Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Maternal Nicotine Exposure Leads to Augmented Expression of the Antioxidant Adipose Tissue Triglyceride Lipase Long-Term in the White Adipose of Female Rat Offspring

Maternal Nicotine Exposure Leads to Augmented Expression of the Antioxidant Adipose Tissue... Abstract Globally, approximately 10%–25% of women smoke during pregnancy. Since nicotine is highly addictive, women may use nicotine-containing products like nicotine replacement therapies for smoking cessation, but the long-term consequences of early life exposure to nicotine remain poorly defined. Our laboratory has previously demonstrated that maternal nicotine exposed (MNE) rat offspring exhibit hypertriglyceridemia due to increased hepatic de novo lipogenesis. Hypertriglyceridemia may also be attributed to impaired white adipose tissue (WAT) lipid storage; however, the effects of MNE on WAT are not completely understood. We hypothesize that nicotine-induced alterations in adipose function (eg, lipid storage) underlie dyslipidemia in MNE adults. Female 6-month-old rats exposed to nicotine during gestation and lactation exhibited significantly decreased visceral adipocyte cell area by 40%, attributed, in part, to a 3-fold increase in adipose triglyceride lipase (ATGL) protein expression compared with vehicle. Given ATGL has antioxidant properties and in utero nicotine exposure promotes oxidative stress in various tissues, we next investigated if there was evidence of increased oxidative stress in MNE WAT. At both 3 weeks and 6 months, MNE offspring expressed 37%–48% higher protein levels of superoxide dismutase-1 and -2 in WAT. Since oxidative stress can induce inflammation, we examined the inflammatory profile of WAT and found increased expression of cytokines (interleukin-1β, tumor necrosis factor α, and interleukin-6) by 44%–61% at 6 months. Collectively, this suggests that the expression of WAT ATGL may be induced to counter MNE-induced oxidative stress and inflammation. However, higher levels of ATGL would further promote lipolysis in WAT, culminating in impaired lipid storage and long-term dyslipidemia. white adipose tissue, maternal nicotine exposure, oxidative stress, adipocytes Evidence now demonstrates that cigarette smoke plays a critical role in the development of dyslipidemia and obesity in children exposed during perinatal life (Wen et al., 2010; Weng et al., 2012). This is especially concerning given that approximately 10%–25% of women still smoke during pregnancy, with rates as high as 59% in certain Indigenous communities (Cui et al., 2014; Roman-Galvez et al., 2017; Tappin et al., 2010; Tong et al., 2013). To date, nicotine replacement therapies (NRTs) for smoking cessation (ie transdermal patches, gums, e-cigarettes) are thought to benefit pregnant women who are highly addicted and unable to quit smoking by other means (Oncken and Kranzler, 2003). However, the consequences of fetal and neonatal exposure to nicotine alone on the long-term metabolic health of the offspring have yet to be fully defined. Maternal nicotine use during gestation and lactation leads to significant exposure to the fetus and neonate since it is present in fetal blood and transferred through amniotic fluid, placental tissue, and breast milk (Luck and Nau, 1987; Luck et al., 1985). Numerous animal studies demonstrate that nicotine use during pregnancy leads to adverse neurobehavioral, pulmonary, cardiovascular, and metabolic outcomes in the offspring (Barra et al., 2017; Chou and Chen, 2014; Dasgupta et al., 2012; Ma et al., 2014; Pauly and Slotkin, 2008). Specifically, we and others have shown in rats that perinatal exposure to nicotine alone leads to increased blood pressure, adiposity, decreased glucose tolerance, and impaired pancreatic beta cell development (Fox et al., 2012; Gao et al., 2005, 2008; Holloway et al., 2008). Moreover, MNE during gestation and lactation leads to increased hepatic de novo lipogenesis and increased hepatic and circulating triglycerides (TGs) in postnatal life (Ma et al., 2014). This reciprocates human studies which have demonstrated that children exposed to maternal smoke in utero have higher TG levels later in life (Cupul-Uicab et al., 2012). Since increased circulating plasma TGs is strongly associated with cardiovascular disease (CVD) (Bansal et al., 2007), elucidating the underlying molecular mechanisms promoting dyslipidemia will undoubtedly uncover therapeutic targets to reduce unwarranted CVD risk to these nicotine-exposed individuals. Aside from the liver, the augmented circulating and hepatic TG accumulation observed in these MNE offspring could also be attributed to impairments in other metabolic tissues, such as white adipose tissue (WAT). The major role of WAT is to store excess circulating TGs to prevent glucose and lipid toxicity, and moreover, ectopic fat deposition (Abate, 2012). Excess circulating TGs promote adipocytes to undergo differentiation, hypertrophy, and/or hyperplasia to process and store lipids. Once the maximum TG storage capacity is reached, fatty acids can spillover in the plasma, increasing substrate availability for hepatic TG synthesis (Abate, 2012). Ultimately, hypertriglyceridemia contributes to various systemic abnormalities like dyslipidemia, insulin resistance, and CVD (Abate, 2012). Currently, the effects of MNE on WAT function are not completely understood. Studies by Somm et al. (2008) indicated that MNE during gestation resulted in adipocyte hypertrophy and increased expression of adipogenic transcription factors in 3-week male offspring, but the long-term effects were not examined. A more recent study by Fan et al. (2016) demonstrated that maternal exposure of nicotine (from gestational day 9 to weaning) led to decreased adipocyte size in 26-week-old male offspring, suggesting an impaired capacity for lipid storage. Furthermore, this study also found an increase in steady-state mRNA levels of adipocyte differentiation and lipogenic markers in MNE WAT compared with vehicle (Fan et al., 2016). However, given most women addicted to smoking would be exposed to nicotine (ie, NRT or cigarettes) in both prenatal and perinatal life, the goal of this study was to determine if this longer, more relevant, window of nicotine exposure impacts adipose function in both male and female offspring. Moreover, this window covers the entire period of rat adipose tissue differentiation (Greenwood and Hirsch, 1974). We hypothesize that in utero nicotine exposure will adversely impact WAT in the offspring, leading to dyslipidemia in adulthood. To examine this further, we will investigate if WAT function is affected due to altered adipocyte size, proliferation (ie, AKT-1), differentiation (ie, CCAAT/enhancer-binding protein [C/EBP]-α/β, sterol regulatory element-binding transcription factor [SREBP]-1c), lipogenesis (ie, lipoprotein lipase [LPL], acetyl-coA carboxlyase (ACCα), fatty acid synthase (FAS), Acsl1), fatty acid transport (ie, FATP1, FATP4), and/or lipolysis (ATGL) in our well-established rat model of maternal nicotine exposure (MNE). MATERIALS AND METHODS MNE rat model Nulliparous 200–250 g female Wistar rats (Harlan, Indianapolis, Indiana) were injected daily subcutaneously with either saline (vehicle) or nicotine bitartrate at 1 mg/kg/day (Sigma-Aldrich, St Louis, Missouri) 2 weeks prior to mating, during gestation, and until weaning (PND21). This nicotine dose results in maternal serum cotinine concentrations of 135.9 ± 7.86 ng/ml, which is comparable to “moderate” female smokers (80 ng/ml) or NRT users (169.9 ng/ml) (Holloway et al., 2006; Shahab et al., 2017). Litters were culled to 8 at birth and following weaning, rats were housed as sibling pairs until 6 weeks of age, then subsequently housed individually. Male and female offspring were sacrificed via carbon dioxide inhalation at 3 weeks and 6 months of age. Gonadal WATs were extracted, either fixed in formalin or frozen in liquid nitrogen and stored at −80°C for histological and molecular analyses, respectively. All rats were conventionally housed in polycarbonate microisolator cages with ad libitum access to water and standard chow diet (Teklad 22/5 rodent diet; Envigo) under controlled lighting (12:12 L:D), humidity (40%–50%), and temperature (22°C). In accordance with the Canadian Council for Animal Care guidelines, animal experiments were approved by the Animal Research Ethics Board at McMaster University. Gonadal adipocyte cell area A portion of gonadal WAT was fixed in 10% (v/v) neutral buffered formalin overnight, washed in water, and embedded in paraffin. Cross sections were stained with hematoxylin and eosin (H&E) and photographed using the Olympus BX50 microscope under a 10× objective. Cell areas were quantified from a minimum of 160 adipocytes from 2 cross sections/rat using Northern Eclipse software (Empix Imaging Inc.). RNA extraction and real time-polymerase chain reaction Total RNA was extracted from homogenized 3-week and 6-month WAT samples using TRIzol reagent according to the manufacturer’s instructions (Invitrogen). Two micrograms of RNA were reversed-transcribed to cDNA (high-capacity cDNA Reverse Transcription Kit, Applied Biosystems). Forward and reverse primer sets used for real time-polymerase chain reaction (RT-PCR), listed in Table 1, were designed with the National Center for Biotechnology Information’s primer designing tool. Relative transcript abundance was determined using SensiFAST No-ROX SYBR Green Supermix (FroggaBio) and the Bio-Rad CFX384 Real Time System. Samples were assayed in triplicate and relative fold change was calculated using comparative cycle times (Ct) method normalized to β-actin. The relative abundance was calculated using the formula 2ΔΔCt, where ΔΔCt was the normalized value. Table 1. Forward and Reverse Primer Sequences Used for Quantitative Real-Time PCR. Gene Forward Reverse GenBank/Reference AKT-1 ATGTGTATGAGAAGAAGCTGAGCC GTTCACTGTCCACACACTCCA NM_033230.2 C/EBPα GCCGGGAGAACTCTAACTCC TCGATGTAGGCGCTGATGTC NM_001287577.1 C/EBPβ ACCACGACTTCCTTTCCGAC TAACCGTAGTCGGACGGCTT NM_024125.5 SREBP1c CATGGACGAGCTACCCTTCG TCTTCGATGTCGGTCAAGAGC NM_001276707.1 LPL GGATGCAACATTGGAGAACCC GCTGGGGTTTTCTTCATTCAGC NM_012598.2 ACCα TCCGTATGTGACCAAAGACC TACGTTGTTCCCAAGGACTG NM_022193.1 FAS GGACATGGTCACAGACGATGAC CGTCGAACTTGGACAGATCCTT NM_017332.1 ACSL1 CTACAGGCAACCCCAAAGGA AATGCACTCTCCGTCGCTT NM_012820.1 FATP1 CAGCCTCTGTGGCCTCATT ACCCACGTACACACCGAAC NM_053580.2 FATP4 CTTGGGCAACTTTGACAGCC AGGACAGGATGCGGCTATTG NM_001100706.1 ATGL AACGCCACTCACATCTACGG TACCAGGTTGAAGGAGGGGT NM_001108509.2 EGR-1 CGAGCGAACAACCCTACGA CGATGTCAGAAAAGGACTCTGTG NM_012551.2 FOXO-1 TGCAGCAGACACCTTGCTAT TTGGGGCTGGGGGAATTTAG NM_001191846.2 IL-1β CAGCTTTCGACAGTGAGGAGA GTCGAGATGCTGCTGTGAGA NM_031512.2 TNFα CCGGGCAGGTCTACTTTGGA AGGCCACTACTTCAGCGTCTCG NM_012675.3 IL-6 CTTCCAGCCAGTTGCCTTCTTG TGGTCTGTTGTGGGTGGTATCC NM_012589.2 CD68 ACTGGGGCTCTTGGAAACTACAC CCTTGGTTTTGTTCGGGTTCA NM_001031638.1 SOD-1 ATTGGCCGTACTATGGTGGTC GCAATCCCAATCACACCACA NM_017050.1 SOD-2 ATTGCCGCCTGCTCTAATCA TCCCACACATCAATCCCCAG NM_017051.2 Gene Forward Reverse GenBank/Reference AKT-1 ATGTGTATGAGAAGAAGCTGAGCC GTTCACTGTCCACACACTCCA NM_033230.2 C/EBPα GCCGGGAGAACTCTAACTCC TCGATGTAGGCGCTGATGTC NM_001287577.1 C/EBPβ ACCACGACTTCCTTTCCGAC TAACCGTAGTCGGACGGCTT NM_024125.5 SREBP1c CATGGACGAGCTACCCTTCG TCTTCGATGTCGGTCAAGAGC NM_001276707.1 LPL GGATGCAACATTGGAGAACCC GCTGGGGTTTTCTTCATTCAGC NM_012598.2 ACCα TCCGTATGTGACCAAAGACC TACGTTGTTCCCAAGGACTG NM_022193.1 FAS GGACATGGTCACAGACGATGAC CGTCGAACTTGGACAGATCCTT NM_017332.1 ACSL1 CTACAGGCAACCCCAAAGGA AATGCACTCTCCGTCGCTT NM_012820.1 FATP1 CAGCCTCTGTGGCCTCATT ACCCACGTACACACCGAAC NM_053580.2 FATP4 CTTGGGCAACTTTGACAGCC AGGACAGGATGCGGCTATTG NM_001100706.1 ATGL AACGCCACTCACATCTACGG TACCAGGTTGAAGGAGGGGT NM_001108509.2 EGR-1 CGAGCGAACAACCCTACGA CGATGTCAGAAAAGGACTCTGTG NM_012551.2 FOXO-1 TGCAGCAGACACCTTGCTAT TTGGGGCTGGGGGAATTTAG NM_001191846.2 IL-1β CAGCTTTCGACAGTGAGGAGA GTCGAGATGCTGCTGTGAGA NM_031512.2 TNFα CCGGGCAGGTCTACTTTGGA AGGCCACTACTTCAGCGTCTCG NM_012675.3 IL-6 CTTCCAGCCAGTTGCCTTCTTG TGGTCTGTTGTGGGTGGTATCC NM_012589.2 CD68 ACTGGGGCTCTTGGAAACTACAC CCTTGGTTTTGTTCGGGTTCA NM_001031638.1 SOD-1 ATTGGCCGTACTATGGTGGTC GCAATCCCAATCACACCACA NM_017050.1 SOD-2 ATTGCCGCCTGCTCTAATCA TCCCACACATCAATCCCCAG NM_017051.2 Table 1. Forward and Reverse Primer Sequences Used for Quantitative Real-Time PCR. Gene Forward Reverse GenBank/Reference AKT-1 ATGTGTATGAGAAGAAGCTGAGCC GTTCACTGTCCACACACTCCA NM_033230.2 C/EBPα GCCGGGAGAACTCTAACTCC TCGATGTAGGCGCTGATGTC NM_001287577.1 C/EBPβ ACCACGACTTCCTTTCCGAC TAACCGTAGTCGGACGGCTT NM_024125.5 SREBP1c CATGGACGAGCTACCCTTCG TCTTCGATGTCGGTCAAGAGC NM_001276707.1 LPL GGATGCAACATTGGAGAACCC GCTGGGGTTTTCTTCATTCAGC NM_012598.2 ACCα TCCGTATGTGACCAAAGACC TACGTTGTTCCCAAGGACTG NM_022193.1 FAS GGACATGGTCACAGACGATGAC CGTCGAACTTGGACAGATCCTT NM_017332.1 ACSL1 CTACAGGCAACCCCAAAGGA AATGCACTCTCCGTCGCTT NM_012820.1 FATP1 CAGCCTCTGTGGCCTCATT ACCCACGTACACACCGAAC NM_053580.2 FATP4 CTTGGGCAACTTTGACAGCC AGGACAGGATGCGGCTATTG NM_001100706.1 ATGL AACGCCACTCACATCTACGG TACCAGGTTGAAGGAGGGGT NM_001108509.2 EGR-1 CGAGCGAACAACCCTACGA CGATGTCAGAAAAGGACTCTGTG NM_012551.2 FOXO-1 TGCAGCAGACACCTTGCTAT TTGGGGCTGGGGGAATTTAG NM_001191846.2 IL-1β CAGCTTTCGACAGTGAGGAGA GTCGAGATGCTGCTGTGAGA NM_031512.2 TNFα CCGGGCAGGTCTACTTTGGA AGGCCACTACTTCAGCGTCTCG NM_012675.3 IL-6 CTTCCAGCCAGTTGCCTTCTTG TGGTCTGTTGTGGGTGGTATCC NM_012589.2 CD68 ACTGGGGCTCTTGGAAACTACAC CCTTGGTTTTGTTCGGGTTCA NM_001031638.1 SOD-1 ATTGGCCGTACTATGGTGGTC GCAATCCCAATCACACCACA NM_017050.1 SOD-2 ATTGCCGCCTGCTCTAATCA TCCCACACATCAATCCCCAG NM_017051.2 Gene Forward Reverse GenBank/Reference AKT-1 ATGTGTATGAGAAGAAGCTGAGCC GTTCACTGTCCACACACTCCA NM_033230.2 C/EBPα GCCGGGAGAACTCTAACTCC TCGATGTAGGCGCTGATGTC NM_001287577.1 C/EBPβ ACCACGACTTCCTTTCCGAC TAACCGTAGTCGGACGGCTT NM_024125.5 SREBP1c CATGGACGAGCTACCCTTCG TCTTCGATGTCGGTCAAGAGC NM_001276707.1 LPL GGATGCAACATTGGAGAACCC GCTGGGGTTTTCTTCATTCAGC NM_012598.2 ACCα TCCGTATGTGACCAAAGACC TACGTTGTTCCCAAGGACTG NM_022193.1 FAS GGACATGGTCACAGACGATGAC CGTCGAACTTGGACAGATCCTT NM_017332.1 ACSL1 CTACAGGCAACCCCAAAGGA AATGCACTCTCCGTCGCTT NM_012820.1 FATP1 CAGCCTCTGTGGCCTCATT ACCCACGTACACACCGAAC NM_053580.2 FATP4 CTTGGGCAACTTTGACAGCC AGGACAGGATGCGGCTATTG NM_001100706.1 ATGL AACGCCACTCACATCTACGG TACCAGGTTGAAGGAGGGGT NM_001108509.2 EGR-1 