Molecular identification of goose (Anser cygnoide) suppressor ubiquitin-specific protease 18 (USP18) and the effects of goose IFN and TMUV on its comparative transcripts

Molecular identification of goose (Anser cygnoide) suppressor ubiquitin-specific protease 18... Abstract Ubiquitin-specific protease 18 (USP18) is known as an inhibition factor and has been associated with the innate immune response to pathogens. USP18 is the only deconjugating protease with specificity for interferon-stimulated gene 15 (ISG15), which is supposed to be missing in birds. To analyze the efficacy of goose USP18 (goUSP18) against Tembusu virus (TMUV) infection, we first cloned USP18 homologous cDNA from TMUV infected geese. The coding sequence was 1131 bp, and the deduced amino acid sequence shared conserved motifs with its homologues. Tissue-specific expression has shown that goUSP18 transcripts are strongly expressed in the spleen and liver of adult geese, as well as in the pancreas of goslings. Moreover, the goUSP18 transcripts were induced by goose interferons (goIFN) in goose embryo fibroblasts (GEF) and by TLR ligands in peripheral blood mononuclear cells (PBMC). Notably, goUSP18 transcripts were highly up-regulated by TMUV infection compared to the basal level in uninfected birds. Taken together, these results suggested that goUSP18 was involved in host innate immunity against TMUV infection. INTRODUCTION The suppressor of ubiquitin-specific peptidase 18 (USP18) is a member of the deubiquitinating (DUB) enzyme family. It was originally identified as an interferon (IFN)-inducible gene and was subsequently demonstrated to be a negative-feedback regulator of IFN-α, -β, and -γ. Types I and II interferons (IFN-I, IFN-II, respectively) are recognized by their cognate receptors, IFNAR and IFNGR, respectively, and secrete pleiotropic cytokines with antiviral, antiproliferative, and immunomodulatory properties (Garcia-Sastre, 2017; Lindqvist, et al., 2016), whereas the more recently identified type III IFN (IFN-III) binds to an unrelated cell-type restricted receptor (Sommereyns, et al., 2008; Yao, et al., 2014; Qin, et al., 2015). Via the classic JAK-STAT signaling pathway, IFN-I, IFN-II, and IFN-III exert their biological effects through mediation by terminal effectors, including antiviral effectors (Mx and OASL), positive regulators (cGAS and PKR), and negative regulators (SOCS-1 and USP18) (Reid and Charleston, 2014; Schneider et al., 2014). Importantly, IFN receptor plasticity can be regulated by USP18, which was previously shown to be a key determinant for the differential activity of interferons alpha, beta, and lambda (IFN-α, IFN-γ, IFN-λ, respectively) in regard to ligand binding affinity (François-Newton, et al., 2012). Hence, exploring the immune role of USP18 will pave the way to the elucidation of the regulatory mechanism of the IFN pathway. Structurally, USP18 possesses 2 functional domains: one consists of Cys and His boxes responsible for isopeptidase activity, and the other one inhibits interferon signaling by binding the IFN receptor subunit (Honke, et al., 2016). Functionally, specific USP18 protease generally can cleave interferon-stimulated gene 15 (ISG15) conjugation, which is a ubiquitin-like protein that can be highly up-regulated by IFN treatment. Interestingly, this protein also functions in down-regulating IFN responses independent of its isopeptidase activity towards ISG15 (Malakhova, et al., 2006). However, bird ISG15 is supposed to be missing, for no genes homologous to human ISG15 have been annotated in any of the available avian genomes (Magor, et al., 2013). The lack of ISG15 in birds motivated us to examine the many facets of goose USP18 (goUSP18). USP18 also has been implicated in immune evasion of several viral infections (Xu, et al., 2012; Mladinich et al., 2017). It is desirable to determine the exact regulation of goUSP18 transcripts upon Tembusu virus (TMUV) infection. TMUV is an enveloped RNA virus in the Flaviviridae family that plagues only poultry. TMUV has been reported in ducks, chickens, and geese (Liu, et al., 2012; Yan, et al., 2016), and there are several reports about host innate immune responses to TMUV infection (Chen, et al., 2016; Fu, et al., 2016; Hao, et al., 2016). However, the interaction between TMUV and host immunity is not clear. Different stimulation from the virus or IFN could reflect diverse roles of goUSP18. In this context, an important step forward for further understanding these immunological characteristics is describing the quality and quantity of stimulation and infection diversification. Here, we explore tissue specificity, age-related dependency of goUSP18, and the difference between TMUV and IFN on goUSP18 transcripts. These findings may shed further light on goUSP18 immune responses in this species. MATERIALS AND METHODS Cells, Viruses, Regents, and Animals Peripheral blood mononuclear cells (PBMC) were isolated using the Animal Peripheral Blood Mononuclear Cells Separation Medium kit (TBD sciences, China) from adult geese and guaranteed at a high purity of 80%. According to the instructions, 20 mL of blood were collected from the jugular veins of each of the 3 adult geese. Finally, the sediment of PBMC was mixed and resuspended in 1 mL RPMI 1640 medium (Gibco). Goose embryo fibroblasts (GEF) were produced from 10-day-old goose embryos and maintained at 37°C and 5.0% CO2 in Dulbecco's Modified Eagle's medium (DMEM; Mediatech, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Australia). The cells were at approximately 80% confluence, then treated with agonists or viruses, and samples were collected at an indicated time point post infection (hpi.). The TMUV strain (accession: KM233707) was propagated in GEF and determined at 6.3 × 106 TCID50/100 μL using 50% tissue culture infection dose (TCID50) titration assays (Zhu, et al., 2015). The previously confirmed antiviral activity of recombinant goose IFN (goIFN) was generated by a pCDNA3.1 prokaryotic expression system in baby hamster kidney (BHK21) cells (Chen, et al., 2017). Polyinosinic–polycytidylic acid (Poly [I:C], Sigma, USA) can mimic treatment with double-stranded RNA. R848 (InvivoGen, USA) is an imidazoquinoline compound with potent anti-viral activity via the TLR7/TLR8 MyD88-dependent signaling pathway, and LPS (InvivoGen, USA) mediated by TLR4 is an important virulence factor that activates the innate immune system. For the viral challenge experiment, 1 μL of TMUV (6.3 × 106 TCID50/100μL in PBS) per gram body weight was injected intramuscularly. Control animals were injected with PBS. Four goslings per group were daily anesthetized to collect sample tissues for mRNA extraction. Additionally, another 4 goslings in each group were artificially infected with gosling plague virus (GPV) and injected intramuscularly with PBS to serve as the control group. The GPV titers were determined as the median egg infectious dose (106.6 EID50/200μL). Three d later, the selected tissues were collected. All the one-week-old healthy goslings and adult geese were purchased from the breeding center of Sichuan Agricultural University, Yaan City, China, and were maintained and observed for 3 d in laboratory animal rooms prior to experimentation. The welfare of the animals was ensured during the sampling process. Gene Cloning and Sequence Analysis Based on the predicted sequence from National Center for Biotechnology Information (NCBI accession number: XM_01,317,2965), the coding sequence of goUSP18 cDNA was cloned from the liver of TMUV-infected goslings using the primers F1/R1 and identified with sequencing (all primers used are shown in Table 1). The ExPASy ProtParam tool was utilized to compute the amino acid sequences, protein molecular weight (MW), and isoelectric point (PI), and to perform the hydropathy analysis of goUSP18 (http://us.expasy.org/tools/protparam.html). The predicted secondary structure of goUSP18 was estimated using Jpred4 (http://www.compbio.dundee.ac.uk/jpred4/results/jp_JsJuDJ0/jp_JsJuDJ0.simple.html). The subcellular localization of goUSP18 was predicted by NLS mapper (http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi). The conserved motifs of goUSP18 were identified by the online tool motif scan (http://myhits.isb-sib.ch/cgi-bin/PFSCAN). Sequences were obtained from GenBank and aligned with the ClustalW multiple alignment program (http://www.ebi.ac.uk/Tools/msa/clustalw2); the N-J phylogenetic tree was made by the MEGA6 program using a Jones-Taylor-Thornton (JTT) model and modified with the Figtree software. Tissue Distribution of goUSP18 mRNA Expression Levels in Goslings and Geese To study the tissue expression profiles of goUSP18, adult geese and goslings were prepared for the collection of biological samples, including the brain (B), bursa of Fabricius (BF), cecum (CE), cecal tonsil (CT), gizzard (GI), heart (H), harderian gland (HG), kidney (K), liver (LI), lung (LU), pancreas (P), proventriculus (PR), small intestine (SI), and spleen (SP). Transcript levels were measured using qRT-PCR with the goUSP18-specific primers F2/R2 ( Table 1). The data were analyzed by the 2−ΔΔCt method, and expression of the target gene was normalized to GAPDH mRNA levels in the same samples. Total RNA was extracted using Trizol reagent according to the manufacturer's instructions. RNA concentrations were determined by measuring their absorbance at 260 nm and 280 nm using a Thermo Scientific NanoDrop 2000. An equal quantity of 1 μg cDNA was instantly synthesized using the HiScript1st Strand cDNA Synthesis Kit (Vazyme, USA) for qRT-PCR and stored at −80 °C according to the manufacturer's instructions. The viral copy number in TMUV-infected gosling tissues was quantified using qRT-PCR through the standard curve: Y = 39.995–3.529 logX. Transcriptional Level Analysis of goUSP18 in PBMC Stimulated with Agonists Three biological replicates and technological replicates per agonist of PBMC (5 × 106/mL) were isolated from the peripheral blood of adult geese and seeded in 12-well plates overnight before stimulation. Cells were subsequently incubated with LPS (25 μg/mL), R848 (5 μg/mL), or Poly (I: C) (30 μg/mL) and collected after 6 h with 3 replicates per treatment. Evaluating goUSP18 mRNA Level Against IFN and TMUV To explore the immune characteristics and transcript levels of goUSP18 in vitro, GEF were placed in 12-well plates, and an equal quantity of proteins of IFN proteins was added in the logarithmic phase. Cells were harvested at 6, 12, 24, 36, or 48 hpi. To explore the effects of TMUV virus on goUSP18 expression in vivo, the relative gene expression levels of goUSP18 in the challenged 3-day-old goslings were determined at 1 d post inoculation (dpi), 2dpi, 3dpi, and 4 dpi. Data are represented as the mean with SD in all bar graphs. Statistically significant differences between the 2 groups were analyzed using an unpaired Student's t test in GraphPad Prism version 5 (GraphPad software, San Diego, CA). Extremely significantly up-regulated (***P < 0.001), significantly up-regulated (**P < 0.01), and up-regulated treated groups in all virus-infected groups (*P < 0.05) compared to the control group are marked in the figures. Ethics Statement The animal studies were approved by the Institutional Animal