Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/ou_press/microrna-590-5p-inhibits-intestinal-inflammation-by-targeting-yap-7JWv7QLrY8
- Publisher
- Oxford University Press
- Copyright
- Copyright © 2018 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com
- ISSN
- 1873-9946
- eISSN
- 1876-4479
- DOI
- 10.1093/ecco-jcc/jjy046
- Publisher site
- See Article on Publisher Site
Abstract
Abstract Background and Aims Hippo signalling is an evolutionarily conserved pathway that controls organ size by regulating cell proliferation, survival, apoptosis, and stem cell self-renewal. In addition, Hippo signalling is profoundly implicated in intestinal regeneration and cancer. However, its roles in the pathogenesis of Crohn’s disease [CD] remain largely unexplored. Methods Quantitative reverse transcription-polymerase chain reaction [qRT-PCR] was performed to identify the deregulated molecules in Hippo signalling. Expression of the highly upregulated Yes-associated protein 1 [YAP] was subsequently examined by qRT-PCR, western blotting, and immunohistochemistry in the intestinal tissues of CD patients and the colons of 2,4,6-trinitrobenzene sulphonic acid [TNBS]-induced colitis mice. The microRNAs [miRNAs] predicted to target YAP were explored by transfection of miR-590-5p mimics or inhibitors and analyzed by luciferase reporter assay. The roles of the miR-590-5p/YAP axis in CD and colorectal cancer were studied in experimental colitis mice and colorectal cancer cell lines. Results YAP mRNA was significantly upregulated in intestinal epithelial cells in CD patients and TNBS-induced colitis mice. MiR-590-5p suppressed YAP expression by directly targeting the YAP 3ʹ-untranslated region in Caco-2 cells and SW620 cells. Upregulation of miR-590-5p in colon reduced YAP level and its downstream targets in intestinal epithelial cells [IECs]. Treatment of miR-590-5p or YAP inhibitor Verteporfin alleviated experimental colitis. Targeting the miR-590-5p/YAP axis inhibited cell proliferation and invasiveness of colorectal cancer [CRC] cells in vitro. Conclusions Our results suggest that miR-590-5p inhibits intestinal inflammation in mouse colon and tumourigenesis of colorectal cancer cells by inhibiting YAP. The miR-590-5p/YAP axis may be an important novel mechanism in the pathogenesis of CD and colorectal cancer. Crohn’s disease, microRNA-590-5p, YAP1, intestinal inflammation, intestinal epithelial cell 1. Introduction Crohn’s disease [CD], one of the two main forms of inflammatory bowel disease [IBD], is a chronic inflammatory disease of the intestines that appears to be due to dysregulation of both innate and adaptive immunity responses.1 CD may affect any part of the gastrointestinal tract, and can be accompanied by abdominal pain, diarrhoea, bowel obstruction, and weight loss, as well as extraintestinal manifestations and associated immune disorders.2,3 Currently, endoscopy and biopsy are the gold standard for evaluating the inflammatory activity of CD, and surgical resection is still required in approximately 70–80% of CD patients. Due to frequent recurrence caused by uncontrolled inflammation, many of these patients will require a second operation.4,5 The Hippo signalling pathway is evolutionarily conserved and plays a crucial role in cell proliferation, apoptosis, differentiation, and development.6,7 In mammals, phosphorylation cascades of Hippo core components MST1/2 [mammalian sterile 20-like kinase 1/2] and LATS1/2 [large tumour suppressor kinase 1/2] inactivate the transcriptional co-activator Yes-associated protein 1 [YAP] as well as its paralogue, transcriptional co-activator with PDZ-binding motif [TAZ]. YAP and TAZ are the major effectors of the Hippo signalling pathway.8,9 Phosphorylation of YAP or TAZ by LATS1/2 leads to their retention in the cytosol and subsequent degradation. Nuclear YAP and TAZ function as transcriptional co-activators, along with multiple transcription factors including TEA-domain [TEAD] family members, octamer binding transcription factor 4 [OCT4], tumour protein p73, and zinc finger E-box binding homeobox 1 [ZEB1], which ultimately increase expression of such target genes as CTGF, CYR61, AXL, and PTGS2.6 Previously, loss of function studies have shown that YAP and TAZ are dispensable for gut homeostasis.10,11 Under the normal circumstances in the gut, Hippo signalling is tightly regulated, and YAP/TAZ are controlled by the inhibitory upstream kinases MST1/2 and LATS1/2, which are released during regenerative responses.12–14 Indeed, our understanding concerning Hippo signalling in intestinal regeneration and cancer initiation is expanding,15 but our knowledge about Hippo signalling in IBD, especially CD, remains scarce. MicroRNAs [miRNAs] have emerged as a critical class of negative regulators of gene expression. They elicit their regulatory effects by base-pairing to partially complementary mRNAs, causing either degradation of target mRNA transcripts or inhibition of mRNA translation.16 Accumulating evidence indicates that miRNAs play critical roles in the regulation of various biological and pathological processes, including innate and adaptive immune responses.16,17 In the past decade, a number of miRNAs have been demonstrated to be involved in the initiation, development, and progression of IBD,18,19 such as miR-301a,20 miR-7,21 and miR-124,22 and they may have the potential to be used as biomarkers and therapeutic targets. MiR-590-5p, a density-sensitive microRNA, has been reported to inhibit tumourigenesis by targeting YAP in colorectal cancer.23 Previously, both tumour suppressor and oncogenic functions of miR-590-5p have been reported.24,25 In addition, miR-590-5p is also able to suppress the molecular signalling pathways involved in inflammation.26,27 In the present study we identified YAP, a component of Hippo signalling, as being upregulated in the intestinal epithelial cells [IECs] of CD patients and 2,4,6-trinitrobenzene sulphonic acid [TNBS]-induced colitis mice. We next investigated the role of YAP-associated miRNAs in modulating the pathogenesis of CD. We revealed reduced expression of miR-590-5p in CD, and further demonstrated its regulatory role on YAP and its inhibitory role on disease progression in TNBS-induced colitis mice. Finally, we also determined the roles of the miR-590-5p/YAP axis in human colorectal cancer tumourigenesis. 2. Materials and Methods 2.1. Tissue samples Tissue biopsy samples were obtained from inflamed colonic areas of patients with CD [n = 25] and normal control subjects [n = 20] undergoing screening colonoscopies or surgery in Ren Ji Hospital [Shanghai, China]. All tissues were immediately frozen in liquid nitrogen and then stored at −80°C until use. All the procedures related to human subjects in this study were approved by the Medical Ethics Committee of the Ren Ji Hospital, School of Medicine, Shanghai Jiaotong University, under the ethics protocol. All patients who took part in this study provided written informed consent. 