CGAGCGAACAACCCTACGA CGATGTCAGAAAAGGACTCTGTG NM_012551.2 FOXO-1 TGCAGCAGACACCTTGCTAT TTGGGGCTGGGGGAATTTAG NM_001191846.2 IL-1β CAGCTTTCGACAGTGAGGAGA GTCGAGATGCTGCTGTGAGA NM_031512.2 TNFα CCGGGCAGGTCTACTTTGGA AGGCCACTACTTCAGCGTCTCG NM_012675.3 IL-6 CTTCCAGCCAGTTGCCTTCTTG TGGTCTGTTGTGGGTGGTATCC NM_012589.2 CD68 ACTGGGGCTCTTGGAAACTACAC CCTTGGTTTTGTTCGGGTTCA NM_001031638.1 SOD-1 ATTGGCCGTACTATGGTGGTC GCAATCCCAATCACACCACA NM_017050.1 SOD-2 ATTGCCGCCTGCTCTAATCA TCCCACACATCAATCCCCAG NM_017051.2 Protein extraction and Western blot WAT was homogenized in RIPA buffer (50 mM Tris-HCL, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Nonidet P40, 0.25% C24H39NaO4) supplemented with a protease inhibitor cocktail (Roche) and phosphatase inhibitors (20 mM NaF, 40 mM Na-pyrophosphate, 40 mM Na3VO4, 200 mM β-glycerophosphate disodium salt hydrate). The solution was sonicated, mixed in a rotator for 1 h at 4°C, and centrifuged at 300 × g for 15 min at 4°C. The total cellular protein extract in the collected supernatant was quantified by colorimetric DC protein assay (BioRad). Loading samples were heated at 50°C for 10 min to denature the proteins. Proteins (20 μg/well) were separated by size via gel electrophoresis and transferred onto polyvinylidene difluoride membrane (Millipore). Membranes were blocked in 1× Tris-buffered saline-Tween 20 buffer with 5% nonfat milk or 5% BSA (blocking solutions), and then probed using primary antibodies diluted in the blocking solution (Table 2). A mouse or rabbit secondary antibody was used to detect primary antibody diluted in the blocking solution at 1:5000 or 1:10 000 dilution, respectively (Table 2). Immuno-reactive bands were visualized, and relative band intensity was calculated using ImageLab software (BioRad) and normalized to β-actin, as previously performed (Ma et al., 2014). Table 2. Western Blot Antibodies, Dilutions Used in Experiments, and Company and Catalog Information Antibody Name Source Dilution Company (No. Catalog) 4-HNE Mouse monoclonal 1:500 R&D Systems Minneapolis, Minnesota (No. MAB3249) AKT-1 Rabbit polyclonal 1:500 Abcam Inc., Cambridge, Massachusetts (No. abcam 5919) ATGL (H-144) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-67355) C/EBPα (14AA) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-61) C/EBPβ (C-19) Rabbit polyclonal 1:300 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-150) SOD-1 (FL-154) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-11407) SOD-2 (FL-222) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-30080) SREBP 1c (H-160) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-8984) Mouse IgG (H+L) Secondary Sheep 1:5000 GE Healthcare UK, Pittsburgh, Pennsylvania (No. NA931) Rabbit IgG (H+L) Secondary Donkey 1:10 000 Jackson ImmunoResearch Laboratories, West Grove, Pennsylvania (No. 711-001-003) Antibody Name Source Dilution Company (No. Catalog) 4-HNE Mouse monoclonal 1:500 R&D Systems Minneapolis, Minnesota (No. MAB3249) AKT-1 Rabbit polyclonal 1:500 Abcam Inc., Cambridge, Massachusetts (No. abcam 5919) ATGL (H-144) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-67355) C/EBPα (14AA) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-61) C/EBPβ (C-19) Rabbit polyclonal 1:300 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-150) SOD-1 (FL-154) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-11407) SOD-2 (FL-222) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-30080) SREBP 1c (H-160) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-8984) Mouse IgG (H+L) Secondary Sheep 1:5000 GE Healthcare UK, Pittsburgh, Pennsylvania (No. NA931) Rabbit IgG (H+L) Secondary Donkey 1:10 000 Jackson ImmunoResearch Laboratories, West Grove, Pennsylvania (No. 711-001-003) Table 2. Western Blot Antibodies, Dilutions Used in Experiments, and Company and Catalog Information Antibody Name Source Dilution Company (No. Catalog) 4-HNE Mouse monoclonal 1:500 R&D Systems Minneapolis, Minnesota (No. MAB3249) AKT-1 Rabbit polyclonal 1:500 Abcam Inc., Cambridge, Massachusetts (No. abcam 5919) ATGL (H-144) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-67355) C/EBPα (14AA) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-61) C/EBPβ (C-19) Rabbit polyclonal 1:300 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-150) SOD-1 (FL-154) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-11407) SOD-2 (FL-222) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-30080) SREBP 1c (H-160) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-8984) Mouse IgG (H+L) Secondary Sheep 1:5000 GE Healthcare UK, Pittsburgh, Pennsylvania (No. NA931) Rabbit IgG (H+L) Secondary Donkey 1:10 000 Jackson ImmunoResearch Laboratories, West Grove, Pennsylvania (No. 711-001-003) Antibody Name Source Dilution Company (No. Catalog) 4-HNE Mouse monoclonal 1:500 R&D Systems Minneapolis, Minnesota (No. MAB3249) AKT-1 Rabbit polyclonal 1:500 Abcam Inc., Cambridge, Massachusetts (No. abcam 5919) ATGL (H-144) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-67355) C/EBPα (14AA) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-61) C/EBPβ (C-19) Rabbit polyclonal 1:300 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-150) SOD-1 (FL-154) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-11407) SOD-2 (FL-222) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-30080) SREBP 1c (H-160) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-8984) Mouse IgG (H+L) Secondary Sheep 1:5000 GE Healthcare UK, Pittsburgh, Pennsylvania (No. NA931) Rabbit IgG (H+L) Secondary Donkey 1:10 000 Jackson ImmunoResearch Laboratories, West Grove, Pennsylvania (No. 711-001-003) Statistical analysis Statistical analyses were performed using Graphpad Prism 6 software. Results were presented as the mean of arbitrary values ± SEM. Grubbs’ test was used to determine significant outliers and data were tested for normality and equal variance. Comparisons between vehicle and nicotine-exposed offspring were assessed using an unpaired Student’s t test, with a p-value of < .05 deemed as significant. RESULTS MNE Leads to Decreased Visceral Adipocyte Size in 6-Month-Old Offspring Using our well-established rat MNE model leading to dyslipidemia (Gao et al., 2005; Ma et al., 2014), we wanted to first confirm whether prenatal nicotine exposure has long term effects on adipocyte size in the offspring. Histological analyses revealed both MNE male and female offspring exhibited smaller gonadal adipocytes compared with vehicle controls at 6 months of age (Figs. 1A and 1B) . Given the more pronounced effects of perinatal nicotine exposure on female WAT area (13.2% male vs 39.7% female decrease in adipocyte size), we continued to examine only female offspring to explore the underlying mechanisms involved. Gondal adipose tissue weight did not differ between MNE and vehicle offspring (data not shown), suggesting a possible increase in adipocyte number due to prenatal nicotine exposure. With decreased adipocyte cell area and subsequent increase in cell number, transcript and protein levels of the proliferation marker AKT-1 were subsequently measured. Despite a significant increase in mRNA levels, there were no corresponding changes in AKT-1 protein levels in 6-month female MNE WAT (Figs. 1C and 1D). Figure 1. View largeDownload slide Maternal nicotine exposure leads to decreased visceral adipocyte cell area in 6-month-old offspring. Representative cross-sections of gonadal WAT excised from (A) vehicle and in utero nicotine exposed 6-month-old male and female offspring were stained with hematoxylin and eosin. B, Bar graph representing calculated cell areas analyzed using Northern Eclipse software (n = 4/group/sex). C, Transcript and (D) protein levels of AKT-1 in 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 7/nicotine). **,*** Significant difference (**p < .01, ***p < .001). Figure 1. View largeDownload slide Maternal nicotine exposure leads to decreased visceral adipocyte cell area in 6-month-old offspring. Representative cross-sections of gonadal WAT excised from (A) vehicle and in utero nicotine exposed 6-month-old male and female offspring were stained with hematoxylin and eosin. B, Bar graph representing calculated cell areas analyzed using Northern Eclipse software (n = 4/group/sex). C, Transcript and (D) protein levels of AKT-1 in 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 7/nicotine). **,*** Significant difference (**p < .01, ***p < .001). In Utero Nicotine Exposure Increases the Expression of the Differentiation Marker C/EBPα in WAT of 6-Month-Old Female Offspring Given impairments in adipocyte differentiation can also decrease adipocyte size, we next measured the expression of key targets involved in adipogenesis (Abate, 2012), including C/EBP-α/β and SREBP-1c. Protein analyses revealed a significant increase in the 42 kDa band of C/EBP-α in female MNE offspring compared with vehicle at 6 months independent of changes in transcript levels (Figs. 2A and 2B). Quantitative real time PCR analyses revealed that WAT from MNE exposed offspring had a significant increase in steady-state transcript levels of C/EBPβ and SREBP-1c compared with controls (Figs. 2C and 2E). However, immunoblot analyses revealed no significant differences at the protein level for either target (Figs. 2D and 2F). To examine if perinatal nicotine exposure had direct effects on C/EBPα, we measured the transcript and protein levels at 3 weeks age but found no difference in expression from vehicle (Figs. 2G and 2H). Figure 2. View largeDownload slide In utero nicotine exposure increases the expression of the differentiation marker C/EBPα in WAT of 6-month-old female offspring. Transcript and protein levels of targets of interest in 3-week and 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. Six-month (A) C/EBPα mRNA and (B) protein levels. C, C/EBPβ mRNA and (D) protein levels. E, SREBP1-c mRNA and (F) protein levels. Three-week (G) C/EBPα mRNA and (H) protein levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 7/nicotine). *Significant difference (*p < .05). Figure 2. View largeDownload slide In utero nicotine exposure increases the expression of the differentiation marker C/EBPα in WAT of 6-month-old female offspring. Transcript and protein levels of targets of interest in 3-week and 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. Six-month (A) C/EBPα mRNA and (B) protein levels. C, C/EBPβ mRNA and (D) protein levels. E, SREBP1-c mRNA and (F) protein levels. Three-week (G) C/EBPα mRNA and (H) protein levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 7/nicotine). *Significant difference (*p < .05). MNE Does Not Increase the Expression of Markers Involved in Lipogenesis and Fatty Acid Transporters in 6-Month-Old Female Offspring Adipocyte size is influenced by its ability to breakdown TG molecules from circulation, transport its constitutive components intracellularly, and re-assemble TGs for storage (Kersten, 2014). Therefore, we wanted to determine whether perinatal nicotine exposure impaired TG transport and esterification by measuring the steady state transcript levels of key targets involved in lipogenesis and fatty acid transport. At 6 months of age we found no significant difference between groups in the expression of lipogenic markers including LPL, ACCα, and FAS, along with fatty acid transporters FATP1/4, and long-chain acyl CoA synthetase (ASCL)-1 in female MNE WAT (Figs. 3A–F). Figure 3. View largeDownload slide Maternal nicotine exposure does not increase the expression of markers involved in lipogenesis and fatty acid transporters in WAT of 6-month-old female offspring. Transcript levels of targets of interest in 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR. Six-month (A) LPL, (B) ACCα, (C) FAS, (D) ASCL1, (E) FATP1, and (F) FATP4 mRNA levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Figure 3. View largeDownload slide Maternal nicotine exposure does not increase the expression of markers involved in lipogenesis and fatty acid transporters in WAT of 6-month-old female offspring. Transcript levels of targets of interest in 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR. Six-month (A) LPL, (B) ACCα, (C) FAS, (D) ASCL1, (E) FATP1, and (F) FATP4 mRNA levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). In Utero Nicotine-Exposed Female Offspring Exhibit Increased Expression of ATGL at 6 Months, But Not at 3 Weeks Since enhanced lipolysis decreases adipocyte size (Zhang et al., 2017), we then examined whether MNE WAT had elevated expression of adipose triglyceride lipase (ATGL), the predominate enzyme involved in intracellular degradation (Zechner et al., 2009). At 6 months of age, we found a significant increase in both ATGL mRNA expression and protein levels in nicotine-exposed female WAT compared with vehicle controls (Figs. 4A and 4B), however this was not observed at 3 weeks (Figs. 4C and 4D). Altogether, these data suggest that augmented ATGL-induced lipolysis may lead to reduced adipocyte cell area in MNE WAT at 6 months. Figure 4. View largeDownload slide In utero nicotine-exposed female offspring exhibit increased expression of ATGL at 6 months, but not at 3 weeks. Transcript and protein levels of ATGL in 3-week and 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. Six-month ATGL (A) mRNA and (B) protein levels. Three-week ATGL (C) mRNA and (D) protein levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 8/nicotine). *,** Significant difference (*p < .05, **p < .01). Figure 4. View largeDownload slide In utero nicotine-exposed female offspring exhibit increased expression of ATGL at 6 months, but not at 3 weeks. Transcript and protein levels of ATGL in 3-week and 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. Six-month ATGL (A) mRNA and (B) protein levels. Three-week ATGL (C) mRNA and (D) protein levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 8/nicotine). *,** Significant difference (*p < .05, **p < .01). MNE Exhibit Enhanced Antioxidant Expression at 6 Months and 3 Weeks Evidence demonstrates that ATGL deficiency in mice is associated with accumulation of reactive oxygen species (ROS) and decreased superoxide dismutase (SOD)-2 expression, suggesting this enzyme may act as an antioxidant and suppress oxidative stress (Aquilano et al., 2016; Chen et al., 2017a,b). Moreover, we and others have previously shown that MNE promotes oxidative stress in the heart, pancreas, and placenta of adult offspring (Barra et al., 2017; Bruin et al., 2008; Sbrana et al., 2011). Therefore, we wanted to determine whether an imbalance between antioxidant defenses occurs in WAT of 6-month female MNE offspring by measuring the transcript and protein levels of the antioxidants SOD-1 and SOD-2. Both SOD 1 and 2 steady state mRNA and protein levels were significantly elevated in prenatal nicotine-exposed WAT in 6-month female offspring compared with vehicle (Figs. 5A–D). At 3 weeks of age, there was also a significant increase in SOD-1 protein levels, and a trending increase in SOD-2, in the nicotine-exposed WAT group compared with controls (Figs. 5E–H). To determine if there was oxidative stress, we measured protein levels of 4-hydroxynonenal (4-HNE) and found a nonsignificant upward trend in nicotine-exposed WAT at both 3-week and 6-month timepoints (Figs. 5I and 5J). Overall, these data suggest that prenatal nicotine exposure directly increases the expression of the antioxidant SOD-1 and SOD-2 in 6-month WAT which was enough to prevent lipid oxidative damage. Figure 5. View largeDownload slide In utero nicotine-exposed female offspring exhibit increased antioxidant expression in WAT at 3 weeks and 6 months. Transcript and protein levels of SOD-1 and SOD-2 in 3-week and 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. Six-month SOD-1 (A) mRNA and (B) protein levels and SOD-2 (C) mRNA and (D) protein levels. Three-week SOD-1 (E) mRNA and (F) protein levels and SOD-2 (G) mRNA and (H) protein levels. Protein levels of 4-HNE at (I) 6 months and (J) 3 weeks of age. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 8/nicotine). *,** Significant difference (*p < .05, **p < .01). Figure 5. View largeDownload slide In utero nicotine-exposed female offspring exhibit increased antioxidant expression in WAT at 3 weeks and 6 months. Transcript and protein levels of SOD-1 and SOD-2 in 3-week and 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. Six-month SOD-1 (A) mRNA and (B) protein levels and SOD-2 (C) mRNA and (D) protein levels. Three-week SOD-1 (E) mRNA and (F) protein levels and SOD-2 (G) mRNA and (H) protein levels. Protein levels of 4-HNE at (I) 6 months and (J) 3 weeks of age. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 8/nicotine). *,** Significant difference (*p < .05, **p < .01). In Utero Nicotine Exposure Exhibit Inflammation at 6 Months, But Not at 3 Weeks Enhanced oxidative stress can activate nuclear factor-κB (NF-κB), leading the expression of proinflammatory cytokines and inflammation (Li and Karin, 1999; Morgan and Liu, 2011). As well, activation of this pathway in differentiated 3T3-L1 cells leads to increased lipase expression and lipolysis (Chi et al., 2014). Since oxidative stress, inflammation, and lipolysis are integrated pathways, we wanted to determine whether inflammation was present in 6-month in utero nicotine-exposed WAT. At 6 months, we found a significant increase in the steady-state mRNA expression profile of proinflammatory cytokines tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and the macrophage marker CD68 (Figs. 6A–D). In contrast at 3 weeks of age, there was no significant difference in steady state mRNA levels of inflammatory markers between groups (Figs. 6E–H). Figure 6. View largeDownload slide Maternal nicotine-exposed female offspring exhibit increases in WAT inflammation at 6 months, but not at 3 weeks. Transcript levels of targets of interest in 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR. Six-month (A) IL-1β, (B) TNFα, (C) IL-6, and (D) CD68 mRNA levels. Three-week (E) IL-1β, (F) TNFα, (G) IL-6, and (H) CD68 mRNA levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). *,**,*** Significant difference (*p < .05, **p < .01, **p < .001). Figure 6. View largeDownload slide Maternal nicotine-exposed female offspring exhibit increases in WAT inflammation at 6 months, but not at 3 weeks. Transcript levels of targets of interest in 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR. Six-month (A) IL-1β, (B) TNFα, (C) IL-6, and (D) CD68 mRNA levels. Three-week (E) IL-1β, (F) TNFα, (G) IL-6, and (H) CD68 mRNA levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). *,**,*** Significant difference (*p < .05, **p < .01, **p < .001). DISCUSSION Under normal physiological conditions, WAT serves as the principle lipid storage site to prevent ectopic lipid deposition in peripheral organs. The balance between lipolysis and lipogenesis dictates the overall amount of TG molecules stored as a single large lipid droplet in the cytoplasm of adipocytes, ultimately influencing its size (Bolsoni-Lopes and Alonso-Vale, 2015). Adipocytes have a limited TG storage capacity. Once exceeded, excess lipids will spill-over into circulation resulting in dyslipidemia and increased lipid content at ectopic sites like the liver (Abate, 2012). In our model, we have previously shown that MNE offspring have dyslipidemia with increased levels of circulating TGs (Gao et al., 2005; Ma et al., 2014). Although we have demonstrated that hepatic de novo lipogenesis is increased in nicotine-exposed offspring, the effect of nicotine exposure on WAT function were not examined. Previous studies indicate MNE during gestation or from gestation until weaning altered adipocyte size and increased the expression of adipocyte differentiation markers, but this was only examined in male offspring (Fan et al., 2016; Somm et al., 2008). Moreover, this exposure to nicotine in these studies (gestation only or mid-gestation to weaning only) does not mimic women’s smoking habits and/or nicotine use prior to pregnancy. Therefore, our goal was to determine if WAT plays a role in promoting dyslipidemia in both male and female offspring exposed to nicotine in prenatal and perinatal life. In this study, we demonstrated that both male and female offspring exposed to nicotine during prenatal and perinatal life decreased adipocyte cell area compared with vehicle controls at 6 months of age. Somm et al. (2008) reported that rats exposed to nicotine during pregnancy alone (from gestational day 4 for 14 days at 3 mg/kg/day) had adipocyte hypertrophy compared with vehicle controls in 3-week-old male offspring, but the effect on WAT size into adulthood, after nicotine exposure, was not examined. Similar to our findings, Fan et al. (2016) demonstrated that in utero nicotine exposure from mid-pregnancy (eg, gestational day 9) until weaning decreased adipocyte size in male WAT at 26 weeks of age. The dose of nicotine (1 mg/kg) administered in this study is relevant as it corresponds to moderate female smokers or NRT users (Holloway et al., 2006; Shahab et al., 2017), while doses used in other studies (2–3 mg/kg/day) correspond to heavy smokers (Fan et al., 2016; Somm et al., 2008). Examining the effects of MNE on WAT for a longer duration is important given adipose development occurs both pre- and postnatally in rats. In rodent adipose tissue, growth and differentiation occurs from late gestation to 4 weeks in postnatal life, while in humans this occurs from 5 to 29 weeks gestation (Greenwood and Hirsch, 1974; Poissonnet et al., 1984). In both species, adipose tissue expansion happens throughout life (Greenwood and Hirsch, 1974; Spalding et al., 2008). Given the extensive differentiation of adipose tissue during perinatal life, it is vulnerable to alterations by environmental cues (ie, drugs) during this developmental window. Furthermore, both mature adipocytes and adipocyte precursors like mesenchymal stem cells express nicotinic acetyl-choline receptor subunits, suggesting that nicotine may directly alter adipogenesis and adipocyte formation (Gochberg-Sarver et al., 2012; Hoogduijn et al., 2009). Since the effect on adipocyte size was more pronounced in female offspring, and previous studies focused on males (Fan et al., 2016; Somm et al., 2008), we decided to examine the effects of MNE on female adipose tissue function. One limitation of our study is that we did not evaluate the estrous cycle of the female rats. This is an important consideration since prenatal nicotine exposure increased progesterone levels in offspring compared with vehicle controls, which is reflective of estrous cycle perturbations (Holloway et al., 2006). Furthermore, others have reported that oscillations in metabolic related genes in the liver occur with estrous cycle (Villa et al., 2012). Since small adipocyte size results from aberrant adipogenesis, we examined whether MNE impaired adipocyte differentiation, lipid synthesis and transport, and/or lipolysis. We found that female MNE offspring exhibited increased mRNA and protein expression of the adipocyte differentiation factor C/EBPα and the lipolytic enzyme ATGL, without altering the expression of targets involved in lipogenesis and lipid transport. Similar to our results, Fan et al. (2016) found an increase in steady-state mRNA levels of adipocyte differentiation markers in MNE male offspring, including C/EBPα and SREBP-1c compared with control WAT in adulthood. Since these studies did not perform protein analyses, our study is the first to demonstrate that MNE induced C/EBPα protein levels in 6-month female WAT. Overall, the increased C/EBPα (42 kDa) expression in WAT suggests that MNE promote adipocyte differentiation and adipogenesis. C/EBPα contains 2 isoforms (30/42 kDa) alternatively translated from 1 mRNA transcript (Lin et al., 1993; Ossipow et al., 1993). Constitutive expression of the 42 kDa isoform can induce adipocyte differentiation in 3T3-L1 preadipocytes, suggesting that enhanced C/EBPα expression of this isoform can enhance adipocyte formation (Lin and Lane, 1994). Although the steady-state levels of AKT1, C/EBP-α, SREBP 1c mRNA were augmented in 6-month nicotine-exposed offspring, this did not translate to an alteration in protein levels. There are several cases in the literature whereby changes in the mRNA levels do not correlate to an alteration in protein, highlighting the importance of looking at both mRNA and protein (Vogel and Marcotte, 2012). Moreover, it is possible that the mRNA and protein levels of these key proliferation and differentiation markers may be altered earlier in development (ie, gestation and/or lactation) due to the direct effects of nicotine on their expression. For example, we have demonstrated that nicotine directly enhances the expression of the proliferation markers GADD45 and Rb1 in differentiating 3T3-L1 preadipocyte cells (data not shown). Therefore, in the absence of nicotine exposure after lactation, the levels of these proliferation and differentiation may have become normalized. This study was the first to demonstrate that both prenatal and perinatal nicotine exposure leads to increased ATGL mRNA and protein expression in adult female MNE offspring. This suggests that MNE may impair the lipid storage capacity of WAT via increased ATGL expression. Studies demonstrate that augmented ATGL leads to enhanced basal and stimulated WAT lipolysis and reduced adipocyte size (Ahmadian et al., 2009; Bezaire et al., 2009; Kershaw et al., 2006). The primary function of ATGL is to initiate lipolysis, by hydrolyzing the sn-2 ester bond of a TG molecule, resulting in the formation of diacylglycerol and fatty acid (Zechner et al., 2009). Therefore, decreased adipocyte cell size in gonadal WAT may be attributed to enhanced lipolysis in MNE offspring. Recently, evidence supports an additional role for ATGL—as an antioxidant and suppressor of oxidative stress. Oxidative stress is defined as an imbalance between antioxidant defenses and ROS production (free radicals) (Sena and Chandel, 2012). Prolonged oxidative stress can result in free radical damage, ultimately leading to mitochondrial-mediated apoptosis (Sena and Chandel, 2012). In vitro and in vivo analyses demonstrate that ATGL deficiency is associated with ROS accumulation and cellular apoptosis in renal podocytes and proximal tubules (Chen et al., 2017a,b). Similarly, ATGL inhibition in C2C12 myoblasts and in murine ATGL deficient skeletal muscle promotes oxidative damage and a defective cellular antioxidant response, characterized by a significant reduction in antioxidant SOD-2 expression and glutathione levels (Aquilano et al., 2016). Altogether, these findings suggest that ATGL may protect against oxidative stress. We and others have previously shown that MNE can cause oxidative stress in the offspring in various tissues including the heart, pancreas, and placenta (Barra et al., 2017; Bruin et al., 2008; Sbrana et al., 2011). Therefore, we examined the expression of antioxidants SOD-1/2 in WAT of 6-month female MNE offspring to assess whether an imbalance in antioxidant expression is present at the same time ATGL levels are elevated. Oxygen can oxidize other molecules to generate ROS, whereby majority of intracellular ROS are derived from superoxide (O2−). Superoxide is formed in the mitochondrial respiratory chain, emitted to the matrix and intermembrane space, and subsequently converted to hydrogen peroxide (H2O2) by SODs (Sena and Chandel, 2012). This study is the first to demonstrate that MNE WAT had increased transcript expression and protein levels of both SOD-1 and -2 at 6 months with evidence for increased SOD-1 at 3 weeks of age. Although nonsignificant, we also observed an upward trend for the oxidative marker 4-HNE in nicotine-exposed WAT compared with vehicle at both time points. This suggests that perinatal nicotine exposure may instigate WAT oxidative stress, triggering a rapid increase in antioxidant expression by weaning which persists into adulthood and may prevent long-term oxidative damage. Oxidative stress can contribute to altered adipocyte differentiation and lipolysis. Depending on environmental cues, mesenchymal stem cells can differentiate into various cell types derived from the mesodermal lineage including myocytes, adipocytes, osteocytes, and chondrocytes. Evidence suggests that elevated ROS levels, produced during oxidative stress, can stimulate adipogenesis while suppressing osteogenesis (Atashi et al., 2015). During conversion of stem cells to adipocytes, mitochondrial complexes I/III and the NADPH oxidase isoform NOX4 produce ROS to initiate adipocyte