Care and Use Committee of Sichuan Agricultural University (No. XF2014–18) and followed the National Institutes of Health guidelines for the performance of animal experiments. RESULTS Molecular Identification of goUSP18 The cloned goUSP18 was 1,131 bp long (GenBank ID: KY012333), encoding 376 amino acid residues with a theoretical molecular mass of 43.5 kDa and an isoelectric point of 8.04. It is rich in helix and β-pleated sheet (Fig. 1), presents a classic bipartite nuclear localization signals, and harbors a Cys-box and a His-box with a conserved putative active-site cysteine at the 66th position and histidine at the 321st position, which are both essential for the catalytic properties of USP18 (Fig. 2, Fig. 3a). The IFNAR2 binding domain facilitates interaction with the intracellular domain of the IFNAR2 subunit (Fig. 3a). In addition, the primary amino acid sequence of goUSP18 harbors all the structural motifs of a DUB enzyme (Fig. 3b). We conclude that goUSP18 might be a member of DUB enzyme family. Figure 1. View largeDownload slide Secondary structure of goUSP18 protein. Based on the cloned sequence (GenBank ID: KY012333), the secondary structure is predicted by the online server of JPRED4. The α-helix and β-pleated sheets are marked in green wavy lines and red columns, respectively. Figure 1. View largeDownload slide Secondary structure of goUSP18 protein. Based on the cloned sequence (GenBank ID: KY012333), the secondary structure is predicted by the online server of JPRED4. The α-helix and β-pleated sheets are marked in green wavy lines and red columns, respectively. Figure 2. View largeDownload slide Multiple alignment analysis of USP18 family from various animals based on primary amino acid sequences. Each sequence was obtained from the database (accession no: Gallus gallus USP18, XP_0,049,38016; Anas platyrhynchos USP18, XP_0,050,09988; Susscrofa USP18, NP_998,991; Homo sapiens USP18, NP_05,9110; Danio rerio USP18, XP_0,026,61398). The bipartite nuclear localization signals predicted by the online software of NLS mapper are shown in black bold and italic type. The classical Cys-box, a His-box, and IFAGR binding domain are indicated in red, green, and blond, respectively. The active-sites cysteine at 66th position and histidine at 321st position, which are both essential for the catalytic property of USP18, are shown in light blue shadow. Figure 2. View largeDownload slide Multiple alignment analysis of USP18 family from various animals based on primary amino acid sequences. Each sequence was obtained from the database (accession no: Gallus gallus USP18, XP_0,049,38016; Anas platyrhynchos USP18, XP_0,050,09988; Susscrofa USP18, NP_998,991; Homo sapiens USP18, NP_05,9110; Danio rerio USP18, XP_0,026,61398). The bipartite nuclear localization signals predicted by the online software of NLS mapper are shown in black bold and italic type. The classical Cys-box, a His-box, and IFAGR binding domain are indicated in red, green, and blond, respectively. The active-sites cysteine at 66th position and histidine at 321st position, which are both essential for the catalytic property of USP18, are shown in light blue shadow. Figure 3. View largeDownload slide Sequence analysis of goUSP18 functional domains. (a) Conserved function domains of goUSP18 protein characterized by the isopetidase activity site and IFNAR-binding site. The classical Cys-box, a His-box, and IFAGR binding domain are indicated in the insert weblogo pictures (http://weblogo.berkeley.edu/logo.cgi). The multiple sequence alignment includes USP18 amino acid sequences of Carassius auratus, Anas platyrhynchos, Gallus gallus, Mus musculus, Susscrofa, and Homo sapiens. (b) Conserve structural motifs of goUSP18. Figure 3. View largeDownload slide Sequence analysis of goUSP18 functional domains. (a) Conserved function domains of goUSP18 protein characterized by the isopetidase activity site and IFNAR-binding site. The classical Cys-box, a His-box, and IFAGR binding domain are indicated in the insert weblogo pictures (http://weblogo.berkeley.edu/logo.cgi). The multiple sequence alignment includes USP18 amino acid sequences of Carassius auratus, Anas platyrhynchos, Gallus gallus, Mus musculus, Susscrofa, and Homo sapiens. (b) Conserve structural motifs of goUSP18. To gain insight into goUSP18 evolution, a phylogenetic tree was constructed based on the conserved sequences and amino acid sequences of various animals that were obtained from GenBank (Table 2). The aligned sequences have been bootstrapped 1,000 times, and only bootstrap values higher than 40 were considered for the consensus tree. The phylogenetic analysis showed that avian USP18 protein sequences are in the same subgroup (Fig. 4). Mammalian USP18 were in another subgroup, and fish USP18 were in a third subgroup. USP22, a member of the DUB family, was chosen as the out group. This finding reinforces the hypothesis that goUSP18 is homologous to USP18 of other species annotated in GenBank. Figure 4. View largeDownload slide Evolution analysis of goUSP18. The same clades are marked in one color, and goUSP18 is in gray background. Phylogenetic tree was constructed based on those sequences listed in Table 1. In addition, the USP22 gene is chosen as outgroup. The selected species are mammals, including human, orangutan, mouse, pig, dog, and cattle and fish species. Evolution analysis was conducted in MEGA6.0 in the method of the neighbor-joining algorithm and a Jukes–Cantor distance model, with the aligned sequences bootstrapped for 1,000 times; only the bootstrap values higher than 50% were taken into consideration for the consensus tree. Figure 4. View largeDownload slide Evolution analysis of goUSP18. The same clades are marked in one color, and goUSP18 is in gray background. Phylogenetic tree was constructed based on those sequences listed in Table 1. In addition, the USP22 gene is chosen as outgroup. The selected species are mammals, including human, orangutan, mouse, pig, dog, and cattle and fish species. Evolution analysis was conducted in MEGA6.0 in the method of the neighbor-joining algorithm and a Jukes–Cantor distance model, with the aligned sequences bootstrapped for 1,000 times; only the bootstrap values higher than 50% were taken into consideration for the consensus tree. Table 1. List of primer sequences in this study. Primer name  Nucleotide sequence  goUSP18–1 F1  ATGGGCCAAAGAAGTGGAC  goUSP18–1 R1  CTACTGGGGATGCTTTTTCA  goUSP18–1 F2  GACAGAACAGCAGAGCCAAGC  goUSP18–1 R2  TCCCACGATACCTGACAAACG  goGAPDH-qPCR-F  CATTTTCCAGGAGCGTGACC  goGAPDH-qPCR-R  AGACACCAGTAGACTCCACA  Primer name  Nucleotide sequence  goUSP18–1 F1  ATGGGCCAAAGAAGTGGAC  goUSP18–1 R1  CTACTGGGGATGCTTTTTCA  goUSP18–1 F2  GACAGAACAGCAGAGCCAAGC  goUSP18–1 R2  TCCCACGATACCTGACAAACG  goGAPDH-qPCR-F  CATTTTCCAGGAGCGTGACC  goGAPDH-qPCR-R  AGACACCAGTAGACTCCACA  View Large Table 2. Identity of deduced amino acid sequences of goUSP18 cDNA among species. GenBank ID of sequences used for constructing phylogenetic tree are listed here. Classes  Accession number  Species  Identity  Fish  XP_01,734,9594  Ctalurus punctatus  29.49%    XP_0,026,61398  Danio rerio  29.17%    ABC86864  Carassius auratus  27.53%  Birds  XP_0,055,00407  Columba livia  67.55%    XP_01,000,1300  Chaetura pelagica  62.39%    XP_0,096,46205  Egretta garzetta  78.80%    XP_0,050,09988  Anas platyrhynchos  89.50%    XP_0,049,38016  Gallus gallus  76.90%    XP_01,071,2227  Meleagris gallopavo  75.33%  Mammals  NP_05,9110  Homo sapiens  50.39%    XP_0,011,64261XP_0,056,37457  Pan troglodytesCanis lupus familiaris  50.79%48.03%    NP_0,010,17940  Bos taurus  47.24%    NP_998,991  Sus scrofa  45.93%  Rodents  NP_03,6039  Mus musculus  48.03%    NP_0,010,14080  Rattus norvegicus  47.24%  Amphilia  XP_0,049,12550  Xenopus tropicalis  37.80%  Classes  Accession number  Species  Identity  Fish  XP_01,734,9594  Ctalurus punctatus  29.49%    XP_0,026,61398  Danio rerio  29.17%    ABC86864  Carassius auratus  27.53%  Birds  XP_0,055,00407  Columba livia  67.55%    XP_01,000,1300  Chaetura pelagica  62.39%    XP_0,096,46205  Egretta garzetta  78.80%    XP_0,050,09988  Anas platyrhynchos  89.50%    XP_0,049,38016  Gallus gallus  76.90%    XP_01,071,2227  Meleagris gallopavo  75.33%  Mammals  NP_05,9110  Homo sapiens  50.39%    XP_0,011,64261XP_0,056,37457  Pan troglodytesCanis lupus familiaris  50.79%48.03%    NP_0,010,17940  Bos taurus  47.24%    NP_998,991  Sus scrofa  45.93%  Rodents  NP_03,6039  Mus musculus  48.03%    NP_0,010,14080  Rattus norvegicus  47.24%  Amphilia  XP_0,049,12550  Xenopus tropicalis  37.80%  View Large Transcript Expression Pattern of goUSP18 in One-week-old Goslings and Adult Geese Tissue-specific expression in normal tissues was analyzed using RT-qPCR. The goUSP18 mRNA was constitutively expressed in all tissues analyzed (Fig. 5). The lowest levels were seen in the brain, heart, and kidney, with higher levels in the cecum, cecal tonsil, gizzard, spleen, and pancreas. The highest levels were in the liver, harderian gland, and lung. In short, goUSP18 transcripts were strongly expressed in the spleen and liver of adult geese and in the pancreas of goslings. This observation of tissue profiles is partially consistent with the GEO profiles of in the NCBI Unigene database (http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi). In general, the tissue-specific expression in adult geese is comparatively higher than in goslings. Figure 5. View largeDownload slide Tissue expression pattern of goUSP18. The goUSP18 mRNA levels of one-week-old goslings and adult geese were quantified by real-time quantitative PCR (RT-qPCR) with goose GAPDH serving as control gene. Data were analyzed by GraphPad Prism software and represented as the mean ± SEM (n = 3). Tissue samples included brain (B), bursa of Fabricius (BF), cecum (CE), cecal tonsil (CT), gizzard (GI), heart (H), harderian gland (HG), kidney (K), liver (LI), lung (LU), pancreas (P), proventriculus (PR), small intestine (SI), and spleen (SP). Figure 5. View largeDownload slide Tissue expression pattern of goUSP18. The goUSP18 mRNA levels of one-week-old goslings and adult geese were quantified by real-time quantitative PCR (RT-qPCR) with goose GAPDH serving as control gene. Data were analyzed by GraphPad Prism software and represented as the mean ± SEM (n = 3). Tissue samples included brain (B), bursa of Fabricius (BF), cecum (CE), cecal tonsil (CT), gizzard (GI), heart (H), harderian gland (HG), kidney (K), liver (LI), lung (LU), pancreas (P), proventriculus (PR), small intestine (SI), and spleen (SP). Agonists Up-regulated goUSP18 Transcripts in PBMC In order to identify the role of goUSP18 in the early immune response, we took advantage of the availability of PBMC, a perfect immune response system. The treatment of agonists R848, Poly (I:C) or LPS can mimic single-stranded RNA, double-stranded RNA, and lipopolysaccharide of pathogens, respectively. The mRNA levels of goUSP18 in PBMC were significantly up-regulated in LPS-, R848-, and Poly (I:C)-treated cells (Fig. 6). Figure 6. View largeDownload slide Effects of different agnoists on goUSP18 mRNA expression in PBMC. The cell density was adjusted as 5 × 106/mL. The final concentrations of each agonist (Poly (I: C), LPS, and R848) were