2.2. Animal studies Female BALB/c mice [ages 6–8 weeks, weight 20–22 g] were purchased from the Laboratory Animal Center of Nanjing Medical University [Nanjing, China]. All animals received appropriate care according to the requirements of the Animal Care and Use Committee of Shanghai Jiaotong University. The TNBS-induced colitis mouse model was established as reported previously.28 In brief, 3 mg of TNBS in 100 μl of 50% ethanol was administered via a transrectal polyethylene catheter inserted 4 cm from the anus. Mice [n = 10] were then kept in a vertical position for 30 s. An equivalent volume of 50% ethanol was used as a control. The severity of colitis was scored daily by recording standard parameters including body weight, diarrhoea, and bloody stools. Colonic tissues from the colitis model were removed, fixed in 10% formalin, embedded in paraffin, sectioned, and stained with haematoxylin and eosin. 2.3. Cell culture and reagent Caco-2 and SW620 human colon carcinoma cell lines were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences [Shanghai, China]. Cells were grown in Dulbecco’s modified Eagle’s medium [Gibco, MD, USA] containing 10% fetal bovine serum [FBS; Gibco], 100 U/ml penicillin, and 100 μg/ml streptomycin [Gibco, MD, USA]. All cells were incubated in a humidified atmosphere containing 5% CO2 at 37°C. YAP inhibitor Verteporfin was purchased from Selleck [Shanghai, China]. 2.4. Isolation of IECs Primary IECs were isolated from human/mouse intestine at a low temperature, using chelating agents. Briefly, the colon was removed from the sacrificed mice, cut into 0.5-cm pieces, and placed in cold phosphate-buffered saline to remove debris. Colonic biopsies from CD patients were obtained during endoscopic examination, and directly used as indicated after incubating at 37°C for 20 × 2 min in phosphate-buffered saline with 2 mmol/l DTT and 1 mmol/l EDTA under gentle shaking to isolate primary IECs. These cells were then collected and further purified via density gradient centrifugation with 20% and 40% percoll-RPMI solution. The isolated epithelium was collected by centrifugation [200 g for 5 min] for short-term function studies, including quantitative reverse transcription-polymerase chain reaction [qRT-PCR] and western blotting. 2.5. RNA isolation and real-time quantitative PCR Total RNA was extracted using TRIzol reagent [Invitrogen, USA] according to the manufacturer’s protocol. mRNA and miRNA reverse transcription were performed using a 5 × All-In-One RT MasterMix kit [Applied Biological Materials Inc., Richmond, BC, Canada] and RT-PCR miRcute miRNA First-Strand cDNA Synthesis Kit [Tiangen Biotech, Beijing, China], respectively. Quantitative RT-PCR was performed using the SYBR green assay [Invitrogen, USA] with the Applied Biosystems 7500. MiR-590-5p expression was detected by qRT-PCR using a miRcute miRNA qPCR Detection kit [Tiangen Biotech], and the relative expression of miR-590 was normalised to U6 expression. All PCR assays were performed in triplicate. The sequences of specific primers are listed in Table 1. Table 1. The sequences for primers used in this study. Gene Forward primer [5’-3’] Reverse primer [5’-3’] MST1 AAGCCGCAGTTCACGTTTAC GGGTCCATCGTGTAGCACC MST2 CGATGTTGGAATCCGACTTGG GTCTTTGTACTTGTGGTGAGGTT SAV1 CTCTTGAGCGAGAAGGACTTCC GAGGTACACTAGGAGCACAGG LATS1 AAACCAGGGAATGTGCAGCAA CATGCCTCTGAGGAACTAAGGA LATS2 ACCCCAAAGTTCGGACCTTAT CATTTGCCGGTTCACTTCTGC MOB1 TCTAAAGCGTCTGTTCAGGGT GCCAGCTCACGCCTATCAAT YAP TAGCCCTGCGTAGCCAGTTA TCATGCTTAGTCCACTGTCTGT Yap ACCCTCGTTTTGCCATGAAC TTGTTTCAACCGCAGTCTCTC TAZ TGGCATGTCGGAATGAATGAC GCTTCCCGATCAGCACAGT TEAD1 ATGGAAAGGATGAGTGACTCTGC TCCCACATGGTGGATAGATAGC TEAD2 GACGGCAGATTTGTGTACCG GAGACCTCGAAGACATAGGCG TEAD3 GCTCCTGGAGTATTCAGCCTT GTCGGCCCAGAACTTGACAA TEAD4 GAACGGGGACCCTCCAATG GCGAGCATACTCTGTCTCAAC IL1B TTCGACACATGGGATAACGAGG TTTTTGCTGTGAGTCCCGGAG Il1b GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT Ptgs2 TGCACTATGGTTACAAAAGCTGG TCAGGAAGCTCCTTATTTCCCTT Cyr61 CTGCGCTAAACAACTCAACGA GCAGATCCCTTTCAGAGCGG Ctgf GGGCCTCTTCTGCGATTTC ATCCAGGCAAGTGCATTGGTA Gene Forward primer [5’-3’] Reverse primer [5’-3’] MST1 AAGCCGCAGTTCACGTTTAC GGGTCCATCGTGTAGCACC MST2 CGATGTTGGAATCCGACTTGG GTCTTTGTACTTGTGGTGAGGTT SAV1 CTCTTGAGCGAGAAGGACTTCC GAGGTACACTAGGAGCACAGG LATS1 AAACCAGGGAATGTGCAGCAA CATGCCTCTGAGGAACTAAGGA LATS2 ACCCCAAAGTTCGGACCTTAT CATTTGCCGGTTCACTTCTGC MOB1 TCTAAAGCGTCTGTTCAGGGT GCCAGCTCACGCCTATCAAT YAP TAGCCCTGCGTAGCCAGTTA TCATGCTTAGTCCACTGTCTGT Yap ACCCTCGTTTTGCCATGAAC TTGTTTCAACCGCAGTCTCTC TAZ TGGCATGTCGGAATGAATGAC GCTTCCCGATCAGCACAGT TEAD1 ATGGAAAGGATGAGTGACTCTGC TCCCACATGGTGGATAGATAGC TEAD2 GACGGCAGATTTGTGTACCG GAGACCTCGAAGACATAGGCG TEAD3 GCTCCTGGAGTATTCAGCCTT GTCGGCCCAGAACTTGACAA TEAD4 GAACGGGGACCCTCCAATG GCGAGCATACTCTGTCTCAAC IL1B TTCGACACATGGGATAACGAGG TTTTTGCTGTGAGTCCCGGAG Il1b GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT Ptgs2 TGCACTATGGTTACAAAAGCTGG TCAGGAAGCTCCTTATTTCCCTT Cyr61 CTGCGCTAAACAACTCAACGA GCAGATCCCTTTCAGAGCGG Ctgf GGGCCTCTTCTGCGATTTC ATCCAGGCAAGTGCATTGGTA View Large Table 1. The sequences for primers used in this study. Gene Forward primer [5’-3’] Reverse primer [5’-3’] MST1 AAGCCGCAGTTCACGTTTAC GGGTCCATCGTGTAGCACC MST2 CGATGTTGGAATCCGACTTGG GTCTTTGTACTTGTGGTGAGGTT SAV1 CTCTTGAGCGAGAAGGACTTCC GAGGTACACTAGGAGCACAGG LATS1 AAACCAGGGAATGTGCAGCAA CATGCCTCTGAGGAACTAAGGA LATS2 ACCCCAAAGTTCGGACCTTAT CATTTGCCGGTTCACTTCTGC MOB1 TCTAAAGCGTCTGTTCAGGGT GCCAGCTCACGCCTATCAAT YAP TAGCCCTGCGTAGCCAGTTA TCATGCTTAGTCCACTGTCTGT Yap ACCCTCGTTTTGCCATGAAC TTGTTTCAACCGCAGTCTCTC TAZ TGGCATGTCGGAATGAATGAC GCTTCCCGATCAGCACAGT TEAD1 ATGGAAAGGATGAGTGACTCTGC TCCCACATGGTGGATAGATAGC TEAD2 GACGGCAGATTTGTGTACCG GAGACCTCGAAGACATAGGCG TEAD3 GCTCCTGGAGTATTCAGCCTT GTCGGCCCAGAACTTGACAA TEAD4 GAACGGGGACCCTCCAATG GCGAGCATACTCTGTCTCAAC IL1B TTCGACACATGGGATAACGAGG TTTTTGCTGTGAGTCCCGGAG Il1b GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT Ptgs2 TGCACTATGGTTACAAAAGCTGG TCAGGAAGCTCCTTATTTCCCTT Cyr61 CTGCGCTAAACAACTCAACGA GCAGATCCCTTTCAGAGCGG Ctgf GGGCCTCTTCTGCGATTTC ATCCAGGCAAGTGCATTGGTA Gene Forward primer [5’-3’] Reverse primer [5’-3’] MST1 AAGCCGCAGTTCACGTTTAC GGGTCCATCGTGTAGCACC MST2 CGATGTTGGAATCCGACTTGG GTCTTTGTACTTGTGGTGAGGTT SAV1 CTCTTGAGCGAGAAGGACTTCC GAGGTACACTAGGAGCACAGG LATS1 AAACCAGGGAATGTGCAGCAA CATGCCTCTGAGGAACTAAGGA LATS2 ACCCCAAAGTTCGGACCTTAT CATTTGCCGGTTCACTTCTGC MOB1 TCTAAAGCGTCTGTTCAGGGT GCCAGCTCACGCCTATCAAT YAP TAGCCCTGCGTAGCCAGTTA TCATGCTTAGTCCACTGTCTGT Yap ACCCTCGTTTTGCCATGAAC TTGTTTCAACCGCAGTCTCTC TAZ TGGCATGTCGGAATGAATGAC GCTTCCCGATCAGCACAGT TEAD1 ATGGAAAGGATGAGTGACTCTGC TCCCACATGGTGGATAGATAGC TEAD2 GACGGCAGATTTGTGTACCG GAGACCTCGAAGACATAGGCG TEAD3 GCTCCTGGAGTATTCAGCCTT GTCGGCCCAGAACTTGACAA TEAD4 GAACGGGGACCCTCCAATG GCGAGCATACTCTGTCTCAAC IL1B TTCGACACATGGGATAACGAGG TTTTTGCTGTGAGTCCCGGAG Il1b GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT Ptgs2 TGCACTATGGTTACAAAAGCTGG TCAGGAAGCTCCTTATTTCCCTT Cyr61 CTGCGCTAAACAACTCAACGA GCAGATCCCTTTCAGAGCGG Ctgf GGGCCTCTTCTGCGATTTC ATCCAGGCAAGTGCATTGGTA View Large 2.6. Western blotting Lysates of human/murine tissues and cultured cells were washed with PBS and homogenised using RIPA lysis buffer [Millipore, Billerica, MA] supplemented with complete EDTA-free protease inhibitor cocktail [Roche, Indianapolis, IN], and phosphatase inhibitor cocktails 1 and 2 [Sigma-Aldrich, St Louis, MO]. Protein concentration was quantified using the Bio-Rad DC protein assay kit [Bio-Rad, USA]. Total protein [15 μg] was resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis [SDS-PAGE], and transferred onto the polyvinylidene fluoride membrane. Membranes were blocked by 5% non-fat dry milk in Tris-buffered saline with 1% Tween. Subsequently, the membranes were probed with the following antibodies anti-YAP [#52771, Abcam, Cambridge, UK]. GAPDH [#8245, Abcam, Cambridge, UK] was used as a loading control. After incubation with HRP-conjugated species-matched secondary antibodies, the protein expression was visualised by an enhanced chemiluminescence kit [Amersham Corp, Buckinghamshire, UK]. 