signaling cascades, leading to terminal differentiation (Atashi et al., 2015). Therefore, increased SOD-1 expression in fetal and neonatal nicotine-exposed WAT may suggest that augmented ROS production may directly promote the expression of adipogenic transcription factors like C/EBPα (Hu et al., 2005). In vitro analyses using both differentiated 3T3-L1 and human primary adipocyte cultures demonstrate that exposure to exogenous 4-HNE elevated lipolysis in basal and stimulated conditions characterized by a dose-dependent significant increase in glycerol and fatty acid release (Zhang et al., 2013). Altogether, these findings suggest that MNE may augment oxidative stress in WAT characterized by increased expression of antioxidants SOD-1/2 and ATGL, leading to altered adipocyte differentiation and lipolysis. Enhanced oxidative stress can promote pathways, like inflammation, that also influence adipose function. Exposure to hydrogen peroxide or ROS accumulation activates the transcription factor NF-κB, leading the expression of proinflammatory cytokines such as TNF-α or IL-1 (Lawrence, 2009; Li and Karin, 1999; Morgan and Liu, 2011). Intriguingly, treatment with either TNF-α or IL-6 in differentiated adipocytes can increase the expression of ATGL and enhance glycerol production (a marker of lipolysis). Moreover, in vitro studies reveal that TNF-α induces lipolysis in differentiated human and murine adipocytes through multiple distinct pathways (ie, mitogen-activated protein kinase kinase; extracellular signal-related kinase 1/2; and elevation of cyclic adenosine monophosphate; NH2-terminal kinase) (Ryden et al., 2002; Yang et al., 2011; Zhang et al., 2002). Similarly, treatment with IL-6 induces lipolysis through increased expression of ATGL in soleus muscles ex vivo (Macdonald et al., 2013) and enhanced glycerol production in 3T3-L1 cells (Ji et al., 2011). Our results reveal that fetal and neonatal nicotine exposure culminates in increased steady-state mRNA levels of proinflammatory mediators, including TNF-α and IL-6 by 6 months of age. These results coincide with previous findings demonstrating that in utero nicotine exposure resulted in increased circulating proinflammatory cytokines throughout development and in 11-week-old offspring (Mohsenzadeh et al., 2014; Orellana et al., 2014). Since inflammation was present in 6-month female WAT and not at 3 weeks, this suggests that nicotine does not have a direct effect on inflammation but that augmented oxidative stress may mediate the expression of proinflammatory cytokines. One research group demonstrated that CD-1 mice fed a nicotine-containing diet for 14 weeks postnatally decreased adipocyte cell size without affecting white adipose inflammation (Liu et al., 2018). In fact, treatment with 4-HNE in 3T3-L1 cells induced inflammation by activating p38, subsequently increasing the expression of cyclooxygenase-2 (Zarrouki et al., 2007). Further studies are warranted to determine whether inflammation may in part promote lipolysis in prenatal nicotine-exposed WAT long term. In summary, our findings demonstrate that MNE during pregnancy and lactation leads to decreased WAT adipocyte size and impaired lipid storage in postnatal life characterized by augmented lipolysis and inflammation triggered possibly by a pro-oxidative stress environment. This impairment in WAT lipid storage can contribute to increased circulating TGs, leading to enhanced hepatic de novo lipogenesis, high blood pressure, and increased CVD risk as we have previously shown (Gao et al. 2008; Ma et al., 2014). These findings provide insight into the consequence of prolonged oxidative stress driving WAT dysfunction long-term. Postnatal intervention strategies targeting oxidative stress may benefit children exposed to nicotine in utero through cigarette smoke and/or NRT. In fact, studies demonstrate that the use of antioxidants (ie, anthocyanin, quercetin, bottle gourd) can significantly reduce dyslipidemia (Li et al., 2015; Talirevic and Jelena, 2012). Overall, results from this study suggest that therapeutic strategies targeting oxidative stress may effectively protect nicotine-exposed offspring from WAT dysfunction and dyslipidemia. FUNDING Canadian Institutes of Health Research (MOP86474 to A.C.H., MOP111011 to D.B.H.); research grant from the Women’s Development Council to D.B.H. N.G.B. is a recipient of a Whaley Fellowship and a Molly Towell Perinatal Research Foundation Fellowship. ACKNOWLEDGMENT The authors would like to acknowledge Dr Lin Zhao for his technical support. REFERENCES Abate N. ( 2012 ). Adipocyte maturation arrest: A determinant of systemic insulin resistance to glucose disposal . J. Clin. Endocrinol. Metab. 97 , 760 – 763 . Google Scholar CrossRef Search ADS PubMed Ahmadian M. , Duncan R. E. , Varady K. A. , Frasson D. , Hellerstein M. K. , Birkenfeld A. L. , Samuel V. T. , Shulman G. I. , Wang Y. , Kang C. ( 2009 ). Adipose overexpression of desnutrin promotes fatty acid use and attenuates diet-induced obesity . Diabetes 58 , 855 – 866 . Google Scholar CrossRef Search ADS PubMed Aquilano K. , Baldelli S. , La Barbera L. , Lettieri Barbato D. , Tatulli G. , Ciriolo M. R. ( 2016 ). Adipose triglyceride lipase decrement affects skeletal muscle homeostasis during aging through FAs-PPARalpha-PGC-1alpha antioxidant response . Oncotarget 7 , 23019 – 23032 . Google Scholar CrossRef Search ADS PubMed Atashi F. , Modarressi A. , Pepper M. S. ( 2015 ). The role of reactive oxygen species in mesenchymal stem cell adipogenic and osteogenic differentiation: A review . Stem Cells Dev. 24 , 1150 – 1163 . Google Scholar CrossRef Search ADS PubMed Bansal S. , Buring J. E. , Rifai N. , Mora S. , Sacks F. M. , Ridker P. M. ( 2007 ). Fasting compared with nonfasting triglycerides and risk of cardiovascular events in women . Jama 298 , 309 – 316 . Google Scholar CrossRef Search ADS PubMed Barra N. G. , Lisyansky M. , Vanduzer T. A. , Raha S. , Holloway A. C. , Hardy D. B. ( 2017 ). Maternal nicotine exposure leads to decreased cardiac protein disulfide isomerase and impaired mitochondrial function in male rat offspring . J. Appl. Toxicol. 37 12 , 1517 – 1526 . Google Scholar CrossRef Search ADS PubMed Bezaire V. , Mairal A. , Ribet C. , Lefort C. , Girousse A. , Jocken J. , Laurencikiene J. , Anesia R. , Rodriguez A. M. , Ryden M. et al. , . ( 2009 ). Contribution of adipose triglyceride lipase and hormone-sensitive lipase to lipolysis in hMADS adipocytes . J. Biol. Chem. 284 , 18282 – 18291 . Google Scholar CrossRef Search ADS PubMed Bolsoni-Lopes A. , Alonso-Vale M. I. ( 2015 ). Lipolysis and lipases in white adipose tissue - An update . Arch. Endocrinol. Metab. 59 , 335 – 342 . Google Scholar CrossRef Search ADS PubMed Bruin J. E. , Petre M. A. , Lehman M. A. , Raha S. , Gerstein H. C. , Morrison K. M. , Holloway A. C. ( 2008 ). Maternal nicotine exposure increases oxidative stress in the offspring . Free Radic. Biol. Med. 44 , 1919 – 1925 . Google Scholar CrossRef Search ADS PubMed Chen W. , Jiang Y. , Han J. , Hu J. , He T. , Yan T. , Huang N. , Zhang Q. , Mei H. , Liao Y. et al. , . ( 2017a ). Atgl deficiency induces podocyte apoptosis and leads to glomerular filtration barrier damage . Febs J. 284 , 1070 – 1081 . Google Scholar CrossRef Search ADS Chen W. , Zhang Q. , Cheng S. , Huang J. , Diao G. , Han J. ( 2017b ). Atgl gene deletion predisposes to proximal tubule damage by impairing the fatty acid metabolism . Biochem. Biophys. Res. Commun. 487 , 160 – 166 . Google Scholar CrossRef Search ADS Chi W. , Dao D. , Lau T. C. , Henriksbo B. D. , Cavallari J. F. , Foley K. P. , Schertzer J. D. ( 2014 ). Bacterial peptidoglycan stimulates adipocyte lipolysis via NOD1 . PLoS One 9 , e97675. Google Scholar CrossRef Search ADS PubMed Chou H. C. , Chen C. M. ( 2014 ). Maternal nicotine exposure during gestation and lactation induces cardiac remodeling in rat offspring . Reprod. Toxicol. 50 , 4 – 10 . Google Scholar CrossRef Search ADS PubMed Cui Y. , Shooshtari S. , Forget E. L. , Clara I. , Cheung K. F. ( 2014 ). Smoking during pregnancy: Findings from the 2009-2010 Canadian Community Health Survey . PLoS One 9 , e84640. Google Scholar CrossRef Search ADS PubMed Cupul-Uicab L. A. , Skjaerven R. , Haug K. , Travlos G. S. , Wilson R. E. , Eggesbo M. , Hoppin J. A. , Whitworth K. W. , Longnecker M. P. ( 2012 ). Exposure to tobacco smoke in utero and subsequent plasma lipids, ApoB, and CRP among adult women in the MoBa cohort . Environ. Health Perspect. 120 , 1532 – 1537 . Google Scholar CrossRef Search ADS PubMed Dasgupta C. , Xiao D. , Xu Z. , Yang S. , Zhang L. ( 2012 ). Developmental nicotine exposure results in programming of alveolar simplification and interstitial pulmonary fibrosis in adult male rats . Reprod. Toxicol. 34 , 370 – 377 . Google Scholar CrossRef Search ADS PubMed Fan J. , Zhang W. X. , Rao Y. S. , Xue J. L. , Wang F. F. , Zhang L. , Yan Y. E. ( 2016 ). Perinatal nicotine exposure increases obesity susceptibility in adult male rat offspring by altering early adipogenesis . Endocrinology 157 , 4276 – 4286 . Google Scholar CrossRef Search ADS PubMed Fox K. A. , Longo M. , Tamayo E. , Gamble P. , Makhlouf M. , Mateus J. F. , Saade G. R. ( 2012 ). Sex-specific effects of nicotine exposure on developmental programming of blood pressure and vascular reactivity in the C57Bl/6J mouse . Am. J. Obstet. Gynecol. 207 , 208 e1 – 209 . Google Scholar CrossRef Search ADS Gao Y. J. , Holloway A. C. , Su L. Y. , Takemori K. , Lu C. , Lee R. M. ( 2008 ). Effects of fetal and neonatal exposure to nicotine on blood pressure and perivascular adipose tissue function in adult life . Eur. J. Pharmacol. 590 , 264 – 268 . Google Scholar CrossRef Search ADS PubMed Gao Y. J. , Holloway A. C. , Zeng Z. H. , Lim G. E. , Petrik J. J. , Foster W. G. , Lee R. M. ( 2005 ). Prenatal exposure to nicotine causes postnatal obesity and altered perivascular adipose tissue function. Obes. Res. 13 , 687 – 692 . Gochberg-Sarver A. , Kedmi M. , Gana-Weisz M. , Bar-Shira A. , Orr-Urtreger A. ( 2012 ). Tnfalpha, Cox2 and AdipoQ adipokine gene expression levels are modulated in murine adipose tissues by both nicotine and nACh receptors containing the beta2 subunit . Mol. Genet. Metab. 107 , 561 – 570 . Google Scholar CrossRef Search ADS PubMed Greenwood M. R. , Hirsch J. ( 1974 ). Postnatal development of adipocyte cellularity in the normal rat . J. Lipid Res. 15 , 474 – 483 . Google Scholar PubMed Holloway A. C. , Kellenberger L. D. , Petrik J. J. ( 2006 ). Fetal and neonatal exposure to nicotine disrupts ovarian function and fertility in adult female rats . Endocrine 30 , 213 – 216 . Google Scholar CrossRef Search ADS PubMed Holloway A. C. , Petrik J. J. , Bruin J. E. , Gerstein H. C. ( 2008 ). Rosiglitazone prevents diabetes by increasing beta-cell mass in an animal model of type 2 diabetes characterized by reduced beta-cell mass at birth . Diabetes Obes. Metab. 10 , 763 – 771 . Google Scholar CrossRef Search ADS PubMed Hoogduijn M. J. , Cheng A. , Genever P. G. ( 2009 ). Functional nicotinic and muscarinic receptors on mesenchymal stem cells . Stem Cells Dev. 18 , 103 – 112 . Google Scholar CrossRef Search ADS PubMed Hu Y. , Rosen D. G. , Zhou Y. , Feng L. , Yang G. , Liu J. , Huang P. ( 2005 ). Mitochondrial manganese-superoxide dismutase expression in ovarian cancer: Role in cell proliferation and response to oxidative stress . J. Biol. Chem. 280 , 39485 – 39492 . Google Scholar CrossRef Search ADS PubMed Ji C. , Chen X. , Gao C. , Jiao L. , Wang J. , Xu G. , Fu H. , Guo X. , Zhao Y. ( 2011 ). IL-6 induces lipolysis and mitochondrial dysfunction, but does not affect insulin-mediated glucose transport in 3T3-L1 adipocytes . J. Bioenerg. Biomembr. 43 , 367 – 375 . Google Scholar CrossRef Search ADS PubMed Kershaw E. E. , Hamm J. K. , Verhagen L. A. , Peroni O. , Katic M. , Flier J. S. ( 2006 ). Adipose triglyceride lipase: Function, regulation by insulin, and comparison with adiponutrin . Diabetes 55 , 148 – 157 . Google Scholar CrossRef Search ADS PubMed Kersten S. ( 2014 ). Physiological regulation of lipoprotein lipase . Biochim. Biophys. Acta 1841 , 919 – 933 . Google Scholar CrossRef Search ADS PubMed Lawrence T. ( 2009 ). The nuclear factor NF-kappaB pathway in inflammation . Cold Spring Harb. Perspect. Biol. 1 , a001651. Google Scholar CrossRef Search ADS PubMed Li D. , Zhang Y. , Liu Y. , Sun R. , Xia M. ( 2015 ). Purified anthocyanin supplementation reduces dyslipidemia, enhances antioxidant capacity, and prevents insulin resistance in diabetic patients . J. Nutr. 145 , 742 – 748 . Google Scholar CrossRef Search ADS PubMed Li N. , Karin M. ( 1999 ). Is NF-kappaB the sensor of oxidative stress? Faseb J. 13 , 1137 – 1143 . Google Scholar CrossRef Search ADS PubMed Lin F. T. , Lane M. D. ( 1994 ). CCAAT/enhancer binding protein alpha is sufficient to initiate the 3T3-L1 adipocyte differentiation program . Proc. Natl. Acad. Sci. U.S.A. 91 , 8757 – 8761 . Google Scholar CrossRef Search ADS PubMed Lin F. T. , MacDougald O. A. , Diehl A. M. , Lane M. D. ( 1993 ). A 30-kDa alternative translation product of the CCAAT/enhancer binding protein alpha message: Transcriptional activator lacking antimitotic activity . Proc. Natl. Acad. Sci. U.S.A. 90 , 9606 – 9610 . Google Scholar CrossRef Search ADS PubMed Liu M. , Chuang Key C. C. , Weckerle A. , Boudyguina E. , Sawyer J. K. , Gebre A. K. , Spoo W. , Makwana O. , Parks J. S. ( 2018 ). Feeding of tobacco blend or nicotine induced weight loss associated with decreased adipocyte size and increased physical activity in male mice . Food Chem. Toxicol. 113 , 287 – 295 . Google Scholar CrossRef Search ADS PubMed Luck W. , Nau H. ( 1987 ). Nicotine and cotinine concentrations in the milk of smoking mothers: Influence of cigarette consumption and diurnal variation . Eur. J. Pediatr. 146 , 21 – 26 . Google Scholar CrossRef Search ADS PubMed Luck W. , Nau H. , Hansen R. , Steldinger R. ( 1985 ). Extent of nicotine and cotinine transfer to the human fetus, placenta and amniotic fluid of smoking mothers . Dev. Pharmacol. Ther. 8 , 384 – 395 . Google Scholar CrossRef Search ADS PubMed Ma N. , Nicholson C. J. , Wong M. , Holloway A. C. , Hardy D. B. ( 2014 ). Fetal and neonatal exposure to nicotine leads to augmented hepatic and circulating triglycerides in adult male offspring due to increased expression of fatty acid synthase . Toxicol. Appl. Pharmacol. 