used at 30 μg/mL, 25 μg/mL and 5 μg/mL, respectively. The statistical analysis was performed in GraphPad Prism using unpaird two-tailed t tests: *P < 0.05; **P < 0.01; ***P < 0.001. Figure 6. View largeDownload slide Effects of different agnoists on goUSP18 mRNA expression in PBMC. The cell density was adjusted as 5 × 106/mL. The final concentrations of each agonist (Poly (I: C), LPS, and R848) were used at 30 μg/mL, 25 μg/mL and 5 μg/mL, respectively. The statistical analysis was performed in GraphPad Prism using unpaird two-tailed t tests: *P < 0.05; **P < 0.01; ***P < 0.001. Differential Regulation of goUSP18 by 3 Types of Goose IFN and TMUV The purpose of this study was to determine the expression profiles of goUSP18 in response to TMUV infection and treatment with 3 types of goIFN. Precise quantification of the mRNA expression in the stimulation analysis suggested that the storm effect of goUSP18 transcripts after treatment with IFNλ was less strong than that after treatment with IFNα and IFNγ. The same was true of the Poly (I:C)-treated group. Not only that, but the goUSP18 transcripts of the IFNλ-treated group decreased over time. Furthermore, the goUSP18 mRNA was up-regulated by goose IFNα and IFNγ treatments, which persisted for the whole experimental time, whereas goUSP18 mRNA was up-regulated only within 24 h in Poly (I:C)- and IFNλ- treated GEF (Fig. 7a). In conclusion, our research indicates that goUSP18 is stimulated by goose IFNα, IFNγ, and IFNλ, which may behave non-redundantly in their potency to exert specific bioactivities. Figure 7. View largeDownload slide Time course study of the effects of goose IFN and TMUV on goUSP18 transcripts. (a) GEF was stimulated with 3 types of IFN, and Poly (I: C) was used as a positive group. (b) GEF was inoculated with TMUV at a volume of 100μL (6.3 × 106 TCID50/100μL). The statistical analysis was performed in GraphPad Prism using unpaird two-tailed t tests: *P < 0.05; **P < 0.01; ***P < 0.001. Figure 7. View largeDownload slide Time course study of the effects of goose IFN and TMUV on goUSP18 transcripts. (a) GEF was stimulated with 3 types of IFN, and Poly (I: C) was used as a positive group. (b) GEF was inoculated with TMUV at a volume of 100μL (6.3 × 106 TCID50/100μL). The statistical analysis was performed in GraphPad Prism using unpaird two-tailed t tests: *P < 0.05; **P < 0.01; ***P < 0.001. Transcripts of goUSP18 were significantly increased during the late phases of TMUV infection in GEF. Our results showed barely any increase and a sharp increase in the mRNA level of goUSP18 in TMUV-infected GEF cells in early and late infection, respectively (Fig. 7b). Collectively, the up-regulation of the goUSP18 transcript was observed as an early response to the IFN treatment, as well as in the late response to TMUV infection. The Strongly Elevated goUSP18 mRNA Expression Upon TMUV Infection Host innate immune responses play a key role against early viral infection. From the perspective of the inhibition effect of the Flaviviridae family on the IFN signaling pathway (Conde, et al., 2017; Morrison, et al., 2013; Grant, et al., 2016), we explored the reaction of goUSP18 upon TMUV infection in vivo (Fig. 8). The effect of viral replication on goUSP18 induction appears to be consistent among different viruses and different tissues until 4 dpi (refer to the supplement Fig. 9). Efficient replication of TMUV in different tissues is demonstrated by TMUV copy number (Fig. 8). Of note, goUSP18 mRNA in the brain and spleen were not rapidly and significantly up-regulated at 1 dpi. Figure 8. View largeDownload slide Endogenous goUSP18 transcripts during TMUV infection. Goslings were injected with 100μL of TMUV (6.3 × 106 TCID50/100μL) or PBS, per gram body weight, then tissues of 4 infected goslings per group were collected, and mRNA levels of goUSP18 were quantified by RT-qPCR with the GAPDH as control gene. Data were represented as the mean ± SEM (n = 4). The taking-samples time was at an interval of one day. GoUSP18 mRNA expressions were tested in various tissues including brain (B), LI (liver), pancreas (P), spleen (SP), thymus (T), and blood (BL). The statistical analysis was performed in GraphPad Prism using unpaird two-tailed t tests: *P < 0.05; **P < 0.01; ***P < 0.001. Figure 8. View largeDownload slide Endogenous goUSP18 transcripts during TMUV infection. Goslings were injected with 100μL of TMUV (6.3 × 106 TCID50/100μL) or PBS, per gram body weight, then tissues of 4 infected goslings per group were collected, and mRNA levels of goUSP18 were quantified by RT-qPCR with the GAPDH as control gene. Data were represented as the mean ± SEM (n = 4). The taking-samples time was at an interval of one day. GoUSP18 mRNA expressions were tested in various tissues including brain (B), LI (liver), pancreas (P), spleen (SP), thymus (T), and blood (BL). The statistical analysis was performed in GraphPad Prism using unpaird two-tailed t tests: *P < 0.05; **P < 0.01; ***P < 0.001. Figure 9. View largeDownload slide Analyses of the mRNA expression patterns post-GPV infection in vivo. The selected tissues included brain (B), bursa of Fabricius (BF), cecum (CE), cecal tonsil (CT), harderian gland (HG), lung (LU), small intestine (SI), thymus (T), and spleen (SP). GAPDH was employed as an internal control. Asterisks (*) mark the significant difference between experimental and control groups. (*P < 0.05; **P < 0.01; ***P < 0.001.) Error bars indicate standard error. Figure 9. View largeDownload slide Analyses of the mRNA expression patterns post-GPV infection in vivo. The selected tissues included brain (B), bursa of Fabricius (BF), cecum (CE), cecal tonsil (CT), harderian gland (HG), lung (LU), small intestine (SI), thymus (T), and spleen (SP). GAPDH was employed as an internal control. Asterisks (*) mark the significant difference between experimental and control groups. (*P < 0.05; **P < 0.01; ***P < 0.001.) Error bars indicate standard error. Overall, the up-regulation of goUSP18 transcript levels occurred in those tissues in which TMUV stock is abundantly persistent. Finally, whether or not the presence of USP18 under TMUV challenge altered the cytokine profile and IFN effect still remains unknown. DISCUSSION In this study, we demonstrated that TMUV induced a USP18 counterpart in goose and identified goUSP18 as a critical mediator of both TMUV infection and IFN stimulation (Fig. 10). Furthermore, significant differences in goose IFNα, IFNγ, IFNλ, and TMUV in regulating goUSP18 also were found. Notably, the elevation of USP18 transcripts in different tissues of TMUV-infected goslings is also obvious in vivo. Taken together, these results suggest that the up-regulation of transcripts goUSP18 may involve goose innate immune responses against TMUV infection. Figure 10. View largeDownload slide USP18-centered relationship network. The red solid lines indicate the positive effects of goose IFN and TMUV on goUSP18 comparative transcripts, while the green dotted lines indicate USP18 feedback on TMUV or IFN, and other black dotted lines indicate previous literatures. All the dotted lines demanded deeper research. The “+” and “–” indicate the positive feedback and negative feedback, respectively. Figure 10. View largeDownload slide USP18-centered relationship network. The red solid lines indicate the positive effects of goose IFN and TMUV on goUSP18 comparative transcripts, while the green dotted lines indicate USP18 feedback on TMUV or IFN, and other black dotted lines indicate previous literatures. All the dotted lines demanded deeper research. The “+” and “–” indicate the positive feedback and negative feedback, respectively. ISG15-conjugated protein expression can be induced by viral infection and IFN (Lenschow and Virgin, 2007; Zhao, et al., 2013), and USP18 is the only deconjugating protease with specificity for ISG15 and controls the reversible ISGylation enzymatic cascade (Ritchie, et al., 2004; Speer, et al., 2016). Although the difference between wild-type and USP18 knockout cells in their susceptibility to the invading virus is partly associated with ISGylation (Malakhova, et al., 2006; Zou, et al., 2007), the ISG15 gene is unfortunately missing in avian genomes (Magor, et al., 2013). In this study, goUSP18 was significantly up-regulated by TMUV and agonists in goose cells and in goslings without the ISG15ylation system. Here, the increased transcripts suggest that goUSP18 regulated by viruses and reagents is independent of the ISG15ylation system. Generally, ISG resembles a Swiss army knife, including antimicrobial effectors and negative and positive regulators of the IFN signaling. Previous studies have shown an increasing interest in antiviral proteins of goose innate immunity, such as Mx, OASL, and IFITM (Colonne, et al., 2013; Miao, et al., 2016; Yang, et al., 2016). USP18 has been discovered to be not only an isopeptidase, but also a potent inhibitor of interferon signaling. Recently, the role of mammalian USP18 in viral infections was comprehensively studied (Ritchie, et al., 2004; Chen, et al., 2011; Basters, et al., 2012). Qian et al also identified duck USP18 as a negative regulator mediated by NF-kB activation (Qin, et al., 2015), but little is known about the role of USP18 in the goose immune system. Previous studies revealed that upon LPS stimulation, IFN treatment and virus infection all strongly increase goUSP18 mRNA. At the same time, USP18 has been demonstrated as necessary and sufficient to induce differential desensitization of different types of IFN, namely, IFNβ would retain activity on USP18-expressing cells owing to IFNβ’s higher affinity for the receptor. Conversely, the immune activity of IFNα, being a low-binding affinity, is impaired in cells expressing USP18 (Arimoto, et al., 2017). The mutual regulatory relationship of IFN and USP18 may inform us about the homeostatic mechanism between them. Based on our data, we also hypothesize that USP18 coexists alongside IFN, regardless of ISG15ylation. Unlike goose IFNα and IFNγ, the transcript level of goUSP18 induced by IFNλ was comparatively low and short-term. USP18 knockout mice were more efficiently resistant to fatal lymphocytic choriomeningitis virus (LCMV) or vesicular stomatitis virus (VSV) than wild-type mice (Ritchie, et al., 2004). Silencing USP18 also potentiated the antiviral activity of IFN against hepatitis C virus infection (Randall, et al., 2006). Furthermore, the growth of LCMV was effectively restricted in both mouse embryonic fibroblasts (MEF) and bone marrow-derived macrophages from USP18 knockout mice. It is interesting that constitutive over-expression of porcine USP18 in MARC-145 cells restricts PRRSV growth via early activation of NF-kB, which exists as a heterodimer consisting of a 50-kDa subunit (p50) and a 65-kDa subunit (p65). Supposedly, USP18 perturbs PRRSV growth by increasing and decreasing the nuclear translocation of p65 and p50, respectively (Xu, et al., 2012). In this study, the differential distribution and the broad expression of goUSP18 transcripts in goslings and adult geese may reflect its immune activity. The tissue distribution of goUSP18 in TMUV-infected goslings suggests that goUSP18 was highly up-regulated in tissues in which TMUV was located, which to