 214.4 148.5 386.4 152.6 87.1 I1+I2 93 ± 0.9 91 ± 2.6 92 ± 1.5 91 ± 1.8 92 ± 1.4 92 ± 0.5 91 ± 3.3 96 ± 1.7 91 ± 0.9 92 ± 2.1 SYPL1 168.2 156.9 107.2 98.6 54.3 1738.8 110.2 256.7 126.6 85.3 I1+I2 92 ± 1.9 94 ± 2.9 91 ± 1.8 92 ± 1.3 91 ± 2.3 90 ± 2.1 91 ± 6.0 89 ± 2.7 98 ± 2.8 92 ± 2.3 SYPL1 0.3 0.4 0.2 0.35 0.5 5.6 3.5 1.4 1.5 1.6 I1 90 ± 1.8 94 ± 3.3 92 ± 1.3 92 ± 2.6 93 ± 0.1 88 ± 1.0 94 ± 1.8 89 ± 1.2 94 ± 1.7 90 ± 1.2 VAPA 46.7 290.8 100.7 118.1 30.6 527.8 92.7 191.9 122.3 117.3 I1 86 ± 2.9 89 ± 2.2 89 ± 0.5 90 ± 1.1 87 ± 3.1 90 ± 1.5 91 ± 1.1 92 ± 2.9 92 ± 3.1 89 ± 2.8 OSBP 31.2 65.5 25.5 27.7 28.1 397.2 30.6 112.0 40.3 27.7 91 ± 1.1 90 ± 0.5 90 ± 2.8 92 ± 3.4 93 ± 1.8 95 ± 2.6 92 ± 1.4 91 ± 2.9 92 ± 3.0 95 ± 2.6 OSBPL9d 34.2 43.2 46.3 45.1 60.7 1123.6 64.6 262.1 36.3 22.5 93 ± 4.9 86 ±7.7 92 ± 1.1 92 ± 0.9 92 ± 0.8 91 ± 3.0 92 ± 1.1 89 ± 2.7 93 ± 1.9 89 ± 2.8 OSBPL9e 9.8 46.3 39.5 43.8 40.1 29.1 49.3 145.0 34.0 22.0 98 ± 1.4 91 ± 1.9 91 ± 2.2 90 ± 3.2 90 ± 2.7 87 ± 2.6 91 ± 3.0 91 ± 2.1 91 ± 0.6 93 ± 3.2 VAMP2 51.8 77.4 92.7 67.8 40.6 205.6 66.4 241.2 82.4 66.0 92 ± 2.3 90 ± 3.5 91 ± 0.9 90 ± 3.5 95 ± 1.9 92 ± 2.1 94 ± 1.2 90 ± 2.1 93 ± 1.1 92 ± 2.1 LRP1 49.3 35.4 81.8 28.7 2.9 27.7 33.0 120.6 6.2 1.6 92 ± 2.1 93 ± 2.9 92 ± 4.0 91 ± 3.4 93 ± 1.9 95 ± 3.4 94 ± 4.1 93 ± 1.5 93 ± 2.1 94 ± 5.7 HGPRT Ct ± SD 20.43±0.12 19.54±0.08 20.53±0.46 19.73±0.34 19.12±0.03 23.11±0.91 19.16±0.1 20.58±0.05 20.79±0.27 21.28±0.22 a cf. Table 1. b MDAMB-468. c J16/RAPO. d The primer combination used amplifies the OSBPL9 forms Ib, Ie, ICRAc, ICRAf, ICRAI (cf. Table 1). e The primer combination used amplifies the OSBPL9 forms If, Id, Ic, Ia ICRA_b, ICRA_ (cf. Table 1). I: isoform; rel. c.: relative concentration normalized to HGPRT (=100%) = 2−ΔCt × 100%, Ct: cycle threshold; ΔCt: Ct (target) – Ct (HGPRT); E: efficiency in %; The E values have been calculated using the LinReg tool: http://www.hartfaalcentrum.nl/index.php? main=files&fileName=LinRegPCR.zip&description=LinRegPCR:%20analysis%20of%20quantitative%20PCR%20data&sub=LinRegPCR (124); SD: standard deviation ( 1n∑χ−χ¯); n (sample) = 3; PCR reactions have been performed in duplicates. Bold highlight of rel.c. values recognise the differences in the expression levels of the distinct targets in the diverse cells. Table 4. Expression of selected hNOT/ALG3 ligands in diverse human cells Cell line Targeta HaCaT rel. c. E ± SD HT-29 rel. c. E ±SD T98G rel. c. E ± SD HeLa rel. c. E ± SD HEK-293 rel. c. E ± SD SKBr3 rel. c. E ± SD MDAMBb rel. c. E ± SD MCF-7 rel. c. E ± SD Jurkat rel. c. E ± SD RAPOc rel. c. E ± SD CREB3 50.3 114.1 154.8 111.0 22.4 327.2 94.0 267.6 97.9 61.1 I2 91 ± 3.6 94 ± 3.4 90 ± 1.1 90 ± 2.3 89 ± 1.4 92 ± 4.6 90 ± 1.1 91 ± 1.5 88 ± 2.8 88 ± 2.2 FKBP8 132.0 107.2 136.6 152.6 80.1 381.2 187.9 569.6 223.5 129.2 I1+I2+I38 92 ± 3.0 90 ± 2.5 90 ± 3.2 95 ± 2.7 93 ± 1.5 94 ± 4.3 92 ± 1.4 91 ± 1.7 90 ± 1.4 91 ± 2.3 FKBP8 94.6 80.1 184.0 107.9 64.2 214.4 148.5 386.4 152.6 87.1 I1+I2 93 ± 0.9 91 ± 2.6 92 ± 1.5 91 ± 1.8 92 ± 1.4 92 ± 0.5 91 ± 3.3 96 ± 1.7 91 ± 0.9 92 ± 2.1 SYPL1 168.2 156.9 107.2 98.6 54.3 1738.8 110.2 256.7 126.6 85.3 I1+I2 92 ± 1.9 94 ± 2.9 91 ± 1.8 92 ± 1.3 91 ± 2.3 90 ± 2.1 91 ± 6.0 89 ± 2.7 98 ± 2.8 92 ± 2.3 SYPL1 0.3 0.4 0.2 0.35 0.5 5.6 3.5 1.4 1.5 1.6 I1 90 ± 1.8 94 ± 3.3 92 ± 1.3 92 ± 2.6 93 ± 0.1 88 ± 1.0 94 ± 1.8 89 ± 1.2 94 ± 1.7 90 ± 1.2 VAPA 46.7 290.8 100.7 118.1 30.6 527.8 92.7 191.9 122.3 117.3 I1 86 ± 2.9 89 ± 2.2 89 ± 0.5 90 ± 1.1 87 ± 3.1 90 ± 1.5 91 ± 1.1 92 ± 2.9 92 ± 3.1 89 ± 2.8 OSBP 31.2 65.5 25.5 27.7 28.1 397.2 30.6 112.0 40.3 27.7 91 ± 1.1 90 ± 0.5 90 ± 2.8 92 ± 3.4 93 ± 1.8 95 ± 2.6 92 ± 1.4 91 ± 2.9 92 ± 3.0 95 ± 2.6 OSBPL9d 34.2 43.2 46.3 45.1 60.7 1123.6 64.6 262.1 36.3 22.5 93 ± 4.9 86 ±7.7 92 ± 1.1 92 ± 0.9 92 ± 0.8 91 ± 3.0 92 ± 1.1 89 ± 2.7 93 ± 1.9 89 ± 2.8 OSBPL9e 9.8 46.3 39.5 43.8 40.1 29.1 49.3 145.0 34.0 22.0 98 ± 1.4 91 ± 1.9 91 ± 2.2 90 ± 3.2 90 ± 2.7 87 ± 2.6 91 ± 3.0 91 ± 2.1 91 ± 0.6 93 ± 3.2 VAMP2 51.8 77.4 92.7 67.8 40.6 205.6 66.4 241.2 82.4 66.0 92 ± 2.3 90 ± 3.5 91 ± 0.9 90 ± 3.5 95 ± 1.9 92 ± 2.1 94 ± 1.2 90 ± 2.1 93 ± 1.1 92 ± 2.1 LRP1 49.3 35.4 81.8 28.7 2.9 27.7 33.0 120.6 6.2 1.6 92 ± 2.1 93 ± 2.9 92 ± 4.0 91 ± 3.4 93 ± 1.9 95 ± 3.4 94 ± 4.1 93 ± 1.5 93 ± 2.1 94 ± 5.7 HGPRT Ct ± SD 20.43±0.12 19.54±0.08 20.53±0.46 19.73±0.34 19.12±0.03 23.11±0.91 19.16±0.1 20.58±0.05 20.79±0.27 21.28±0.22 Cell line Targeta HaCaT rel. c. E ± SD HT-29 rel. c. E ±SD T98G rel. c. E ± SD HeLa rel. c. E ± SD HEK-293 rel. c. E ± SD SKBr3 rel. c. E ± SD MDAMBb rel. c. E ± SD MCF-7 rel. c. E ± SD Jurkat rel. c. E ± SD RAPOc rel. c. E ± SD CREB3 50.3 114.1 154.8 111.0 22.4 327.2 94.0 267.6 97.9 61.1 I2 91 ± 3.6 94 ± 3.4 90 ± 1.1 90 ± 2.3 89 ± 1.4 92 ± 4.6 90 ± 1.1 91 ± 1.5 88 ± 2.8 88 ± 2.2 FKBP8 132.0 107.2 136.6 152.6 80.1 381.2 187.9 569.6 223.5 129.2 I1+I2+I38 92 ± 3.0 90 ± 2.5 90 ± 3.2 95 ± 2.7 93 ± 1.5 94 ± 4.3 92 ± 1.4 91 ± 1.7 90 ± 1.4 91 ± 2.3 FKBP8 94.6 80.1 184.0 107.9 64.2 214.4 148.5 386.4 152.6 87.1 I1+I2 93 ± 0.9 91 ± 2.6 92 ± 1.5 91 ± 1.8 92 ± 1.4 92 ± 0.5 91 ± 3.3 96 ± 1.7 91 ± 0.9 92 ± 2.1 SYPL1 168.2 156.9 107.2 98.6 54.3 1738.8 110.2 256.7 126.6 85.3 I1+I2 92 ± 1.9 94 ± 2.9 91 ± 1.8 92 ± 1.3 91 ± 2.3 90 ± 2.1 91 ± 6.0 89 ± 2.7 98 ± 2.8 92 ± 2.3 SYPL1 0.3 0.4 0.2 0.35 0.5 5.6 3.5 1.4 1.5 1.6 I1 90 ± 1.8 94 ± 3.3 92 ± 1.3 92 ± 2.6 93 ± 0.1 88 ± 1.0 94 ± 1.8 89 ± 1.2 94 ± 1.7 90 ± 1.2 VAPA 46.7 290.8 100.7 118.1 30.6 527.8 92.7 191.9 122.3 117.3 I1 86 ± 2.9 89 ± 2.2 89 ± 0.5 90 ± 1.1 87 ± 3.1 90 ± 1.5 91 ± 1.1 92 ± 2.9 92 ± 3.1 89 ± 2.8 OSBP 31.2 65.5 25.5 27.7 28.1 397.2 30.6 112.0 40.3 27.7 91 ± 1.1 90 ± 0.5 90 ± 2.8 92 ± 3.4 93 ± 1.8 95 ± 2.6 92 ± 1.4 91 ± 2.9 92 ± 3.0 95 ± 2.6 OSBPL9d 34.2 43.2 46.3 45.1 60.7 1123.6 64.6 262.1 36.3 22.5 93 ± 4.9 86 ±7.7 92 ± 1.1 92 ± 0.9 92 ± 0.8 91 ± 3.0 92 ± 1.1 89 ± 2.7 93 ± 1.9 89 ± 2.8 OSBPL9e 9.8 46.3 39.5 43.8 40.1 29.1 49.3 145.0 34.0 22.0 98 ± 1.4 91 ± 1.9 91 ± 2.2 90 ± 3.2 90 ± 2.7 87 ± 2.6 91 ± 3.0 91 ± 2.1 91 ± 0.6 93 ± 3.2 VAMP2 51.8 77.4 92.7 67.8 40.6 205.6 66.4 241.2 82.4 66.0 92 ± 2.3 90 ± 3.5 91 ± 0.9 90 ± 3.5 95 ± 1.9 92 ± 2.1 94 ± 1.2 90 ± 2.1 93 ± 1.1 92 ± 2.1 LRP1 49.3 35.4 81.8 28.7 2.9 27.7 33.0 120.6 6.2 1.6 92 ± 2.1 93 ± 2.9 92 ± 4.0 91 ± 3.4 93 ± 1.9 95 ± 3.4 94 ± 4.1 93 ± 1.5 93 ± 2.1 94 ± 5.7 HGPRT Ct ± SD 20.43±0.12 19.54±0.08 20.53±0.46 19.73±0.34 19.12±0.03 23.11±0.91 19.16±0.1 20.58±0.05 20.79±0.27 21.28±0.22 a cf. Table 1. b MDAMB-468. c J16/RAPO. d The primer combination used amplifies the OSBPL9 forms Ib, Ie, ICRAc, ICRAf, ICRAI (cf. Table 1). e The primer combination used amplifies the OSBPL9 forms If, Id, Ic, Ia ICRA_b, ICRA_ (cf. Table 1). I: isoform; rel. c.: relative concentration normalized to HGPRT (=100%) = 2−ΔCt × 100%, Ct: cycle threshold; ΔCt: Ct (target) – Ct (HGPRT); E: efficiency in %; The E values have been calculated using the LinReg tool: http://www.hartfaalcentrum.nl/index.php? main=files&fileName=LinRegPCR.zip&description=LinRegPCR:%20analysis%20of%20quantitative%20PCR%20data&sub=LinRegPCR (124); SD: standard deviation ( 1n∑χ−χ¯); n (sample) = 3; PCR reactions have been performed in duplicates. Bold highlight of rel.c. values recognise the differences in the expression levels of the distinct targets in the diverse cells. In vivo confirmation of hNOT/ALG3–1 binding with CREB3 via IP As shown in Table 1, we isolated the 371 aa long isoform 2 (I2) of the CREB3 protein (Table 1), which is known to be a multifunctional player acting in both the cytosol and the nucleus (47,89–93,126,127) as a binding partner of hNOT-1/ALG3–1 (4). To confirm the interaction of the two molecules in question via IP we first investigated the suitability of the previously described antibodies (abs) α-NOT 1/4 and α-NOT 1b (4; cf. Materials and Methods) for this analysis. Unfortunately, both abs turned out to be unsuitable for IP. Thus, we generated stable HEK 293 transfectants (T) (Fig. 2) by expressing the human proteins NOT-1/ALG3–1 and CREB3 in fusion with the enhanced green fluorescent protein (EGFP) (T-hNOT-1/ALG3–1-EGFP and T-hCREB3-EGFP; cf. Materials and Methods) and used a monoclonal α-GFP ab against this portion of the recombinant proteins (cf. Material and Methods) in order to immunoprecipitate the complexes of interest. As shown in Figure 3A, the α-GFP ab recognizes both recombinant proteins hNOT-1/ALG3–1-EGFP and hCREB3-EGFP (star) and is suitable for IP. The subcellular distribution of the two recombinant proteins corresponds to that described for the native forms (Fig. 3B and C; cf. NT and T-NOT) (4,126,127). The band of 55 kDa (star) detected in the crude homogenate (CH), the ER fraction (F2) and the IP-α-GFP generated from the T-hNOT-1/ALG3–1-EGFP transfectant (Fig. 3A; T-NOT) represents the EGFP fused full-length hNOT-1/ALG3–1 precursor molecule (cf. Fig. 3B; open circle). The band of about 60 kDa detected additionally in the IP-α-GFP (Fig. 3A; star) represents the EGFP fused N-glycosylated precursor molecule (cf. Fig. 3B; NT, closed circle) (4). The size of the detected recombinant hCREB3-EGFP protein, about 95 kDa, suggests that it represents the EGFP fused N-glycosylated CREB3 form (cf. Fig. 3C; star). Figure 2. View largeDownload slide Expression of the recombinant human proteins NOT-1/ALG3-1-pEGFP and CREB3-EGFP in stable HEK 293 transfectants. The images shown in the upper part of the figure illustrate the expression of the two recombinant proteins hCREB3-EGFP (CREB3) and hNOT-1/ALG3-1 (NOT). To control the efficiency of the transfection, the cells were transfected with the pure pEGFP-N3 vector (K2). Non-transfected cells (K1) served as control. The cell areas selected in the fluorescence microscopy pictures (488 nm filter) correspond exactly to those shown in the black-white photographs (below) illustrating the density of the cells. The images were taken using the inverted Olympus IX70 microscope and the TILLvisION software (Photonics GmbH; http://tillvision.software.informer.com/). Figure 2. View largeDownload slide Expression of the recombinant human proteins NOT-1/ALG3-1-pEGFP and CREB3-EGFP in stable HEK 293 transfectants. The images shown in the upper part of the figure illustrate the expression of the two recombinant proteins hCREB3-EGFP (CREB3) and hNOT-1/ALG3-1 (NOT). To control the efficiency of the transfection, the cells were transfected with the pure pEGFP-N3 vector (K2). Non-transfected cells (K1) served as control. The cell areas selected in the fluorescence microscopy pictures (488 nm filter) correspond exactly to those shown in the black-white photographs (below) illustrating the density of the cells. The images were taken using the inverted Olympus IX70 microscope and the TILLvisION software (Photonics GmbH; http://tillvision.software.informer.com/). Figure 3. View largeDownload slide Confirmation of hNOT-1/ALG3-1 binding with CREB3 in vivo. (A) Detection of the recombinant proteins hNOT-1/ALG3-1-EGFP and hCREB3-EGFP in the CH and subcellular fractions (F1–F3) made from the stable HEK 293 transfectants T-hNOT-1/ALG3-1-EGFP (T-NOT) and T-hCREB3-EGFP (T-CREB3) (cf. Fig. 2) using the α-GFP ab (cf. Material and Methods). The 2 bands of about 55 and 60 kDa (star) detected in the IP-α-GFP generated from the T-NOT transfectant represent the EGFP fused full-length hNOT-1/ALG3-1 precursor and its N-glycosylated form (cf. B, circle and closed circle). The detected recombinant hCREB3-EGFP molecule, about 95 kDa (star), represents the EGFP fused N-glycosylated CREB3 form (cf. C). (B) Detection of the hNOT-1/ALG3-1 proteins in the HEK 293 cells and in the T-NOT transfectant using the α-NOT 1b ab (4). In non-transfected cells the 50 kDa hNOT-1/ALG3-1 precursor protein (open circle), its N-glycosylated 55 kDa form (closed circle), the cell compartment specific proteolytic products of 42 (closed diamond), 37 kDa (triangle), 35 kDa (closed square) and 20 kDa (open diamond), and two high molecular forms of 70 kDa (closed triangle) and 150 kDa (+) are visible. In the T-NOT transfectant, the ab detects additionally the recombinant hNOT-1/ALG3-1-EGFP protein (star). The N-glycosylated native form (closed circle) and the EGFP fused hNOT-1/ALG3-1 precursor molecule (star, cf. A, star) are both 55 kDa in size and, thus, overlap (closed circle and star). (C) Detection of the CREB3 proteins in the HEK293 cells and the T-CREB3 transfectant. The visible bands represent the 44 kDa cytosolic full-length precursor molecule (open square), its N-glycosylated form of about 70 kDa (closed inverted triangle) and the cell compartment specific proteolytic products of the latter, the active nuclear CRERB3 TF (closed right-pointing triangle) and the ER associated C-terminus of the cleaved N-glycosylated CREB3 (open left-pointing triangle). The band of about 95 kDa (star) represents the EGFP fused N-glycosylated CREB3 form. (D, E) Confirmation of the binding of the N-glycosylated hNOT-1/ALG3-1 (closed circle) with the cytosolic (open square) and ER associated N-glycosylated CREB3 (closed inverted triangle). Detection of the native and immunoprecipitated CREB3 molecules in both transfectants using the α-CREB3 ab (D). The presence of the cytosolic (open square) and ER associated N-glycosylated CREB3 (closed inverted triangle) in the IP-α-GFP from the T-NOT transfectant confirms their binding with hNOT-1/ALG3-1. The 130 kDa band (–) visible in D may represent the not denatured complex of the partners in question. (E) The detection of the N-glycosylated hNOT-1/ALG-3 molecule in the IP-CREB3 confirms its binding with the 44 (open square) and 70 (closed inverted triangle) kDa