2.7. Immunohistochemistry Formalin-fixed paraffin-embedded intestinal mucosal biopsy samples from CD patients or TNBS-induced colitis mice were cut into 5-μm sections for immunohistochemical [IHC] analysis. Briefly, sections were deparaffinised, followed by heat-mediated retrieval at 100°C in a water bath for 15 min in citrate buffer pH-6.0 to perform antigen retrieval. Endogenous peroxidase activity was blocked with peroxidase block solution H2O2-methanol for 15 min. Next, sections were blocked using normal goat serum followed by incubation in primary antibody [#52771, Abcam, Cambridge, UK] at 4°C overnight. Sections were subsequently incubated with horseradish peroxide-labelled secondary antibody and developed with diaminobenzidine. Counterstaining was performed with haematoxylin. Bright field images were taken at 20× and 40× magnification. 2.8. Enzyme-linked immunosorbent assays A sandwich enzyme-linked immunosorbent assay [ELISA] was performed to analyse serum levels of IL-1β in this study. The cytokine IL-1β was measured using enzyme-linked immunosorbent assay [ELISA] kits from R&D Systems according to the manufacturer’s protocol. Absorbance was measured at 450 nm and compared with the respective standard curve of the cytokines. 2.9. Plasmid transfection Synthetic pre-miR-590-5p, anti-miR-590-5p and scrambled negative control RNA [pre-scramble and anti-scramble] were purchased from GenePharma [Shanghai, China]. Caco-2 cells and SW620 cells were seeded in six-well plates to approximately 50–70% confluency. The next day, cells were transfected with pre-miR-590-5p, anti-miR-590-5p, and scrambled negative control RNA using Lipofectamine 2000 [Invitrogen, USA] with Opti-MEM in low serum medium. In each well, equal amounts of these RNA oligonucleotides were used and, 24 h after transfection, the cells were harvested for qRT-PCR and western blotting. In designated experiments, the mirVanaTMmiRNA mimic of miR-590-5p or its negative control was complexed with Invivofectamine®2.0 Reagent and injected into the tail veins of TNBS-induced colitis mice on 3 consecutive days at a dose of 5 mg/kg [Life Technologies, USA]. 2.10. Target prediction and luciferase activity assay The bioinformatic software programs miRDB [http://mirdb.org/] and TargetScan [http://www.targetscan.org/vert_71/] were used to predict the binding target miRNA for YAP. DNA fragments of wild-type and mutant YAP 3’-UTR containing the miR-590-5p binding region were cloned into the PmeI and XbaI sites of pmirGLO vector [Promega, Madison, WI, USA]. For reporter assays, cells were transfected with 3’-UTR or mutant 3’-UTR luciferase reporters only, or co-transfected with miR-590-5p expression vector and luciferase reporter. After transfection for 48 h, cells were harvested and analysed for luciferase activity in a Dual-Glo Luciferase Assay System [Promega, WI, USA]. Normalised firefly luciferase activity [firefly luciferase activity/Renilla luciferase activity] for each construct was compared with that of the group of pmirGLO vector with the wild-type YAP 3’-UTR. Each assay was performed in triplicate. 2.11. Cell proliferation, cell apoptosis, cell invasion, and cell cycle assay Cell proliferation and cell invasion assay were performed as reported previously.29 Cell apoptosis was detected by the Caspase-3/7 Detection Kit [G7790, Promega, San Jose, CA] according to the manufacturer’s protocol. Briefly, cells were first starved for 24 h, followed by indicated treatments for another 24 h. Then caspase-3/7 activity was monitored using an Apo-ONE Caspase-3/7 assay kit. For cell cycle analysis, transfected cells from indicated groups were cultured overnight and then treated with nocodazole [100 ng/ml] for 16–20 h. Subsequently, collected cells were fixed and incubated with 50 μg/ml propidium iodide and 20 μg/ml RNase A [BD Pharmingen, USA] for 30 min at 37°C. The cell cycle distribution was analysed by the BD LSRII flow cytometer [Becton Dickinson, USA]. 2.12. Statistical analysis All experiments were performed at least three times. Student’s t-test or one-way analysis of variance [ANOVA] was used for comparison between groups. All values shown in the text and figures are mean ± s.d [standard deviation]. Statistical analyses were performed using SPSS 13.0 statistical package software [SPSS, Chicago, IL, USA] or GraphPad Prism [GraphPad Software Inc., San Diego, CA]; A p-value less than 0.05 were considered statistically significant [*p < 0.05, **p < 0.01, ***p < 0.001]. 3. Results 3.1. YAP expression is significantly increased in IECs of CD patients Hippo signalling is implicated in intestinal regeneration and cancer.12,14 However, the role of Hippo signalling in the pathogenesis of CD remains largely unknown. To examine the expression profile of components of Hippo signalling in CD tissues [Figure 1A], we isolated primary intestinal epithelial cells [IECs] from colonic biopsies of CD patients and healthy controls during endoscopic examination. As shown in Figure 1B, expression of YAP and TAZ was markedly upregulated in IECs from both CD patients, compared with that in healthy controls. YAP was selected for further study due to its larger fold change. Next, immunohistochemical analysis showed that YAP protein in the inflamed colonic mucosa of CD patients was elevated compared with healthy controls, especially in the epithelial layer [Figure 1C]. Because proinflammatory cytokines are highly expressed in the inflamed mucosa of CD patients, especially interleukin [IL]-1β, we next investigated the correlation between YAP and IL-1β. As expected, levels of IL1B mRNA were positively correlated with YAP mRNA expression in IECs from CD patients [Figure 1D]. Furthermore, a similar correlation was noted between the serum levels of IL-1β and YAP mRNA expression in IEC from CD patients [Figure 1E]. Taken together, these data indicate that YAP, a co-activator of Hippo signalling, is implicated in the pathogenesis of CD. Figure 1. View largeDownload slide YAP expression is significantly increased in intestinal epithelial cells [IECs] of Crohn’s disease [CD] patients. [A] Key components of Hippo signalling pathway. [B] IECs [1 × 106] were isolated from colonic biopsies of healthy controls [HC, n = 20] and inflamed mucosa from CD patients [n = 25]. Expression of