some degree reflects the antiviral activity of goUSP18. Our results also show the up-regulation of goUSP18 transcripts during early TMUV infection appeared in the late phase, which echoes emerging evidence that Flaviviridae infection may delay or interfere with IFN-I transcriptional signaling during early infection (Grant, et al., 2016). Otherwise, its final elevation might be a consequence of virus proliferation. Taken together, the increasing USP18 transcription during TMUV replication may be required for the activation of the IFN-I and IFN-II signaling pathway. Namely, the increasing level of goUSP18 transcripts suggests its participation as an essential innate immune regulator molecule triggered by IFN. As a consequence, TMUV infection strongly triggers the transcription of goUSP18 both in vivo and in vitro, meaning goUSP18 might play an important role in TMUV developing strategies to escape host immune responses. Although conjugation ubiquitin ISG15 is missing in birds, the ubiquitin-like proteins of the goUSP18 gene homologous to human USP18 exactly existed. Understanding the host response in USP18 transcript levels to TMUV challenge and IFN treatment will facilitate the elucidation of TMUV pathogenesis and the development of a better strategy for controlling TMUV. As shown in Fig. 10, goUSP18 plays a key role in the host innate immune response to early viral infection and the IFN pathway. Further research is merited to illustrate whether goUSP18 plays a suppressive effect on antiviral ISG and assists the invading virus. ACKNOWLEDGEMENTS This work was funded by grants from the National Key Research and Development Program of China (2016YFD0500800); Integration and Demonstration of Key Technologies for Duck Industrial in Sichuan Province (2014NZ0030); and China Agricultural Research System (CARS-43-8). REFERENCES Arimoto K., Löchte S., Stoner S. A., Burkart C., Zhang Y., Miyauchi S., Wilmes S., Fan J., Heinisch J. J., Li Z.. 2017. STAT2 is an essential adaptor in USP18-mediated suppression of type I interferon signaling. Nat. Struct. Mol. Biol . 24: 279– 289. Google Scholar CrossRef Search ADS PubMed  Basters A., Ketscher L., Deuerling E., Arkona C., Rademann J., Knobeloch K. P., Fritz G.. 2012. High yield expression of catalytically active USP18 (UBP43) using a trigger factor fusion system. BMC Biotechnol.  12: 56. Google Scholar CrossRef Search ADS PubMed  Chen L., Li S., Mcgilvray I.. 2011. The ISG15/USP18 ubiquitin-like pathway (ISGylation system) in hepatitis C virus infection and resistance to interferon therapy. Int. J. Biochem. Cell Biol.  43: 1427– 1431. Google Scholar CrossRef Search ADS PubMed  Chen S., Luo G., Yang Z., Lin S., Chen S., Wang S., Goraya M. U., Chi X., Zeng X., Chen J. L.. 2016. Avian Tembusu virus infection effectively triggers host innate immune response through MDA5 and TLR3-dependent signaling pathways. Vet. Res.  47: 74. Google Scholar CrossRef Search ADS PubMed  Chen S., Zhang W., Zhou Q., Wang A., Sun L., Wang M., Jia R., Zhu D., Liu M., Sun K., Yang Q., Wu Y., Chen X., Cheng A.. 2017. Cross-species antiviral activity of goose interferon lambda against duck plague virus is related to its positive self-regulatory feedback loop. J. Gen. Virol.  98: 1455– 1466. Google Scholar CrossRef Search ADS PubMed  Colonne P. M., Sahni A., Sahni S. K.. 2013. Suppressor of cytokine signalling protein SOCS1 and UBP43 regulate the expression of type I interferon-stimulated genes in human microvascular endothelial cells infected with Rickettsia conorii. J. Med. Microbiol.  62: 968. Google Scholar CrossRef Search ADS PubMed  François-Newton V., Livingstone M., Payelle-Brogard B., Uzé G., Pellegrini S. 2012. USP18 establishes the transcriptional and anti-proliferative interferon α/β differential. Biochem. J.  446: 509– 516. Google Scholar CrossRef Search ADS PubMed  Fu G., Chen C., Yu H., Cheng L., Fu Q., Wan C., Shi S., Chen H., Wei L.. 2016. Comparative analysis of transcriptional profiles of retinoic-acid-induced gene I-like receptors and interferons in seven tissues from ducks infected with avian Tembusu virus. Arch. Virol.  161: 11– 18. Google Scholar CrossRef Search ADS PubMed  Grant A., Ponia S., Tripathi S., Balasubramaniam V., Miorin L., Sourisseau M., Schwarz M., Sánchez-Seco M. P., Evans M., Best S.. 2016. Zika virus targets human STAT2 to inhibit Type I interferon signaling. Cell Host Microbe . 19: 882– 890. Google Scholar CrossRef Search ADS PubMed  Hao Z., Chen S., Wang M., Jia R., Zhu D., Liu M., Fei L., Qiao Y., Ying W., Sun K.. 2016. Antigen distribution of TMUV and GPV are coincident with the expression profiles of CD8α-positive cells and goose IFNγ. Sci Rep . 6: 25545. Google Scholar CrossRef Search ADS PubMed  Honke N., Shaabani N., Zhang D. E., Hardt C., Lang K. S.. 2016. Multiple functions of USP18. Cell Death & Disease  7: e2444. Google Scholar CrossRef Search ADS PubMed  Lenschow D. J., Virgin H. W.. 2007. IFN-stimulated gene 15 functions as a critical antiviral molecule against Influenza, Herpes, and Sindbis Viruses. Proc. Natl. Acad. Sci. USA . 104: 1371– 1376. Google Scholar CrossRef Search ADS   Lindqvist R., Mundt F., Gilthorpe J. D., Wolfel S., Gekara N. O., Kroger A., Overby A. K.. 2016. Fast type I interferon response protects astrocytes from flavivirus infection and virus-induced cytopathic effects. J Neuroinflammation . 13: 277. Google Scholar CrossRef Search ADS PubMed  Liu M., Chen S., Chen Y., Liu C., Chen S., Yin X., Li G., Zhang Y.. 2012. Adapted Tembusu-like virus in chickens and geese in China. J. Clin. Microbiol . 50: 2807– 2809. Google Scholar CrossRef Search ADS PubMed  Magor K. E., Miranzo N. D., Barber M. R., Petkau K., Fleming-Canepa X., Blyth G. A., Blaine A. H.. 2013. Defense genes missing from the flight division. Dev. Comp. Immunol.  41: 377– 388. Google Scholar CrossRef Search ADS PubMed  Malakhova O. A., Kim K. I., Luo J. K., Zou W., Kumar K. G., Fuchs S. Y., Shuai K., Zhang D. E.. 2006. UBP43 is a novel regulator of interferon signaling independent of its ISG15 isopeptidase activity. EMBO J.  25: 2358– 2367. Google Scholar CrossRef Search ADS PubMed  Miao Z., Chen S., Wang M., Jia R., Zhu D., Liu M., Sun K., Qiao Y., Ying W., Chen X.. 2016. Molecular identification and comparative transcriptional analysis of myxovirus resistance GTPase (Mx) gene in goose (Ansercygnoide) after H9N2 AIV infection. Comp. Immunol. Microbiol. Infect. Dis.  47: 32– 40. Google Scholar CrossRef Search ADS PubMed  Mladinich M. C., Schwedes J., Mackow E. R.. 2017. Zika virus persistently infects and is basolaterally released from primary human brain microvascular endothelial cells. Mbio . 8: e00952– 17. Google Scholar CrossRef Search ADS PubMed  Morrison J., Laurent-Rolle M., Maestre A. M., Rajsbaum R., Pisanelli G., Simon V., Mulder L. C. F., Fernandez-Sesma A., García-Sastre A.. 2013. Dengue virus co-opts UBR4 to degrade STAT2 and antagonize Type I interferon signaling. PLoS Pathog.  9: e1003265. Google Scholar CrossRef Search ADS PubMed  Qian W., Wei X., Zhou H., Jin M.. 2016. Molecular cloning and functional analysis of duck ubiquitin-specific protease 18 (USP18) gene. Dev. Comp. Immunol.  62: 39– 47. Google Scholar CrossRef Search ADS PubMed  Qin Z., Chen S., Qi Y., Hao Z., Wang M., Jia R., Zhu D., Liu M., Fei L., Chen X.. 2015. Identification, characterization, and developmental expression pattern of Type III interferon receptor gene in the Chinese goose. 2015: 1– 11. Randall G., Chen L., Panis M., Fischer A. K., Lindenbach B. D., Sun J., Heathcote J., Rice C. M., Edwards A. M., Mcgilvray I. D.. 2006. Silencing of USP18 potentiates the antiviral activity of interferon against hepatitis C virus infection. Gastroenterology . 131: 1584– 1591. Google Scholar CrossRef Search ADS PubMed  Reid E., Charleston B.. 2014. Type I and III interferon production in response to RNA viruses. J. Interferon Cytokine Res.  34: 649– 658. Google Scholar CrossRef Search ADS PubMed  Ritchie K. J., Hahn C. S., Kim K. I., Yan M., Rosario D., Li L., Jc D. L. T., Zhang D. E.. 2004. Role of ISG15 protease UBP43 (USP18) in innate immunity to viral infection. Nat. Med.  10: 1374– 1378. Google Scholar CrossRef Search ADS PubMed  Schneider W. M., Chevillotte M. D., Rice C. M., 2014. Interferon-stimulated genes: A complex web of host defenses. Annu. Rev. Immunol . 32: 513– 545. Google Scholar CrossRef Search ADS PubMed  Sommereyns C., Paul S., Staeheli P., Michiels T.. 2008. IFN-lambda (IFN-lambda) is expressed in a tissue-dependent fashion and primarily acts on epithelial cells in vivo. PLoS Pathog . 4: e1000017. Google Scholar CrossRef Search ADS PubMed  Speer S. D., Li Z., Buta S., Payellebrogard B., Qian L., Vigant F., Rubino E., Gardner T. J., Wedeking T., Hermann M.. 2016. ISG15 deficiency and increased viral resistance in humans but not mice. Nat Commun . 7: 11496. Google Scholar CrossRef Search ADS PubMed  Wilmes S., Beutel O., Li Z., Francoisnewton V., Richter C. P., Janning D., Kroll C., Hanhart P., Hötte K., You C.. 2015. Receptor dimerization dynamics as a regulatory valve for plasticity of type I interferon signaling. J. Cell Biol.  209: 579– 593. Google Scholar CrossRef Search ADS PubMed  Xu D., Lillico S, Barnett M. W., Whitelaw B., Archibald A. L., Ait-Ali T.. 2012. USP18 restricts PRRSV growth through alteration of nuclear translocation of NF-kB p65 and p50 in MARC-145 cells. Virus Res.  169: 264– 267. Google Scholar CrossRef Search ADS PubMed  Yan Z., Shen H., Wang Z., Lin W., Xie Q., Bi Y., Chen F.. 2016. Isolation and characterization of a novel Tembusu virus circulating in muscovy ducks in south China. TransboundEmerg Dis . doi: 10.1111/tbed.12525 Yang C., Liu F., Chen S., Wang M., Jia R., Zhu D., Liu M., Sun K., Yang Q., Wu Y.. 2016. Identification of 2'-5'-oligoadenylate synthetase-like gene in goose: Gene structure, expression patterns, and antiviral activity against Newcastle disease virus. J. Interferon Cytokine Res.  36: 563– 572. Google Scholar CrossRef Search ADS PubMed  Yao Q., Fischer K. P., Arnesen K., Tyrrell D. L., Gutfreund K. S.. 2014. Molecular cloning, expression and characterization of Pekin duck interferon-lambda. Gene . 548: 29– 38. Google Scholar CrossRef Search ADS PubMed  Zhao C., Collins M., Hsiang T. Y., Krug R. M.. 2013. Interferon-induced ISG15 pathway: An ongoing virus–host battle. Trends Microbiol.  21: 181– 186. Google Scholar CrossRef Search ADS PubMed  Zhu K., Huang J., Jia R., Zhang B., Wang M., Zhu D., Chen S., Liu M., Yin Z., Cheng A.. 2015. Identification and molecular characterization of a novel duck Tembusu virus isolate from Southwest China. Archives of Virology . 160: 2781– 2790. Google Scholar CrossRef Search ADS PubMed  Zou W., Kim J. H., Handidu A., Li X., Kim K. I., Yan M., Li J., Zhang D. E.. 2007. Microarray analysis reveals that Type I interferon strongly increases the expression of immune-response related genes in Ubp43 (Usp18) deficient macrophages. Biochem. Biophys. Res. Commun.  356: 193– 199. Google Scholar CrossRef Search ADS PubMed  © 2017 Poultry Science Association Inc. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Molecular identification of goose (Anser cygnoide) suppressor ubiquitin-specific protease 18 (USP18) and the effects of goose IFN and TMUV on its comparative transcripts

Loading next page...