CREB3 molecules. The specificity of the immunodetection was proven by staining the western blots using the appropriate secondary ab (lane II. AK). The electrophoretic separation was performed on 10% agarose gels using aliquots containing 40 µg of total protein from the cellular fraction and 15 μl of the IP made as described in Materials and Methods. To control the fractionation procedure, the blots were stained with the α-TBP ab (CH: crude homogenate; F1: cytosolic fraction; F2: ER fraction; F3: nuclear fraction; IP: immunoprecipitate; IP α-GFP: IP performed using the α-GFP ab; T-V: HEK 293 cells transfected with the pure p-EGFP vector; T-NOT: HEK293 cells transfected with the phNOT-1/ALG3-1-EGFP construct; T-CREB3: HEK 293 cells transfected with the recombinant phCREB3-EGFP vector). Figure 3. View largeDownload slide Confirmation of hNOT-1/ALG3-1 binding with CREB3 in vivo. (A) Detection of the recombinant proteins hNOT-1/ALG3-1-EGFP and hCREB3-EGFP in the CH and subcellular fractions (F1–F3) made from the stable HEK 293 transfectants T-hNOT-1/ALG3-1-EGFP (T-NOT) and T-hCREB3-EGFP (T-CREB3) (cf. Fig. 2) using the α-GFP ab (cf. Material and Methods). The 2 bands of about 55 and 60 kDa (star) detected in the IP-α-GFP generated from the T-NOT transfectant represent the EGFP fused full-length hNOT-1/ALG3-1 precursor and its N-glycosylated form (cf. B, circle and closed circle). The detected recombinant hCREB3-EGFP molecule, about 95 kDa (star), represents the EGFP fused N-glycosylated CREB3 form (cf. C). (B) Detection of the hNOT-1/ALG3-1 proteins in the HEK 293 cells and in the T-NOT transfectant using the α-NOT 1b ab (4). In non-transfected cells the 50 kDa hNOT-1/ALG3-1 precursor protein (open circle), its N-glycosylated 55 kDa form (closed circle), the cell compartment specific proteolytic products of 42 (closed diamond), 37 kDa (triangle), 35 kDa (closed square) and 20 kDa (open diamond), and two high molecular forms of 70 kDa (closed triangle) and 150 kDa (+) are visible. In the T-NOT transfectant, the ab detects additionally the recombinant hNOT-1/ALG3-1-EGFP protein (star). The N-glycosylated native form (closed circle) and the EGFP fused hNOT-1/ALG3-1 precursor molecule (star, cf. A, star) are both 55 kDa in size and, thus, overlap (closed circle and star). (C) Detection of the CREB3 proteins in the HEK293 cells and the T-CREB3 transfectant. The visible bands represent the 44 kDa cytosolic full-length precursor molecule (open square), its N-glycosylated form of about 70 kDa (closed inverted triangle) and the cell compartment specific proteolytic products of the latter, the active nuclear CRERB3 TF (closed right-pointing triangle) and the ER associated C-terminus of the cleaved N-glycosylated CREB3 (open left-pointing triangle). The band of about 95 kDa (star) represents the EGFP fused N-glycosylated CREB3 form. (D, E) Confirmation of the binding of the N-glycosylated hNOT-1/ALG3-1 (closed circle) with the cytosolic (open square) and ER associated N-glycosylated CREB3 (closed inverted triangle). Detection of the native and immunoprecipitated CREB3 molecules in both transfectants using the α-CREB3 ab (D). The presence of the cytosolic (open square) and ER associated N-glycosylated CREB3 (closed inverted triangle) in the IP-α-GFP from the T-NOT transfectant confirms their binding with hNOT-1/ALG3-1. The 130 kDa band (–) visible in D may represent the not denatured complex of the partners in question. (E) The detection of the N-glycosylated hNOT-1/ALG-3 molecule in the IP-CREB3 confirms its binding with the 44 (open square) and 70 (closed inverted triangle) kDa CREB3 molecules. The specificity of the immunodetection was proven by staining the western blots using the appropriate secondary ab (lane II. AK). The electrophoretic separation was performed on 10% agarose gels using aliquots containing 40 µg of total protein from the cellular fraction and 15 μl of the IP made as described in Materials and Methods. To control the fractionation procedure, the blots were stained with the α-TBP ab (CH: crude homogenate; F1: cytosolic fraction; F2: ER fraction; F3: nuclear fraction; IP: immunoprecipitate; IP α-GFP: IP performed using the α-GFP ab; T-V: HEK 293 cells transfected with the pure p-EGFP vector; T-NOT: HEK293 cells transfected with the phNOT-1/ALG3-1-EGFP construct; T-CREB3: HEK 293 cells transfected with the recombinant phCREB3-EGFP vector). As described previously (4), the hNOT-1/ALG3–1 specific α-NOT 1b ab directed against the N-terminal 14 aa of the protein recognizes the full-length 50 kDa hNOT-1/ALG3–1 precursor molecule (open circle), its 55 kDa N-glycosylated form (closed circle), the proteolytic products of the N-glycosylated hNOT-1/ALG3–1–42 kDa (closed diamond), 37 kDa (open triangle), 35 kDa (closed square) and 20 kDa (open diamond)—as well as two high molecular forms of 70 kDa (closed triangle) and 150 kDa (+)(Fig. 3B; NT). The latter are specific but not detectable in each preparation and, thus, may represent either further post translationally modified forms (cf. Table 3) or not denatured complexes (Fig. 3B; +). Generally, the hNOT-1/ALG-3–1 pattern detected in the HEK 293 cells shown in Figure 3B corresponds to that described previously for the HT-29 cells (4). In the T-phNOT-1/ALG3–1-EGFP transfectant the α-NOT 1b ab recognizes the native forms and additionally the EGFP fused precursor molecule (Fig. 3B; star). Because both the N-glycosylated native form (Fig. 3B; NT, closed circle) and the EGFP fused hNOT-1/ALG3–1 precursor molecule (Fig. 3B; T-NOT, star, cf. Fig. 3A; star) are 55 kDa in size, the corresponding bands on the immunoblots overlap (Fig. 3B; closed circle and star). The hNOT-1/ALG3–1 pattern detected in the transfectant confirms our previously published data suggesting the N-glycosylation step to be a prerequisite for the sequential cleavage of hNOT-1/ALG3–1 resulting in at least two cell compartment specific molecules, 37 and 35 kDa in size, destined to the ER and to the nucleus (Fig. 3B; open triangle, closed square). In order to immunoprecipitate the native and the EGFP fused CREB3 molecules, polyclonal and monoclonal α-CREB3 abs both against the full-length human CREB3 (cf. Materials and Methods) were applied (Fig. 3C and D). As shown in Figure 3, the polyclonal α-CREB3 ab recognizes in the CH two molecules which are about 44 (open square) and 70 (closed inverted triangle) kDa in size. As mentioned previously, the I2 form isolated as hNOT-1/ALG3–1 ligand consists of 371 aa (cf. Table 1). It encodes a protein of a putative molecular weight of 44 kDa (127). As previously identified by Raggo et al. (127), the 44 kDa CREB3 molecule corresponds to the cytosolic precursor protein processed to the active nuclear form by regulated intramembrane proteolysis (RIP) (127). The N-glycosylation of the precursor and its association with the ER is a prerequisite for the processing by RIP (127), resulting at least in the active transcription factor (TF) which consists of the N-terminal part of the molecule. Whereas the active TF enters the nucleus after the release from the ER (cf. Fig. 3C and D; closed right-pointing triangle) the C-terminus remains in the ER (cf. Fig. 3C and D; open left-pointing triangle). As shown in Figure 3C and D, we detect both the 44 kDa precursor molecule (open square) and its N-glycosylated 70 kDa form associated with the ER (closed inverted triangle) in the CH of both not transfected cells, the two transfectants and in the appropriate cellular fractions generated from the T-hCREB3-EGFP (T-CREB3) transfectant. Furthermore, in both transfectants we determine the active nuclear CREB3 (Fig. 3C and D; closed right-pointing triangle) and the C-terminus of the cleaved N-glycosylated CREB3 which remains in the ER (Fig. 3C and D; open left-pointing triangle). Thus, the identified CREB3 pattern shown in Figure 3C and D corresponds to that described previously by Raggo et al. (127). The detection of the cytosolic 44 kDa CREB3 precursor and its ER associated N-glycosylated 70 kDa form in the complex pooled down using the α-GFP ab from the T-hNOT-1/ALG3–1-EGFP transfectant (Fig. 4D; T-NOT/IP α-GFP, closed inverted triangle, open square) and the detection of the 55 kDa N-glycosylated hNOT-1/ALG3–1 in the complex pooled down using the α-CREB3 ab from the T-CREB3-EGFP transfectant (Fig. 3E; closed circle) confirm the in vivo binding of the two partners in question. Furthermore, the data presented in Figure 3C–E show clearly that the 55 kDa N-glycosylated hNOT-1/ALG3–1 molecule (cf. Fig. 3B; closed circle) binds the N-glycosylated CREB3 precursor molecule. It does not interact with the proteolytic products specific to the ER and the nucleus (Fig. 3C and D; closed right-pointing triangle, open left-pointing triangle). As shown in Figure 3C, the α-CREB3 ab recognizes in the cytosol and the ER also a high molecular species of about 130 kDa (–), as similiarly detected with the hNOT-1/ALG3–1 specific ab (Fig. 3B; +). This band may represent the not denatured complex of the two interacting partners. Figure 4. View largeDownload slide Confirmation of hNOT-1/ALG3-1 in vivo binding with OSBP, OSBPL9, LRP1 and SYPL1 in the cells SK-BR-3, MDA-MB-468 and the T-NOT transfectant. (A) Detection of the full-length OSBP (closed circle) in the CH and α-OSBP-IP. The 130 kDa band (closed right-pointing triangle) may represent its post translationally modified form (136,137). The OSBP molecules of about 65 and 35 kDa (open left-pointing triangle, open circle) has not been described yet. Staining of the western blot with the α-NOT1/4 ab (4) identifies the 42 kDa hNOT-1/ALG3-1 derivative (closed diamond) located in the cytosol, ER and the nucleus (4) as OSBP binding partner. The two further bands detected in the CH, 37 (open triangle) and 20 (double open diamonds), represent hNOT-1/ALG3-1 derivatives (4). (B) Western blot of electrophoretically separated CH and IP performed using an OSBPL9 specific ab (cf. Material and Methods). In the CH two specific bands of about 68 (double open circles) and 42 kDa (closed left-pointing triangle) are visible. The size of the molecule with the electrophoretic mobility of 68 kDa (double open circles) corresponds to that of the OSBPL9S form (52). Staining of the immunoblot of the electrophoretically separated denatured complex pooled down using the α-OSBPL9 ab with the α-NOT 1/4 ab (4) revealed the 42 kDa hNOT-1/ALG3-1 derivative located in the cytosol, ER and nucleus (closed diamond; cf. A) as OSBPL9 partner. (C) Detection of the ß-subunit of LRP1, 85 kDa (open diamond), and its putative posttranslational product of 100 kDa (+) in the CH and the IP performed using the α-LRP1 (cf. Materials and Methods). Staining of the IP α-LRP1 IP with the α-NOT 1/4 ab identified the 42 kDa hNOT-1/ALG3-1 molecule (cf. B, closed diamond) as LRP1 binding partner. (D) Detection of SYPL1 in the CH and the IP performed using the α-SYPL1 ab (cf. Material and Methods). The molecules migrating at 32 kDa (closed triangle) and 30 kDa (closed inverted triangle) represent the two known SYPL1 forms (142). The molecules migrating at higher molecular weight than predicted (double closed circles, open right-pointing triangle, double open inverted triangles, closed square) represent either post translationally modified SYPL1 molecules (double closed circles, double open inverted triangles, closed square) (21,143) or not denatured complexes (open right-pointing triangle). Staining of the IP α-SYPL1 with the α-NOT 1/4 ab (4) identifies the 37 kDa (open triangle) and 20 kDa (double open diamonds) hNOT-1/ALG3-1 cleavage products of hNOT-1/ALG3-1 (4) as partners of the two SYPL1 molecules present in the IP α-GFP ab from the T-NOT transfectant (closed inverted triangle, closed triangle). The electrophoretic separation of the samples was performed under the conditions given in the legend to Figure 3. Figure 4. View largeDownload slide Confirmation of hNOT-1/ALG3-1 in vivo binding with OSBP, OSBPL9, LRP1 and SYPL1 in the cells SK-BR-3, MDA-MB-468 and the T-NOT transfectant. (A) Detection of the full-length OSBP (closed circle) in the CH and α-OSBP-IP. The 130 kDa band (closed right-pointing triangle) may represent its post translationally modified form (136,137). The OSBP molecules of about 65 and 35 kDa (open left-pointing triangle, open circle) has not been described yet. Staining of the western blot with the α-NOT1/4 ab (4) identifies the 42 kDa hNOT-1/ALG3-1 derivative (closed diamond) located in the cytosol, ER and the nucleus (4) as OSBP binding partner. The two further bands detected in the CH, 37 (open triangle) and 20 (double open diamonds), represent hNOT-1/ALG3-1 derivatives (4). (B) Western blot of electrophoretically separated CH and IP performed using an OSBPL9 specific ab (cf. Material and Methods). In the CH two specific bands of about 68 (double open circles) and 42 kDa (closed left-pointing triangle) are visible. The size of the molecule with the electrophoretic mobility of 68 kDa (double open circles) corresponds to that of the OSBPL9S form (52). Staining of the immunoblot of the electrophoretically separated denatured complex pooled down using the α-OSBPL9 ab with the α-NOT 1/4 ab (4) revealed the 42 kDa hNOT-1/ALG3-1 derivative located in the cytosol, ER and nucleus (closed diamond; cf. A) as OSBPL9 partner. (C) Detection of the ß-subunit of LRP1, 85 kDa (open diamond), and its putative posttranslational product of 100 kDa (+) in the CH and the IP performed using the α-LRP1 (cf. Materials and Methods). Staining of the IP