275 , 1 – 11 . Google Scholar CrossRef Search ADS PubMed Macdonald T. L. , Wan Z. , Frendo-Cumbo S. , Dyck D. J. , Wright D. C. ( 2013 ). IL-6 and epinephrine have divergent fiber type effects on intramuscular lipolysis . J. Appl. Physiol. (1985) 115 , 1457 – 1463 . Google Scholar CrossRef Search ADS PubMed Mohsenzadeh Y. , Rahmani A. , Cheraghi J. , Pyrani M. , Asadollahi K. ( 2014 ). Prenatal exposure to nicotine in pregnant rat increased inflammatory marker in newborn rat . Mediators Inflamm. 2014 , 1. Google Scholar CrossRef Search ADS Morgan M. J. , Liu Z. G. ( 2011 ). Crosstalk of reactive oxygen species and NF-kappaB signaling . Cell Res. 21 , 103 – 115 . Google Scholar CrossRef Search ADS PubMed Oncken C. A. , Kranzler H. R. ( 2003 ). Pharmacotherapies to enhance smoking cessation during pregnancy . Drug Alcohol Rev. 22 , 191 – 202 . Google Scholar CrossRef Search ADS PubMed Orellana J. A. , Busso D. , Ramirez G. , Campos M. , Rigotti A. , Eugenin J. , von Bernhardi R. ( 2014 ). Prenatal nicotine exposure enhances Cx43 and Panx1 unopposed channel activity in brain cells of adult offspring mice fed a high-fat/cholesterol diet . Front. Cell Neurosci. 8 , 403. Google Scholar CrossRef Search ADS PubMed Ossipow V. , Descombes P. , Schibler U. ( 1993 ). CCAAT/enhancer-binding protein mRNA is translated into multiple proteins with different transcription activation potentials . Proc. Natl. Acad. Sci. U.S.A. 90 , 8219 – 8223 . Google Scholar CrossRef Search ADS PubMed Pauly J. R. , Slotkin T. A. ( 2008 ). Maternal tobacco smoking, nicotine replacement and neurobehavioural development . Acta Paediatr. 97 , 1331 – 1337 . Google Scholar CrossRef Search ADS PubMed Poissonnet C. M. , Burdi A. R. , Garn S. M. ( 1984 ). The chronology of adipose tissue appearance and distribution in the human fetus . Early Hum. Dev. 10 , 1 – 11 . Google Scholar CrossRef Search ADS PubMed Roman-Galvez R. M. , Amezcua-Prieto C. , Olmedo-Requena R. , Lewis-Mikhael Saad A. M. , Martinez-Galiano J. M. , Bueno-Cavanillas A. ( 2017 ). Partner smoking influences whether mothers quit smoking during pregnancy: A prospective cohort study . BJOG Oct 20. doi: 10.1111/1471-0528.14986, 1 – 8 . Ryden M. , Dicker A. , van Harmelen V. , Hauner H. , Brunnberg M. , Perbeck L. , Lonnqvist F. , Arner P. ( 2002 ). Mapping of early signaling events in tumor necrosis factor-alpha -mediated lipolysis in human fat cells . J. Biol. Chem. 277 , 1085 – 1091 . Google Scholar CrossRef Search ADS PubMed Sbrana E. , Suter M. A. , Abramovici A. R. , Hawkins H. K. , Moss J. E. , Patterson L. , Shope C. , Aagaard-Tillery K. ( 2011 ). Maternal tobacco use is associated with increased markers of oxidative stress in the placenta . Am. J. Obstet. Gynecol. 205 , 246 e1 – 247 . Google Scholar CrossRef Search ADS Sena L. A. , Chandel N. S. ( 2012 ). Physiological roles of mitochondrial reactive oxygen species . Mol Cell 48 , 158 – 167 . Google Scholar CrossRef Search ADS PubMed Shahab L. , Dobbie F. , Hiscock R. , McNeill A. , Bauld L. ( 2017 ). Prevalence and impact of long-term use of nicotine replacement therapy in UK stop-smoking services: Findings from the ELONS study . Nicotine Tob. Res. 20 1 , 81 – 88 . Google Scholar PubMed Somm E. , Schwitzgebel V. M. , Vauthay D. M. , Camm E. J. , Chen C. Y. , Giacobino J. P. , Sizonenko S. V. , Aubert M. L. , Huppi P. S. ( 2008 ). Prenatal nicotine exposure alters early pancreatic islet and adipose tissue development with consequences on the control of body weight and glucose metabolism later in life . Endocrinology 149 , 6289 – 6299 . Google Scholar CrossRef Search ADS PubMed Spalding K. L. , Arner E. , Westermark P. O. , Bernard S. , Buchholz B. A. , Bergmann O. , Blomqvist L. , Hoffstedt J. , Naslund E. , Britton T. ( 2008 ). Dynamics of fat cell turnover in humans . Nature 453 , 783 – 787 . Google Scholar CrossRef Search ADS PubMed Talirevic E. , Jelena S. ( 2012 ). Quercetin in the treatment of dyslipidemia . Med. Arh. 66 , 87 – 88 . Google Scholar CrossRef Search ADS PubMed Tappin D. M. , MacAskill S. , Bauld L. , Eadie D. , Shipton D. , Galbraith L. ( 2010 ). Smoking prevalence and smoking cessation services for pregnant women in Scotland . Subst. Abuse Treat. Prev. Policy 5 , 1. Google Scholar CrossRef Search ADS PubMed Tong V. T. , Dietz P. M. , Morrow B. , D’Angelo D. V. , Farr S. L. , Rockhill K. M. , England L. J. , Centers for Disease, C., and Prevention ( 2013 ). Trends in smoking before, during, and after pregnancy–Pregnancy Risk Assessment Monitoring System, United States, 40 sites, 2000-2010 . MMWR Surveill. Summ . 62 , 1 – 19 . Google Scholar PubMed Villa A. , Della Torre S. , Stell A. , Cook J. , Brown M. , Maggi A. ( 2012 ). Tetradian oscillation of estrogen receptor alpha is necessary to prevent liver lipid deposition . Proc. Natl. Acad. Sci. U.S.A. 109 , 11806 – 11811 . Google Scholar CrossRef Search ADS PubMed Vogel C. , Marcotte E. M. ( 2012 ). Insights into the regulation of protein abundance from proteomic and transcriptomic analyses . Nat. Rev. Genet. 13 , 227 – 232 . Google Scholar CrossRef Search ADS PubMed Wen X. , Triche E. W. , Hogan J. W. , Shenassa E. D. , Buka S. L. ( 2010 ). Birth weight and adult hypercholesterolemia: Subgroups of small-for-gestational-age based on maternal smoking status during pregnancy . Epidemiology 21 , 786 – 790 . Google Scholar CrossRef Search ADS PubMed Weng S. F. , Redsell S. A. , Swift J. A. , Yang M. , Glazebrook C. P. ( 2012 ). Systematic review and meta-analyses of risk factors for childhood overweight identifiable during infancy . Arch. Dis. Child 97 , 1019 – 1026 . Google Scholar CrossRef Search ADS PubMed Yang X. , Zhang X. , Heckmann B. L. , Lu X. , Liu J. ( 2011 ). Relative contribution of adipose triglyceride lipase and hormone-sensitive lipase to tumor necrosis factor-alpha (TNF-alpha)-induced lipolysis in adipocytes . J. Biol. Chem. 286 , 40477 – 40485 . Google Scholar CrossRef Search ADS PubMed Zarrouki B. , Soares A. F. , Guichardant M. , Lagarde M. , Geloen A. ( 2007 ). The lipid peroxidation end-product 4-HNE induces COX-2 expression through p38MAPK activation in 3T3-L1 adipose cell . FEBS Lett 581 , 2394 – 2400 . Google Scholar CrossRef Search ADS PubMed Zechner R. , Kienesberger P. C. , Haemmerle G. , Zimmermann R. , Lass A. ( 2009 ). Adipose triglyceride lipase and the lipolytic catabolism of cellular fat stores . J. Lipid Res. 50 , 3 – 21 . Google Scholar CrossRef Search ADS PubMed Zhang H. H. , Halbleib M. , Ahmad F. , Manganiello V. C. , Greenberg A. S. ( 2002 ). Tumor necrosis factor-alpha stimulates lipolysis in differentiated human adipocytes through activation of extracellular signal-related kinase and elevation of intracellular cAMP . Diabetes 51 , 2929 – 2935 . Google Scholar CrossRef Search ADS PubMed Zhang X. , Wang Z. , Li J. , Gu D. , Li S. , Shen C. , Song Z. ( 2013 ). Increased 4-hydroxynonenal formation contributes to obesity-related lipolytic activation in adipocytes . PLoS One 8 , e70663. Google Scholar CrossRef Search ADS PubMed Zhang Y. , Li J. , Wen X. ( 2017 ). Jueming prescription and its ingredients, semen cassiae and Rhizoma Curcumae Longae, stimulate lipolysis and enhance the phosphorylation of hormonesensitive lipase in cultured rat white adipose tissue . Mol. Med. Rep. 16 , 6200 – 6207 . Google Scholar CrossRef Search ADS PubMed © The Author(s) 2018. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Toxicological Sciences Oxford University Press

Maternal Nicotine Exposure Leads to Augmented Expression of the Antioxidant Adipose Tissue Triglyceride Lipase Long-Term in the White Adipose of Female Rat Offspring

Download PDF
13 pages

Loading next page...
 
/lp/ou_press/maternal-nicotine-exposure-leads-to-augmented-expression-of-the-7iLMz4vBQF

References (145)

Publisher
Oxford University Press
Copyright
© The Author(s) 2018. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
1096-6080
eISSN
1096-0929
DOI
10.1093/toxsci/kfy083
Publisher site
See Article on Publisher Site

Abstract

Abstract Globally, approximately 10%–25% of women smoke during pregnancy. Since nicotine is highly addictive, women may use nicotine-containing products like nicotine replacement therapies for smoking cessation, but the long-term consequences of early life exposure to nicotine remain poorly defined. Our laboratory has previously demonstrated that maternal nicotine exposed (MNE) rat offspring exhibit hypertriglyceridemia due to increased hepatic de novo lipogenesis. Hypertriglyceridemia may also be attributed to impaired white adipose tissue (WAT) lipid storage; however, the effects of MNE on WAT are not completely understood. We hypothesize that nicotine-induced alterations in adipose function (eg, lipid storage) underlie dyslipidemia in MNE adults. Female 6-month-old rats exposed to nicotine during gestation and lactation exhibited significantly decreased visceral adipocyte cell area by 40%, attributed, in part, to a 3-fold increase in adipose triglyceride lipase (ATGL) protein expression compared with vehicle. Given ATGL has antioxidant properties and in utero nicotine exposure promotes oxidative stress in various tissues, we next investigated if there was evidence of increased oxidative stress in MNE WAT. At both 3 weeks and 6 months, MNE offspring expressed 37%–48% higher protein levels of superoxide dismutase-1 and -2 in WAT. Since oxidative stress can induce inflammation, we examined the inflammatory profile of WAT and found increased expression of cytokines (interleukin-1β, tumor necrosis factor α, and interleukin-6) by 44%–61% at 6 months. Collectively, this suggests that the expression of WAT ATGL may be induced to counter MNE-induced oxidative stress and inflammation. However, higher levels of ATGL would further promote lipolysis in WAT, culminating in impaired lipid storage and long-term dyslipidemia. white adipose tissue, maternal nicotine exposure, oxidative stress, adipocytes Evidence now demonstrates that cigarette smoke plays a critical role in the development of dyslipidemia and obesity in children exposed during perinatal life (Wen et al., 2010; Weng et al., 2012). This is especially concerning given that approximately 10%–25% of women still smoke during pregnancy, with rates as high as 59% in certain Indigenous communities (Cui et al., 2014; Roman-Galvez et al., 2017; Tappin et al., 2010; Tong et al., 2013). To date, nicotine replacement therapies (NRTs) for smoking cessation (ie transdermal patches, gums, e-cigarettes) are thought to benefit pregnant women who are highly addicted and unable to quit smoking by other means (Oncken and Kranzler, 2003). However, the consequences of fetal and neonatal exposure to nicotine alone on the long-term metabolic health of the offspring have yet to be fully defined. Maternal nicotine use during gestation and lactation leads to significant exposure to the fetus and neonate since it is present in fetal blood and transferred through amniotic fluid, placental tissue, and breast milk (Luck and Nau, 1987; Luck et al., 1985). Numerous animal studies demonstrate that nicotine use during pregnancy leads to adverse neurobehavioral, pulmonary, cardiovascular, and metabolic outcomes in the offspring (Barra et al., 2017; Chou and Chen, 2014; Dasgupta et al., 2012; Ma et al., 2014; Pauly and Slotkin, 2008). Specifically, we and others have shown in rats that perinatal exposure to nicotine alone leads to increased blood pressure, adiposity, decreased glucose tolerance, and impaired pancreatic beta cell development (Fox et al., 2012; Gao et al., 2005, 2008; Holloway et al., 2008). Moreover, MNE during gestation and lactation leads to increased hepatic de novo lipogenesis and increased hepatic and circulating triglycerides (TGs) in postnatal life (Ma et al., 2014). This reciprocates human studies which have demonstrated that children exposed to maternal smoke in utero have higher TG levels later in life (Cupul-Uicab et al., 2012). Since increased circulating plasma TGs is strongly associated with cardiovascular disease (CVD) (Bansal et al., 2007), elucidating the underlying molecular mechanisms promoting dyslipidemia will undoubtedly uncover therapeutic targets to reduce unwarranted CVD risk to these nicotine-exposed individuals. Aside from the liver, the augmented circulating and hepatic TG accumulation observed in these MNE offspring could also be attributed to impairments in other metabolic tissues, such as white adipose tissue (WAT). The major role of WAT is to store excess circulating TGs to prevent glucose and lipid toxicity, and moreover, ectopic fat deposition (Abate, 2012). Excess circulating TGs promote adipocytes to undergo differentiation, hypertrophy, and/or hyperplasia to process and store lipids. Once the maximum TG storage capacity is reached, fatty acids can spillover in the plasma, increasing substrate availability for hepatic TG synthesis (Abate, 2012). Ultimately, hypertriglyceridemia contributes to various systemic abnormalities like dyslipidemia, insulin resistance, and CVD (Abate, 2012). Currently, the effects of MNE on WAT function are not completely understood. Studies by Somm et al. (2008) indicated that MNE during gestation resulted in adipocyte hypertrophy and increased expression of adipogenic transcription factors in 3-week male offspring, but the long-term effects were not examined. A more recent study by Fan et al. (2016) demonstrated that maternal exposure of nicotine (from gestational day 9 to weaning) led to decreased adipocyte size in 26-week-old male offspring, suggesting an impaired capacity for lipid storage. Furthermore, this study also found an increase in steady-state mRNA levels of adipocyte differentiation and lipogenic markers in MNE WAT compared with vehicle (Fan et al., 2016). However, given most women addicted to smoking would be exposed to nicotine (ie, NRT or cigarettes) in both prenatal and perinatal life, the goal of this study was to determine if this longer, more relevant, window of nicotine exposure impacts adipose function in both male and female offspring. Moreover, this window covers the entire period of rat adipose tissue differentiation (Greenwood and Hirsch, 1974). We hypothesize that in utero nicotine exposure will adversely impact WAT in the offspring, leading