 
/lp/ou_press/molecular-identification-of-goose-anser-cygnoide-suppressor-ubiquitin-70bHBYdGVP
Publisher
Oxford University Press
Copyright
© 2017 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pex322
Publisher site
See Article on Publisher Site

Abstract

Abstract Ubiquitin-specific protease 18 (USP18) is known as an inhibition factor and has been associated with the innate immune response to pathogens. USP18 is the only deconjugating protease with specificity for interferon-stimulated gene 15 (ISG15), which is supposed to be missing in birds. To analyze the efficacy of goose USP18 (goUSP18) against Tembusu virus (TMUV) infection, we first cloned USP18 homologous cDNA from TMUV infected geese. The coding sequence was 1131 bp, and the deduced amino acid sequence shared conserved motifs with its homologues. Tissue-specific expression has shown that goUSP18 transcripts are strongly expressed in the spleen and liver of adult geese, as well as in the pancreas of goslings. Moreover, the goUSP18 transcripts were induced by goose interferons (goIFN) in goose embryo fibroblasts (GEF) and by TLR ligands in peripheral blood mononuclear cells (PBMC). Notably, goUSP18 transcripts were highly up-regulated by TMUV infection compared to the basal level in uninfected birds. Taken together, these results suggested that goUSP18 was involved in host innate immunity against TMUV infection. INTRODUCTION The suppressor of ubiquitin-specific peptidase 18 (USP18) is a member of the deubiquitinating (DUB) enzyme family. It was originally identified as an interferon (IFN)-inducible gene and was subsequently demonstrated to be a negative-feedback regulator of IFN-α, -β, and -γ. Types I and II interferons (IFN-I, IFN-II, respectively) are recognized by their cognate receptors, IFNAR and IFNGR, respectively, and secrete pleiotropic cytokines with antiviral, antiproliferative, and immunomodulatory properties (Garcia-Sastre, 2017; Lindqvist, et al., 2016), whereas the more recently identified type III IFN (IFN-III) binds to an unrelated cell-type restricted receptor (Sommereyns, et al., 2008; Yao, et al., 2014; Qin, et al., 2015). Via the classic JAK-STAT signaling pathway, IFN-I, IFN-II, and IFN-III exert their biological effects through mediation by terminal effectors, including antiviral effectors (Mx and OASL), positive regulators (cGAS and PKR), and negative regulators (SOCS-1 and USP18) (Reid and Charleston, 2014; Schneider et al., 2014). Importantly, IFN receptor plasticity can be regulated by USP18, which was previously shown to be a key determinant for the differential activity of interferons alpha, beta, and lambda (IFN-α, IFN-γ, IFN-λ, respectively) in regard to ligand binding affinity (François-Newton, et al., 2012). Hence, exploring the immune role of USP18 will pave the way to the elucidation of the regulatory mechanism of the IFN pathway. Structurally, USP18 possesses 2 functional domains: one consists of Cys and His boxes responsible for isopeptidase activity, and the other one inhibits interferon signaling by binding the IFN receptor subunit (Honke, et al., 2016). Functionally, specific USP18 protease generally can cleave interferon-stimulated gene 15 (ISG15) conjugation, which is a ubiquitin-like protein that can be highly up-regulated by IFN treatment. Interestingly, this protein also functions in down-regulating IFN responses independent of its isopeptidase activity towards ISG15 (Malakhova, et al., 2006). However, bird ISG15 is supposed to be missing, for no genes homologous to human ISG15 have been annotated in any of the available avian genomes (Magor, et al., 2013). The lack of ISG15 in birds motivated us to examine the many facets of goose USP18 (goUSP18). USP18 also has been implicated in immune evasion of several viral infections (Xu, et al., 2012; Mladinich et al., 2017). It is desirable to determine the exact regulation of goUSP18 transcripts upon Tembusu virus (TMUV) infection. TMUV is an enveloped RNA virus in the Flaviviridae family that plagues only poultry. TMUV has been reported in ducks, chickens, and geese (Liu, et al., 2012; Yan, et al., 2016), and there are several reports about host innate immune responses to TMUV infection (Chen, et al., 2016; Fu, et al., 2016; Hao, et al., 2016). However, the interaction between TMUV and host immunity is not clear. Different stimulation from the virus or IFN could reflect diverse roles of goUSP18. In this context, an important step forward for further understanding these immunological characteristics is describing the quality and quantity of stimulation and infection diversification. Here, we explore tissue specificity, age-related dependency of goUSP18, and the difference between TMUV and IFN on goUSP18 transcripts. These findings may shed further light on goUSP18 immune responses in this species. MATERIALS AND METHODS Cells, Viruses, Regents, and Animals Peripheral blood mononuclear cells (PBMC) were isolated using the Animal Peripheral Blood Mononuclear Cells Separation Medium kit (TBD sciences, China) from adult geese and guaranteed at a high purity of 80%. According to the instructions, 20 mL of blood were collected from the jugular veins of each of the 3 adult geese. Finally, the sediment of PBMC was mixed and resuspended in 1 mL RPMI 1640 medium (Gibco). Goose embryo fibroblasts (GEF) were produced from 10-day-old goose embryos and maintained at 37°C and 5.0% CO2 in Dulbecco's Modified Eagle's medium (DMEM; Mediatech, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Australia). The cells were at approximately 80% confluence, then treated with agonists or viruses, and samples were collected at an indicated time point post infection (hpi.). The TMUV strain (accession: KM233707) was propagated in GEF and determined at 6.3 × 106 TCID50/100 μL using 50% tissue culture infection dose (TCID50) titration assays (Zhu, et al., 2015). The previously confirmed antiviral activity of recombinant goose IFN (goIFN) was generated by a pCDNA3.1 prokaryotic expression system in baby hamster kidney (BHK21) cells (Chen, et al., 2017). Polyinosinic–polycytidylic acid (Poly [I:C], Sigma, USA) can mimic treatment with double-stranded RNA. R848 (InvivoGen, USA) is an imidazoquinoline compound with potent anti-viral activity via the TLR7/TLR8 MyD88-dependent signaling pathway, and LPS (InvivoGen, USA) mediated by TLR4 is an important virulence factor that activates the innate immune system. For the viral challenge experiment, 1 μL of TMUV (6.3 × 106 TCID50/100μL in PBS) per gram body weight was injected intramuscularly. Control animals were injected with PBS. Four goslings per group were daily anesthetized to collect sample tissues for mRNA extraction. Additionally, another 4 goslings in each group were artificially infected with gosling plague virus (GPV) and injected intramuscularly with PBS to serve as the control group. The GPV titers were determined as the median egg infectious dose (106.6 EID50/200μL). Three d later, the selected tissues were collected. All the one-week-old healthy goslings and adult geese were purchased from the breeding center of Sichuan Agricultural University, Yaan City, China, and were maintained and observed for 3 d in laboratory animal rooms prior to experimentation. The welfare of the animals was ensured during the sampling process. Gene Cloning and Sequence Analysis Based on the predicted sequence from National Center for Biotechnology Information (NCBI accession number: XM_01,317,2965), the coding sequence of goUSP18 cDNA was cloned from the liver of TMUV-infected goslings using the primers F1/R1 and identified with sequencing (all primers used are shown in Table 1). The ExPASy ProtParam tool was utilized to compute the amino acid sequences, protein molecular weight (MW), and isoelectric point (PI), and to perform the hydropathy analysis of goUSP18 (http://us.expasy.org/tools/protparam.html). The predicted secondary structure of goUSP18 was estimated using Jpred4 (http://www.compbio.dundee.ac.uk/jpred4/results/jp_JsJuDJ0/jp_JsJuDJ0.simple.html). The subcellular localization of goUSP18 was predicted by NLS mapper (http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi). The conserved motifs of goUSP18 were identified by the online tool motif scan (http://myhits.isb-sib.ch/cgi-bin/PFSCAN). Sequences were obtained from GenBank and aligned with the ClustalW multiple alignment program (http://www.ebi.ac.uk/Tools/msa/clustalw2); the N-J phylogenetic tree was made by the MEGA6 program using a Jones-Taylor-Thornton (JTT) model and modified with the Figtree software. Tissue Distribution of goUSP18 mRNA Expression Levels in Goslings and Geese To study the tissue expression profiles of goUSP18, adult geese and goslings were prepared for the collection of biological samples, including the brain (B), bursa of Fabricius (BF), cecum (CE), cecal tonsil (CT), gizzard (GI), heart (H), harderian gland (HG), kidney (K), liver (LI), lung (LU), pancreas (P), proventriculus (PR), small intestine (SI), and spleen (SP). Transcript levels were measured using qRT-PCR with the goUSP18-specific primers F2/R2 ( Table 1). The data were analyzed by the 2−ΔΔCt method, and expression of the target gene was normalized to GAPDH mRNA levels in the same samples. Total RNA was extracted using Trizol reagent according to the manufacturer's instructions. RNA concentrations were determined by measuring their absorbance at 260 nm and 280 nm using a Thermo Scientific NanoDrop 2000. An equal quantity of 1 μg cDNA was instantly synthesized using the HiScript1st Strand cDNA Synthesis Kit (Vazyme, USA) for qRT-PCR and stored at −80 °C according to the manufacturer's instructions. The viral copy number in TMUV-infected gosling tissues was quantified using qRT-PCR through the standard curve: Y = 39.995–3.529 logX. Transcriptional Level Analysis of goUSP18 in PBMC Stimulated with Agonists Three biological replicates and technological replicates per agonist of PBMC (5 × 106/mL) were isolated from the peripheral blood of adult geese and seeded in 12-well plates overnight before stimulation. Cells were subsequently incubated with LPS (25 μg/mL), R848 (5 μg/mL), or Poly (I: C) (30 μg/mL) and collected after 6 h with 3 replicates per treatment. Evaluating goUSP18 mRNA Level Against IFN and TMUV To explore the immune characteristics and transcript levels of goUSP18 in vitro, GEF were placed in 12-well plates, and an equal quantity of proteins of IFN proteins was added in the logarithmic phase. Cells were harvested at 6, 12, 24, 36, or 48 hpi. To explore the effects of TMUV virus on goUSP18 expression in vivo, the relative gene expression levels of goUSP18 in the challenged 3-day-old goslings were determined at 1 d post inoculation (dpi), 2dpi, 3dpi, and 4 dpi. Data are represented as the mean with SD in all bar graphs. Statistically significant differences between the 2 groups were analyzed using an unpaired Student's t test in GraphPad Prism version 5 (GraphPad software, San Diego, CA). Extremely significantly up-regulated (***P < 0.001), significantly up-regulated (**P < 0.01), and up-regulated treated groups in all virus-infected groups (*P < 0.05) compared to the control group are marked in the figures. Ethics Statement The animal studies were approved by the Institutional Animal Care and Use Committee of Sichuan