molecules in Hippo signaling pathway was analysed by quantitative reverse transcription-polymerase chain reaction [qRT-PCR]. [C] Representative photos of immunohistochemistry [IHC] for YAP expression in HC and CD tissues. Comparison of YAP density staining by IHC is shown in the right panel. Scale bar: 100 μm [left] and 50 μm [right]. [D] Correlation between the relative levels of IL1B and YAP mRNA expression in IECs of inflamed mucosa from 25 CD patients. [E] Correlation between the serum levels of IL-1β and YAP mRNA expression in IECs of inflamed mucosa from 25 CD patients; *p < 0.05; ***p < 0.001. Figure 1. View largeDownload slide YAP expression is significantly increased in intestinal epithelial cells [IECs] of Crohn’s disease [CD] patients. [A] Key components of Hippo signalling pathway. [B] IECs [1 × 106] were isolated from colonic biopsies of healthy controls [HC, n = 20] and inflamed mucosa from CD patients [n = 25]. Expression of molecules in Hippo signaling pathway was analysed by quantitative reverse transcription-polymerase chain reaction [qRT-PCR]. [C] Representative photos of immunohistochemistry [IHC] for YAP expression in HC and CD tissues. Comparison of YAP density staining by IHC is shown in the right panel. Scale bar: 100 μm [left] and 50 μm [right]. [D] Correlation between the relative levels of IL1B and YAP mRNA expression in IECs of inflamed mucosa from 25 CD patients. [E] Correlation between the serum levels of IL-1β and YAP mRNA expression in IECs of inflamed mucosa from 25 CD patients; *p < 0.05; ***p < 0.001. 3.2. YAP expression is significantly increased in the TNBS-induced mouse model Next, we determined the expression pattern of YAP in an animal model of inflammatory bowel disease [IBD], the TNBS-induced colitis model. As shown in Figure 2A and B, shortening of colon length and loss of body weight were significantly more pronounced in the TNBS-treated group than in the control group, suggesting successful establishment of the IBD mouse model. By qRT-PCR and western blotting analyses, we revealed that mRNA and protein levels of YAP were significantly upregulated in the TNBS-induced colitis mice compared with those in the control mice [Figure 2C and D]. By IHC analysis, we noticed that YAP was intensely expressed in the inflamed colonic epithelial cells whereas YAP protein was barely detected in normal colonic epithelial cells [Figure 2E]. Collectively, these results indicate that YAP is also dysregulated in this preclinical model. Figure 2. View largeDownload slide YAP expression is significantly increased in the 2,4,6-trinitrobenzene sulphonic acid [TNBS]-induced mouse model. [A] Gross morphology and length of the large bowel in the control and TNBS groups. [B] Changes of body weight of mice in the control and TNBS groups. [C] Yap mRNA expression levels in the control and TNBS groups were detected by quantitative reverse transcription-polymerase chain reaction [qRT-PCR] [n = 10 per group]. [D] The YAP protein levels in colon tissues from control and TNBS-treated mice were analysed by western blotting. [E] Representative immunohistochemical [IHC] photos of YAP protein expression in colon tissues from the control and TNBS-treated mice. Haemotoxylin and eosin [H&E] staining is shown in the left panel. Scale bar: 200 μm [H&E staining] and 50 μm [IHC]; **p < 0.01; ***p < 0.001. Figure 2. View largeDownload slide YAP expression is significantly increased in the 2,4,6-trinitrobenzene sulphonic acid [TNBS]-induced mouse model. [A] Gross morphology and length of the large bowel in the control and TNBS groups. [B] Changes of body weight of mice in the control and TNBS groups. [C] Yap mRNA expression levels in the control and TNBS groups were detected by quantitative reverse transcription-polymerase chain reaction [qRT-PCR] [n = 10 per group]. [D] The YAP protein levels in colon tissues from control and TNBS-treated mice were analysed by western blotting. [E] Representative immunohistochemical [IHC] photos of YAP protein expression in colon tissues from the control and TNBS-treated mice. Haemotoxylin and eosin [H&E] staining is shown in the left panel. Scale bar: 200 μm [H&E staining] and 50 μm [IHC]; **p < 0.01; ***p < 0.001. 3.3. Downregulation of miR-590-5p in CD tissues Over the past decade, knowledge of microRNAs in CD has expanded and indicates that microRNAs play an important role in this disease. We hypothesised that dysregulation of YAP in CD may be regulated by miRNAs. To uncover the potential target miRNA[s] for YAP in CD, two bioinformatic software programs, miRDB and TargetScan, were used for prediction. As a result, four miRNAs were identified as candidates, named miR-200a-3p, miR-141-3p, miR-21-5p, and miR-590-5p [Figure 3A]. By qRT-PCR analysis of candidate miRNAs expression in colonic biopsies of healthy controls and CD patients, we found that only miR-590-5p was significantly downregulated in CD tissues in relative to healthy subjects [Figure 3B]; similarly, miR-590-5p was also downregulated in TNBS-induced colitis mice compared with in the control mice, as revealed by qRT-PCR [Figure 3C], respectively. Interestingly, the levels of IEC-derived YAP were inversely correlated with miR-590-5p in CD patients [Figure 3D], suggesting that miR-590-5p might be the regulatory miRNA responsible for YAP expression in CD. Meanwhile, mRNA and serum levels of IL-1β were inversely correlated with miR-590-5p levels in IECs from CD patients [Figure 3E and F]. Figure 3. View largeDownload slide Downregulation of miR-590-5p in Crohn’s disease [CD] tissue. [A] Prediction of miRNAs targeting YAP by TargetScan and miRDB. [B] Expression of candidate miRNAs in colonic biopsies of healthy controls [n = 20] and CD patients [n = 25] was analysed by quantitative reverse transcription-polymerase chain reaction [qRT-PCR]. [C] Expression levels of miR-590-5p in the control and 2,4,6-trinitrobenzene sulphonic acid [TNBS] groups were detected by qRT-PCR [n = 10 per group]. [D] Correlation between the relative levels of miR-590-5p expression and YAP mRNA in intestinal epithelial cells [IECs] of inflamed mucosa from 25 CD patients. [E-F] Correlation between the levels of miR-590-5p expression and IL1B mRNA [E] and its serum level [F] from 25 CD patients; **p < 0.01. Figure 3. View largeDownload slide Downregulation of miR-590-5p in Crohn’s disease [CD] tissue. [A] Prediction of miRNAs targeting YAP by TargetScan and miRDB. [B] Expression of candidate miRNAs in colonic biopsies of healthy controls [n = 20] and CD patients [n = 25] was analysed by quantitative reverse transcription-polymerase chain reaction [qRT-PCR]. [C] Expression levels of miR-590-5p in the control and 2,4,6-trinitrobenzene sulphonic acid [TNBS] groups were detected by qRT-PCR [n = 10 per group]. [D] Correlation between the relative levels of miR-590-5p expression and YAP mRNA in intestinal epithelial cells [IECs] of inflamed mucosa from 25 CD patients. [E-F] Correlation between the levels of miR-590-5p expression and IL1B mRNA [E] and its serum level [F] from 25 CD patients; **p < 0.01. 