α-LRP1 IP with the α-NOT 1/4 ab identified the 42 kDa hNOT-1/ALG3-1 molecule (cf. B, closed diamond) as LRP1 binding partner. (D) Detection of SYPL1 in the CH and the IP performed using the α-SYPL1 ab (cf. Material and Methods). The molecules migrating at 32 kDa (closed triangle) and 30 kDa (closed inverted triangle) represent the two known SYPL1 forms (142). The molecules migrating at higher molecular weight than predicted (double closed circles, open right-pointing triangle, double open inverted triangles, closed square) represent either post translationally modified SYPL1 molecules (double closed circles, double open inverted triangles, closed square) (21,143) or not denatured complexes (open right-pointing triangle). Staining of the IP α-SYPL1 with the α-NOT 1/4 ab (4) identifies the 37 kDa (open triangle) and 20 kDa (double open diamonds) hNOT-1/ALG3-1 cleavage products of hNOT-1/ALG3-1 (4) as partners of the two SYPL1 molecules present in the IP α-GFP ab from the T-NOT transfectant (closed inverted triangle, closed triangle). The electrophoretic separation of the samples was performed under the conditions given in the legend to Figure 3. In vivo interaction of hNOT-1/ALG3–1 with OSBP and OSBPL9 The two hNOT-1/ALG3–1 interaction partners OSBP and OSBPL9 (cf. Table 1) are members of the evolutionarily conserved family of oxysterol-binding proteins (OSBPs) which in mammals are termed oxysterol-binding protein-related (ORP) or OSBP-like (OSBPL) proteins (128–130). In this study, we will use the latter name. In humans, this family consists of 12 genes, which encode the proteins OSBP—the founder member –, and OSBPL1–11. On the basis of structural homology, localization in similar cell compartments and common interaction partners the molecules are organized into six subfamilies (128–130). The OSBP gene together with OSBP4 builds the subfamily I (128,131). The OSBPL9 gene builds the subfamily V (128). All full-length family members are equipped with the conserved C-terminally located sterol-binding domain (SBD), about 400 aa in size, and a pleckstrin-homology domain (PHD) located at their N-terminus (128–131). Interestingly, the genes of the subfamilies I, II and V encode the full-length protein forms (L forms) and short (S) forms transcribed from alternative promoters, lacking the PHD and characterized by specific differential expression patterns associated with specific functions (128,131). In the case of OSBP, to date only the full-length protein, 807 aa long, with a putative molecular weight of 89 kDa is known (130). The polyclonal rabbit α-OSBP ab directed against the C-terminal 300 aa of the protein (cf. Materials and Methods) recognizes in the CH of both cells MCF7 and SKBR-3 two main bands, about 100 and 65 kDa in size (Fig. 4A; closed circle, open left-pointing triangle), and three weaker bands representing molecules with an electrophoretic mobility of about 35, 70 and 130 kDa (Fig. 4A; open circle, star, closed right-pointing triangle). The detection of the full-length OSBP (Fig. 4A; closed circle) is congruent with the data previously published (131–133). The 130 kDa band (Fig. 4A; closed right-pointing triangle) may represent a not denatured complex harbouring OSBP or its post translationally modified form(s). As described previously multisite phosphorylation of OSBP is of essential importance for the mediation of its functions (134,135). An about 65 and 35 kDa derivative of OSBP (Fig. 4A; open left-pointing triangle, open circle) has not been identified yet. However, because the SBD of OSBP is 74% identical with the corresponding region of the OSBP4 proteins, we consider these bands as putative unprocessed and processed OSBP4S forms identified by Charman et al. (136). As shown in Figure 4A, the α-OSBP ab immunoprecipitates the full-length precursor molecule (closed circle), and the 130 and 65 kDa molecules (closed right-pointing triangle, open left-pointing triangle). Staining of the electrophoretically separated denatured IP α-OSBP with the α-NOT1/4 ab resulted in the identification of the 42 kDa hNOT-1/ALG3–1 protein present in the cytosol, ER and the nucleus (4) as the OSBP interaction partner (Fig. 4A; closed diamond). The two further bands detected in the CH (Fig. 4A; open triangle, double open diamonds) represent the previously described 37 kDa hNOT-1/ALG3–1 derivative destined to the ER (open triangle) and the 20 kDa C-terminal cleavage product of the molecule (double open diamonds) (4). The OSBPL9 gene encodes a putative full-length 723 aa long ORPL9L protein with an electrophoretic mobility corresponding to the molecular weight of 95 kDa and the N-terminally truncated ORPL9S form lacking the PHD, 558 aa long, with a molecular weight of about 70 kDa (36,52). According to the NCBI database, twelve OSBPL9 transcript variants are known (cf. Material & Methods). Because of the structural similarity and comparable molecular weight of the putative proteins they may encode (ICRA_a/Ia, 62.53 kDa; ICRA_b, 86.25 kDa; ICRA_c, 85.18 kDa; ICRA_d/Ib, 81.17 kDa; ICRA_e, 83.79 kDa; ICRA_f, 83.41, ICRA_g/Ic, 70.24 kDa, ICRA_h, 58.50; ICRA_i, 63.93 kDa; Id, 81.79 kDa; Ie, 83.18 kDa, If, 84.26 kDa) the generation of form specific abs is not possible. In any case, forms with similar molecular weight would be undistinguishable by immunoblotting. To date, two proteins, ORP9L and ORP9S, have been identified in distinct tissues using an ab directed against all forms (52). The two proteins identified by Wyles and Ridgway (52) correspond to the forms Id and ICRA_a/Ia (cf. Table 1). The clone isolated in the Y2H screen (Table 1) encodes a region corresponding to aa 55–310 of ICRA_d/Ib, aa 72–327 of Ie, aa 90–345 of ICRA_c and 72–327 of ICRA_f. By using an α-OSBPL9 ab (cf. Material an Methods) directed against a central region of OSBPL9 and encompassing the C-terminal portion of the PSD and the N-terminal portion of the SBP two bands of the size of about 68 and 42 kDa (Fig. 4B; double open circles, closed left-pointing triangle) were detected in the CH of all cells (shown exemplary for the SK-BR-3 cells) applied in the qRT-PCR analysis (cf. Table 4). The molecule with the electrophoretic mobility of 68 kDa corresponds to the OSBPL9S form originally described by Wyles and Ridgway (52). Interestingly, in the immunoprecipitate solely the 42 kDa molecule is present (Fig. 4B; IP-α-OSBPL9). Staining of the immunoblot of the denatured complex with the α-NOT 1/4 ab (4) revealed its interaction with the 42 kDa hNOT-1/ALG3–1 molecule (Fig. 4B; closed diamond) which is present in the cytosol, ER and the nucleus (4), as determined similarly for OSBP (Fig. 4A). Thus, our data suggest that hNOT-1/ALG3–1 interacts with distinct OSBPs and, furthermore, with their direct targets, such as the VAMP/VAP-A protein (cf. Table 1) and the LDL family members (see later; cf. Table 1). Similar to the further members of the family containing the FFAT motif both OSBP and OSBPL9 interact directly with the VAMP/VAP-A protein (128–132,137) which was also identified as hNOT-1/ALG3–1 ligand (cf. Table 1). The latter molecule is a type II integral ER membrane protein acting in a variety of cellular processes including the regulation of lipid transport and homeostasis, membrane trafficking, neurotransmitter release, stabilization of presynaptic microtubules and unfolded protein response (UPR) (35,139). Furthermore, both OSBPs and VAMP/VAP-A also bind and affect the actin and microtubule cytoskeleton (132,137,138). Unfortunately, the commercially available abs against VAMP/VAP-A (cf. Material and Methods) turned out to be unsuitable for IP and, thus, we could not confirm in vivo its interaction with hNOT-1/ALG3–1 and/or its putative presence in hNOT-1/ALG3–1 complexes with the OSBP/OSBPL9 molecules. In vivo interaction of hNOT-1/ALG3–1 with LRP1 The LRP family encompasses seven structurally related members (139). The active LRP1, also known as CD91 or α2macroglobulin receptor (α2MR), is derived by proteolysis from a N-glycosylated 600 kDa precursor consisting of an 85 kDa carboxy-terminal β-subunit building the transmembrane and intracellular domain and of a non-covalently attached N-terminal α-subunit building the extracellular domain (1). LRP1 not only regulates the cholesterol and lipid metabolism but it also acts as an essential signal transducer and therefore is involved in distinct physiological processes and related pathologies (139). The clone isolated in the Y2H screen encompasses the cytoplasmic domain (Table 1). Thus, to immunoprecipitate the LRP1-hNOT-1/ALG3–1 complex (Fig. 4C) a α-LRP1 ab directed against the 85 kDa β-subunit was used (cf. Material and Methods). As shown in Figure 4C, the ab recognizes and immunoprecipitates two molecules with an electrophoretic mobility corresponding to 85 and 100 kDa (Fig. 4C; open diamond, +). Whereas the 85 kDa band corresponds to the ß-subunit, the 100 kDa molecule may represent a not-denatured complex or a post translationally modified form. In this context, the already described phosphorylation-dependent binding of LRP1 with distinct cytoplasmic adaptor proteins (140) has to be considered in the scope of research on the functional impact of the interaction in question. According to the UniProt database (cf. Material and Methods), the β-subunit is equipped with six phosphorylation sites. Interestingly, as shown above for OSBP and OSBPL9, LRP1 also interacts with the 42 kDa hNOT-1/ALG3–1 molecule (Fig. 4B; closed diamond) present in the cytosol, ER and nucleus (4). In vivo interaction of hNOT-1/ALG3–1 with SYPL1 Two differentially expressed isoforms of the vesicle protein SYPL1 (259 and 241 aa in size) with an electrophoretic mobility corresponding to 32 and 30 kDa are known (21,22,142). The clone isolated in the Y2H screen corresponds to aa 173–259 of I1 and aa 155–241 of I2 (cf. Table 1). To confirm the interaction of hNOT-1/ALG3 with the vesicle-trafficking processes mediating SYPL1 (143) a polyclonal α-SYPL1 ab against a 16 aa polypeptide derived from the N-terminal region of the molecule was applied (cf. Material and Methods). As shown in Figure 4D, it recognizes multiple polypeptide bands with a molecular weight both higher (double closed circles, open right-pointing triangle, closed square, double open inverted triangles) and lower (closed inverted triangle, closed triangle, open square) than predicted. This result corresponds to that previously described by Brooks et al. (21) and Haass et al. (142). The molecules migrating at 32 and 30 kDa (Fig. 4D; closed triangle, closed inverted triangle) correspond to the two forms identified by Windoffer et al. (141). The molecules migrating at higher molecular weight than predicted (Fig. 4D; double closed circles, open right-pointing triangle, double open inverted triangles, closed square) may represent post translationally modified SYPL1 molecules. Interestingly, in the IP performed using the α-SYPL1 ab (IP α-SYPL1) only a band of about 90 kDa (Fig. 4D; open right-pointing triangle) is detectable. In order to get some explanation for the high molecular weight of the detected molecule we analysed the SYPL1 sequence using the ELM database (http://elm.eu.org/) for sites relevant in the context of post-translational modifications. In addition to the N-glycosylation site (Table 2), this analysis revealed phosphorylation sites for distinct kinases (CK1, GSK3, PIKK, PKA, PlK and MAPK) similar as determined for the hNOT-1/ALG3–1 molecules (Table 3) and two binding sites for the glycosaminoglycan attachment (143). Staining of the IP α-SYPL1 with the α-NOT 1/4 ab (4) revealed that the 37 and 20 kDa hNOT-1/ALG3–1 cleavage products of hNOT-1/ALG3–1, which were previously determined in the cytosol and ER (4), interact with SYPL1 (Fig. 4D; open triangle, double open diamonds). Staining of the IP performed using the α-GFP ab (cf. Material and Methods) from the T-NOT transfectant with the α-SYPL1 ab revealed the two main forms of SYPL1 (Fig. 4D; closed inverted triangle, closed triangle) as interacting partners of hNOT-1/ALG3–1. Taken together, these results suggest that the interaction between the two molecules in question is associated with the proteolytic processing of hNOT-1/ALG3–1 (4). Discussion HNOT/ALG3 is the human homolog of the NOT gene originally identified in Dmel (1,2) and its distant relative Dvir (3) as a gene harbouring in its intron the tumour suppressor tumorous imaginal discs (tid) (1–3). As described previously (4), the ALG3 component in its name points to the 33% identity of the putative flies NOT56 protein (1–3) and its human counterpart with the yeast non-essential ALG3 protein, a dolichyl-PP-Man: Man5GlcNAc2-dolichyl-PP mannosyltransferase, which acts in asparagine (Asn)-linked/N-linked glycosylation (5). Because defects in the synthesis of N-glycans and under glycosylation of glycoproteins are a diagnostic feature in CDG pathology (6), the latter drew the researcher’s attention towards the identification of hNOT/ALG3 mutations in CDG patients (7–15). To date, from over 1000 described CDG cases in 12 patients 10 mutational events in hNOT/ALG3 were described (7–15). However, in no described case a direct link between the detected mutation in hNOT/ALG3 with failure of its role as mannosyltransferase and, in turn, the causality of the failure of N-glycosylation and the phenotype in CDG patients can be postulated. As we described previously, the gene encodes 17 transcripts of which only two main forms, hNOT-1/ALG3–1 and hNOT-4/ALG3–4, are translated (4). Furthermore, the 15 remaining