Agricultural University (No. XF2014–18) and followed the National Institutes of Health guidelines for the performance of animal experiments. RESULTS Molecular Identification of goUSP18 The cloned goUSP18 was 1,131 bp long (GenBank ID: KY012333), encoding 376 amino acid residues with a theoretical molecular mass of 43.5 kDa and an isoelectric point of 8.04. It is rich in helix and β-pleated sheet (Fig. 1), presents a classic bipartite nuclear localization signals, and harbors a Cys-box and a His-box with a conserved putative active-site cysteine at the 66th position and histidine at the 321st position, which are both essential for the catalytic properties of USP18 (Fig. 2, Fig. 3a). The IFNAR2 binding domain facilitates interaction with the intracellular domain of the IFNAR2 subunit (Fig. 3a). In addition, the primary amino acid sequence of goUSP18 harbors all the structural motifs of a DUB enzyme (Fig. 3b). We conclude that goUSP18 might be a member of DUB enzyme family. Figure 1. View largeDownload slide Secondary structure of goUSP18 protein. Based on the cloned sequence (GenBank ID: KY012333), the secondary structure is predicted by the online server of JPRED4. The α-helix and β-pleated sheets are marked in green wavy lines and red columns, respectively. Figure 1. View largeDownload slide Secondary structure of goUSP18 protein. Based on the cloned sequence (GenBank ID: KY012333), the secondary structure is predicted by the online server of JPRED4. The α-helix and β-pleated sheets are marked in green wavy lines and red columns, respectively. Figure 2. View largeDownload slide Multiple alignment analysis of USP18 family from various animals based on primary amino acid sequences. Each sequence was obtained from the database (accession no: Gallus gallus USP18, XP_0,049,38016; Anas platyrhynchos USP18, XP_0,050,09988; Susscrofa USP18, NP_998,991; Homo sapiens USP18, NP_05,9110; Danio rerio USP18, XP_0,026,61398). The bipartite nuclear localization signals predicted by the online software of NLS mapper are shown in black bold and italic type. The classical Cys-box, a His-box, and IFAGR binding domain are indicated in red, green, and blond, respectively. The active-sites cysteine at 66th position and histidine at 321st position, which are both essential for the catalytic property of USP18, are shown in light blue shadow. Figure 2. View largeDownload slide Multiple alignment analysis of USP18 family from various animals based on primary amino acid sequences. Each sequence was obtained from the database (accession no: Gallus gallus USP18, XP_0,049,38016; Anas platyrhynchos USP18, XP_0,050,09988; Susscrofa USP18, NP_998,991; Homo sapiens USP18, NP_05,9110; Danio rerio USP18, XP_0,026,61398). The bipartite nuclear localization signals predicted by the online software of NLS mapper are shown in black bold and italic type. The classical Cys-box, a His-box, and IFAGR binding domain are indicated in red, green, and blond, respectively. The active-sites cysteine at 66th position and histidine at 321st position, which are both essential for the catalytic property of USP18, are shown in light blue shadow. Figure 3. View largeDownload slide Sequence analysis of goUSP18 functional domains. (a) Conserved function domains of goUSP18 protein characterized by the isopetidase activity site and IFNAR-binding site. The classical Cys-box, a His-box, and IFAGR binding domain are indicated in the insert weblogo pictures (http://weblogo.berkeley.edu/logo.cgi). The multiple sequence alignment includes USP18 amino acid sequences of Carassius auratus, Anas platyrhynchos, Gallus gallus, Mus musculus, Susscrofa, and Homo sapiens. (b) Conserve structural motifs of goUSP18. Figure 3. View largeDownload slide Sequence analysis of goUSP18 functional domains. (a) Conserved function domains of goUSP18 protein characterized by the isopetidase activity site and IFNAR-binding site. The classical Cys-box, a His-box, and IFAGR binding domain are indicated in the insert weblogo pictures (http://weblogo.berkeley.edu/logo.cgi). The multiple sequence alignment includes USP18 amino acid sequences of Carassius auratus, Anas platyrhynchos, Gallus gallus, Mus musculus, Susscrofa, and Homo sapiens. (b) Conserve structural motifs of goUSP18. To gain insight into goUSP18 evolution, a phylogenetic tree was constructed based on the conserved sequences and amino acid sequences of various animals that were obtained from GenBank (Table 2). The aligned sequences have been bootstrapped 1,000 times, and only bootstrap values higher than 40 were considered for the consensus tree. The phylogenetic analysis showed that avian USP18 protein sequences are in the same subgroup (Fig. 4). Mammalian USP18 were in another subgroup, and fish USP18 were in a third subgroup. USP22, a member of the DUB family, was chosen as the out group. This finding reinforces the hypothesis that goUSP18 is homologous to USP18 of other species annotated in GenBank. Figure 4. View largeDownload slide Evolution analysis of goUSP18. The same clades are marked in one color, and goUSP18 is in gray background. Phylogenetic tree was constructed based on those sequences listed in Table 1. In addition, the USP22 gene is chosen as outgroup. The selected species are mammals, including human, orangutan, mouse, pig, dog, and cattle and fish species. Evolution analysis was conducted in MEGA6.0 in the method of the neighbor-joining algorithm and a Jukes–Cantor distance model, with the aligned sequences bootstrapped for 1,000 times; only the bootstrap values higher than 50% were taken into consideration for the consensus tree. Figure 4. View largeDownload slide Evolution analysis of goUSP18. The same clades are marked in one color, and goUSP18 is in gray background. Phylogenetic tree was constructed based on those sequences listed in Table 1. In addition, the USP22 gene is chosen as outgroup. The selected species are mammals, including human, orangutan, mouse, pig, dog, and cattle and fish species. Evolution analysis was conducted in MEGA6.0 in the method of the neighbor-joining algorithm and a Jukes–Cantor distance model, with the aligned sequences bootstrapped for 1,000 times; only the bootstrap values higher than 50% were taken into consideration for the consensus tree. Table 1. List of primer sequences in this study. Primer name  Nucleotide sequence  goUSP18–1 F1  ATGGGCCAAAGAAGTGGAC  goUSP18–1 R1  CTACTGGGGATGCTTTTTCA  goUSP18–1 F2  GACAGAACAGCAGAGCCAAGC  goUSP18–1 R2  TCCCACGATACCTGACAAACG  goGAPDH-qPCR-F  CATTTTCCAGGAGCGTGACC  goGAPDH-qPCR-R  AGACACCAGTAGACTCCACA  Primer name  Nucleotide sequence  goUSP18–1 F1  ATGGGCCAAAGAAGTGGAC  goUSP18–1 R1  CTACTGGGGATGCTTTTTCA  goUSP18–1 F2  GACAGAACAGCAGAGCCAAGC  goUSP18–1 R2  TCCCACGATACCTGACAAACG  goGAPDH-qPCR-F  CATTTTCCAGGAGCGTGACC  goGAPDH-qPCR-R  AGACACCAGTAGACTCCACA  View Large Table 2. Identity of deduced amino acid sequences of goUSP18 cDNA among species. GenBank ID of sequences used for constructing phylogenetic tree are listed here. Classes  Accession number  Species  Identity  Fish  XP_01,734,9594  Ctalurus punctatus  29.49%    XP_0,026,61398  Danio rerio  29.17%    ABC86864  Carassius auratus  27.53%  Birds  XP_0,055,00407  Columba livia  67.55%    XP_01,000,1300  Chaetura pelagica  62.39%    XP_0,096,46205  Egretta garzetta  78.80%    XP_0,050,09988  Anas platyrhynchos  89.50%    XP_0,049,38016  Gallus gallus  76.90%    XP_01,071,2227  Meleagris gallopavo  75.33%  Mammals  NP_05,9110  Homo sapiens  50.39%    XP_0,011,64261XP_0,056,37457  Pan troglodytesCanis lupus familiaris  50.79%48.03%    NP_0,010,17940  Bos taurus  47.24%    NP_998,991  Sus scrofa  45.93%  Rodents  NP_03,6039  Mus musculus  48.03%    NP_0,010,14080  Rattus norvegicus  47.24%  Amphilia  XP_0,049,12550  Xenopus tropicalis  37.80%  Classes  Accession number  Species  Identity  Fish  XP_01,734,9594  Ctalurus punctatus  29.49%    XP_0,026,61398  Danio rerio  29.17%    ABC86864  Carassius auratus  27.53%  Birds  XP_0,055,00407  Columba livia  67.55%    XP_01,000,1300  Chaetura pelagica  62.39%    XP_0,096,46205  Egretta garzetta  78.80%    XP_0,050,09988  Anas platyrhynchos  89.50%    XP_0,049,38016  Gallus gallus  76.90%    XP_01,071,2227  Meleagris gallopavo  75.33%  Mammals  NP_05,9110  Homo sapiens  50.39%    XP_0,011,64261XP_0,056,37457  Pan troglodytesCanis lupus familiaris  50.79%48.03%    NP_0,010,17940  Bos taurus  47.24%    NP_998,991  Sus scrofa  45.93%  Rodents  NP_03,6039  Mus musculus  48.03%    NP_0,010,14080  Rattus norvegicus  47.24%  Amphilia  XP_0,049,12550  Xenopus tropicalis  37.80%  View Large Transcript Expression Pattern of goUSP18 in One-week-old Goslings and Adult Geese Tissue-specific expression in normal tissues was analyzed using RT-qPCR. The goUSP18 mRNA was constitutively expressed in all tissues analyzed (Fig. 5). The lowest levels were seen in the brain, heart, and kidney, with higher levels in the cecum, cecal tonsil, gizzard, spleen, and pancreas. The highest levels were in the liver, harderian gland, and lung. In short, goUSP18 transcripts were strongly expressed in the spleen and liver of adult geese and in the pancreas of goslings. This observation of tissue profiles is partially consistent with the GEO profiles of in the NCBI Unigene database (http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi). In general, the tissue-specific expression in adult geese is comparatively higher than in goslings. Figure 5. View largeDownload slide Tissue expression pattern of goUSP18. The goUSP18 mRNA levels of one-week-old goslings and adult geese were quantified by real-time quantitative PCR (RT-qPCR) with goose GAPDH serving as control gene. Data were analyzed by GraphPad Prism software and represented as the mean ± SEM (n = 3). Tissue samples included brain (B), bursa of Fabricius (BF), cecum (CE), cecal tonsil (CT), gizzard (GI), heart (H), harderian gland (HG), kidney (K), liver (LI), lung (LU), pancreas (P), proventriculus (PR), small intestine (SI), and spleen (SP). Figure 5. View largeDownload slide Tissue expression pattern of goUSP18. The goUSP18 mRNA levels of one-week-old goslings and adult geese were quantified by real-time quantitative PCR (RT-qPCR) with goose GAPDH serving as control gene. Data were analyzed by GraphPad Prism software and represented as the mean ± SEM (n = 3). Tissue samples included brain (B), bursa of Fabricius (BF), cecum (CE), cecal tonsil (CT), gizzard (GI), heart (H), harderian gland (HG), kidney (K), liver (LI), lung (LU), pancreas (P), proventriculus (PR), small intestine (SI), and spleen (SP). Agonists Up-regulated goUSP18 Transcripts in PBMC In order to identify the role of goUSP18 in the early immune response, we took advantage of the availability of PBMC, a perfect immune response system. The treatment of agonists R848, Poly (I:C) or LPS can mimic single-stranded RNA, double-stranded RNA, and lipopolysaccharide of pathogens, respectively. The mRNA levels of goUSP18 in PBMC were significantly up-regulated in LPS-, R848-, and Poly (I:C)-treated cells (Fig. 6). Figure 6. View largeDownload slide Effects of different agnoists on goUSP18 mRNA expression in PBMC. The cell density was adjusted as 5 × 106/mL. The final concentrations of each agonist (Poly (I: C), LPS, and R848) were used at 30 μg/mL, 25 μg/mL and 5 μg/mL, respectively. The statistical