3.4. Identification of YAP as a direct target of miR-590-5p Given the inverse correlation between miR-590-5p and YAP, we next investigated whether YAP is a putative target of miR-590-5p. The putative binding site of miR-590-5p in the 3’-UTR of human YAP was shown in Figure 4A. To uncover whether miR-590-5p directly binds to the 3’-UTR of YAP and leads to its translational inhibition, we performed gain-of-function and loss-of-function studies in two colonic cell lines, Caco-2 and SW620, by transfection with miR-590-5p mimic or the inhibitor [Figure 4B]. Compared with the mimic control, the miR-590 mimic significantly reduced the expression of YAP at the protein level in both Caco-2 and SW620 cells [Figure 4C]. Conversely, treatment with anti-miR-590-5p remarkably increased the protein expression of YAP [Figure 4D], suggesting that miR-590-5p may be a direct regulator of YAP at the translational level. To further examine whether miR-590-5p directly targets the 3ʹ-UTR of human YAP mRNA, we constructed two luciferase reporter plasmids encoding a firefly luciferase transcript with either the wild-type or mutant 3’-UTR of YAP. As a result, overexpression of miR-590-5p significantly inhibited the luciferase reporter activity of the wild-type 3’-UTR of human YAP, whereas suppression of miR-590-5p upregulated the luciferase reporter activity of YAP [Figure 4E]. Importantly, no significant difference was observed in the mutant plasmid. Taken together, these data unequivocally demonstrate that miR-590-5p acts as a direct regulator of YAP. Figure 4. View largeDownload slide Identification of YAP as a direct target of miR-590-5p. [A] Schematic description of conserved binding site for miR-590-5p with 3’-UTR of human YAP. [B] Expression of miR-590-5p after transfection with pre-miR-590-5p, pre-scramble, anti-miR-590-5p, and anti-scramble in Caco-2 cells and SW620 cells. [C] YAP protein expression levels after transfection with pre-miR-590-5p, pre-scramble, anti-miR-590-5p, and anti-scramble in Caco-2 cells and SW620 cells were detected by western blotting. [D] Luciferase reporters carrying wild-type [WT] or mutant [Mut] YAP 3ʹ-UTR were co-transfected into both cell lines along with the indicated oligonucleotides. Luciferase reporter activity in Caco-2 and SW620 cells was analysed; *p < 0.05; **p < 0.01; ***p < 0.001. Figure 4. View largeDownload slide Identification of YAP as a direct target of miR-590-5p. [A] Schematic description of conserved binding site for miR-590-5p with 3’-UTR of human YAP. [B] Expression of miR-590-5p after transfection with pre-miR-590-5p, pre-scramble, anti-miR-590-5p, and anti-scramble in Caco-2 cells and SW620 cells. [C] YAP protein expression levels after transfection with pre-miR-590-5p, pre-scramble, anti-miR-590-5p, and anti-scramble in Caco-2 cells and SW620 cells were detected by western blotting. [D] Luciferase reporters carrying wild-type [WT] or mutant [Mut] YAP 3ʹ-UTR were co-transfected into both cell lines along with the indicated oligonucleotides. Luciferase reporter activity in Caco-2 and SW620 cells was analysed; *p < 0.05; **p < 0.01; ***p < 0.001. 3.5. MiR-590-5p or YAP inhibitor attenuates TNBS-induced colitis in mice Next, we sought to investigate whether miR-590-5p can modulate the inflammatory process by targeting YAP in TNBS-induced mice colitis. We administered pre-miR-590-5p to mice via tail vein on 3 consecutive days at a dose of 5 mg/kg. Tissue biopsy and histopathological examinations showed that pre-miR-590-5p treatment significantly attenuated colitis as revealed by colon length [Figure 5A], body weight [Figure 5B], decreased pathological scores [Figure 5C], and lower myeloperoxidase [MPO] activity [Figure 5D]. Also qRT-PCR analysis of colon tissues from three groups of mice revealed that expression of YAP mRNA was markedly decreased in IEC from miR-590-5p mimic-treated mice compared with that in mimic control mice [Figure 5E]. Moreover, the mRNA expression of the downstream targets of Yap, including Ptgs2, Ctgf, and Cyr61, were markedly decreased in the colons of pre-miR-590-5p-treated mice compared with that in mimic control mice [Figure 5F]. Next, we determined whether the YAP1 inhibitor Verteporfin inhibits TNBS-induced colitis. The result was that Verteporfin significantly ameliorated TNBS-induced colitis as demonstrated by colon length [Figure 5G], body weight [Figure 5H], decreased pathological scores [Figure 5I], and lower MPO activity [Figure 5J]. Together, our results indicate that targeting the miR-590-5p/YAP axis is sufficient to reduce colitis in the TNBS-induced mouse model. Figure 5. View largeDownload slide MiR-590-5p or YAP inhibitor attenuates TNBS-induced colitis in mice. [A] Gross morphology and length of the colon tissues in the indicated groups. [B] Changes of body weight over a period of observation are shown as percentage of the initial weight at the start of the experiments. Comparison was made between the mimic control and miR-590-5p groups. [C] Yap mRNA expression in the miR-590-5p and mimic control groups was analysed by quantitative reverse transcription-polymerase chain reaction [qRT-PCR] [n = 5 per group]. [D] Colonic pathological scores of mice in the miR-590-5p and mimic control groups. [E] Myeloperoxidase [MPO] activity in colon tissues was analysed in mice receiving miR-590-5p treatments compared with the mimic control group. [F] The mRNA expression levels of Yap downstream targets [Ptgs2, Ctgf, and Cyr61] in colon tissues, analysed in mice receiving miR-590-5p treatments, compared with the mimic control group analysed by quantitative reverse transcription-polymerase chain reaction [qRT-PCR]. [G] Gross morphology and length of the colon tissues in the control and Verteporfin groups. [H] Changes of body weight in the control and Verteporfin groups. [I] Colonic pathological scores of mice in the control and Verteporfin groups. Comparison was made between the control and Verteporfin groups. [J] MPO activity in colon tissues was analysed in the control and Verteporfin groups; *p < 0.05; **p < 0.01. Figure 5. View largeDownload slide MiR-590-5p or YAP inhibitor attenuates TNBS-induced colitis in mice. [A] Gross morphology and length of the colon tissues in the indicated groups. [B] Changes of body weight over a period of observation are shown as percentage of the initial weight at the start of the experiments. Comparison was made between the mimic control and miR-590-5p groups. [C] Yap mRNA expression in the miR-590-5p and mimic control groups was analysed by quantitative reverse transcription-polymerase chain reaction [qRT-PCR] [n = 5 per group]. [D] Colonic pathological scores of mice in the miR-590-5p and mimic control groups. [E] Myeloperoxidase [MPO] activity in colon tissues was analysed in mice receiving miR-590-5p treatments compared with the mimic control group. [F] The mRNA expression levels of Yap downstream targets [Ptgs2, Ctgf, and Cyr61] in colon tissues, analysed in mice receiving miR-590-5p treatments, compared with the mimic control group analysed by quantitative reverse transcription-polymerase chain reaction [qRT-PCR]. [G] Gross morphology and length of the colon tissues in the control and Verteporfin groups. [H] Changes of body weight in the control and Verteporfin groups. [I] Colonic pathological scores of mice in the control and Verteporfin groups. Comparison was made between the control and Verteporfin groups. [J] MPO activity in colon tissues was analysed in the control and Verteporfin groups; *p < 0.05; **p < 0.01. 