to dyslipidemia in adulthood. To examine this further, we will investigate if WAT function is affected due to altered adipocyte size, proliferation (ie, AKT-1), differentiation (ie, CCAAT/enhancer-binding protein [C/EBP]-α/β, sterol regulatory element-binding transcription factor [SREBP]-1c), lipogenesis (ie, lipoprotein lipase [LPL], acetyl-coA carboxlyase (ACCα), fatty acid synthase (FAS), Acsl1), fatty acid transport (ie, FATP1, FATP4), and/or lipolysis (ATGL) in our well-established rat model of maternal nicotine exposure (MNE). MATERIALS AND METHODS MNE rat model Nulliparous 200–250 g female Wistar rats (Harlan, Indianapolis, Indiana) were injected daily subcutaneously with either saline (vehicle) or nicotine bitartrate at 1 mg/kg/day (Sigma-Aldrich, St Louis, Missouri) 2 weeks prior to mating, during gestation, and until weaning (PND21). This nicotine dose results in maternal serum cotinine concentrations of 135.9 ± 7.86 ng/ml, which is comparable to “moderate” female smokers (80 ng/ml) or NRT users (169.9 ng/ml) (Holloway et al., 2006; Shahab et al., 2017). Litters were culled to 8 at birth and following weaning, rats were housed as sibling pairs until 6 weeks of age, then subsequently housed individually. Male and female offspring were sacrificed via carbon dioxide inhalation at 3 weeks and 6 months of age. Gonadal WATs were extracted, either fixed in formalin or frozen in liquid nitrogen and stored at −80°C for histological and molecular analyses, respectively. All rats were conventionally housed in polycarbonate microisolator cages with ad libitum access to water and standard chow diet (Teklad 22/5 rodent diet; Envigo) under controlled lighting (12:12 L:D), humidity (40%–50%), and temperature (22°C). In accordance with the Canadian Council for Animal Care guidelines, animal experiments were approved by the Animal Research Ethics Board at McMaster University. Gonadal adipocyte cell area A portion of gonadal WAT was fixed in 10% (v/v) neutral buffered formalin overnight, washed in water, and embedded in paraffin. Cross sections were stained with hematoxylin and eosin (H&E) and photographed using the Olympus BX50 microscope under a 10× objective. Cell areas were quantified from a minimum of 160 adipocytes from 2 cross sections/rat using Northern Eclipse software (Empix Imaging Inc.). RNA extraction and real time-polymerase chain reaction Total RNA was extracted from homogenized 3-week and 6-month WAT samples using TRIzol reagent according to the manufacturer’s instructions (Invitrogen). Two micrograms of RNA were reversed-transcribed to cDNA (high-capacity cDNA Reverse Transcription Kit, Applied Biosystems). Forward and reverse primer sets used for real time-polymerase chain reaction (RT-PCR), listed in Table 1, were designed with the National Center for Biotechnology Information’s primer designing tool. Relative transcript abundance was determined using SensiFAST No-ROX SYBR Green Supermix (FroggaBio) and the Bio-Rad CFX384 Real Time System. Samples were assayed in triplicate and relative fold change was calculated using comparative cycle times (Ct) method normalized to β-actin. The relative abundance was calculated using the formula 2ΔΔCt, where ΔΔCt was the normalized value. Table 1. Forward and Reverse Primer Sequences Used for Quantitative Real-Time PCR. Gene Forward Reverse GenBank/Reference AKT-1 ATGTGTATGAGAAGAAGCTGAGCC GTTCACTGTCCACACACTCCA NM_033230.2 C/EBPα GCCGGGAGAACTCTAACTCC TCGATGTAGGCGCTGATGTC NM_001287577.1 C/EBPβ ACCACGACTTCCTTTCCGAC TAACCGTAGTCGGACGGCTT NM_024125.5 SREBP1c CATGGACGAGCTACCCTTCG TCTTCGATGTCGGTCAAGAGC NM_001276707.1 LPL GGATGCAACATTGGAGAACCC GCTGGGGTTTTCTTCATTCAGC NM_012598.2 ACCα TCCGTATGTGACCAAAGACC TACGTTGTTCCCAAGGACTG NM_022193.1 FAS GGACATGGTCACAGACGATGAC CGTCGAACTTGGACAGATCCTT NM_017332.1 ACSL1 CTACAGGCAACCCCAAAGGA AATGCACTCTCCGTCGCTT NM_012820.1 FATP1 CAGCCTCTGTGGCCTCATT ACCCACGTACACACCGAAC NM_053580.2 FATP4 CTTGGGCAACTTTGACAGCC AGGACAGGATGCGGCTATTG NM_001100706.1 ATGL AACGCCACTCACATCTACGG TACCAGGTTGAAGGAGGGGT NM_001108509.2 EGR-1 CGAGCGAACAACCCTACGA CGATGTCAGAAAAGGACTCTGTG NM_012551.2 FOXO-1 TGCAGCAGACACCTTGCTAT TTGGGGCTGGGGGAATTTAG NM_001191846.2 IL-1β CAGCTTTCGACAGTGAGGAGA GTCGAGATGCTGCTGTGAGA NM_031512.2 TNFα CCGGGCAGGTCTACTTTGGA AGGCCACTACTTCAGCGTCTCG NM_012675.3 IL-6 CTTCCAGCCAGTTGCCTTCTTG TGGTCTGTTGTGGGTGGTATCC NM_012589.2 CD68 ACTGGGGCTCTTGGAAACTACAC CCTTGGTTTTGTTCGGGTTCA NM_001031638.1 SOD-1 ATTGGCCGTACTATGGTGGTC GCAATCCCAATCACACCACA NM_017050.1 SOD-2 ATTGCCGCCTGCTCTAATCA TCCCACACATCAATCCCCAG NM_017051.2 Gene Forward Reverse GenBank/Reference AKT-1 ATGTGTATGAGAAGAAGCTGAGCC GTTCACTGTCCACACACTCCA NM_033230.2 C/EBPα GCCGGGAGAACTCTAACTCC TCGATGTAGGCGCTGATGTC NM_001287577.1 C/EBPβ ACCACGACTTCCTTTCCGAC TAACCGTAGTCGGACGGCTT NM_024125.5 SREBP1c CATGGACGAGCTACCCTTCG TCTTCGATGTCGGTCAAGAGC NM_001276707.1 LPL GGATGCAACATTGGAGAACCC GCTGGGGTTTTCTTCATTCAGC NM_012598.2 ACCα TCCGTATGTGACCAAAGACC TACGTTGTTCCCAAGGACTG NM_022193.1 FAS GGACATGGTCACAGACGATGAC CGTCGAACTTGGACAGATCCTT NM_017332.1 ACSL1 CTACAGGCAACCCCAAAGGA AATGCACTCTCCGTCGCTT NM_012820.1 FATP1 CAGCCTCTGTGGCCTCATT ACCCACGTACACACCGAAC NM_053580.2 FATP4 CTTGGGCAACTTTGACAGCC AGGACAGGATGCGGCTATTG NM_001100706.1 ATGL AACGCCACTCACATCTACGG TACCAGGTTGAAGGAGGGGT NM_001108509.2 EGR-1 CGAGCGAACAACCCTACGA CGATGTCAGAAAAGGACTCTGTG NM_012551.2 FOXO-1 TGCAGCAGACACCTTGCTAT TTGGGGCTGGGGGAATTTAG NM_001191846.2 IL-1β CAGCTTTCGACAGTGAGGAGA GTCGAGATGCTGCTGTGAGA NM_031512.2 TNFα CCGGGCAGGTCTACTTTGGA AGGCCACTACTTCAGCGTCTCG NM_012675.3 IL-6 CTTCCAGCCAGTTGCCTTCTTG TGGTCTGTTGTGGGTGGTATCC NM_012589.2 CD68 ACTGGGGCTCTTGGAAACTACAC CCTTGGTTTTGTTCGGGTTCA NM_001031638.1 SOD-1 ATTGGCCGTACTATGGTGGTC GCAATCCCAATCACACCACA NM_017050.1 SOD-2 ATTGCCGCCTGCTCTAATCA TCCCACACATCAATCCCCAG NM_017051.2 Table 1. Forward and Reverse Primer Sequences Used for Quantitative Real-Time PCR. Gene Forward Reverse GenBank/Reference AKT-1 ATGTGTATGAGAAGAAGCTGAGCC GTTCACTGTCCACACACTCCA NM_033230.2 C/EBPα GCCGGGAGAACTCTAACTCC TCGATGTAGGCGCTGATGTC NM_001287577.1 C/EBPβ ACCACGACTTCCTTTCCGAC TAACCGTAGTCGGACGGCTT NM_024125.5 SREBP1c CATGGACGAGCTACCCTTCG TCTTCGATGTCGGTCAAGAGC NM_001276707.1 LPL GGATGCAACATTGGAGAACCC GCTGGGGTTTTCTTCATTCAGC NM_012598.2 ACCα TCCGTATGTGACCAAAGACC TACGTTGTTCCCAAGGACTG NM_022193.1 FAS GGACATGGTCACAGACGATGAC CGTCGAACTTGGACAGATCCTT NM_017332.1 ACSL1 CTACAGGCAACCCCAAAGGA AATGCACTCTCCGTCGCTT NM_012820.1 FATP1 CAGCCTCTGTGGCCTCATT ACCCACGTACACACCGAAC NM_053580.2 FATP4 CTTGGGCAACTTTGACAGCC AGGACAGGATGCGGCTATTG NM_001100706.1 ATGL AACGCCACTCACATCTACGG TACCAGGTTGAAGGAGGGGT NM_001108509.2 EGR-1 CGAGCGAACAACCCTACGA CGATGTCAGAAAAGGACTCTGTG NM_012551.2 FOXO-1 TGCAGCAGACACCTTGCTAT TTGGGGCTGGGGGAATTTAG NM_001191846.2 IL-1β CAGCTTTCGACAGTGAGGAGA GTCGAGATGCTGCTGTGAGA NM_031512.2 TNFα CCGGGCAGGTCTACTTTGGA AGGCCACTACTTCAGCGTCTCG NM_012675.3 IL-6 CTTCCAGCCAGTTGCCTTCTTG TGGTCTGTTGTGGGTGGTATCC NM_012589.2 CD68 ACTGGGGCTCTTGGAAACTACAC CCTTGGTTTTGTTCGGGTTCA NM_001031638.1 SOD-1 ATTGGCCGTACTATGGTGGTC GCAATCCCAATCACACCACA NM_017050.1 SOD-2 ATTGCCGCCTGCTCTAATCA TCCCACACATCAATCCCCAG NM_017051.2 Gene Forward Reverse GenBank/Reference AKT-1 ATGTGTATGAGAAGAAGCTGAGCC GTTCACTGTCCACACACTCCA NM_033230.2 C/EBPα GCCGGGAGAACTCTAACTCC TCGATGTAGGCGCTGATGTC NM_001287577.1 C/EBPβ ACCACGACTTCCTTTCCGAC TAACCGTAGTCGGACGGCTT NM_024125.5 SREBP1c CATGGACGAGCTACCCTTCG TCTTCGATGTCGGTCAAGAGC NM_001276707.1 LPL GGATGCAACATTGGAGAACCC GCTGGGGTTTTCTTCATTCAGC NM_012598.2 ACCα TCCGTATGTGACCAAAGACC TACGTTGTTCCCAAGGACTG NM_022193.1 FAS GGACATGGTCACAGACGATGAC CGTCGAACTTGGACAGATCCTT NM_017332.1 ACSL1 CTACAGGCAACCCCAAAGGA AATGCACTCTCCGTCGCTT NM_012820.1 FATP1 CAGCCTCTGTGGCCTCATT ACCCACGTACACACCGAAC NM_053580.2 FATP4 CTTGGGCAACTTTGACAGCC AGGACAGGATGCGGCTATTG NM_001100706.1 ATGL AACGCCACTCACATCTACGG TACCAGGTTGAAGGAGGGGT NM_001108509.2 EGR-1 CGAGCGAACAACCCTACGA CGATGTCAGAAAAGGACTCTGTG NM_012551.2 FOXO-1 TGCAGCAGACACCTTGCTAT TTGGGGCTGGGGGAATTTAG NM_001191846.2 IL-1β CAGCTTTCGACAGTGAGGAGA GTCGAGATGCTGCTGTGAGA NM_031512.2 TNFα CCGGGCAGGTCTACTTTGGA AGGCCACTACTTCAGCGTCTCG NM_012675.3 IL-6 CTTCCAGCCAGTTGCCTTCTTG TGGTCTGTTGTGGGTGGTATCC NM_012589.2 CD68 ACTGGGGCTCTTGGAAACTACAC CCTTGGTTTTGTTCGGGTTCA NM_001031638.1 SOD-1 ATTGGCCGTACTATGGTGGTC GCAATCCCAATCACACCACA NM_017050.1 SOD-2 ATTGCCGCCTGCTCTAATCA TCCCACACATCAATCCCCAG NM_017051.2 Protein extraction and Western blot WAT was homogenized in RIPA buffer (50 mM Tris-HCL, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Nonidet P40, 0.25% C24H39NaO4) supplemented with a protease inhibitor cocktail (Roche) and phosphatase inhibitors (20 mM NaF, 40 mM Na-pyrophosphate, 40 mM Na3VO4, 200 mM β-glycerophosphate disodium salt hydrate). The solution was sonicated, mixed in a rotator for 1 h at 4°C, and centrifuged at 300 × g for 15 min at 4°C. The total cellular protein extract in the collected supernatant was quantified by colorimetric DC protein assay (BioRad). Loading samples were heated at 50°C for 10 min to denature the proteins. Proteins (20 μg/well) were separated by size via gel electrophoresis and transferred onto polyvinylidene difluoride membrane (Millipore). Membranes were blocked in 1× Tris-buffered saline-Tween 20 buffer with 5% nonfat milk or 5% BSA (blocking solutions), and then probed using primary antibodies diluted in the blocking solution (Table 2). A mouse or rabbit secondary antibody was used to detect primary antibody diluted in the blocking solution at 1:5000 or 1:10 000 dilution, respectively (Table 2). Immuno-reactive bands were visualized, and relative band intensity was calculated using ImageLab software (BioRad) and normalized to β-actin, as previously performed (Ma et al., 2014). Table 2. Western Blot Antibodies, Dilutions Used in Experiments, and Company and Catalog Information Antibody Name Source Dilution Company (No. Catalog) 4-HNE Mouse monoclonal 1:500 R&D Systems Minneapolis, Minnesota (No. MAB3249) AKT-1 Rabbit polyclonal 1:500 Abcam Inc., Cambridge, Massachusetts (No. abcam 5919) ATGL (H-144) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-67355) C/EBPα (14AA) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-61) C/EBPβ (C-19) Rabbit polyclonal 1:300 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-150) SOD-1 (FL-154) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-11407) SOD-2 (FL-222) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-30080) SREBP 1c (H-160) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-8984) Mouse IgG (H+L) Secondary Sheep 1:5000 GE Healthcare UK, Pittsburgh, Pennsylvania (No. NA931) Rabbit IgG (H+L) Secondary Donkey 1:10 000 Jackson ImmunoResearch Laboratories, West Grove, Pennsylvania (No. 711-001-003) Antibody Name Source Dilution Company (No. Catalog) 4-HNE Mouse monoclonal 1:500 R&D Systems Minneapolis, Minnesota (No. MAB3249) AKT-1 Rabbit polyclonal 1:500 Abcam Inc., Cambridge, Massachusetts (No. abcam 5919) ATGL (H-144) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-67355) C/EBPα (14AA) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-61) C/EBPβ (C-19) Rabbit polyclonal 1:300 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-150) SOD-1 (FL-154) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-11407) SOD-2 (FL-222) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-30080) SREBP 1c (H-160) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-8984) Mouse IgG (H+L) Secondary Sheep 1:5000 GE Healthcare UK, Pittsburgh, Pennsylvania (No. NA931) Rabbit IgG (H+L) Secondary Donkey 1:10 000 Jackson ImmunoResearch Laboratories, West Grove, Pennsylvania (No. 711-001-003) Table 2. Western Blot Antibodies, Dilutions Used in Experiments, and Company and Catalog Information Antibody Name Source Dilution Company (No. Catalog) 4-HNE Mouse monoclonal 1:500 R&D Systems Minneapolis, Minnesota (No. MAB3249) AKT-1 Rabbit polyclonal 1:500 Abcam Inc., Cambridge, Massachusetts (No. abcam 5919) ATGL (H-144) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-67355) C/EBPα (14AA) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-61) C/EBPβ (C-19) Rabbit polyclonal 1:300 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-150) SOD-1 (FL-154) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-11407) SOD-2 (FL-222) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-30080) SREBP 1c (H-160) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-8984) Mouse IgG (H+L) Secondary Sheep 1:5000 GE Healthcare UK, Pittsburgh, Pennsylvania (No. NA931) Rabbit IgG (H+L) Secondary Donkey 1:10 000 Jackson ImmunoResearch Laboratories, West Grove, Pennsylvania (No. 711-001-003) Antibody Name Source Dilution Company (No. Catalog) 4-HNE Mouse monoclonal 1:500 R&D Systems Minneapolis, Minnesota (No. MAB3249) AKT-1 Rabbit polyclonal 1:500 Abcam Inc., Cambridge, Massachusetts (No. abcam 5919) ATGL (H-144) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-67355) C/EBPα (14AA) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-61) C/EBPβ (C-19) Rabbit polyclonal 1:300 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-150) SOD-1 (FL-154) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-11407) SOD-2 (FL-222) Rabbit polyclonal 1:1000 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-30080) SREBP 1c (H-160) Rabbit polyclonal 1:500 Santa Cruz Biotechnology Inc., Santa Cruz, California (No. sc-8984) Mouse IgG (H+L) Secondary Sheep 1:5000 GE Healthcare UK, Pittsburgh, Pennsylvania (No. NA931) Rabbit IgG (H+L) Secondary Donkey 1:10 000 Jackson ImmunoResearch Laboratories, West Grove, Pennsylvania (No. 711-001-003) Statistical analysis Statistical analyses were performed using Graphpad Prism 6 software. Results were presented as the mean of arbitrary values ± SEM. Grubbs’ test was used to determine significant outliers and data were tested for normality and equal variance. Comparisons between vehicle and nicotine-exposed offspring were assessed using an unpaired Student’s t test, with a p-value of < .05 deemed as significant. RESULTS MNE Leads to Decreased Visceral Adipocyte Size in 6-Month-Old Offspring Using our well-established rat MNE model leading to dyslipidemia (Gao et al., 2005; Ma et al., 2014), we wanted to first confirm whether prenatal nicotine exposure has long term effects on adipocyte size in the offspring. Histological analyses revealed both MNE male and female offspring exhibited smaller gonadal adipocytes compared with vehicle controls at 6 months of age (Figs. 1A and 1B) . Given