analysis was performed in GraphPad Prism using unpaird two-tailed t tests: *P < 0.05; **P < 0.01; ***P < 0.001. Figure 6. View largeDownload slide Effects of different agnoists on goUSP18 mRNA expression in PBMC. The cell density was adjusted as 5 × 106/mL. The final concentrations of each agonist (Poly (I: C), LPS, and R848) were used at 30 μg/mL, 25 μg/mL and 5 μg/mL, respectively. The statistical analysis was performed in GraphPad Prism using unpaird two-tailed t tests: *P < 0.05; **P < 0.01; ***P < 0.001. Differential Regulation of goUSP18 by 3 Types of Goose IFN and TMUV The purpose of this study was to determine the expression profiles of goUSP18 in response to TMUV infection and treatment with 3 types of goIFN. Precise quantification of the mRNA expression in the stimulation analysis suggested that the storm effect of goUSP18 transcripts after treatment with IFNλ was less strong than that after treatment with IFNα and IFNγ. The same was true of the Poly (I:C)-treated group. Not only that, but the goUSP18 transcripts of the IFNλ-treated group decreased over time. Furthermore, the goUSP18 mRNA was up-regulated by goose IFNα and IFNγ treatments, which persisted for the whole experimental time, whereas goUSP18 mRNA was up-regulated only within 24 h in Poly (I:C)- and IFNλ- treated GEF (Fig. 7a). In conclusion, our research indicates that goUSP18 is stimulated by goose IFNα, IFNγ, and IFNλ, which may behave non-redundantly in their potency to exert specific bioactivities. Figure 7. View largeDownload slide Time course study of the effects of goose IFN and TMUV on goUSP18 transcripts. (a) GEF was stimulated with 3 types of IFN, and Poly (I: C) was used as a positive group. (b) GEF was inoculated with TMUV at a volume of 100μL (6.3 × 106 TCID50/100μL). The statistical analysis was performed in GraphPad Prism using unpaird two-tailed t tests: *P < 0.05; **P < 0.01; ***P < 0.001. Figure 7. View largeDownload slide Time course study of the effects of goose IFN and TMUV on goUSP18 transcripts. (a) GEF was stimulated with 3 types of IFN, and Poly (I: C) was used as a positive group. (b) GEF was inoculated with TMUV at a volume of 100μL (6.3 × 106 TCID50/100μL). The statistical analysis was performed in GraphPad Prism using unpaird two-tailed t tests: *P < 0.05; **P < 0.01; ***P < 0.001. Transcripts of goUSP18 were significantly increased during the late phases of TMUV infection in GEF. Our results showed barely any increase and a sharp increase in the mRNA level of goUSP18 in TMUV-infected GEF cells in early and late infection, respectively (Fig. 7b). Collectively, the up-regulation of the goUSP18 transcript was observed as an early response to the IFN treatment, as well as in the late response to TMUV infection. The Strongly Elevated goUSP18 mRNA Expression Upon TMUV Infection Host innate immune responses play a key role against early viral infection. From the perspective of the inhibition effect of the Flaviviridae family on the IFN signaling pathway (Conde, et al., 2017; Morrison, et al., 2013; Grant, et al., 2016), we explored the reaction of goUSP18 upon TMUV infection in vivo (Fig. 8). The effect of viral replication on goUSP18 induction appears to be consistent among different viruses and different tissues until 4 dpi (refer to the supplement Fig. 9). Efficient replication of TMUV in different tissues is demonstrated by TMUV copy number (Fig. 8). Of note, goUSP18 mRNA in the brain and spleen were not rapidly and significantly up-regulated at 1 dpi. Figure 8. View largeDownload slide Endogenous goUSP18 transcripts during TMUV infection. Goslings were injected with 100μL of TMUV (6.3 × 106 TCID50/100μL) or PBS, per gram body weight, then tissues of 4 infected goslings per group were collected, and mRNA levels of goUSP18 were quantified by RT-qPCR with the GAPDH as control gene. Data were represented as the mean ± SEM (n = 4). The taking-samples time was at an interval of one day. GoUSP18 mRNA expressions were tested in various tissues including brain (B), LI (liver), pancreas (P), spleen (SP), thymus (T), and blood (BL). The statistical analysis was performed in GraphPad Prism using unpaird two-tailed t tests: *P < 0.05; **P < 0.01; ***P < 0.001. Figure 8. View largeDownload slide Endogenous goUSP18 transcripts during TMUV infection. Goslings were injected with 100μL of TMUV (6.3 × 106 TCID50/100μL) or PBS, per gram body weight, then tissues of 4 infected goslings per group were collected, and mRNA levels of goUSP18 were quantified by RT-qPCR with the GAPDH as control gene. Data were represented as the mean ± SEM (n = 4). The taking-samples time was at an interval of one day. GoUSP18 mRNA expressions were tested in various tissues including brain (B), LI (liver), pancreas (P), spleen (SP), thymus (T), and blood (BL). The statistical analysis was performed in GraphPad Prism using unpaird two-tailed t tests: *P < 0.05; **P < 0.01; ***P < 0.001. Figure 9. View largeDownload slide Analyses of the mRNA expression patterns post-GPV infection in vivo. The selected tissues included brain (B), bursa of Fabricius (BF), cecum (CE), cecal tonsil (CT), harderian gland (HG), lung (LU), small intestine (SI), thymus (T), and spleen (SP). GAPDH was employed as an internal control. Asterisks (*) mark the significant difference between experimental and control groups. (*P < 0.05; **P < 0.01; ***P < 0.001.) Error bars indicate standard error. Figure 9. View largeDownload slide Analyses of the mRNA expression patterns post-GPV infection in vivo. The selected tissues included brain (B), bursa of Fabricius (BF), cecum (CE), cecal tonsil (CT), harderian gland (HG), lung (LU), small intestine (SI), thymus (T), and spleen (SP). GAPDH was employed as an internal control. Asterisks (*) mark the significant difference between experimental and control groups. (*P < 0.05; **P < 0.01; ***P < 0.001.) Error bars indicate standard error. Overall, the up-regulation of goUSP18 transcript levels occurred in those tissues in which TMUV stock is abundantly persistent. Finally, whether or not the presence of USP18 under TMUV challenge altered the cytokine profile and IFN effect still remains unknown. DISCUSSION In this study, we demonstrated that TMUV induced a USP18 counterpart in goose and identified goUSP18 as a critical mediator of both TMUV infection and IFN stimulation (Fig. 10). Furthermore, significant differences in goose IFNα, IFNγ, IFNλ, and TMUV in regulating goUSP18 also were found. Notably, the elevation of USP18 transcripts in different tissues of TMUV-infected goslings is also obvious in vivo. Taken together, these results suggest that the up-regulation of transcripts goUSP18 may involve goose innate immune responses against TMUV infection. Figure 10. View largeDownload slide USP18-centered relationship network. The red solid lines indicate the positive effects of goose IFN and TMUV on goUSP18 comparative transcripts, while the green dotted lines indicate USP18 feedback on TMUV or IFN, and other black dotted lines indicate previous literatures. All the dotted lines demanded deeper research. The “+” and “–” indicate the positive feedback and negative feedback, respectively. Figure 10. View largeDownload slide USP18-centered relationship network. The red solid lines indicate the positive effects of goose IFN and TMUV on goUSP18 comparative transcripts, while the green dotted lines indicate USP18 feedback on TMUV or IFN, and other black dotted lines indicate previous literatures. All the dotted lines demanded deeper research. The “+” and “–” indicate the positive feedback and negative feedback, respectively. ISG15-conjugated protein expression can be induced by viral infection and IFN (Lenschow and Virgin, 2007; Zhao, et al., 2013), and USP18 is the only deconjugating protease with specificity for ISG15 and controls the reversible ISGylation enzymatic cascade (Ritchie, et al., 2004; Speer, et al., 2016). Although the difference between wild-type and USP18 knockout cells in their susceptibility to the invading virus is partly associated with ISGylation (Malakhova, et al., 2006; Zou, et al., 2007), the ISG15 gene is unfortunately missing in avian genomes (Magor, et al., 2013). In this study, goUSP18 was significantly up-regulated by TMUV and agonists in goose cells and in goslings without the ISG15ylation system. Here, the increased transcripts suggest that goUSP18 regulated by viruses and reagents is independent of the ISG15ylation system. Generally, ISG resembles a Swiss army knife, including antimicrobial effectors and negative and positive regulators of the IFN signaling. Previous studies have shown an increasing interest in antiviral proteins of goose innate immunity, such as Mx, OASL, and IFITM (Colonne, et al., 2013; Miao, et al., 2016; Yang, et al., 2016). USP18 has been discovered to be not only an isopeptidase, but also a potent inhibitor of interferon signaling. Recently, the role of mammalian USP18 in viral infections was comprehensively studied (Ritchie, et al., 2004; Chen, et al., 2011; Basters, et al., 2012). Qian et al also identified duck USP18 as a negative regulator mediated by NF-kB activation (Qin, et al., 2015), but little is known about the role of USP18 in the goose immune system. Previous studies revealed that upon LPS stimulation, IFN treatment and virus infection all strongly increase goUSP18 mRNA. At the same time, USP18 has been demonstrated as necessary and sufficient to induce differential desensitization of different types of IFN, namely, IFNβ would retain activity on USP18-expressing cells owing to IFNβ’s higher affinity for the receptor. Conversely, the immune activity of IFNα, being a low-binding affinity, is impaired in cells expressing USP18 (Arimoto, et al., 2017). The mutual regulatory relationship of IFN and USP18 may inform us about the homeostatic mechanism between them. Based on our data, we also hypothesize that USP18 coexists alongside IFN, regardless of ISG15ylation. Unlike goose IFNα and IFNγ, the transcript level of goUSP18 induced by IFNλ was comparatively low and short-term. USP18 knockout mice were more efficiently resistant to fatal lymphocytic choriomeningitis virus (LCMV) or vesicular stomatitis virus (VSV) than wild-type mice (Ritchie, et al., 2004). Silencing USP18 also potentiated the antiviral activity of IFN against hepatitis C virus infection (Randall, et al., 2006). Furthermore, the growth of LCMV was effectively restricted in both mouse embryonic fibroblasts (MEF) and bone marrow-derived macrophages from USP18 knockout mice. It is interesting that constitutive over-expression of porcine USP18 in MARC-145 cells restricts PRRSV growth via early activation of NF-kB, which exists as a heterodimer consisting of a 50-kDa subunit (p50) and a 65-kDa subunit (p65). Supposedly, USP18 perturbs PRRSV growth by increasing and decreasing the nuclear translocation of p65 and p50, respectively (Xu, et al., 2012). In this study, the differential distribution and the broad expression of goUSP18 transcripts in goslings and adult geese may reflect its immune activity. The tissue distribution of goUSP18 in TMUV-infected goslings suggests that goUSP18 was highly up-regulated in tissues in which TMUV was located, which to some degree reflects the antiviral activity of goUSP18. Our results also show the up-regulation of goUSP18 