3.6. The oncogenic roles of YAP in colorectal cancer Finally, we analysed the expression pattern of YAP in colorectal cancer. The pattern of YAP overexpression in human colorectal cancer was commonly found in many cohorts derived from the Oncomine database [Figure 6A]. By qRT-qPCR, we found that levels of YAP mRNA were closely correlated with miR-590-5p expression in tumour tissues from 30 colorectal cancer patients [Figure 6B]. Given these findings, we tested whether miR-590-5p plays a tumour-suppressive role in colorectal cancer by targeting YAP. As shown in Figure 6C-F, treatment with miR-590-5p mimics decreased cell proliferation [Figure 6C], cell cycle progression [Figure 6D], and invasive abilities [Figure 6F], and promoted cell apoptosis [Figure 6E] of Caco-2 and SW620 cells. Notably, overexpression of YAP largely compromised the inhibitory effects induced by miR-590-5p [Figure 6C-F]. Collectively, these findings suggest that miR-590-5p/YAP contributes to malignant phenotypes in human CRC cells. Figure 6. View largeDownload slide The oncogenic roles of YAP in human colorectal cancer [CRC]. [A] Data from Oncomine database showed the overexpression profile of YAP in human CRC. The rank for a gene is the median rank for that gene across each of the analyses. The p-value for a gene is its p-value for the median-ranked analysis. [B] Correlation between the relative levels of miR-590-5p expression and YAP mRNA in 30 CRC patients was done. [C-F] Effects of miR-590-5p/YAP axis on cell proliferation [C, n = 5], cell cycle [D, n = 5], cell apoptosis [E, n = 3], and cell invasion [F, n = 3] of Caco-2 and SW620 cells. The statistical analysis in cell proliferation among indicated groups was performed on Day 7 [control vs miR-590-5p]. Relative cell invasion was calculated as the number of invasive cells in the lower well and non-invasive cells remaining in the upper well; *p < 0.05; **p < 0.01. Figure 6. View largeDownload slide The oncogenic roles of YAP in human colorectal cancer [CRC]. [A] Data from Oncomine database showed the overexpression profile of YAP in human CRC. The rank for a gene is the median rank for that gene across each of the analyses. The p-value for a gene is its p-value for the median-ranked analysis. [B] Correlation between the relative levels of miR-590-5p expression and YAP mRNA in 30 CRC patients was done. [C-F] Effects of miR-590-5p/YAP axis on cell proliferation [C, n = 5], cell cycle [D, n = 5], cell apoptosis [E, n = 3], and cell invasion [F, n = 3] of Caco-2 and SW620 cells. The statistical analysis in cell proliferation among indicated groups was performed on Day 7 [control vs miR-590-5p]. Relative cell invasion was calculated as the number of invasive cells in the lower well and non-invasive cells remaining in the upper well; *p < 0.05; **p < 0.01. 4. Discussion In the past decade, significant scientific progress has broadened our understanding of the function and regulation of Hippo signalling in the gut epithelium. Despite these achievements, many important questions are left unaddressed. As the well-known downstream transcriptional coactivator of the Hippo pathway, YAP has been demonstrated to play critical roles in gut epithelium, particularly in intestinal stem cells. In the current study, we revealed that IEC expression of YAP is remarkably increased in patients with CD and in mice with colitis. In addition, we identified miR-590-5p as a direct modulator of YAP. By establishing experimental models of colitis, we found that miR-590-5p not only reduced intestinal inflammation, but also suppressed human colorectal cancer by inhibiting cell proliferation, cell invasion, and promoting cell apoptosis, possibly through targeting YAP. The mammalian Hippo pathway is of great importance in maintaining normal intestinal homeostasis.14 Normally, the Hippo pathway is constitutively active.30 Dysregulation of Hippo signalling can lead to tissue overgrowth and colorectal cancer tumourigenesis. For example, conditional knockout of MST1 and MST2 in IECs lead to a disorganised villus structure, expansion of undifferentiated cells, dysplastic epithelia, and adenomas.31 In addition, mouse small and large intestines with SAV1 deficiency show enlarged crypt structures and increased polyp formation.32 Notably, mice with YAP and/or TAZ-deficient intestines have no significant adverse phenotype under homeostasis, suggesting that YAP and TAZ might be dispensable under non-pathogenic conditions.10,33,34 However, the roles of the Hippo signalling pathway in IBD are still largely unknown. In this study, we demonstrated that YAP is the most differentially expressed gene in inflamed CD mucosa among the components of the Hippo signalling pathway. Increased levels of YAP were closely associated with the intestinal inflammation. Furthermore, we also confirmed the expression pattern of YAP in the TNBS-induced colitis mouse model, suggesting the potential common roles of YAP in IBD. Consistent with our observation, several reports have shown that increased YAP protein levels are found 2–5 days after dextran sulphate sodium [DSS]-induced colitis.32 Differing from the expression pattern of YAP staining in the crypt compartment of small intestine where the stem/progenitor cells reside, however, we found a ubiquitous expression profile of YAP in inflamed colon tissue. Interestingly, YAP regulation has been previously identified as a responsive mechanism for mucosal regeneration in IBD in a DSS-induced colitis mouse model. Activation of IL-6/gp130 signalling further triggers activation of YAP and Notch, which control tissue growth and regeneration.35 Specifically, IEC-specific YAP depletion in gp130Act mice reverses their DSS resistance.35 Therefore, our studies and previous reports provide insights into the potential therapeutic value of targeting YAP in IBD. The roles of miRNAs in the pathogenesis of IBD are increasingly recognised.19 It has been proven that miR-122 directly targets the tight junction protein occludin to influence its impenetrability of barrier function.36 MiR-146a and miR-320 lead to the disruption of intestine immune homeostasis by influencing different innate immune cells.37,38 In addition, many miRNAs can affect IBD by targeting autophagy-associated genes.39 In this respect, we sought to uncover the regulatory miRNAs for YAP in IBD, identifying miR-590-5p as a candidate. Previously, miR-590-5p has been demonstrated to be a tumour suppressor in various human cancers including gastric cancer,40 breast cancer,41 renal cell carcinoma,42 and colorectal cancer.23,25 In breast cancer, miR-590-5p inhibits cancer cell stemness and metastasis by targeting Sry-related high-mobility box SOX-2.41 In colorectal