non-translated transcripts, among them one found in CDG patients (7), represent common aberrant products of the transcription machinery and have to be excluded as pathologically relevant (4). Recent reports suggesting hNOT/ALG3 as a novel target in cancer (4,16–18) and CDG independent MR (19) also do not provide hints concerning the mechanisms and cellular processes the gene may be involved in. Thus, to address the cellular and molecular aspects of hNOT-1/ALG3–1’s actions and to get primary hints concerning the molecular networks it is involved in we performed a search for molecules directly interacting with the hNOT-1/ALG3–1 protein. As shown in this study, the identified putative molecular partners of hNOT-1/ALG3 represent diverse functional protein classes. This indicates clearly that the molecule in question is a multifunctional player involved in diverse cellular processes, which are associated in violated state with distinct pathologies. Most of the identified hNOT-1/ALG3–1 partners—LRP1, VAMP, FKBP8, HO-2, BNIP3, OSBP, OSBPL9, CD74, SEC16 B, INF-2 and CREB3 (cf. Table 1)—have already been confirmed as residing within the ER and the Golgi apparatus, similar to and as previously described for hNOT-1/ALG3–1 (4). Furthermore, many of the ligands acting in processes such as the regulation of intracellular protein trafficking, vesicle biogenesis and transport, endocytosis and secretion are functionally linked. The proteins VAMP and SYPL are direct binding partners (144) involved in the regulation of the trafficking of the insulin responsive GLUT4 glucose transporter from intracellular vesicles to the plasma membrane (21,50). VAMP and OSBP mediate in concert the export of proteins from the ER (51), the activation of ceramide transport (35) and the regulation of the OSBPL9 partitioning between the ER and Golgi (53). Both VAMP and FKBP8 regulate the subcellular location of protrudin and determine the neurite formation (145). Four of the molecules destined to ER—CREB3 (47,96), LRP1 (95), CD74 (94) and SRPX (26)—have been experimentally confirmed as N-glycosylated. In the case of LRP1 and CREB3, the essential necessity of the N-glycosylation step for the biological activation of the proteins has been experimentally confirmed (94,95). Thus, the question arises whether these interactions may be associated with the putative role of hNOT-1/ALG3–1 in the N-glycosylation process as postulated on the basis of its 33% identity with the yeast ALG3 protein (4). As we show in this study, regarding the interaction of CREB3 and hNOT-1/ALG3–1 the results so far allow to rule out the latter to act as a mannosyltransferase. The N-glycosylated hNOT-1/ALG3 molecule interacts with the N-glycosylated CREB3 precursor. It does not interact with both the active TF, which after releasing from the ER enters the nucleus, and with the C-terminal part of the CREB3 precursor, that remains in the ER. Thus, because the N-glycosylation and association with the ER of the CREB3 precursor is essential for its processing to the active TF by RIP (127), the interaction in question seems to be a prerequisite for the processing of CREB3. In case of LRP1, we show that the 85 kDa β-subunit representing the cytoplasmic domain of the molecule binds with the 42 kDa cleavage product of the N-glycosylated hNOT-1/ALG3–1 located in the cytosol, the ER and the nucleus (4). Interestingly, this processed hNOT-1/ALG3–1 form does also interact with OSBP and OSBPL9. In contrast, the two SYPL1 forms interact with the two further cleavage products of the N-glycosylated hNOT-1/ALG3–1, namely the N-terminal 37 kDa and the C-terminal 20 kDa molecules located in the cytosol and the ER (4). Generally, the OSBP family members, which are cytosolic oxygenated derivatives of cholesterol (oxysterols), maintain essential housekeeping actions associated with the ER and other organelle membranes and act as sterol sensors and regulators of homeostatic responses in lipid metabolism and transport (130). Although both OSBP and OSBPL9 mediate oxysterols actions, their capacity to bind and transport sterols differs depending on the cellular sterol levels and the membrane compartment (131). By interaction with VAPA via the FFAT domain (cf. Table 3) OSBP localizes to the ER and the Golgi apparatus where it stimulates sphingomyelin (SM) biosynthesis (133). Furthermore, it occurs in the cytoplasm and in the vesicles near the nucleus where it regulates the sterol metabolism and transport from the lysosomes to the nucleus and it is required for the delivery of cargo destined to the exocytosis (134). In the nucleus, OSBP supresses the transcription of genes which encode enzymes of the sterol and LDL biosynthesis (130). Concerning the latter finding, the isolation of LRP1, which acts as a regulator of the cholesterol homeostasis by receptor-mediated endocytosis of cholesterol-rich LDL particles (139), as a partner of hNOT-1/ALG3–1 has to be pointed out. The two OSBPL9 proteins L and S, which are in various tissues differentially expressed, play distinct functions in sterol sensing and trafficking (52). OSBPL9L localizes similar to OSBP to the trans-Golgi network (TGN) and the ER via its PH domain and the FFAT motif. Its knockdown via siRNA results in Golgi fragmentation and impaired trafficking of proteins and cholesterol between the ER and Golgi (52). Overexpression of the dominant negative OSBPL9S variant results in complete cessation of the protein transport and leads to inhibition of cell growth (52). The LRP1 protein regulates both the cholesterol and lipid metabolism and acts as an essential signal transducer (137). The SYPL1 molecule mediates vesicle-trafficking processes (143). Regarding these functions of OSBP, OSBPL9, LRP1 and SYPL1 and considering the fact that they interact in vivo with distinct processed forms of hNOT-1/ALG3–1, the hypothesis that these interactions may be associated with either the involvement of hNOT-1/ALG3–1 in the intercompartmental transport machinery or with its processing via this route seems to be plausible. This hypothesis is consistent with the previously described resistance of hNOT-1/ALG3–1 to the endoglycosidase H (Endo H) which suggests its complex N-glycosylation status that is characteristic for molecules undergoing fast processing and transfer to Golgi (4). Furthermore, it is congruent with distinct structural features of hNOT/ALG3, such as the endosome-lysosome-basolateral sorting signals, which mediate sorting of transmembrane proteins to different compartments of the endomembrane system and to the basolateral plasma membrane of polarized epithelial cells and attachment sites for glycosaminoglycan (4). The latter is the most abundant heteropolysaccharide located primarily on the surface of cells, in the extracellular matrix (EMC) and in secretory vesicles. As described previously, the C-terminus of both hNOT/ALG3 proteins is equipped with the di-lysine KKXX motif associated with targeting to the ER (4). However, whereas the hNOT-1/ALG3–1, which is additionally equipped with the di-arginine LRKR/RRL retention/retrieving signal for ER localization is located in the ER the hNOT-4/ALG3–4 precursor remains in the cytosol (4). Furthermore, both proteins are glycosylated and undergo sequential proteolytic cleavage resulting in derivatives destined to distinct cellular compartments (4). The N-glycosylation step seems to be a prerequisite for the processing process (4). The fact that the two translated hNOT/ALG3 proteins differ with respect to their N-terminus but share the portion corresponding to aa 70–438 of hNOT-1/ALG3–1 and, thus, share the distinct structural features which determine their binding and cellular functions suggests that at least some of the putative partners identified may interact with both. The distinct subcellular destination of the two hNOT/ALG3 proteins may act as a determinant maintaining the specificity of their binding with distinct partners in a defined cellular compartment. The above-discussed findings concerning the in vivo binding of OSBP, OSBPL9, LRP1 and SYPL1 with distinct processed hNOT-1/ALG3–1 forms support this hypothesis, which needs to be addressed in future functional analysis. Regarding the putative interactions of hNOT/ALG3–1 with its ligands in the context of their relevance for specific cellular processes, the fact that the latter share with hNOT-1/ALG3–1 many functional binding motifs/domains is of importance (Benedikt Hacker, Hendrik Messal, Niels van de Roemer and Ursula Kurzik-Dumke. Identification of the binding domains mediating the interaction of the human NOT-1/ALG3–1 protein with its partners OSBP, OSBPL9, SYPL1, LRP1, VAPA and FKBP8, in preparation). In summary, although the biological reason of the interactions of hNOT/ALG3 with most of its partners is not known yet, both the known cellular actions of these molecules and the known pathological consequences of their malfunction suggest that hNOT/ALG3 may be involved in a variety of cellular processes relevant to diverse pathologies. Materials and Methods Isolation of proteins interacting with hNOT-1/ALG3–1 using the Y2H technique In order to isolate the molecular partners of hNOT-1/ALG3–1, to confirm the binding between the isolated ligands and the bait and to proof if hNOT-1/ALG3–1 builds homodimers, the Y2H technique was employed. In order to isolate hNOT-1/ALG3–1 binding partners the Matchmaker™ GAL4 Two-Hybrid System 3 (BD Clontech GmbH, Heidelberg, Germany) was used according to the manufacturer’s protocols. To screen the prey, Human Mammary Gland Matchmaker™ cDNA Library (BD Clontech GmbH) cloned into the pACT2 vector, the recombinant expression bait-vector pAS2–1-hNOT-11–438 was used. It was generated by cloning the full-length hNOT-1/ALG3–1 cDNA (4) into the pAS2–1 vector equipped with the GAL4-binding domain (BD). In order to examine the building of hNOT-1/ALG3–1 homodimers, this cDNA was also cloned into the pACT2 vector (pACT2-hNOT-11–438) equipped with the GAL4-activating domain (AD). The superscripted numbers in the vector’s name indicate the aa residues of the protein encoded. The corresponding cDNA fragment has been derived from the IRAUp969D0822D clone through EcoRI/XhoI restriction (Acc. Nr. BC002839, RZPD-German Science Centre for Genome Research, Berlin, Germany, http:/www.rzpd.de/) and after Klenov treatment cloned into the pAS2–1 vector via EcoRI and SmaI. The expression of the bait protein was confirmed by immunoblot using the affinity purified α-NOT1/4 ab directed against the aa 320–333 of hNOT-1/ALG3–1 (4). The prey (10 µg) and bait (20 µg) DNA were co-transformed into the yeast AH109 cells and grown on the medium-stringency dropout medium containing glucose and X-α-Gal and lacking leucine, tryptophan and histidine (SD-Leu/-Trp/-His/+X-α-Gal). Clones identified as positive under these growth conditions were subjected to further selection by cultivation on a high-stringency medium containing glucose and X-α-Gal and lacking leucine, tryptophan, histidine and adenine (SD/-Leu/-Trp/-His/-Ade/+X-α-Gal). A total of 6.8 × 105 clones was screened. The determination of β-Galactosidase using the β-Gal filter assay was applied to identify putative positive clones. In order to verify the results, the cells were co-transformed with the bait and the recombinant pACT2-p53 plasmid provided with the Y2H kit (negative control), the empty plasmids pAS2–1 and pACT2 (negative controls), the pC11 Vector encoding GAL4 (positive control) and with the previously described recombinant vectors pAS2–1-Ptc11143–1286 and pACT2-Tid206–318 (146,125) used as positive controls. The clones verified as positive were sequenced using the primers MATCHMAKER™ 5′ LD-Insert- (5′–CTATTCGATGATGAAGATACCCCACCAAACCC–3′) and the 3′ LD-Insert Screening Amplimer (5′–GTGAACTTGCGGGGTTTTTCAGTATCTACGAT–3′) (BD Clontech GmbH). In order to examine whether hNOT-1/ALG3–1 builds homodimers, the yeast Y187 cells were sequentially transformed with the recombinant vectors pAS2–1-hNOT-11–438 and pACT2-hNOT-11–438. The expression of the recombinant BD- and AD-tagged proteins was determined via western blot using the tag specific abs α-GAL4-BD and α-GAL4-AD (Sigma-Aldrich, Munich, Germany) in the following concentrations: 1 µg/ml (α-GAL4-BD) and 0.4 µg/ml (α-GAL4-AD). To disclose the building of hNOT-1/ALG3–1 homodimers the β-Gal filter assay was applied. The Y187 cells transformed with the empty vectors pAS2–1 and pACT2 served as negative controls. Cells transformed with the pCL1 vector encoding GAL4 served as positive controls. DNA sequencing and sequence analysis Gel electrophoretically separated DNA fragments generated by RT-PCR using appropriate primers were extracted from the gels using the GenElute™ Gel Extraction Kit (Sigma-Aldrich, Steinheim, Germany) and purified using the GenElute™ PCR Clean-Up Kit (Sigma-Aldrich) according to the manufacturer’s instructions. Sequencing was performed using the BigDy®Terminator v1.1 Cycle Seqeuncing Kit (Applied Biosystems, Weiterstadt, Germany) and the services of the company GENterprice GmbH (Mainz, Germany). Cell lines and cell culture conditions The yeast cells AH109 and Y187 were purchased by Clontech (BD Clontech GmbH). Non-transformed cells were grown on a yeast (Y)/peptone (P)/dextrose (D) (YPD) medium according to the manufacturer’s protocols. Depending on the assay, the transformed cells were cultured on a medium- or high-stringency-medium as described earlier. The human cell lines HT-29, MCF-7, HeLa, J16/RAPO and Jurkat were purchased from the German Resource Centre