the more pronounced effects of perinatal nicotine exposure on female WAT area (13.2% male vs 39.7% female decrease in adipocyte size), we continued to examine only female offspring to explore the underlying mechanisms involved. Gondal adipose tissue weight did not differ between MNE and vehicle offspring (data not shown), suggesting a possible increase in adipocyte number due to prenatal nicotine exposure. With decreased adipocyte cell area and subsequent increase in cell number, transcript and protein levels of the proliferation marker AKT-1 were subsequently measured. Despite a significant increase in mRNA levels, there were no corresponding changes in AKT-1 protein levels in 6-month female MNE WAT (Figs. 1C and 1D). Figure 1. View largeDownload slide Maternal nicotine exposure leads to decreased visceral adipocyte cell area in 6-month-old offspring. Representative cross-sections of gonadal WAT excised from (A) vehicle and in utero nicotine exposed 6-month-old male and female offspring were stained with hematoxylin and eosin. B, Bar graph representing calculated cell areas analyzed using Northern Eclipse software (n = 4/group/sex). C, Transcript and (D) protein levels of AKT-1 in 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 7/nicotine). **,*** Significant difference (**p < .01, ***p < .001). Figure 1. View largeDownload slide Maternal nicotine exposure leads to decreased visceral adipocyte cell area in 6-month-old offspring. Representative cross-sections of gonadal WAT excised from (A) vehicle and in utero nicotine exposed 6-month-old male and female offspring were stained with hematoxylin and eosin. B, Bar graph representing calculated cell areas analyzed using Northern Eclipse software (n = 4/group/sex). C, Transcript and (D) protein levels of AKT-1 in 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 7/nicotine). **,*** Significant difference (**p < .01, ***p < .001). In Utero Nicotine Exposure Increases the Expression of the Differentiation Marker C/EBPα in WAT of 6-Month-Old Female Offspring Given impairments in adipocyte differentiation can also decrease adipocyte size, we next measured the expression of key targets involved in adipogenesis (Abate, 2012), including C/EBP-α/β and SREBP-1c. Protein analyses revealed a significant increase in the 42 kDa band of C/EBP-α in female MNE offspring compared with vehicle at 6 months independent of changes in transcript levels (Figs. 2A and 2B). Quantitative real time PCR analyses revealed that WAT from MNE exposed offspring had a significant increase in steady-state transcript levels of C/EBPβ and SREBP-1c compared with controls (Figs. 2C and 2E). However, immunoblot analyses revealed no significant differences at the protein level for either target (Figs. 2D and 2F). To examine if perinatal nicotine exposure had direct effects on C/EBPα, we measured the transcript and protein levels at 3 weeks age but found no difference in expression from vehicle (Figs. 2G and 2H). Figure 2. View largeDownload slide In utero nicotine exposure increases the expression of the differentiation marker C/EBPα in WAT of 6-month-old female offspring. Transcript and protein levels of targets of interest in 3-week and 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. Six-month (A) C/EBPα mRNA and (B) protein levels. C, C/EBPβ mRNA and (D) protein levels. E, SREBP1-c mRNA and (F) protein levels. Three-week (G) C/EBPα mRNA and (H) protein levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 7/nicotine). *Significant difference (*p < .05). Figure 2. View largeDownload slide In utero nicotine exposure increases the expression of the differentiation marker C/EBPα in WAT of 6-month-old female offspring. Transcript and protein levels of targets of interest in 3-week and 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. Six-month (A) C/EBPα mRNA and (B) protein levels. C, C/EBPβ mRNA and (D) protein levels. E, SREBP1-c mRNA and (F) protein levels. Three-week (G) C/EBPα mRNA and (H) protein levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 7/nicotine). *Significant difference (*p < .05). MNE Does Not Increase the Expression of Markers Involved in Lipogenesis and Fatty Acid Transporters in 6-Month-Old Female Offspring Adipocyte size is influenced by its ability to breakdown TG molecules from circulation, transport its constitutive components intracellularly, and re-assemble TGs for storage (Kersten, 2014). Therefore, we wanted to determine whether perinatal nicotine exposure impaired TG transport and esterification by measuring the steady state transcript levels of key targets involved in lipogenesis and fatty acid transport. At 6 months of age we found no significant difference between groups in the expression of lipogenic markers including LPL, ACCα, and FAS, along with fatty acid transporters FATP1/4, and long-chain acyl CoA synthetase (ASCL)-1 in female MNE WAT (Figs. 3A–F). Figure 3. View largeDownload slide Maternal nicotine exposure does not increase the expression of markers involved in lipogenesis and fatty acid transporters in WAT of 6-month-old female offspring. Transcript levels of targets of interest in 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR. Six-month (A) LPL, (B) ACCα, (C) FAS, (D) ASCL1, (E) FATP1, and (F) FATP4 mRNA levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Figure 3. View largeDownload slide Maternal nicotine exposure does not increase the expression of markers involved in lipogenesis and fatty acid transporters in WAT of 6-month-old female offspring. Transcript levels of targets of interest in 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR. Six-month (A) LPL, (B) ACCα, (C) FAS, (D) ASCL1, (E) FATP1, and (F) FATP4 mRNA levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). In Utero Nicotine-Exposed Female Offspring Exhibit Increased Expression of ATGL at 6 Months, But Not at 3 Weeks Since enhanced lipolysis decreases adipocyte size (Zhang et al., 2017), we then examined whether MNE WAT had elevated expression of adipose triglyceride lipase (ATGL), the predominate enzyme involved in intracellular degradation (Zechner et al., 2009). At 6 months of age, we found a significant increase in both ATGL mRNA expression and protein levels in nicotine-exposed female WAT compared with vehicle controls (Figs. 4A and 4B), however this was not observed at 3 weeks (Figs. 4C and 4D). Altogether, these data suggest that augmented ATGL-induced lipolysis may lead to reduced adipocyte cell area in MNE WAT at 6 months. Figure 4. View largeDownload slide In utero nicotine-exposed female offspring exhibit increased expression of ATGL at 6 months, but not at 3 weeks. Transcript and protein levels of ATGL in 3-week and 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. Six-month ATGL (A) mRNA and (B) protein levels. Three-week ATGL (C) mRNA and (D) protein levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 8/nicotine). *,** Significant difference (*p < .05, **p < .01). Figure 4. View largeDownload slide In utero nicotine-exposed female offspring exhibit increased expression of ATGL at 6 months, but not at 3 weeks. Transcript and protein levels of ATGL in 3-week and 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. Six-month ATGL (A) mRNA and (B) protein levels. Three-week ATGL (C) mRNA and (D) protein levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 8/nicotine). *,** Significant difference (*p < .05, **p < .01). MNE Exhibit Enhanced Antioxidant Expression at 6 Months and 3 Weeks Evidence demonstrates that ATGL deficiency in mice is associated with accumulation of reactive oxygen species (ROS) and decreased superoxide dismutase (SOD)-2 expression, suggesting this enzyme may act as an antioxidant and suppress oxidative stress (Aquilano et al., 2016; Chen et al., 2017a,b). Moreover, we and others have previously shown that MNE promotes oxidative stress in the heart, pancreas, and placenta of adult offspring (Barra et al., 2017; Bruin et al., 2008; Sbrana et al., 2011). Therefore, we wanted to determine whether an imbalance between antioxidant defenses occurs in WAT of 6-month female MNE offspring by measuring the transcript and protein levels of the antioxidants SOD-1 and SOD-2. Both SOD 1 and 2 steady state mRNA and protein levels were significantly elevated in prenatal nicotine-exposed WAT in 6-month female offspring compared with vehicle (Figs. 5A–D). At 3 weeks of age, there was also a significant increase in SOD-1 protein levels, and a trending increase in SOD-2, in the nicotine-exposed WAT group compared with controls (Figs. 5E–H). To determine if there was oxidative stress, we measured protein levels of 4-hydroxynonenal (4-HNE) and found a nonsignificant upward trend in nicotine-exposed WAT at both 3-week and 6-month timepoints (Figs. 5I and 5J). Overall, these data suggest that prenatal nicotine exposure directly increases the expression of the antioxidant SOD-1 and SOD-2 in 6-month WAT which was enough to prevent lipid oxidative damage. Figure 5. View largeDownload slide In utero nicotine-exposed female offspring exhibit increased antioxidant expression in WAT at 3 weeks and 6 months. Transcript and protein levels of SOD-1 and SOD-2 in 3-week and 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. Six-month SOD-1 (A) mRNA and (B) protein levels and SOD-2 (C) mRNA and (D) protein levels. Three-week SOD-1 (E) mRNA and (F) protein levels and SOD-2 (G) mRNA and (H) protein levels. Protein levels of 4-HNE at (I) 6 months and (J) 3 weeks of age. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 8/nicotine). *,** Significant difference (*p < .05, **p < .01). Figure 5. View largeDownload slide In utero nicotine-exposed female offspring exhibit increased antioxidant expression in WAT at 3 weeks and 6 months. Transcript and protein levels of SOD-1 and SOD-2 in 3-week and 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR and Western blot, respectively. Six-month SOD-1 (A) mRNA and (B) protein levels and SOD-2 (C) mRNA and (D) protein levels. Three-week SOD-1 (E) mRNA and (F) protein levels and SOD-2 (G) mRNA and (H) protein levels. Protein levels of 4-HNE at (I) 6 months and (J) 3 weeks of age. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). Protein levels were expressed as means normalized to β-actin ± SEM (n = 8/vehicle; n = 8/nicotine). *,** Significant difference (*p < .05, **p < .01). In Utero Nicotine Exposure Exhibit Inflammation at 6 Months, But Not at 3 Weeks Enhanced oxidative stress can activate nuclear factor-κB (NF-κB), leading the expression of proinflammatory cytokines and inflammation (Li and Karin, 1999; Morgan and Liu, 2011). As well, activation of this pathway in differentiated 3T3-L1 cells leads to increased lipase expression and lipolysis (Chi et al., 2014). Since oxidative stress, inflammation, and lipolysis are integrated pathways, we wanted to determine whether inflammation was present in 6-month in utero nicotine-exposed WAT. At 6 months, we found a significant increase in the steady-state mRNA expression profile of proinflammatory cytokines tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and the macrophage marker CD68 (Figs. 6A–D). In contrast at 3 weeks of age, there was no significant difference in steady state mRNA levels of inflammatory markers between groups (Figs. 6E–H). Figure 6. View largeDownload slide Maternal nicotine-exposed female offspring exhibit increases in WAT inflammation at 6 months, but not at 3 weeks. Transcript levels of targets of interest in 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR. Six-month (A) IL-1β, (B) TNFα, (C) IL-6, and (D) CD68 mRNA levels. Three-week (E) IL-1β, (F) TNFα, (G) IL-6, and (H) CD68 mRNA levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). *,**,*** Significant difference (*p < .05, **p < .01, **p < .001). Figure 6. View largeDownload slide Maternal nicotine-exposed female offspring exhibit increases in WAT inflammation at 6 months, but not at 3 weeks. Transcript levels of targets of interest in 6-month vehicle and perinatal nicotine-exposed WAT were determined via real time PCR. Six-month (A) IL-1β, (B) TNFα, (C) IL-6, and (D) CD68 mRNA levels. Three-week (E) IL-1β, (F) TNFα, (G) IL-6, and (H) CD68 mRNA levels. mRNA levels were expressed as means normalized to β-actin ± SEM (n = 15/vehicle; n = 11/nicotine). *,**,*** Significant difference (*p < .05, **p < .01, **p < .001). DISCUSSION Under normal physiological conditions, WAT serves as the principle lipid storage site to prevent ectopic lipid deposition in peripheral organs. The balance between lipolysis and lipogenesis dictates the overall amount of TG molecules stored as a single large lipid droplet in the cytoplasm of adipocytes, ultimately influencing its size (Bolsoni-Lopes and Alonso-Vale, 2015). Adipocytes have a limited TG storage capacity. Once exceeded, excess lipids will spill-over into circulation resulting in dyslipidemia and increased lipid content at ectopic sites like the liver (Abate, 2012). In our model, we have previously shown that MNE offspring have dyslipidemia with increased levels of circulating TGs (Gao et al., 2005; Ma et al., 2014). Although we have demonstrated that hepatic de novo lipogenesis is increased in nicotine-exposed offspring, the effect of nicotine exposure on WAT function were not examined. Previous studies indicate MNE during gestation or from gestation until weaning altered adipocyte size and increased the expression of adipocyte differentiation markers, but this was only examined in male offspring (Fan et al., 2016; Somm et al., 2008). Moreover, this exposure to nicotine in these studies (gestation only or mid-gestation to weaning only) does not mimic women’s smoking habits and/or nicotine use prior to pregnancy. Therefore, our goal was to determine if WAT plays a role in promoting dyslipidemia in both male and female offspring exposed to nicotine in prenatal and perinatal life. In this study, we demonstrated that both male and female offspring exposed to nicotine during prenatal and perinatal life decreased adipocyte cell area compared with vehicle controls at 6 months of age. Somm et al. (2008) reported that rats exposed to nicotine during pregnancy alone (from gestational day 4 for 14 days at 3 mg/kg/day) had adipocyte hypertrophy compared with vehicle controls in 3-week-old male offspring, but