cancer, miR-590-5p inhibits tumour angiogenesis and metastasis by regulating the nuclear factor 90/vascular endothelial growth factor A axis.25 Notably, miR-590-5p also inhibits colorectal cancer tumourigenesis by directly targeting YAP.23 However, no reports are available concerning the role of miR-590-5p in IBD. In the present study, we show that the miR-590-5p level is significantly downregulated in the inflamed IECs of CD patients. Moreover, dramatically reduced levels of miR-590-5p were found in the TNBS-induced mice, and treatment of CRC cells with a miR-590-5p mimic resulted in decreased YAP, whereas miR-590-5p inhibitor led to increased YAP expression. Consistently, in vivo data indicated that miR-590-5p reduces colonic inflammation in TNBS-induced mice. Because YAP immunoreactivity is also present in the infiltrated immune cells, we cannot fully rule out that the immunomodulatory roles of miR-590-5p/YAP axis contribute to the amelioration of TNBS-induced colitis. Indeed, miR-590-5p can cause opioid-induced immunosuppression in human monocytes by targeting NF-κB signalling.43 Taken together, these findings suggest that this axis may lead to the identification of therapeutic targets in IBD. Dysregulation of the Hippo pathway leads to hyperactivation of YAP, subsequently causing uncontrolled stem cell proliferation and tumourigenesis.44 YAP regulates a range of secreted factors that broadly function in regenerating crypts and adenomas, such as Il33 and Tgfb.44 YAP also interacts with conserved signalling pathways, such as Wnt, Notch, Hedgehog, and bone morphogenetic protein [BMP] pathways, to promote cancer cell proliferation, migration, invasion, and maintenance of cancer cell stemness.45–47 For instance, YAP interactions with Wnt/β-catenin signalling and Notch signalling suppresses liver tumourigenesis.45 Previously, YAP has been reported to be overexpressed in multiple human malignancies, and its upregulation is closely associated with poor prognosis in cancer patients.48 In the current study, we first asked whether the expression profile of YAP is dysregulated in colorectal cancer. Using the GEO datasets, we revealed that YAP mRNA was highly expressed in human colorectal cancer. Specifically, genetic silencing of YAP in two colorectal cell lines significantly inhibited the oncogenic roles of YAP on cell proliferation, cell apoptosis, and cell invasion. Of note, there was a close correlation between miR-590-5p and YAP expression in human colorectal cancer tissues. These findings confirm the importance of miR-590-5p-YAP in the tumourigenesis of colorectal cancer. Although the severity and extent of IBD seem to be major factors associated with the development of colitis-associated cancer [CAC] in IBD patients, the molecular mechanisms underlying this link only recently started to be uncovered. With regard to the roles of the miR-590-5p/YAP axis in TNBS-induced colitis and colorectal cancer, we are exploring whether the miR-590-5p/YAP axis is implicated in the development and progression of CAC. In conclusion, our findings for the first time show that increased YAP expression and decreased miR-590-5p level may serve as a molecular signature for CD and colorectal cancer. The miR-590-5p/YAP axis is profoundly implicated in the development of intestinal inflammation. Overexpression of miR-590-5p suppresses intestinal inflammation in TNBS-induced colitis by directly targeting YAP. Thus, our data uncover a new and promising therapeutic target in the clinical treatment of CD and colorectal cancer. Funding This work was supported by a grant from the National Natural Science Foundation of China [No. 81672347, No.81702300, and No.81600439]. Conflict of Interest There are no potential competing interests. Author Contributions MY, YL, ZC, and MZ performed the in vitro and in vivo experiments, analysed the data, and wrote the manuscript; YM and YQ contributed to the animal experiments; MZ conceived of the study and designed and supervised the experiments. All the authors read and approved the final manuscript. Acknowledgments We are grateful to all the patients enrolled in this study. References 1. Torres J , Mehandru S , Colombel JF , Peyrin-Biroulet L . Crohn’s disease . Lancet 2017 ; 389 : 1741 – 55 . Google Scholar CrossRef Search ADS PubMed 2. American Gastroenterological Association Institute . Managing Crohn’s disease after surgery: a patient guide . Gastroenterology 2017 ; 152 : 296 – 7 . CrossRef Search ADS PubMed 3. Stappenbeck TS , McGovern DPB . Paneth cell alterations in the development and phenotype of Crohn’s disease . Gastroenterology 2017 ; 152 : 322 – 6 . Google Scholar CrossRef Search ADS PubMed 4. American Gastroenterological Association . American Gastroenterological Institute guideline on the management of Crohn’s disease after surgical resection: clinical decision support tool . Gastroenterology 2017 ; 152 : 276 . CrossRef Search ADS PubMed 5. Subramanian S , Ekbom A , Rhodes JM . Recent advances in clinical practice: a systematic review of isolated colonic Crohn’s disease: the third IBD ? Gut 2017 ; 66 : 362 – 81 . Google Scholar CrossRef Search ADS PubMed 6. Badouel C , McNeill H . SnapShot: The hippo signaling pathway . Cell 2011 ; 145 : 484 . Google Scholar CrossRef Search ADS PubMed 7. Yu FX , Guan KL . The Hippo pathway: regulators and regulations . Genes Dev 2013 ; 27 : 355 – 71 . Google Scholar CrossRef Search ADS PubMed 8. Yu FX , Zhao B , Guan KL . Hippo pathway in organ size control, tissue homeostasis, and cancer . Cell 2015 ; 163 : 811 – 28 . Google Scholar CrossRef Search ADS PubMed 9. Patel SH , Camargo FD , Yimlamai D . Hippo signaling in the liver regulates organ size, cell fate, and carcinogenesis . Gastroenterology 2017 ; 152 : 533 – 45 . Google Scholar CrossRef Search ADS PubMed 10. Barry ER , Morikawa T , Butler BL et al. Restriction of intestinal stem cell expansion and the regenerative response by YAP . Nature 2013 ; 493 : 106 – 10 . Google Scholar CrossRef Search ADS PubMed 11. Gregorieff A , Liu Y , Inanlou MR , Khomchuk Y , Wrana JL . Yap-dependent reprogramming of Lgr5[+] stem cells drives intestinal regeneration and cancer . Nature 2015 ; 526 : 715 – 8 . Google Scholar CrossRef Search ADS PubMed 12. Le Bouteiller M , Jensen KB . Hippo signalling directs intestinal fate . Nat Cell Biol 2015 ; 17 : 5 – 6 . Google Scholar CrossRef Search ADS PubMed 13. Ryoo HD , Steller H . Hippo and its mission for growth control . Nat Cell Biol 2003 ; 5 : 853 – 5 . Google Scholar CrossRef Search ADS PubMed 14. Gregorieff A , Wrana JL . Hippo signalling in intestinal regeneration and cancer . Curr Opin Cell Biol 2017 ; 48 : 17 – 25 . Google Scholar CrossRef Search ADS PubMed 15. Imajo M , Ebisuya M , Nishida E . Dual role of YAP and TAZ in renewal of the intestinal epithelium . Nat Cell Biol 2015 ; 17 : 7 – 19 . Google Scholar CrossRef Search ADS PubMed 16. Bartel DP . MicroRNAs: target recognition and regulatory functions . Cell 2009 ; 136 : 215 – 33 . Google Scholar CrossRef Search ADS PubMed 17. Spizzo R , Nicoloso MS , Croce CM , Calin GA . SnapShot: MicroRNAs in