for Biological Material (DSMZ GmbH, Braunschweig, Germany). The human cell lines MDA-MB-468, SK-BR-3, HEK-293 and HaCaT were purchased from the Cell Lines Service GmbH (CLS, Eppelheim, Germany). The human T98G cell line (CRL-1690) was purchased from the European Collection of Authenticated Cell Cultures (ECACC, via Sigma-Aldrich). The mouse MOCHA cells were purchased from LGC Standards GmbH (Wesel, Germany). The HaCaT, SK-BR-3, MDA-MB-468, MCF-7 and HEK-293 cells were cultivated on a DMEM/F-12 medium (Sigma-Aldrich GmbH, Munich, Germany). The cell lines HT-29, J16/RAPO and Jurkat were grown on a RPMI-1640 medium (Sigma-Aldrich GmbH) and the cell lines T98G and HeLa on a MEM (Eagle) medium (Biochrom GmbH, Berlin, Germany). All media were supplemented with 10% heat-deactivated FCS (Biochrom GmbH), and 100 U/ml penicillin and 100 μg/ml streptomycin (Sigma-Aldrich GmbH). The MEM (Eagle) medium has been additionally supplemented with 1 volume per cent (v/v%) 100 mM sodium pyruvate solution (Sigma-Aldrich) and 1 v/v% 100× MEM non-essential amino acid solution (Sigma-Aldrich GmbH). The cells were analysed for Mycoplasma contamination using the Venor®GeM Mycoplasma Detection Kit (Minerva Biolabs GmbH, Berlin, Germany) according to the manufacturer’s instructions and cultivated in a humidified 5% CO2 atmosphere at 37°C. Generation of transient and stable transfectants The recombinant expression constructs phNOT-1/ALG3–1-EGFP-N3 and pCREB3-EGFP-N3 were generated by cloning the corresponding full-length cDNA fragments via the restriction sites NheI and SmaI into the pEGFP-N3 vector (BD Clontech GmbH) equipped with the neomycin-resistance gene. As templates for the amplification of the sequences which encode the two full-length proteins of interest the IRALp962K1013Q plasmid carrying the hNOT-1/ALG3–1 sequence and the IRAUp969E0760D plasmid carrying the CREB3 sequence were used. Both vectors were purchased by the RZPD-German Resource Centre for Genome Research (Berlin, Germany, http:/www.rzpd.de/). The fragments of interest were amplified using cDNA specific primers equipped with the cloning sites NheI (5′) and SmaI (3′) (Supplementary Material, Table S1). The correctness of the open reading frame (ORF) of the generated recombinant vectors was proven by sequencing. The recombinant plasmid DNA was propagated in the Escherichiacoli DH5α cells and purified using the EndoFree® Plasmid Maxi Kit (Qiagen, Hilden, Germany). In order to generate the stable transfectants used in this study, T-NOT-1/ALG3–1 (T-NOT) and T-CREB3, 2 × 104 HEK 293 cells grown on 96-well plates were transfected with 0.2 and 0.3 μg DNA using the Effectene® Transfection Reagent (Qiagen) according to the manufacturer’s manual. The expression of the EGFP-reporter has been monitored for 24 and 48 h after the transfection using the inverted fluorescence microscope Olympus IX70 and the TILLvisION software (Photonics GmbH; http://tillvision.software.informer.com). To control the efficiency of the transfection with the recombinant vector the cells were transfected with the pure pEGFP-N3 vector. In order to generate a stable transfected clonal cell population, the neomycin-resistant transfectants were diluted in such a way that single cells were seeded into the 96-cell plate. Subsequently, the monoclonal cell cultures were submitted to the above-described selection process. Quantification of the RNA of the identified hNOT-1/ALG3–1 ligands by qRT-PCR The quantification of the identified hNOT/ALG3 ligands (cf. Results, Table 1 and Fig. 1) was performed by qRT-PCR as described previously (4,147). To exclude potential secondary structures and dimerization, the specific primer combinations used in this analysis (Supplementary Material, Table S1) were analysed prior to the synthesis using the computer program FastPCR Professional version 5.2.118 (fast-pcr.software.informer.com). With the synthesis of the primers, the Sigma-Aldrich Company (Taufkirchen, Germany) was entrusted. The specificity of all amplification products was confirmed by sequencing. The efficiency (E) of the PCR reactions was optimized for each target and examined in all cells investigated. The E values were calculated using the LinReg tool (124) (http://www.hartfaalcentrum.nl/index.php? main=files&fileName=LinRegPCR.zip&description=LinRegPCR:%20analysis%20of%20quantitative%20PCR%20data&sub=LinRegPCR). The relative expression levels, 2−ΔCt, of the transcripts investigated in the diverse cell lines presented in this study were normalized to HGPRT (2−ΔCt = 100%; ΔCt(X) = Ct(X) – Ct(R), X = target of interest, R: reference = HGPRT) and are shown as percentage change 2-ΔCt × 100%. The qRT-PCR analysis was performed using the ABI PRISM 7900HT Fast Real time PCR System (Applied Biosystems, Darmstadt, Germany). Data analysis was performed using the sodium dodecyl sulphate (SDS) 2.4 RT-PCR software provided with the system. Statistical evaluation was performed using the Student’s t-test. The reported RNA expression levels are mean values (n = 3) ± standard deviation (SD) calculated according to the formula: 1n∑χ−χ¯. Preparation of crude protein homogenates, subcellular fractions, IP and Western blotting Crude protein homogenates were made according to the previously described protocols (125). Subcellular fractions F1 (cytosolic proteins), F2 (membrane proteins), F3 (nuclear proteins) were isolated using the Qproteome® Cell Compartment Kit (Qiagen) according to the manufacturer’s protocols. In order to quantify the total amount of protein, the Bio-Rad Protein Assay (Bio-Rad Laboratories GmbH, Munich, Germany) was used. Aliquots consisting of 40 μg of total protein were separated under denatured conditions on SDS-polyacrylamide gel electrophoresis (SDS-PAGE) gels (10%). For IP pre-cleared protein lysates made from 107 cells were used. Pre-clearing and IP-reactions (IPs) were performed using the Immunoprecipitation Kit (Roche Diagnostics GmbH, Mannheim, Germany) as described previously (125). The final volume of the IPs was 60 μl. In order to pull down the complexes of interest using IP, 2–3 μg of the appropriate specific ab was used. All operations were performed at 4°C. For the investigation via immunoblot 15 μl of the IP of interest were separated on 10% SDS-PAGE. Antibodies and antigens In the Y2H assays the following polyclonal abs produced in rabbits and purchased by Sigma-Aldrich were used: α-GAL4-AD, generated against a peptide corresponding to aa 867–881 of the AD of the yeast GAL4 protein, and α-GAL4-BD, generated against a peptide corresponding to aa 39–52 of the BD of yeast GAL4. The ab concentration used for the detection via colony and western blot was 0.4 µg/ml for the α-GAL4-AD ab and 1 µg/ml for the α-GAL4-BD ab. To detect the native and EGFP fused hNOT-1/ALG3–1 molecule and its derivatives, the previously described polyclonal rabbit antisera α-NOT-1b, specific to its N-terminal aa 1–14, and α-NOT-1/4, against aa 320–333, were used (4). Both abs were applied in a dilution 1 µg/ml in phosphate-buffered saline buffer containing 0.2% I-Block (Life Technologies GmbH, Darmstadt, Germany) and 0.1% Tween (Carl Roth GmbH & Co., Karlsruhe, Germany). Further rabbit polyclonal abs used in this study are α-CREB3 (Abnova, Heidelberg, Germany; Cat. No. H00010488-D01P) against the recombinant full-length GST-tagged human CREB3 protein, α-OSBP (Proteintech, Manchester, UK; Cat. No. 11096–1-AP) against the C-terminal 300 aa of the protein, α-OSBPL9 (Antibodies-Online, Aachen, Germany; Cat. No. ABIN1013879) against a central region of the molecule encompassing the C-terminal portion of the PSD and the N-terminal portion of the SBP, α-LRP1 (Abcam, Berlin, Germany; Cat. No. ab92544) against a peptide derived from the 85 β-subunit, α-SYPL1 (Sigma-Aldrich; Cat. No. SAB3500080) against a 16 aa polypeptide derived from the N-terminus of the protein, α-VAPA (Abnova; H00009218-D01) against the full-length human I1 of VAPA and α-Actin against an N-terminally located epitope (Sigma-Aldrich; Cat.No. A5060). Primary mouse monoclonal abs used in this study are α-GFP (Roche Diagnostics, Mannheim, Germany; Cat. No. 11814460001), directed against the 27 kDa EGFP protein, and α-TBP (Abcam, Cambridge, UK) directed against aa 1–100 of the human TATA binding protein (TBP). For immunodetection by western blot the primary antibodies were used in a dilution 2 μg/ml in TBS blocking buffer (0.05 M Tris/0.15 M NaCl, pH 7.5) containing 3% BSA (Sigma). Proteins were visualized using appropriate secondary alkaline phosphatase (AP) conjugated α-mouse IgG and α-rabbit IgG produced in goat, horseradish peroxidase (HRP) conjugated α-rabbit IgG produced in goat and α-mouse IgG-HRP produced in rabbit. The antibodies were purchased by Sigma-Aldrich (Deisenhofen, Germany) and used in a 1:5000 dilution. Genbank references of the relevant gene sequences The GenBank accession numbers (Acc.Nrs.) of the identified molecular partners of the hNOT/ALG3 proteins (cf. Results and Table 1) and the further sequences analysed within the scope of this study are available at the National Center for Biotechnology Information (NCBI, gb-admin@ncbi.nlm.hih.gov). The full-length cDNA encoding the hNOT-1/ALG3–1 protein used to generate the recombinant vectors pAS2–1-NOT-11–438, ACT2-NOT-11–438 and hNOT-1/ALG3–1-pEGFP was derived from the IRAUp969D0822D clone (Acc. Nr. BC002839; RZPD-German Science Centre for Genome Research, Berlin, Germany, http:/www.rzpd.de/). The full-length cDNA encoding human CREB3 was derived from the IRAUp969E0760D clone (Acc. Nr. BC009402; RZPD-German Resource Centre for Genome Research, Berlin, Germany, http:/www.rzpd.de/). The sequences of the twelve OSBPL9 transcript variants are deposited at the NCBI data base under the following Acc. Nrs.: NM_148904 (ICRA_a/Ia), EAX06811 (ICRA_b), EAX06812 (ICRA_c), EAX06813/NM_148906 (ICRA_d/Ib), EAX06814 (ICRA_e), EAX06815 (ICRA_f), EAX06816/NM_148907 (ICRA_g/Ic), EAX06818 (ICRA_h), EAX06819 (ICRA_i), NM_148908 (Id), NM_024586 (Ie) and NM_148909 (If). Computational DNA and protein analysis The sequences were analysed using the Basic Local Alignment Search Tool (BLAST, http://blast.ncbi.nlm.nih.gov/Blast.cgi) available at the National Center for Biotechnology Information (NCBI, gb-admin@ncbi.nlm.hih.gov) and the following programmes: FastPCR (PrimerDigital Ltd, Helsinki, Finland), FinchTV version 1.4.0 (Geospiza, Inc., Seattle, USA, www.geospiza.com/ftvdlinfo.html) and Jellyfish Version v1.5_56891 (Biowire.com, Mountain View, USA, biowire-jellyfish.software.informer.com). In order to define the glycosylation status of the 17 potential binding partners of the hNOT/ALG3 proteins isolated in the Y2H screen, the Unipep (http://www.unipep.org) ISB N-glycosylation peptide prediction server and the data bases Eukaryotic Linear Motif (ELM, http://elm.eu.org/) and Universal Protein Resource (UniProt, http://www.uniprot.org/) were used. The prediction of the functional sites/motifs relevant in the context of the protein–protein binding was performed using the databases ELM (http://elm.eu.org/) and UniProt (http://www.uniprot.org/). The putative molecular weight of the proteins encoded by the identified ligands and the further molecules analysed within this study was predicted using the Compute pI/Mw program (http://web.expasy.org/compute_pi/). The positions of the putative phosphorylation sites of LRP1 are available at UniProt under the Acc. Nr. Q07954-LRP1_HUMAN. The above web sites were last accessed on 15 February 2018. Supplementary Material Supplementary Material is available at HMG online. Conflict of Interest statement. None declared. Funding Internal research funding programs of the Johannes Gutenberg University to UK-D. BH and ChS were partially supported by scholarships for graduate students funded by the Rhineland Palatinate Foundation. References 1 Kurzik-Dumke U. , Gundacker D. , Rentrop M. , Gateff E. ( 1995 ) Tumor suppression in Drosophila is causally related to the function of the lethal(2)tumorous imaginal discs gene, a dnaJ homolog . Dev. Genetics , 16 , 64 – 76 . Google Scholar CrossRef Search ADS 2 Kurzik-Dumke U. , Kaymer M. , Gundacker D. , Debes A. , Labitzke K. ( 1997 ) Gene within a gene configuration and expression of the Drosophila melanogaster genes lethal(2)neighbour of tid [l(2)not] and lethal(2)relative of tid [l(2)rot] . Gene , 200 , 45 – 58 . Google Scholar CrossRef Search ADS PubMed 3 Kaymer M. , Debes A. , Kress H. , Kurzik-Dumke U. ( 1997 ) Sequence, molecular organization and products of the Drosophila virilis homologs of the D. melanogaster nested genes lethal(2) tumorous imaginal discs [l(2)tid] and lethal(2)neighbour of tid [l(2)not] . Gene , 204 , 91 – 103 . Google Scholar CrossRef Search ADS PubMed 4 Kurzik-Dumke U. , Schultheiß C.H. , Hacker B. , Kaymer M. ( 2017 ) HNOT/ALG3, the human counterpart of the Drosophila NOT and yeast ALG3 gene, is involved in distinct molecular contexts relevant for congenital disorders of glycosylation, cancer and further pathologies . HMG , in press. 5 Aebi M. , Gassenhuber J. , Domdey H. , Heesen S. t. ( 1996 ) Cloning and characterization of theALG3 gene of Saccharomyces cerevisiae . Glycobiology , 6 , 439 – 444 . Google Scholar CrossRef Search ADS PubMed 6 Jones M. , Hedge M. ( 2013 ) Molecular Diagnostics of Congenital Disorders of Glycosylation. In: Wong L.-J. (ed.), Next Generation Sequencing: Translation to Clinical Diagnostics . Springer , New York, NY , pp. 151 – 166 . Google Scholar CrossRef Search ADS 7 Denecke J. , Kranz C.H. , Kemming D. , Koch H.