transcripts during early TMUV infection appeared in the late phase, which echoes emerging evidence that Flaviviridae infection may delay or interfere with IFN-I transcriptional signaling during early infection (Grant, et al., 2016). Otherwise, its final elevation might be a consequence of virus proliferation. Taken together, the increasing USP18 transcription during TMUV replication may be required for the activation of the IFN-I and IFN-II signaling pathway. Namely, the increasing level of goUSP18 transcripts suggests its participation as an essential innate immune regulator molecule triggered by IFN. As a consequence, TMUV infection strongly triggers the transcription of goUSP18 both in vivo and in vitro, meaning goUSP18 might play an important role in TMUV developing strategies to escape host immune responses. Although conjugation ubiquitin ISG15 is missing in birds, the ubiquitin-like proteins of the goUSP18 gene homologous to human USP18 exactly existed. Understanding the host response in USP18 transcript levels to TMUV challenge and IFN treatment will facilitate the elucidation of TMUV pathogenesis and the development of a better strategy for controlling TMUV. As shown in Fig. 10, goUSP18 plays a key role in the host innate immune response to early viral infection and the IFN pathway. Further research is merited to illustrate whether goUSP18 plays a suppressive effect on antiviral ISG and assists the invading virus. ACKNOWLEDGEMENTS This work was funded by grants from the National Key Research and Development Program of China (2016YFD0500800); Integration and Demonstration of Key Technologies for Duck Industrial in Sichuan Province (2014NZ0030); and China Agricultural Research System (CARS-43-8). REFERENCES Arimoto K., Löchte S., Stoner S. A., Burkart C., Zhang Y., Miyauchi S., Wilmes S., Fan J., Heinisch J. J., Li Z.. 2017. STAT2 is an essential adaptor in USP18-mediated suppression of type I interferon signaling. Nat. Struct. Mol. Biol . 24: 279– 289. Google Scholar CrossRef Search ADS PubMed  Basters A., Ketscher L., Deuerling E., Arkona C., Rademann J., Knobeloch K. P., Fritz G.. 2012. High yield expression of catalytically active USP18 (UBP43) using a trigger factor fusion system. BMC Biotechnol.  12: 56. Google Scholar CrossRef Search ADS PubMed  Chen L., Li S., Mcgilvray I.. 2011. The ISG15/USP18 ubiquitin-like pathway (ISGylation system) in hepatitis C virus infection and resistance to interferon therapy. Int. J. Biochem. Cell Biol.  43: 1427– 1431. Google Scholar CrossRef Search ADS PubMed  Chen S., Luo G., Yang Z., Lin S., Chen S., Wang S., Goraya M. U., Chi X., Zeng X., Chen J. L.. 2016. Avian Tembusu virus infection effectively triggers host innate immune response through MDA5 and TLR3-dependent signaling pathways. Vet. Res.  47: 74. Google Scholar CrossRef Search ADS PubMed  Chen S., Zhang W., Zhou Q., Wang A., Sun L., Wang M., Jia R., Zhu D., Liu M., Sun K., Yang Q., Wu Y., Chen X., Cheng A.. 2017. Cross-species antiviral activity of goose interferon lambda against duck plague virus is related to its positive self-regulatory feedback loop. J. Gen. Virol.  98: 1455– 1466. Google Scholar CrossRef Search ADS PubMed  Colonne P. M., Sahni A., Sahni S. K.. 2013. Suppressor of cytokine signalling protein SOCS1 and UBP43 regulate the expression of type I interferon-stimulated genes in human microvascular endothelial cells infected with Rickettsia conorii. J. Med. Microbiol.  62: 968. Google Scholar CrossRef Search ADS PubMed  François-Newton V., Livingstone M., Payelle-Brogard B., Uzé G., Pellegrini S. 2012. USP18 establishes the transcriptional and anti-proliferative interferon α/β differential. Biochem. J.  446: 509– 516. Google Scholar CrossRef Search ADS PubMed  Fu G., Chen C., Yu H., Cheng L., Fu Q., Wan C., Shi S., Chen H., Wei L.. 2016. Comparative analysis of transcriptional profiles of retinoic-acid-induced gene I-like receptors and interferons in seven tissues from ducks infected with avian Tembusu virus. Arch. Virol.  161: 11– 18. Google Scholar CrossRef Search ADS PubMed  Grant A., Ponia S., Tripathi S., Balasubramaniam V., Miorin L., Sourisseau M., Schwarz M., Sánchez-Seco M. P., Evans M., Best S.. 2016. Zika virus targets human STAT2 to inhibit Type I interferon signaling. Cell Host Microbe . 19: 882– 890. Google Scholar CrossRef Search ADS PubMed  Hao Z., Chen S., Wang M., Jia R., Zhu D., Liu M., Fei L., Qiao Y., Ying W., Sun K.. 2016. Antigen distribution of TMUV and GPV are coincident with the expression profiles of CD8α-positive cells and goose IFNγ. Sci Rep . 6: 25545. Google Scholar CrossRef Search ADS PubMed  Honke N., Shaabani N., Zhang D. E., Hardt C., Lang K. S.. 2016. Multiple functions of USP18. Cell Death & Disease  7: e2444. Google Scholar CrossRef Search ADS PubMed  Lenschow D. J., Virgin H. W.. 2007. IFN-stimulated gene 15 functions as a critical antiviral molecule against Influenza, Herpes, and Sindbis Viruses. Proc. Natl. Acad. Sci. USA . 104: 1371– 1376. Google Scholar CrossRef Search ADS   Lindqvist R., Mundt F., Gilthorpe J. D., Wolfel S., Gekara N. O., Kroger A., Overby A. K.. 2016. Fast type I interferon response protects astrocytes from flavivirus infection and virus-induced cytopathic effects. J Neuroinflammation . 13: 277. Google Scholar CrossRef Search ADS PubMed  Liu M., Chen S., Chen Y., Liu C., Chen S., Yin X., Li G., Zhang Y.. 2012. Adapted Tembusu-like virus in chickens and geese in China. J. Clin. Microbiol . 50: 2807– 2809. Google Scholar CrossRef Search ADS PubMed  Magor K. E., Miranzo N. D., Barber M. R., Petkau K., Fleming-Canepa X., Blyth G. A., Blaine A. H.. 2013. Defense genes missing from the flight division. Dev. Comp. Immunol.  41: 377– 388. Google Scholar CrossRef Search ADS PubMed  Malakhova O. A., Kim K. I., Luo J. K., Zou W., Kumar K. G., Fuchs S. Y., Shuai K., Zhang D. E.. 2006. UBP43 is a novel regulator of interferon signaling independent of its ISG15 isopeptidase activity. EMBO J.  25: 2358– 2367. Google Scholar CrossRef Search ADS PubMed  Miao Z., Chen S., Wang M., Jia R., Zhu D., Liu M., Sun K., Qiao Y., Ying W., Chen X.. 2016. Molecular identification and comparative transcriptional analysis of myxovirus resistance GTPase (Mx) gene in goose (Ansercygnoide) after H9N2 AIV infection. Comp. Immunol. Microbiol. Infect. Dis.  47: 32– 40. Google Scholar CrossRef Search ADS PubMed  Mladinich M. C., Schwedes J., Mackow E. R.. 2017. Zika virus persistently infects and is basolaterally released from primary human brain microvascular endothelial cells. Mbio . 8: e00952– 17. Google Scholar CrossRef Search ADS PubMed  Morrison J., Laurent-Rolle M., Maestre A. M., Rajsbaum R., Pisanelli G., Simon V., Mulder L. C. F., Fernandez-Sesma A., García-Sastre A.. 2013. Dengue virus co-opts UBR4 to degrade STAT2 and antagonize Type I interferon signaling. PLoS Pathog.  9: e1003265. Google Scholar CrossRef Search ADS PubMed  Qian W., Wei X., Zhou H., Jin M.. 2016. Molecular cloning and functional analysis of duck ubiquitin-specific protease 18 (USP18) gene. Dev. Comp. Immunol.  62: 39– 47. Google Scholar CrossRef Search ADS PubMed  Qin Z., Chen S., Qi Y., Hao Z., Wang M., Jia R., Zhu D., Liu M., Fei L., Chen X.. 2015. Identification, characterization, and developmental expression pattern of Type III interferon receptor gene in the Chinese goose. 2015: 1– 11. Randall G., Chen L., Panis M., Fischer A. K., Lindenbach B. D., Sun J., Heathcote J., Rice C. M., Edwards A. M., Mcgilvray I. D.. 2006. Silencing of USP18 potentiates the antiviral activity of interferon against hepatitis C virus infection. Gastroenterology . 131: 1584– 1591. Google Scholar CrossRef Search ADS PubMed  Reid E., Charleston B.. 2014. Type I and III interferon production in response to RNA viruses. J. Interferon Cytokine Res.  34: 649– 658. Google Scholar CrossRef Search ADS PubMed  Ritchie K. J., Hahn C. S., Kim K. I., Yan M., Rosario D., Li L., Jc D. L. T., Zhang D. E.. 2004. Role of ISG15 protease UBP43 (USP18) in innate immunity to viral infection. Nat. Med.  10: 1374– 1378. Google Scholar CrossRef Search ADS PubMed  Schneider W. M., Chevillotte M. D., Rice C. M., 2014. Interferon-stimulated genes: A complex web of host defenses. Annu. Rev. Immunol . 32: 513– 545. Google Scholar CrossRef Search ADS PubMed  Sommereyns C., Paul S., Staeheli P., Michiels T.. 2008. IFN-lambda (IFN-lambda) is expressed in a tissue-dependent fashion and primarily acts on epithelial cells in vivo. PLoS Pathog . 4: e1000017. Google Scholar CrossRef Search ADS PubMed  Speer S. D., Li Z., Buta S., Payellebrogard B., Qian L., Vigant F., Rubino E., Gardner T. J., Wedeking T., Hermann M.. 2016. ISG15 deficiency and increased viral resistance in humans but not mice. Nat Commun . 7: 11496. Google Scholar CrossRef Search ADS PubMed  Wilmes S., Beutel O., Li Z., Francoisnewton V., Richter C. P., Janning D., Kroll C., Hanhart P., Hötte K., You C.. 2015. Receptor dimerization dynamics as a regulatory valve for plasticity of type I interferon signaling. J. Cell Biol.  209: 579– 593. Google Scholar CrossRef Search ADS PubMed  Xu D., Lillico S, Barnett M. W., Whitelaw B., Archibald A. L., Ait-Ali T.. 2012. USP18 restricts PRRSV growth through alteration of nuclear translocation of NF-kB p65 and p50 in MARC-145 cells. Virus Res.  169: 264– 267. Google Scholar CrossRef Search ADS PubMed  Yan Z., Shen H., Wang Z., Lin W., Xie Q., Bi Y., Chen F.. 2016. Isolation and characterization of a novel Tembusu virus circulating in muscovy ducks in south China. TransboundEmerg Dis . doi: 10.1111/tbed.12525 Yang C., Liu F., Chen S., Wang M., Jia R., Zhu D., Liu M., Sun K., Yang Q., Wu Y.. 2016. Identification of 2'-5'-oligoadenylate synthetase-like gene in goose: Gene structure, expression patterns, and antiviral activity against Newcastle disease virus. J. Interferon Cytokine Res.  36: 563– 572. Google Scholar CrossRef Search ADS PubMed  Yao Q., Fischer K. P., Arnesen K., Tyrrell D. L., Gutfreund K. S.. 2014. Molecular cloning, expression and characterization of Pekin duck interferon-lambda. Gene . 548: 29– 38. Google Scholar CrossRef Search ADS PubMed  Zhao C., Collins M., Hsiang T. Y., Krug R. M.. 2013. Interferon-induced ISG15 pathway: An ongoing virus–host battle. Trends Microbiol.  21: 181– 186. Google Scholar CrossRef Search ADS PubMed  Zhu K., Huang J., Jia R., Zhang B., Wang M., Zhu D., Chen S., Liu M., Yin Z., Cheng A.. 2015. Identification and molecular characterization of a novel duck Tembusu virus isolate from Southwest China. Archives of Virology . 160: 2781– 2790. Google Scholar CrossRef Search ADS PubMed  Zou W., Kim J. H., Handidu A., Li X., Kim K. I., Yan M., Li J., Zhang D. E.. 2007. Microarray analysis reveals that Type I interferon strongly increases the expression of immune-response related genes in Ubp43 (Usp18) deficient macrophages. Biochem. Biophys. Res. Commun.  356: 193– 199. Google Scholar CrossRef Search ADS PubMed  © 2017 Poultry Science Association Inc.

Journal

Poultry ScienceOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve Freelancer

DeepDyve Pro

Price
FREE
$49/month

$360/year
Save searches from
Google Scholar,
PubMed
Create lists to
organize your research
Export lists, citations
Read DeepDyve articles
Abstract access only
Unlimited access to over
18 million full-text articles
Print
20 pages/month
PDF Discount
20% off