cancer . Cell 2009 ; 137 : 586 . Google Scholar CrossRef Search ADS PubMed 18. Whiteoak SR , Felwick R , Sanchez-Elsner T , Fraser Cummings JR . MicroRNAs in inflammatory bowel diseases: paradoxes and possibilities . Inflamm Bowel Dis 2015 ; 21 : 1160 – 5 . Google Scholar CrossRef Search ADS PubMed 19. Kalla R , Ventham NT , Kennedy NA et al. MicroRNAs: new players in IBD . Gut 2015 ; 64 : 504 – 17 . Google Scholar CrossRef Search ADS PubMed 20. He C , Yu T , Shi Y et al. MicroRNA 301A promotes intestinal inflammation and colitis-associated cancer development by inhibiting BTG1 . Gastroenterology 2017 ; 152 : 1434 – 1448 . Google Scholar CrossRef Search ADS PubMed 21. Yu Q , Zhang S , Chao K et al. E3 ubiquitin ligase RNF183 is a novel regulator in inflammatory bowel disease . J Crohns Colitis 2016 ; 10 : 713 – 25 . Google Scholar CrossRef Search ADS PubMed 22. Zhao Y , Ma T , Chen W et al. MicroRNA-124 promotes intestinal inflammation by targeting aryl hydrocarbon receptor in Crohn’s disease . J Crohns Colitis 2016 ; 10 : 703 – 12 . Google Scholar CrossRef Search ADS PubMed 23. Ou C , Sun Z , Li X et al. MiR-590-5p, a density-sensitive microRNA, inhibits tumorigenesis by targeting YAP1 in colorectal cancer . Cancer Lett 2017 ; 399 : 53 – 63 . Google Scholar CrossRef Search ADS PubMed 24. Miao MH , Ji XQ , Zhang H , Xu J , Zhu H , Shao XJ . miR-590 promotes cell proliferation and invasion in T-cell acute lymphoblastic leukaemia by inhibiting RB1 . Oncotarget 2016 ; 7 : 39527 – 34 . Google Scholar PubMed 25. Zhou Q , Zhu Y , Wei X et al. MiR-590-5p inhibits colorectal cancer angiogenesis and metastasis by regulating nuclear factor 90/vascular endothelial growth factor A axis . Cell Death Dis 2016 ; 7 : e2413 . Google Scholar CrossRef Search ADS PubMed 26. Sheikholeslami A , Nabiuni M , Arefian E . Suppressing the molecular signaling pathways involved in inflammation and cancer in breast cancer cell lines MDA-MB-231 and MCF-7 by miR-590 . Tumour Biol 2017 ; 39 : 1010428317697570 . Google Scholar CrossRef Search ADS PubMed 27. Zhao S , Yang G , Liu PN et al. miR-590-3p is a novel MicroRNA in myocarditis by targeting nuclear factor kappa-B in vivo . Cardiology 2015 ; 132 : 182 – 8 . Google Scholar CrossRef Search ADS PubMed 28. Neurath MF , Fuss I , Kelsall BL , Stüber E , Strober W . Antibodies to interleukin 12 abrogate established experimental colitis in mice . J Exp Med 1995 ; 182 : 1281 – 90 . Google Scholar CrossRef Search ADS PubMed 29. Yu MH , Luo Y , Qin SL , Wang ZS , Mu YF , Zhong M . Up-regulated CKS2 promotes tumor progression and predicts a poor prognosis in human colorectal cancer . Am J Cancer Res 2015 ; 5 : 2708 – 18 . Google Scholar PubMed 30. Hong AW , Meng Z , Guan KL . The Hippo pathway in intestinal regeneration and disease . Nat Rev Gastroenterol Hepatol 2016 ; 13 : 324 – 37 . Google Scholar CrossRef Search ADS PubMed 31. Zhou D , Zhang Y , Wu H et al. Mst1 and Mst2 protein kinases restrain intestinal stem cell proliferation and colonic tumorigenesis by inhibition of Yes-associated protein [Yap] overabundance . Proc Natl Acad Sci U S A 2011 ; 108 : E1312 – 20 . Google Scholar CrossRef Search ADS PubMed 32. Cai J , Zhang N , Zheng Y , de Wilde RF , Maitra A , Pan D . The Hippo signaling pathway restricts the oncogenic potential of an intestinal regeneration program . Genes Dev 2010 ; 24 : 2383 – 8 . Google Scholar CrossRef Search ADS PubMed 33. Camargo FD , Gokhale S , Johnnidis JB et al. YAP1 increases organ size and expands undifferentiated progenitor cells . Curr Biol 2007 ; 17 : 2054 – 60 . Google Scholar CrossRef Search ADS PubMed 34. Azzolin L , Panciera T , Soligo S et al. YAP/TAZ incorporation in the β-catenin destruction complex orchestrates the Wnt response . Cell 2014 ; 158 : 157 – 70 . Google Scholar CrossRef Search ADS PubMed 35. Taniguchi K , Wu LW , Grivennikov SI et al. A gp130-Src-YAP module links inflammation to epithelial regeneration . Nature 2015 ; 519 : 57 – 62 . Google Scholar CrossRef Search ADS PubMed 36. Ye D , Guo S , Al-Sadi R , Ma TY . MicroRNA regulation of intestinal epithelial tight junction permeability . Gastroenterology 2011 ; 141 : 1323 – 33 . Google Scholar CrossRef Search ADS PubMed 37. Ghorpade DS , Sinha AY , Holla S , Singh V , Balaji KN . NOD2-nitric oxide-responsive microRNA-146a activates Sonic hedgehog signaling to orchestrate inflammatory responses in murine model of inflammatory bowel disease . J Biol Chem 2013 ; 288 : 33037 – 48 . Google Scholar CrossRef Search ADS PubMed 38. Pierdomenico M , Cesi V , Cucchiara S et al. NOD2 is regulated by Mir-320 in physiological conditions but this control is altered in inflamed tissues of patients with inflammatory bowel disease . Inflamm Bowel Dis 2016 ; 22 : 315 – 26 . Google Scholar CrossRef Search ADS PubMed 39. Brest P , Lapaquette P , Souidi M et al. A synonymous variant in IRGM alters a binding site for miR-196 and causes deregulation of IRGM-dependent xenophagy in Crohn’s disease . Nat Genet 2011 ; 43 : 242 – 5 . Google Scholar CrossRef Search ADS PubMed 40. Shen B , Yu S , Zhang Y et al. miR-590-5p regulates gastric cancer cell growth and chemosensitivity through RECK and the AKT/ERK pathway . Onco Targets Ther 2016 ; 9 : 6009 – 19 . Google Scholar CrossRef Search ADS PubMed 41. Zhou L , Zhao LC , Jiang N et al. MicroRNA miR-590-5p inhibits breast cancer cell stemness and metastasis by targeting SOX2 . Eur Rev Med Pharmacol Sci 2017 ; 21 : 87 – 94 . Google Scholar PubMed 42. Wang L , Wei WQ , Wu ZY , Wang GC . MicroRNA-590-5p regulates cell viability, apoptosis, migration and invasion of renal cell carcinoma cell lines through targeting ARHGAP24 . Mol Biosyst 2017 ; 13 : 2564 – 73 . Google Scholar CrossRef Search ADS PubMed 43. Long X , Li Y , Qiu S , Liu J , He L , Peng Y . MiR-582-5p/miR-590-5p targeted CREB1/CREB5-NF-κB signaling and caused opioid-induced immunosuppression in human monocytes . Transl Psychiatry 2016 ; 6 : e757 . Google Scholar CrossRef Search ADS PubMed 44. Terzic J , Grivennikov S , Karin E , Karin M . Inflammation and colon cancer . Gastroenterology 2010 ; 138 : 2101 – 14.e2105 . Google Scholar CrossRef Search ADS PubMed 45. Kim W , Khan SK , Gvozdenovic-Jeremic J et al. Hippo signaling interactions with Wnt/β-catenin and Notch signaling repress liver tumorigenesis . J Clin Invest 2017 ; 127 : 137 – 52 . Google Scholar CrossRef Search ADS PubMed 46. Cotton JL , Li Q , Ma L et al. YAP/TAZ and hedgehog coordinate growth and patterning in gastrointestinal mesenchyme . Dev Cell 2017 ; 43 : 35 – 47.e34 . Google Scholar CrossRef Search ADS PubMed 47. Hansen CG , Moroishi T , Guan KL . YAP and TAZ: a nexus for Hippo signaling and beyond . Trends Cell Biol 2015 ; 25 : 499 – 513 . Google Scholar CrossRef Search ADS PubMed 48. Sun Z , Xu R , Li X et al. Prognostic value of yes-associated protein 1 [YAP1] in various cancers: a meta-analysis . PLoS One 2015 ; 10 : e0135119 . Google Scholar CrossRef Search ADS PubMed Copyright © 2018 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
Journal
Journal of Crohn's and Colitis – Oxford University Press
Published: Aug 1, 2018