-G. , Marquardt T. ( 2004 ) An activated 5´cryptic splice site in the human ALG3 gene generates a premature termination codon insensitive to nonsense-mediated mRNA decay in a new case of congenital disorder of glycosylation type ID (CDG-Id) . Hum. Mutat ., 23 , 477 – 486 . Google Scholar CrossRef Search ADS PubMed 8 Stibler H. , Stephani U. , Kutsch U. ( 1995 ) Carbohydrate-deficient glycoprotein syndrome: a fourth subtype . Neuropediatrics , 26 , 235 – 237 . Google Scholar CrossRef Search ADS PubMed 9 Denecke J. , Kranz C.H. , von Kleist-Retzow J.C.H. , Bosse K. , Herkenrath P. , Debus O. , Harms E. , Marquardt T. ( 2005 ) Congenital disorder of glycosylation type Id: clinical phenotype, molecular analysis, prenatal diagnosis, and glycosylation of fetal proteins . Pediatric Res , 58 , 248 – 253 . Google Scholar CrossRef Search ADS 10 Schollen E. , Grünewald S. , Keldermans L. , Albrecht B. , Körner C. , Matthijs G. ( 2005 ) CDG-Id caused by homozygosity for an ALG3 mutation due to segmental maternal isodisomy UPD3(q21.3-qter) . Eur. J. Med. Genet ., 48 , 153 – 158 . Google Scholar CrossRef Search ADS PubMed 11 Sun L. , Eklund E.A. , Chung W.K. , Wang C. , Cohen J. , Freeze H.H. ( 2005 ) Congenital disorder of glycosylation Id presenting with hyperinsulinemic hypoglycemia and islet cell hyperplasia . J. Clin. Endocr. Metab ., 90 , 4371 – 4375 . Google Scholar CrossRef Search ADS 12 Kranz C. , Sun L. , Eklund E.A. , Krasnewich D. , Casey J.R. , Freeze H.H. ( 2007 ) CDG-Id in two siblings with partially different phenotypes . Am. J. Med. Genet ., 143A , 1414 – 1420 . Google Scholar CrossRef Search ADS 13 Rimella-Le-Huu A. , Henry H. , Kern I. , Hanquinet S. , Roulet-Perez E. , Newman C.J. , Suerti-Furga A. , Bonafe L. , Ballhausen D. ( 2008 ) Congenital disorder of glycosylation type Id (CDG Id): phenotypic, biochemical and molecular characterization of a new patient . J. Inherit. Metab. Dis ., 31 , 381 – 386 . Google Scholar CrossRef Search ADS 14 Riess S. , Reddihough D.S. , Howell K.B. , Dagia C. , Jaeken J. , Matthijs G. , Yaplito-Lee J. ( 2013 ) ALG3-CDG (CDG-Id) clinical, biochemical and molecular findings in two siblings . Mol. Genet. Metab ., 110 , 170 – 175 . Google Scholar CrossRef Search ADS PubMed 15 Lepais L. , Cheillan D. , Frachon S.C. , Hays S. , Matthijs G. , Panagiotakaki E. , Abel C. , Edery P. , Rossi M. ( 2015 ) ALG3-CDG: report of two syblings with antenatal features carrying homozygous p.Gly96Arg mutation . Am. J. Med. Genet ., 167 , 2748 – 2754 . Google Scholar CrossRef Search ADS 16 Choi Y.-W. , Bae S.M. , Kim Y.-W. , Lee H.N. , Kim Y.W. , Park T.C. , Ro D.Y. , Shin J.C. , Shin S.J. , Seo J.-S. , Ahn W.S. ( 2007 ) Gene expression profiles in squamous cell cervical carcinoma using array-based comparative genomic hybridization analysis . Int. J. Gynecol. Cancer , 17 , 687 – 696 . Google Scholar CrossRef Search ADS PubMed 17 Sanchez-Palencia A. , Gomez-Morales M. , Gomez-Capilla J.A. , Pedraza V. , Boyero L. , Roseli R. , Fárez-Vidal M.E. ( 2010 ) Gene expression profiling reveals novel biomarkers in non small cell lung cancer . Int. J. Cancer , 129 , 355 – 364 . Google Scholar CrossRef Search ADS PubMed 18 Shi Z.-Z. , Jiang Y.-Y. , Hao J.-J. , Zhang Y. , Zhang T.-T. , Shang L. , Liu S.-G. , Shi F. , Wang M.-R. ( 2014 ) Identification of putative target genes for simplification within 11q13.2 and 3q27.1 in oesophageal squamous cell carcinoma . Clin. Transl. Oncol ., 16 , 606 – 615 . Google Scholar CrossRef Search ADS PubMed 19 Inlow J.K. , Restifo L.L. ( 2004 ) Molecular and comparative genetics of mental retardation . Genetics , 166 , 835 – 881 . Google Scholar CrossRef Search ADS PubMed 20 Brückner A. , Polge C. , Lentze N. , Auerbach D. , Schlattner U. ( 2009 ) Yeast Two-Hybrid, a powerful tool for systems biology . Int. J. Mol. Sci ., 10 , 2763 – 2788 . Google Scholar CrossRef Search ADS PubMed 21 Brooks C.C. , Scherer P.E. , Cleveland K. , Whittemore J.L. , Lodish H.F. , Cheatham B. ( 2000 ) Pantophysin is a phosphoprotein component of adipocyte transport vesicles and associates with GLUT4-containing vesicles . J. Biol. Chem ., 275 , 2029 – 2036 . Google Scholar CrossRef Search ADS PubMed 22 Henriksson R. , Kuzmin A. , Ökvist A. , Harper C. , Sheedy D. , Garrick T. , Yakovleva T. , Bakalkin G. ( 2008 ) Elevated synaptophysin I in the prefrontal cortex of human chronic alcoholics . Synapse , 62 , 829 – 833 . Google Scholar CrossRef Search ADS PubMed 23 Lillis A.P. , Van Duyn L.B. , Murphy-Ullrich J.A. , Strickland D.J. ( 2008 ) The low density lipoprotein receptor-related protein 1: unique tissue-specific functions revealed by selective gene knockout studies . Physiol. Rev ., 88 , 887 – 918 . Google Scholar CrossRef Search ADS PubMed 24 Parkyn C.J. , Vermeulen E.G. , Mootoosamy R.C. , Sunyach C. , Jacobsen C. , Oxvig C. , Moestrup S. , Liu Q. , Bu G. , Jen A. , Morris R.J. ( 2008 ) LRP1 controls biosynthetic and endocytic trafficking of neuronal prion protein . J. Cell Sci ., 121 , 773 – 783 . Google Scholar CrossRef Search ADS PubMed 25 Weir L.M. , Xie H. , Klip A. , Trimble S. ( 2001 ) VAP-A binds promiscuously to both v- and t-SNAREs . Biochim. Biophys. Res. Comm ., 286 , 616 – 621 . Google Scholar CrossRef Search ADS 26 Tanaka K. , Arao T. , Maegawa M. , Matsumoto K. , Kaneda H. , Kudo K. , Fujita Y. , Yokote H. , Yanagihara K. , Yamada Y. ( 2009 ) SRPX2 is overexpressed in gastric cancer and promotes cellular migration and adhesion . Int. J. Cancer , 124 , 1072 – 2080 . Google Scholar CrossRef Search ADS PubMed 27 Maestre-Martínez M. , Haupt K. , Edlich F. , Jahreis G. , Jarczowski F. , Erdmann F. , Fischer G. , Lück C. ( 2010 ) New structural aspects of FKPB38 activation . Biol. Chem ., 391 , 1157 – 1167 . Google Scholar CrossRef Search ADS PubMed 28 Choi B.-H. , Feng L. , Yoon H.S. ( 2010 ) FKBP38 protects Bcl-2 from caspase-dependent degradation . J. Biol. Chem ., 285 , 9770 – 9779 . Google Scholar CrossRef Search ADS PubMed 29 Prakash B. , Praefcke G.J.K. , Renault L. , Wittinghofer A. , Herrmann C. ( 2000 ) Structure of human guanylate binding protein 1 representing a unique class of GTP-binding proteins . Nature , 403 , 567 – 571 . Google Scholar CrossRef Search ADS PubMed 30 Vestal D.J. , Jeyaratnam J.A. ( 2011 ) The guanylate-binding proteins: emerging insights into the biochemical properties and functions of this family of large interferon-induced guanosine triphosphates . J. Interferon Cytokine Res ., 31 , 89 – 97 . Google Scholar CrossRef Search ADS PubMed 31 Muñoz-Sánchez J. , Chánez-Cárdenas M.E. ( 2014 ) A review on hemeoxygenase-2: focus on cellular protection and oxygen response . Oxid. Med. Cell. Longev ., 2014 , 81 – 96 . http://dx.doi.org/10.1155/2014/60491). Google Scholar CrossRef Search ADS 32 Van de Velde C. , Cizeau J. , Dubik D. , Alimonti J. , Brown T. , Israels S. , Hakem R. , Greenberg A.H. ( 2000 ) BNIP3 and genetic control of necrosis-like cell death through the mitochondrial permeability transition pore . Mol. Cell. Biol ., 20 , 5454 – 5468 . Google Scholar CrossRef Search ADS PubMed 33 Daido S. , Kanzawa T. , Yamamoto A. , Takeuchi H. , Kondo Y. , Kondo S. ( 2004 ) Pivotal role of the cell death factor BNIP3 in ceramide-induced autophagic cell death in malignant glioma cells . Cancer Res ., 64 , 4286 – 4293 . Google Scholar CrossRef Search ADS PubMed 34 Kothari S. , Cizeau J. , McMillan-Ward E. , Israels S.J. , Bailes M. , Ens K. , Kirshenbaum L.A. , Gibson S.B. ( 2003 ) BNIP3 plays a role in hypoxic cell death in human epithelial cells that is inhibited by growth factors EGF and IGF . Oncogene , 22 , 4734 – 4744 . Google Scholar CrossRef Search ADS PubMed 35 Kawano M. , Kumagai K. , Nishijima M. , Hanada K. ( 2006 ) Efficient trafficking of ceramide from the endoplasmic reticulum to the Golgi apparatus requires a VAMP-associated protein-interacting FFAT and CERT . J. Biol. Chem ., 281 , 30279 – 30288 . Google Scholar CrossRef Search ADS PubMed 36 Ngo M. , Ridgway N.D. ( 2009 ) Oxysterol binding protein-related protein 9 (ORP9) is a cholesterol transfer protein that regulates Golgi structure and function . Mol. Biol. Cell , 20 , 1388 – 1399 . Google Scholar CrossRef Search ADS PubMed 37 Beswick E. , Reyes W.E. ( 2009 ) CD74 in antigen presentation, inflammation, and cancers of the gastrointestinal tract . World J. Gastroenterol ., 15 , 2855 – 2861 . Google Scholar CrossRef Search ADS PubMed 38 Stein R. , Mattes M.J. , Cardillo T.M. , Hansen H.J. , Chang C.-H. , Burton J. , Govindan S. , Goldenberg D.M. ( 2007 ) CD74: a new candidate target for the immunotherapy of B-cell neoplasms . Clin. Cancer Res ., 13 , 5556 – 5563 . Google Scholar CrossRef Search ADS 39 Van der Loop F.T.L. , Schaart G. , Timmer E.D.J. , Ramaekers F.C.S. , van Eys G.J.J.M. ( 1996 ) Smoothelin, a novel cytoskeletal protein specific for smooth muscle cells . J. Cell Biol ., 134 , 401 – 411 . Google Scholar CrossRef Search ADS PubMed 40 Bhattacharyya D. , Glick B.S. ( 2007 ) Two mammalian Sec16 homologues have non redundant functions in endoplasmic reticulum (ER) export and transitional ER organization . Mol. Biol. Cell , 18 , 839 – 849 . Google Scholar CrossRef Search ADS PubMed 41 Budnik A. , Heesom K.J. , Stephens D.J. ( 2011 ) Characterization of human Sec 16B: indications of specialized non-redundant functions . Sci. Rep ., 1 , 77 – 86 . Google Scholar CrossRef Search ADS PubMed 42 Yao L. , Zhang J. , Liu X. ( 2008 ) NDRG2: a Myc-repressed gene involved in cancer and cell stress . Acta Biochim. Biophys. Sin. (Shanghai) , 40 , 625 – 635 . Google Scholar CrossRef Search ADS PubMed 43 Schönichen A. , Geyer M. ( 2010 ) Fifteen formins for an actin filament: a molecular view on the regulation of human formins . Biochim. Biophys. Acta , 1803 , 152 – 163 . Google Scholar CrossRef Search ADS PubMed 44 Sun H. , Schlondorff J. , Higgs H.N. , Pollak M.R. ( 2013 ) Inverted Formin 2 regulates actin dynamics by antagonizing Rho/Diaphanous-related formin signaling . J. Am. Soc. Nephrol ., 24 , 917 – 929 . Google Scholar CrossRef Search ADS PubMed 45 Barrientos A. , Barros M.H. , Valnot I. , Rötig A. , Rustin P. , Tzagoloff A. ( 2002 ) Cytochrome oxidase in health and disease . Gene , 286 , 53 – 63 . Google Scholar CrossRef Search ADS PubMed 46 Choi B.-O. , Hwang J.H. , Kim J. , Cho E.M. , Cho S.Y. , Hwang S.J. , Lee H.W. , Kim S.J. , Chung K.W. ( 2008 ) A MELAS syndrome family harbouring two mutations in mitochondrial genome . Exp. Mol. Med ., 40 , 354 – 360 . Google Scholar CrossRef Search ADS PubMed 47 Chan Ch, P. , Kok K.-H. , Jin D.-Y. ( 2011 ) CREB3 subfamily transcription factors are not created equal: recent insights from global analyses and animal models . Cell Biosci ., 1 , 6 – 12 . Google Scholar CrossRef Search ADS PubMed 48 Mollinedo F. , Calafat J. , Janssen H. , Martín-Martín B. , Canchado J. , Nabokina S.M. , Gajate C. ( 2008 ) Combinatorial SNARE complexes modulate the secretion of cytoplasmic granules in human neutrophils . J. Immunol ., 177 , 2831 – 2841 . Google Scholar CrossRef Search ADS 49 Becher A. , Drenchhahn A. , Pahner I. , Margittai M. , Jahn R. , Ahnert-Hilger G. ( 1999 ) The synaptophysin-synaptobrevin complex: a hallmark of synaptic vesicle maturation . J. Neurosci ., 19 , 1922 – 1931 . Google Scholar CrossRef Search ADS PubMed 50 Foster L.J. , Weir M.L. , Lim D.Y. , Liu Z. , Trimble W.S. , Klip A. ( 2000 ) A functional role for VAP-33 in insulin-stimulated GLUT4 traffic . Traffic , 1 , 512 – 521 . Google Scholar CrossRef Search ADS PubMed 51 Perry R.J. , Ridgway N.D. ( 2006 ) Oxysterol-binding protein and vesicle-associated membrane protein-associated protein are required for sterol-dependent activation of the ceramide transport protein . Mol. Biol. Cell , 17 , 2604 – 2616 . Google Scholar CrossRef Search ADS PubMed 52 Wyles J.P. , Ridgway N.D. ( 2004 ) VAMP-associated protein-A regulates partitioning of oxysterol-binding protein-related protein-9 between the endoplasmic reticulum and Golgi apparatus . Exp. Cell Res ., 297 , 533 – 547 . Google Scholar CrossRef Search ADS PubMed 53 Gao L. , Aizaki H. , He J.-W. , Lai M.M.C. ( 2004 ) Interactions between viral non-structural proteins and host protein hVAP-33 mediate the formation of hepatitis C virus RNA replication complex on lipid raft . J. Virol ., 78 , 3480 – 3488 . Google Scholar CrossRef Search ADS PubMed 54 Saita S. , Shirane M. , Natume T. , Iemura S.-I. , Nakayama K.I. ( 2009 ) Promotion of neurite extension by protrudin requires its interaction with vesicle-associated membrane protein-associated protein . J. Biol. Chem ., 284 , 13766 – 13777 . Google Scholar CrossRef Search ADS PubMed 55 Sengupta S. , Miller K.K. , Homma K. , Edge R. , Cheatham M.A. , Dallos P. , Zheng J. ( 2010 ) Interaction between the motor protein prestin and the transporter protein VAPA . Biochim. Biophys. Acta , 1803 , 796 – 804 . Google Scholar CrossRef Search ADS PubMed 56 Fukuda M. ( 2002 ) Vesicle-associated membrane protein-2/synaptobrevin binding to synaptotagmin 1 promotes O-glycosylation of synaptotagmin I . J. Biol. Chem ., 277 , 30351 – 30358 . Google Scholar CrossRef Search ADS PubMed 57 Miljkovic-Licina M. , Hammel P. , Garrido-Urbani S. , Bradfield P. , Szepetowski P. , Imhof B.A. ( 2009 ) Sushi repeat protein X-linked 2, a novel mediator of angiogenesis . FASEB J ., 23 , 415 – 416 . Google Scholar CrossRef Search ADS PubMed 58 Liu K.L. , Wu J. , Zhou Y. , Fan J.H. ( 2015 ) Increased sushi-repeat-containing protein X-linked 2 is associated with progression of colorectal cancer . Mol. Oncol ., 32 , 99 – 107 . 59 Inoue H. , Pan J. , Hakura A. ( 1998 ) Suppression of v-src transformation by the drs gene . J. Virol ., 72 , 2532 – 2537 . Google Scholar PubMed 60 Meindl A. , Carvalho M.R.S. , Herrmann K. , Lorenz B. , Achatz H. , Lorenz B. , Apfelstedt-Sylla E. , Wittwer B. , Ross M. , Meitinger T. ( 1995 ) A gene (SRPX) encoding a sushi-repeat-containing protein is deleted in patients with X-linked retinitis pigmentosa . Hum. Mol. Genet ., 4 , 2339 – 2346 . Google Scholar CrossRef Search ADS PubMed 61 Roll P. , Rudolf G. , Pereira S.A. , Royer B. , Scheffer I.E. , Massacrier A. , Valenti M.-P. , Roeckel-Trevisiol N. , Jamali S. , Beclin C.H. ( 2006 ) SRPX2 mutations in disorders of language cortex and cognition . Hum. Mol. Genet ., 15 , 1195 – 1207 . Google Scholar CrossRef Search ADS PubMed 62 Walker V.E. , Atanasiu R. , Lam H. , Shrier A. ( 2007 ) Co-chaperone FKBP38 promotes HERG trafficking . J. Biol. Chem ., 282 , 23509 – 23516 . Google Scholar CrossRef Search ADS PubMed 63 Nakagawa T. , Shirane M. , Iemura S.-I. , Natsume T. , Nakayama K.I. ( 2007 ) Anchoring of the 26S proteasome to the organellar membrane by FKBP38 . Genes Cells , 12 , 709 – 719 . Google Scholar PubMed 64 Rosner M. , Hofer K. , Kubista M. , Hengstschläger M. ( 2003 ) Cell size regulation by the human TSC tumor suppressor proteins depends on PI3K and FKBP38 . Oncogene , 22 , 4786 – 4798 . Google Scholar CrossRef Search ADS PubMed 65 Cho A. , Ko H.W. , Eggenschwiller J.T. ( 2006 ) FKBP8 cell-autonomously controls neural tube patterning through a Gli2- and Kif3a-dependent mechanism . Dev. Biol ., 321 , 27 - 39 . Google Scholar CrossRef Search ADS 66 Okamoto T. , Nishimura Y. , Ichimura T. , Suzuki K. , Miyamura T. , Suzuki T. , Moriishi K. , Matsuura Y. ( 2006 ) Hepatitis C virus RNA replication is regulated by FKBP8 and Hsp90 . EMBO J ., 25 , 5015 - 5025 . Google Scholar CrossRef Search ADS PubMed 67 Britzen-Laurent N. , Lipnik K. , Ocker M. , Naschberger E. , Schellerer V.S. , Croner R.S. , Vieth M. , Waldner M. , Steinberg P. , Hohenadl C. , Stürzl M. ( 2013 ) GBP-1 acts as a tumor suppressor in colorectal cancer . Carcinogenesis , 34 , 153 – 162 . Google Scholar CrossRef Search ADS PubMed 68 Guenzi E. , Töpolt K. , Lubeseder-Martellato J.A. , Naschberger E. , Benelli R. , Albini A. , Stürzl M. ( 2003 ) The guanylate binding protein-1 GTPase controls the invasive and angiogenic capability of endothelial cells through inhibition of MMP-1 expression . EMBO J ., 22 , 3772 – 3782 . Google Scholar CrossRef Search ADS PubMed 69 Chinnadurai G. , Vijayalingam S. , Gibson S.B. ( 2009 ) BNIP3 subfamily BH3-only proteins: mitochondrial stress sensors in normal and pathological functions . Oncogene , 27 , S114 – S127 . Google Scholar CrossRef Search ADS 70 Olkkonen V.M. , Béaslas O. , Nissilä E. ( 2012 ) Oxysterols and their cellular effectors . Biomelecules , 2 , 76 – 103 . Google Scholar CrossRef Search ADS 71 Amako Y. , Sarkeshik A. , Hotta H. , Yates J. I.I.I. , Siddiqui A. ( 2009 ) Role of oxysterol binding protein in hepatitis c virus infection . J. Virol ., 83 , 9237 – 9246 . Google Scholar CrossRef Search ADS PubMed 72 Burgett A.W.G. , Poulsen T.B. , Wangkanont K. , Anderson D.R. , Kikuchi C. , Shimada K. , Okubo S. , Fortner K.C. , Mimaki Y. , Kuroda M. ( 2011 ) Natural products reveal cancer cell dependence on oxysterol-binding proteins . Nat. Chem. Biol ., 7 , 639 – 647 . Google Scholar CrossRef Search ADS PubMed 73 Lessmann E. , Ngo M. , Leitges M. , Minguet S. , Ridgway N.D. , Huber M. ( 2006 ) Oxysterol-binding protein-related protein (ORP) 9 is a PDK-2 substrate and regulates Akt phosphorylation . Cell. Signal ., 19 , 384 – 392 . Google Scholar CrossRef Search ADS PubMed 74 Liu Y.-H. , Lin J.-Y. ( 2014 ) Recent advances of cluster of differentiation 74 in cancer . World J. Immunol ., 4 , 174 – 184 . Google Scholar CrossRef Search ADS 75 Zheng Y.X. , Yang M. , Rong T.T. , Yuan X.L. , Ma Y.H. , Wang Z.H. , Shen L.S. , Cui L. ( 2012 ) CD74 and macrophage migration inhibitory factor as therapeutic targets in gastric cancer . World J. Gastroenterol ., 14 , 2253 – 2261 . Google Scholar CrossRef Search ADS 76 Burton J.D. , Ely S. , Reddy P.K. , Stein R. , Gold D.V. , Cardillo T.M. , Goldenberg D.M. ( 2004 ) CD74 is expressed by multiple myeloma and is a promising target for therapy . Clin. Cancer Res ., 10 , 6606 – 6611 . Google Scholar CrossRef Search ADS PubMed 77 Jiang J. , Nakayama T. , Shimodaira M. , Sato N. , Aoi N. , Sato M. , Izumi Y. , Kasamaki Y. , Ohta M. , Soma M. ( 2014 ) Association of the smoothelin (SMTN) gene with cerebral infarction in men: a haplotype-based case-control study . Vasc. Med ., 17 , 317 – 325 . Google Scholar CrossRef Search ADS 78 Roberts J.A. , Waters L. , Ro J.Y. , Zhai Q.J. ( 2014 ) Smoothelin and caldesmon are reliable markers for distinguishing muscularis propria from desmoplasia: a critical distinction for accurate staging colorectal adenocarcinoma . Int. J. Clin. Exp. Pathol ., 7 , 792 – 796 . Google Scholar PubMed 79 Forni D. , Pozzoli U. , Cagliani R. , Tresoldi C. , Menozzi G. , Riva S. , Guerini F.R. , Comi G.P. , Bolognesi E. , Bresolin N. ( 2014 ) Genetic adaptation of the human circadian clock to day-length latitudinal variations and relevance for affective disorders . Genome Biol ., 15 , 499 – 515 . Google Scholar CrossRef Search ADS PubMed 80 Hotta K. , Nakamura M. , Nakamura T. , Matsuo T. , Nakata Y. , Kamohara S. , Miyatake N. , Kotani K. , Komatsu R. , Itoh N. ( 2009 ) Association between obesity and polymorphisms in SEC16B, TMEM18, GNPDA2, BDNF, FAIM2 and MC4R in a Japanese population . J. Hum. Genet ., 54 , 727 – 731 . Google Scholar CrossRef Search ADS PubMed 81 Burchfield J.G. , Lennard A.J. , Narasimhan S. , Hughes W.E. , Wasinger V.C. , Corthals G.L. , Okuda T. , Kondoh H. , Biden T.J. , Schmitz-Peiffer C. ( 2004 ) Akt mediates insulin-stimulated phosphorylation of Ndrg2: evidence for cross-talk with protein kinase C theta . J. Biol. Chem ., 279 , 18623 – 18632 . Google Scholar CrossRef Search ADS PubMed 82 Shen L. , Yao L. , Zhang J. ( 2015 ) NDRG2: on the path to cell stress and cancer . Austin J. Cancer Clin. Res ., 2 , 1024 – 1027 . 83 Choi S.-C. , Kim K.D. , Kim J.-T. , Kim J.W. , Lee H.G. , Kim J.-M. , Jang Y.-S. , Yoon D.-Y. , Kim K.I. , Yang Y. , Cho D.H. , Lim J.-S. ( 2008 ) Expression of human NDRG2 by myeloid dendritic cells inhibits down-regulation of activated leukocyte cell adhesion molecule (ALCAM) and contributes to maintenance of T cell stimulatory activity . J. Leukoc. Biol ., 83 , 89 – 98 . Google Scholar CrossRef Search ADS PubMed 84 Mitchelmore C. , Büchmann-Møller S. , Rask L. , West M.J. , Troncoso J.C. , Jensen N.A. ( 2004 ) NDRG2: a novel Alzheimer’s disease associated protein . Neurobiol. Dis ., 16 , 48 – 58 . Google Scholar CrossRef Search ADS PubMed 85 Mademan I. , Deconinck T. , Dinopoulos A. , Voit T. , Schara U. , Devriendt K. , Meijers B. , Lerut E. , De Jonghe P. , Baets J. ( 2013 ) De novo INF2 mutations expand the genetic spectrum of hereditary neuropathy with glomerulopathy . Neurology , 81 , 1953 – 1958 . Google Scholar CrossRef Search ADS PubMed 86 Fogo A.B. ( 2015 ) Causes and pathogenesis of focal segmental glomerulosclerosis . Nat. Rev. Nephrol ., 11 , 76 – 87 . Google Scholar CrossRef Search ADS PubMed 87 Roos A. , Weis J. , Korinthenberg R. , Fehrenbach H. , Häusler M. , Züchner S. , Mache C. , Hubmann H. , Auer-Grumbach M. , Senderek J. ( 2015 ) Inverted formin-2-related Charcot-Marie-Tooth disease: extension of the mutational spectrum and pathological findings in Schwann cells and axons . J. Peripehr. Nerv. Syst ., 20 , 52 – 59 . Google Scholar CrossRef Search ADS 88 Diaz F. Cyytochrome c oxidase deficiency: patients and animal models . Biochim. Biophys. Acta , 1802 , 100 – 111 . CrossRef Search ADS PubMed 89 Fox R.M. , Hanlan C.D. , Andrew D.J. ( 2010 ) The CrebA/Creb3-like transcription factors are major and direct regulators of secretory capacity . J. Cell Biol ., 191 , 479 – 492 . Google Scholar CrossRef Search ADS PubMed 90 Den Boer L.M. , Hardy-Smith P.W. , Hogan M.R. , Cockram G.P. , Audas T.E. , Lu R. ( 2005 ) Luman is capable of binding and activating transcription from the unfolded protein response element . Biochim. Biophys. Res. Commun ., 331 , 113 – 119 . Google Scholar CrossRef Search ADS 91 Blot G. , Lopez-Vergès S. , Treand C. , Kubat N.J. , Delcroix-Genête D. , Emiliani S. , Benarous R. , Berlioz-Torrent C. ( 2006 ) Luman, a new partner of HIV-1 TMgp41, interferes with Tat-mediated transcription of the HIV-1 LTR . J. Mol. Biol ., 364 , 1034 – 1047 . Google Scholar CrossRef Search ADS PubMed 92 Jang S.-W. , Kim Y.K. , Lee Y.H. , Ko J. ( 2006 ) Role of human LZIP in differential activation of The NF-κB pathway that is induced by CCR1-dependent chemokines . J. Cell Physiol ., 211 , 630 – 637 . Google Scholar CrossRef Search ADS 93 Kang H. , Kim Y.S. , Ko J. ( 2009 ) A novel isoform of human LZIP negatively regulates the transactivation of the glucocorticoid receptor . Mol. Endocrinol ., 23 , 1746 – 1757 . Google Scholar CrossRef Search ADS PubMed 94 Neumann J. , Schach N. , Koch N. ( 2001 ) Glycosylation signals that separate the trimerization from the MHC class II–binding domain control intracellular degradation of invariant chain . J. Biol. Chem ., 276 , 13469 – 13475 . Google Scholar CrossRef Search ADS PubMed 95 May P. , Bock H.H. , Nimpf J. , Herz J. ( 2003 ) Differential glycosylation regulates processing of lipoprotein receptors by γ-secretase . J. Biol. Chem ., 278 , 37386 – 37392 . Google Scholar CrossRef Search ADS PubMed 96 Chan Ch, P. , Mak T.-Y. , Chin K.-T. , Ng I.Q.-L. , Jin D.-Y. ( 2010 ) N-linked glycosylation is required for optimal proteolytic activation of membrane-bound transcription factor CREB-H . J. Cell Sci ., 123 , 1438 – 1448 . Google Scholar CrossRef Search ADS PubMed 97 Obata T. , Yaffe M.B. , Lepare G.G. , Piro E.T. , Maegawa H. , Kashiwagi A. , Kikkawa R. , Cantley L.C. ( 2000 ) Peptide and protein library screening defines optimal substrate motifs for AKT/PKB . J. Biol. Chem ., 275 , 36008 – 36115 . Google Scholar CrossRef Search ADS 98 Hiom K. ( 2005 ) DNA repair: how to PIKK a partner . Curr. Biol ., 15 , 473 – 475 . Google Scholar CrossRef Search ADS 99 Litovchick L. , Chestukhin A. , DeCaprio J.A. ( 2004 ) Glycogen synthase kinase 3 phosphorylates RBL2/p130 during quiescence . Mol. Cell. Biol ., 24 , 8970 – 8980 . Google Scholar CrossRef Search ADS PubMed 100 Neuberger G. , Schneider G. , Eisenhaber F. ( 2007 ) PkaPS: prediction of protein kinase A phosphorylation sites with the simplified kinase-substrate binding model . Biol. Direct , 2 , 1. doi: 10.1186/1745-6150-2-1). Google Scholar CrossRef Search ADS PubMed 101 Dupre-Crochet S. , Figueroa A. , Hogan C. , Ferber E.C. , Bialucha C.U. , Adams J. , Richardson E.C. , Fujita Y. ( 2007 ) Casein kinase 1 is a novel negative regulator of E-cadherin-based cell-cell contacts . Mol. Cell. Biol ., 27 , 3804 – 3816 . Google Scholar CrossRef Search ADS PubMed 102 Alexander J. , Lim D. , Joughin B.A. , Hegemann B. , Hutchins J.R.A. , Ehrenberger T. , Ivins F. , Sessa F. , Hudecz O. , Nigg E.A. et al. ( 2011 ) Spatial exclusivity combined with positive and negative selection of phosphorylation motifs is the basis for context-dependent mitotic signaling . Sci. Signal ., 4 , ra42. Google Scholar CrossRef Search ADS PubMed 103 Nakajima H. , Toyoshima-Morimoto F. , Taniguchi E. , Nishida E. ( 2003 ) Identification of a consensus motif for Plk (Polo-like kinase) phosphorylation reveals Myt1 as a Plk1 substrate . J. Biol. Chem ., 278 , 25277 – 25280 . Google Scholar CrossRef Search ADS PubMed 104 Bardwell L. ( 2006 ) Mechanisms of MAPK signalling specificity . Biochem. Soc. Trans ., 34 , 837 – 841 . Google Scholar CrossRef Search ADS PubMed 105 Takeda D.Y. , Wohlschlegel J.A. , Dutta A. ( 2001 ) A bipartite substrate recognition motif for cyclin-dependent kinases . J. Biol. Chem ., 276 , 1993 – 1997 . Google Scholar CrossRef Search ADS PubMed 106 Salvesen G.S. , Duckett C.S. ( 2002 ) IAP proteins: blocking the road to death's door . Nat. Rev. Mol. Cell. Biol ., 3 , 401 – 410 . Google Scholar CrossRef Search ADS PubMed 107 Pfleger A.M. , Kirschner M.W. ( 2000 ) The KEN box: an APC recognition signal distinct from the D box targeted by Cdh1 . Genes Dev ., 14 , 655 – 665 . Google Scholar PubMed 108 Colombo S.L. , Palacios-Callender M. , Frakich N. , Carcamo S. , Kovacs I. , Tudzarova S. , Moncada S. ( 2011 ) Molecular basis for the differential use of glucose and glutamine in cell proliferation as revealed by synchronized HeLa cells . Proc. Natl. Acad. Sci. U S A , 8 , 21069 – 21074 . Google Scholar CrossRef Search ADS 109 Li M. , Lu L.-Y. , Yang C.H.-Y. , Wang S. , Yu X. ( 2013 ) The FHA and BRCT domains recognize ADP-ribosylation during DNA damage response . Genes Dev ., 27 , 1752 – 1768 . Google Scholar CrossRef Search ADS PubMed 110 Ye H. , Park Y.C. , Kreishman M. , Kieff E. , Wu H. ( 1999 ) The structural basis for the recognition of diverse receptor sequences by TRAF2 . Mol. Cell , 4 , 321 – 330 . Google Scholar CrossRef Search ADS PubMed 111 Lebrun J.J. , Ali S. , Goffin V. , Ullrich A. , Kelly P.A. ( 1995 ) A single phosphotyrosine residue of the prolactin receptor is responsible for activation of gene transcription . Proc. Natl. Acad. Sci. U S A , 92 , 4031 – 4035 . Google Scholar CrossRef Search ADS PubMed 112 Birgisdottir Å.B. , Lamark T. , Johansen T. ( 2013 ) The LIR motif - crucial for selective autophagy . J. Cell Sci ., 126 , 3237 – 3247 . Google Scholar PubMed 113 Uhlik M.T. , Temple B. , Bencharit S. , Kimple A.J. , Siderovski D.P. , Johnson G.L. ( 2005 ) Structural and evolutionary division of phosphoryrosine binding (PTB) domains . J. Mol. Biol ., 345 , 1 – 20 . Google Scholar CrossRef Search ADS PubMed 114 Holtzman J.H. , Woronowicz K. , Golemi-Kotra D. , Schepartz A. ( 2007 ) Miniature protein ligands for EVH1 domains: interplay between affinity, specificity, and cell motility . Biochemistry , 46 , 13541 – 13553 . Google Scholar CrossRef Search ADS PubMed 115 Neufeld C. , Filipp F.V. , Simon B. , Neuhaus A. , Schüller N. , David C. , Kooshapur H. , Madl T. , Erdmann R. , Schliebs W. , Wilmanns M. , Sattler M. ( 2009 ) Structural basis for competitive interactions of Pex14 with the import receptors Pex5 and Pex19 . EMBO J ., 28 , 745 – 754 . Google Scholar CrossRef Search ADS PubMed 116 Grigoriu S. , Bond R. , Cossio P. , Chen J.A. , Ly N. , Hummer G. , Page R. , Cyert M.S. , Peti W. ( 2013 ) The molecular mechanism of substrate engagement and immunosuppressant inhibition of calcineurin . PLoS Biol ., 11 , e1001492. Google Scholar CrossRef Search ADS PubMed 117 Glover J.N. , Williams R.S. , Lee M.S. ( 2004 ) Interactions between BRCT repeats and phosphoproteins: tangled up in two . Trends Biochem. Sci ., 29 , 579 – 585 . Google Scholar CrossRef Search ADS PubMed 118 Coblitz B. , Shikano S. , Wu M. , Gabelli S.B. , Cockrell L.M. , Spieker M. , Hanyu Y. , Fu H. , Amzel M. , Li M. ( 2005 ) C-terminal recognition by 14-3-3- proteins for surface expression of membrane receptors . J. Biol. Chem ., 280 , 36263 – 36272 . Google Scholar CrossRef Search ADS PubMed 119 Hickey Ch, M. , Wilson N.R. , Hochstrasser M. ( 2012 ) Function and regulation of SUMO proteases . Nat. Rev ., 13 , 755 – 766 . Google Scholar CrossRef Search ADS 120 Jain S. , Bader G.D. ( 2016 ) Predicting physiologically relevant SH3 domain mediated protein-protein interactions in yeast . Bioinformatics , 15 , 1866 – 1872 . 121 Ingham R.J. , Colwill K. , Howard C. , Dettwiler S. , Lim C.S.H. , Yu J. , Hersi K. , Raaijmakers J. , Gish G. , Mbamalu G. et al. ( 2005 ) WW domains provide a platform for the assembly of multiprotein networks . Mol. Cell. Biol ., 25 , 7092 – 7106 . Google Scholar CrossRef Search ADS PubMed 122 Kõivomägi M. , Ord M. , Iofik A. , Valk E. , Venta R. , Faustova I. , Kivi R. , Balog E.R. , Rubin S.M. , Loog M. ( 2013 ) Multisite phosphorylation networks as signal processors for Cdk1 . Nat. Struct. Mol. Biol ., 20 , 1415 – 1424 . Google Scholar CrossRef Search ADS PubMed 123 Aasland R. , Abrams C. , Ampe C. , Ball L.J. , Bedford M.T. , Cesareni G. , Gimona M. , Hurley J.H. , Jarchau T. , Lehto V.P. ( 2002 ) Normalization of nomenclature for peptide motifs as ligands of modular protein domains . FEBS Lett ., 513 , 141 – 144 . Google Scholar CrossRef Search ADS PubMed 124 Ruijter J.M. , Ramakers C. , Hoogaars W.M.H. , Karlen Y. , Bakker O. , van den Hoff M.J.B. , Moorman A.F. ( 2009 ) Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data . Nucleic Acids Res ., 37 , e45 . https:/doi.org/10.1093/nar/gkp045. Google Scholar CrossRef Search ADS PubMed 125 Kurzik-Dumke U. , Czaja J. ( 2007 ) Htid-1, the human homolog of the Drosophila melanogaster l(2)tid tumor suppressor, defines a novel physiological role of APC . Cell. Signal ., 19 , 1973 – 1985 . Google Scholar CrossRef Search ADS PubMed 126 Asada R. , Kanemoto S. , Kondo S. , Saito A. , Imaizumi K. ( 2011 ) The signalling from endoplasmic reticulum-resident bZIP transcription factors involved in diverse cellular physiology . J. Biochem ., 149 , 507 – 519 . Google Scholar CrossRef Search ADS PubMed 127 Raggo C. , Rapin N. , Stirling J. , Gobeil P. , Smith-Windsor E. , O’Hare P. , Misra V. ( 2002 ) Luman, the cellular counterpart of herpes simplex virus VP16, is processed by regulated intramembrane proteolysis . Mol. Cell. Biol ., 22 , 5639 – 5649 . Google Scholar CrossRef Search ADS PubMed 128 Lehto M. , Laitinen S. , Chinetti G. , Johansson M. , Ehnholm C. , Staels B. , Ikonen E. , Olkkonen V.M. ( 2001 ) The OSBP-related protein family in humans . J. Lipid Res ., 42 , 1203 – 1213 . Google Scholar PubMed 129 Jaworski C.J. , Moreira E. , Li A. , Lee R. , Rodriguez I.R. ( 2001 ) A family of 12 human genes containing oxysterol-binding domains . Genomics , 78 , 185 – 196 . Google Scholar CrossRef Search ADS PubMed 130 Yan D. , Olkkonen V. ( 2007 ) OSBP-related proteins: lipid sensors or transporters . Future Lipidol ., 2 , 85 – 94 . Google Scholar CrossRef Search ADS 131 Ridgway N.D. ( 2010 ) Oxysterol-binding proteins . Subcell. Biochem ., 51 , 159 – 182 . Google Scholar CrossRef Search ADS PubMed 132 Ridgway N.D. , Dawson P.A. , Ho Y.K. , Brown M.S. , Goldstein J.L. ( 1992 ) Translocation of oxysterol binding protein to Golgi apparatus triggered by ligand binding . J. Cell Biol ., 116 , 307 – 319 . Google Scholar CrossRef Search ADS PubMed 133 Ngo M.H. , Colbourne T.R. , Ridgway N.D. ( 2010 ) Functional implications of sterol transport by the oxysterol-binding gene family . Biochem. J ., 429 , 13 – 24 . Google Scholar CrossRef Search ADS PubMed 134 Nhek S. , Ngo M. , Yang X. , Ng M.M. , Field S.J. , Asara J.M. , Ridgway N.D. , Toker A. ( 2010 ) Regulation of oxysterol-binding protein Golgi localization through protein kinase D-mediated phosphorylation . Mol. Biol. Cell , 21 , 2327 – 2337 . Google Scholar CrossRef Search ADS PubMed 135 Goto A. , Liu X. , Robinson C.-A. , Ridgway N. ( 2012 ) Multisite phosphorylation of oxysterol-binding protein regulates sterol binding and activation of sphingomyelin synthesis . Mol. Biol. Cell , 23 , 3624 – 3635 . Google Scholar CrossRef Search ADS PubMed 136 Charman M. , Colbourne T.R. , Pietrangelo A. , Kreplak L. , Ridgway N.D. ( 2014 ) Oxysterol-binding protein (OSBP)-related protein 4 (ORP4) is essential for cell proliferation and survival . J. Biol. Chem ., 289 , 15705 – 15717 . Google Scholar CrossRef Search ADS PubMed 137 Lapierre L. , Tuma P.L. , Navarre J. , Goldenring J.R. , Anderson J.M. ( 1999 ) VAP-33 localizes to both an itracellular vesicle population and with occluding at the tight junction . J. Cell Sci ., 112 , 3723 – 3732 . Google Scholar PubMed 138 Lev S. , Halevy D.B. , Peretti D. , Dahan N. ( 2008 ) The VAP protein family: from cellular functions to motor neuron disease . Trends Cell Biol ., 18 , 282 – 290 . 141. Google Scholar CrossRef Search ADS PubMed 139 May P. , Woldt E. , Matz R.L. , Boucher P. ( 2007 ) The LDL receptor-related protein (LRP) family: an old family of proteins with new physiological functions . Ann. Med ., 39 , 219 – 228 . Google Scholar CrossRef Search ADS PubMed 140 Van der Geer P. ( 2002 ) Phosphorylation of LRP1: regulation of transport and signal transduction . Trends Cardiovasc. Med ., 12 , 160 – 165 . Google Scholar CrossRef Search ADS PubMed 141 Windoffer R. , Borchert-Stuhlträger M. , Haass N.K. , Thomas S. , Hergt M. , Bulitta C.J. , Leube R.E. ( 1999 ) Tissue expression of the vesicle protein panthophysin . Cell Tissue Res ., 296 , 499 – 510 . Google Scholar CrossRef Search ADS PubMed 142 Haass N.K. , Kartenbeck J. , Leube R.E. ( 1996 ) Panthophysin is a ubiquitously expressed synaptophysin homologue and defines constitutive transport vehicles . J. Cell Biol ., 134 , 731 – 746 . Google Scholar CrossRef Search ADS PubMed 143 Häcker U. , Nybakken K. , Perrimon N. ( 2005 ) Heparan sulphate proteoglycans: the sweet side of development . Nat. Rev. Mol. Cell. Biol ., 6 , 530 – 541 . 145. Google Scholar CrossRef Search ADS PubMed 144 Edelmann L. , Hanson P.I. , Chapman E.R. , Jahn R. ( 1995 ) Synaprobrevin binding to synaptophysin: a potential mechanism for controlling the exocytotic fusion machine . EMBO J ., 14 , 224 – 231 . Google Scholar PubMed 145 Shirane M. , Nakayama K.I. ( 2006 ) Protrudin induces neurite formation by directional membrane trafficking . Science , 314 , 818 – 821 . Google Scholar CrossRef Search ADS PubMed 146 Canamasas I. , Debes A. , Natali P.G. , Kurzik-Dumke U. ( 2003 ) Understanding human cancer using Drosophila. Tid47, a cytosolic product of the dnaJ-like tumor suppressor gene l(2)tid, is a novel molecular partner of Patched related to skin cancer . J. Biol. Chem ., 278 , 30952 – 30960 . Google Scholar CrossRef Search ADS PubMed 147 Kurzik-Dumke U. , Hörner M. , Czaja J. , Nicotra M.R. , Simiantonaki N. , Koslowski M. , Natali P.G. ( 2008 ) Progression of colorectal cancers correlates with overexpression and loss of polariziation of expression of the htid-1 tumor suppressor . Int. J. Mol. Med ., 2 , 19 – 31 . © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Human Molecular Genetics Oxford University Press

Molecular partners of hNOT/ALG3, the human counterpart of the Drosophila NOT and yeast ALG3 gene, suggest its involvement in distinct cellular processes relevant to congenital disorders of glycosylation, cancer, neurodegeneration and a variety of further pathologies

Loading next page...
 
/lp/ou_press/molecular-partners-of-hnot-alg3-the-human-counterpart-of-the-xjiY1rkGzE
Publisher
Oxford University Press
Copyright
© The Author(s) 2018. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com
ISSN
0964-6906
eISSN
1460-2083
D.O.I.
10.1093/hmg/ddy087
Publisher site
See Article on Publisher Site

Abstract

Abstract This study provides first insights into the involvement of hNOT/ALG3, the human counterpart of the Drosophila Neighbour of TID and yeast ALG3 gene, in various putative molecular networks. HNOT/ALG3 encodes two translated transcripts encoding precursor proteins differing in their N-terminus and showing 33% identity with the yeast asparagine-linked glycosylation 3 (ALG3) protein. Experimental evidence for the functional homology of the proteins of fly and man in the N-glycosylation has still to be provided. In this study, using the yeast two-hybrid technique we identify 17 molecular partners of hNOT-1/ALG3–1. We disclose the building of hNOT/ALG3 homodimers and provide experimental evidence for its in vivo interaction with the functionally linked proteins OSBP, OSBPL9 and LRP1, the SYPL1 protein and the transcription factor CREB3. Regarding the latter, we show that the 55 kDa N-glycosylated hNOT-1/ALG3–1 molecule binds the N-glycosylated CREB3 precursor but does not interact with CREB3’s proteolytic products specific to the endoplasmic reticulum and to the nucleus. The interaction between the two partners is a prerequisite for the proteolytic activation of CREB3. In case of the further binding partners, our data suggest that hNOT-1/ALG3–1 interacts with both OSBPs and with their direct targets LRP1 and VAMP/VAP-A. Moreover, our results show that various partners of hNOT-1/ALG3–1 interact with its diverse post translationally processed products destined to distinct cellular compartments. Generally, our data suggest the involvement of hNOT-1/ALG3–1 in various molecular contexts determining essential processes associated with distinct cellular machineries and related to various pathologies, such as cancer, viral infections, neuronal and immunological disorders and CDG. Introduction HNOT/ALG3 is the human counterpart of the Neighbour of TID (NOT) gene, which was originally identified in the fruit fly Drosophila melanogaster (Dmel) (1,2) and its distant relative Drosophila virilis (Dvir) (3). As described previously, sequence comparison of the Dmel and Dvir NOT proteins revealed an identity score of 71% (3). The identity score between the proteins Dmel NOT56 (2) and hNOT-1/ALG3–1 was estimated at 48% (4). Both proteins show a 33% identity with the Saccharomyces cerevisiae non-essential asparagine (Asn)-linked glycosylation 3 (ALG3) protein, a dolichol-PP-Man: Man5GlcNAc2-dolichyl-PP mannosyltransferase acting in the asparagine-linked/N-linked glycosylation (5). Because of the structural homology, a putative association of hNOT/ALG3 with the autosomal recessive multi-systemic congenital disorders of glycosylation (CDG), which involves the defective synthesis of N-glycans and under glycosylation of glycoproteins (6,7), was concluded. However, unambiguous evidence for both Dmel NOT and its human counterpart as essential components of the N-glycosylation machinery has not been provided yet (4). The discovery of mutated hNOT/ALG3 transcripts in CDG patients (8–15) suggested this functional aspect to be of relevance and justifies research on the role of hNOT/ALG3 in the CDG pathology. Our recent study concerning the genomic organization of the gene in question and its transcription in diverse normal and tumorous cells clearly revealed that some of the mutations previously identified in CDG patients are common erratic products of the transcription/splicing machinery and, thus, can be excluded as pathologically relevant (4). Furthermore, CDG is not the only disease the gene must be considered as relevant to. Recent studies identified hNOT/ALG3 as a novel cancer biomarker (4,16–18) and putative target molecule in mental retardation (MR) not associated with CDG (19). In this study, we provide first insights into the complex biology and diversity of the cellular actions of the hNOT/ALG3 gene. Using the yeast two-hybrid (Y2H) technique (20), we identify the following 17 putative direct interaction partners of hNOT-1/ALG3–1: synaptophysin-like protein 1 (SYPL1) (21,22), low-density lipoprotein receptor-related protein 1 (LRP1) (23,24), vesicle-associated membrane protein-associated protein A (VAP-A) (25), sushi-repeat containing protein (SRPX) (26), FK506 binding protein 8 (FKBP8) (27,28), guanylate binding protein 1 (GBP1) (29,30), heme oxygenase 2 (HO-2) (31), BCL2/adenovirus E1B19 kDa interacting protein 3 (BNIP3) (32–34), oxys