the effect on WAT size into adulthood, after nicotine exposure, was not examined. Similar to our findings, Fan et al. (2016) demonstrated that in utero nicotine exposure from mid-pregnancy (eg, gestational day 9) until weaning decreased adipocyte size in male WAT at 26 weeks of age. The dose of nicotine (1 mg/kg) administered in this study is relevant as it corresponds to moderate female smokers or NRT users (Holloway et al., 2006; Shahab et al., 2017), while doses used in other studies (2–3 mg/kg/day) correspond to heavy smokers (Fan et al., 2016; Somm et al., 2008). Examining the effects of MNE on WAT for a longer duration is important given adipose development occurs both pre- and postnatally in rats. In rodent adipose tissue, growth and differentiation occurs from late gestation to 4 weeks in postnatal life, while in humans this occurs from 5 to 29 weeks gestation (Greenwood and Hirsch, 1974; Poissonnet et al., 1984). In both species, adipose tissue expansion happens throughout life (Greenwood and Hirsch, 1974; Spalding et al., 2008). Given the extensive differentiation of adipose tissue during perinatal life, it is vulnerable to alterations by environmental cues (ie, drugs) during this developmental window. Furthermore, both mature adipocytes and adipocyte precursors like mesenchymal stem cells express nicotinic acetyl-choline receptor subunits, suggesting that nicotine may directly alter adipogenesis and adipocyte formation (Gochberg-Sarver et al., 2012; Hoogduijn et al., 2009). Since the effect on adipocyte size was more pronounced in female offspring, and previous studies focused on males (Fan et al., 2016; Somm et al., 2008), we decided to examine the effects of MNE on female adipose tissue function. One limitation of our study is that we did not evaluate the estrous cycle of the female rats. This is an important consideration since prenatal nicotine exposure increased progesterone levels in offspring compared with vehicle controls, which is reflective of estrous cycle perturbations (Holloway et al., 2006). Furthermore, others have reported that oscillations in metabolic related genes in the liver occur with estrous cycle (Villa et al., 2012). Since small adipocyte size results from aberrant adipogenesis, we examined whether MNE impaired adipocyte differentiation, lipid synthesis and transport, and/or lipolysis. We found that female MNE offspring exhibited increased mRNA and protein expression of the adipocyte differentiation factor C/EBPα and the lipolytic enzyme ATGL, without altering the expression of targets involved in lipogenesis and lipid transport. Similar to our results, Fan et al. (2016) found an increase in steady-state mRNA levels of adipocyte differentiation markers in MNE male offspring, including C/EBPα and SREBP-1c compared with control WAT in adulthood. Since these studies did not perform protein analyses, our study is the first to demonstrate that MNE induced C/EBPα protein levels in 6-month female WAT. Overall, the increased C/EBPα (42 kDa) expression in WAT suggests that MNE promote adipocyte differentiation and adipogenesis. C/EBPα contains 2 isoforms (30/42 kDa) alternatively translated from 1 mRNA transcript (Lin et al., 1993; Ossipow et al., 1993). Constitutive expression of the 42 kDa isoform can induce adipocyte differentiation in 3T3-L1 preadipocytes, suggesting that enhanced C/EBPα expression of this isoform can enhance adipocyte formation (Lin and Lane, 1994). Although the steady-state levels of AKT1, C/EBP-α, SREBP 1c mRNA were augmented in 6-month nicotine-exposed offspring, this did not translate to an alteration in protein levels. There are several cases in the literature whereby changes in the mRNA levels do not correlate to an alteration in protein, highlighting the importance of looking at both mRNA and protein (Vogel and Marcotte, 2012). Moreover, it is possible that the mRNA and protein levels of these key proliferation and differentiation markers may be altered earlier in development (ie, gestation and/or lactation) due to the direct effects of nicotine on their expression. For example, we have demonstrated that nicotine directly enhances the expression of the proliferation markers GADD45 and Rb1 in differentiating 3T3-L1 preadipocyte cells (data not shown). Therefore, in the absence of nicotine exposure after lactation, the levels of these proliferation and differentiation may have become normalized. This study was the first to demonstrate that both prenatal and perinatal nicotine exposure leads to increased ATGL mRNA and protein expression in adult female MNE offspring. This suggests that MNE may impair the lipid storage capacity of WAT via increased ATGL expression. Studies demonstrate that augmented ATGL leads to enhanced basal and stimulated WAT lipolysis and reduced adipocyte size (Ahmadian et al., 2009; Bezaire et al., 2009; Kershaw et al., 2006). The primary function of ATGL is to initiate lipolysis, by hydrolyzing the sn-2 ester bond of a TG molecule, resulting in the formation of diacylglycerol and fatty acid (Zechner et al., 2009). Therefore, decreased adipocyte cell size in gonadal WAT may be attributed to enhanced lipolysis in MNE offspring. Recently, evidence supports an additional role for ATGL—as an antioxidant and suppressor of oxidative stress. Oxidative stress is defined as an imbalance between antioxidant defenses and ROS production (free radicals) (Sena and Chandel, 2012). Prolonged oxidative stress can result in free radical damage, ultimately leading to mitochondrial-mediated apoptosis (Sena and Chandel, 2012). In vitro and in vivo analyses demonstrate that ATGL deficiency is associated with ROS accumulation and cellular apoptosis in renal podocytes and proximal tubules (Chen et al., 2017a,b). Similarly, ATGL inhibition in C2C12 myoblasts and in murine ATGL deficient skeletal muscle promotes oxidative damage and a defective cellular antioxidant response, characterized by a significant reduction in antioxidant SOD-2 expression and glutathione levels (Aquilano et al., 2016). Altogether, these findings suggest that ATGL may protect against oxidative stress. We and others have previously shown that MNE can cause oxidative stress in the offspring in various tissues including the heart, pancreas, and placenta (Barra et al., 2017; Bruin et al., 2008; Sbrana et al., 2011). Therefore, we examined the expression of antioxidants SOD-1/2 in WAT of 6-month female MNE offspring to assess whether an imbalance in antioxidant expression is present at the same time ATGL levels are elevated. Oxygen can oxidize other molecules to generate ROS, whereby majority of intracellular ROS are derived from superoxide (O2−). Superoxide is formed in the mitochondrial respiratory chain, emitted to the matrix and intermembrane space, and subsequently converted to hydrogen peroxide (H2O2) by SODs (Sena and Chandel, 2012). This study is the first to demonstrate that MNE WAT had increased transcript expression and protein levels of both SOD-1 and -2 at 6 months with evidence for increased SOD-1 at 3 weeks of age. Although nonsignificant, we also observed an upward trend for the oxidative marker 4-HNE in nicotine-exposed WAT compared with vehicle at both time points. This suggests that perinatal nicotine exposure may instigate WAT oxidative stress, triggering a rapid increase in antioxidant expression by weaning which persists into adulthood and may prevent long-term oxidative damage. Oxidative stress can contribute to altered adipocyte differentiation and lipolysis. Depending on environmental cues, mesenchymal stem cells can differentiate into various cell types derived from the mesodermal lineage including myocytes, adipocytes, osteocytes, and chondrocytes. Evidence suggests that elevated ROS levels, produced during oxidative stress, can stimulate adipogenesis while suppressing osteogenesis (Atashi et al., 2015). During conversion of stem cells to adipocytes, mitochondrial complexes I/III and the NADPH oxidase isoform NOX4 produce ROS to initiate adipocyte signaling cascades, leading to terminal differentiation (Atashi et al., 2015). Therefore, increased SOD-1 expression in fetal and neonatal nicotine-exposed WAT may suggest that augmented ROS production may directly promote the expression of adipogenic transcription factors like C/EBPα (Hu et al., 2005). In vitro analyses using both differentiated 3T3-L1 and human primary adipocyte cultures demonstrate that exposure to exogenous 4-HNE elevated lipolysis in basal and stimulated conditions characterized by a dose-dependent significant increase in glycerol and fatty acid release (Zhang et al., 2013). Altogether, these findings suggest that MNE may augment oxidative stress in WAT characterized by increased expression of antioxidants SOD-1/2 and ATGL, leading to altered adipocyte differentiation and lipolysis. Enhanced oxidative stress can promote pathways, like inflammation, that also influence adipose function. Exposure to hydrogen peroxide or ROS accumulation activates the transcription factor NF-κB, leading the expression of proinflammatory cytokines such as TNF-α or IL-1 (Lawrence, 2009; Li and Karin, 1999; Morgan and Liu, 2011). Intriguingly, treatment with either TNF-α or IL-6 in differentiated adipocytes can increase the expression of ATGL and enhance glycerol production (a marker of lipolysis). Moreover, in vitro studies reveal that TNF-α induces lipolysis in differentiated human and murine adipocytes through multiple distinct pathways (ie, mitogen-activated protein kinase kinase; extracellular signal-related kinase 1/2; and elevation of cyclic adenosine monophosphate; NH2-terminal kinase) (Ryden et al., 2002; Yang et al., 2011; Zhang et al., 2002). Similarly, treatment with IL-6 induces lipolysis through increased expression of ATGL in soleus muscles ex vivo (Macdonald et al., 2013) and enhanced glycerol production in 3T3-L1 cells (Ji et al., 2011). Our results reveal that fetal and neonatal nicotine exposure culminates in increased steady-state mRNA levels of proinflammatory mediators, including TNF-α and IL-6 by 6 months of age. These results coincide with previous findings demonstrating that in utero nicotine exposure resulted in increased circulating proinflammatory cytokines throughout development and in 11-week-old offspring (Mohsenzadeh et al., 2014; Orellana et al., 2014). Since inflammation was present in 6-month female WAT and not at 3 weeks, this suggests that nicotine does not have a direct effect on inflammation but that augmented oxidative stress may mediate the expression of proinflammatory cytokines. One research group demonstrated that CD-1 mice fed a nicotine-containing diet for 14 weeks postnatally decreased adipocyte cell size without affecting white adipose inflammation (Liu et al., 2018). In fact, treatment with 4-HNE in 3T3-L1 cells induced inflammation by activating p38, subsequently increasing the expression of cyclooxygenase-2 (Zarrouki et al., 2007). Further studies are warranted to determine whether inflammation may in part promote lipolysis in prenatal nicotine-exposed WAT long term. In summary, our findings demonstrate that MNE during pregnancy and lactation leads to decreased WAT adipocyte size and impaired lipid storage in postnatal life characterized by augmented lipolysis and inflammation triggered possibly by a pro-oxidative stress environment. This impairment in WAT lipid storage can contribute to increased circulating TGs, leading to enhanced hepatic de novo lipogenesis, high blood pressure, and increased CVD risk as we have previously shown (Gao et al. 2008; Ma et al., 2014). These findings provide insight into the consequence of prolonged oxidative stress driving WAT dysfunction long-term. Postnatal intervention strategies targeting oxidative stress may benefit children exposed to nicotine in utero through cigarette smoke and/or NRT. In fact, studies demonstrate that the use of antioxidants (ie, anthocyanin, quercetin, bottle gourd) can significantly reduce dyslipidemia (Li et al., 2015; Talirevic and Jelena, 2012). Overall, results from this study suggest that therapeutic strategies targeting oxidative stress may effectively protect nicotine-exposed offspring from WAT dysfunction and dyslipidemia. FUNDING Canadian Institutes of Health Research (MOP86474 to A.C.H., MOP111011 to D.B.H.); research grant from the Women’s Development Council to D.B.H. N.G.B. is a recipient of a Whaley Fellowship and a Molly Towell Perinatal Research Foundation Fellowship. ACKNOWLEDGMENT The authors would like to acknowledge Dr Lin Zhao for his technical support. REFERENCES Abate N. ( 2012 ). Adipocyte maturation arrest: A determinant of systemic insulin resistance to glucose disposal . J. Clin. Endocrinol. Metab. 97 , 760 – 763 . Google Scholar CrossRef Search ADS PubMed Ahmadian M. , Duncan R. E. , Varady K. A. , Frasson D. , Hellerstein M. K. , Birkenfeld A. L. , Samuel V. T. , Shulman G. I. , Wang Y. , Kang C. ( 2009 ). Adipose overexpression of desnutrin promotes fatty acid use and attenuates diet-induced obesity . Diabetes 58 , 855 – 866 . Google Scholar CrossRef Search ADS PubMed Aquilano K. , Baldelli S. , La Barbera L. , Lettieri Barbato D. , Tatulli G. , Ciriolo M. R. ( 2016 ). Adipose triglyceride lipase decrement affects skeletal muscle homeostasis during aging through FAs-PPARalpha-PGC-1alpha antioxidant response . Oncotarget 7 , 23019 – 23032 . Google Scholar CrossRef Search ADS PubMed Atashi F. , Modarressi A. , Pepper M. S. ( 2015 ). The role of reactive oxygen species in mesenchymal stem cell adipogenic and osteogenic differentiation: A review . Stem Cells Dev. 24 , 1150 – 1163 . Google Scholar CrossRef Search ADS PubMed Bansal S. , Buring J. E. , Rifai N. , Mora S. , Sacks F. M. , Ridker P. M. ( 2007 ). Fasting compared with nonfasting triglycerides and risk of cardiovascular events in women . Jama 298 , 309 – 316 . Google Scholar CrossRef Search ADS PubMed Barra N. G. , Lisyansky M. , Vanduzer T. A. , Raha S. , Holloway A. C. , Hardy D. B. ( 2017 ). Maternal nicotine exposure leads to decreased cardiac protein disulfide isomerase and impaired mitochondrial function in male rat offspring . J. Appl. Toxicol. 37 12 , 1517 – 1526 . Google Scholar CrossRef Search ADS PubMed Bezaire V. , Mairal A. , Ribet C. , Lefort C. , Girousse A. , Jocken J. , Laurencikiene J. , Anesia R. , Rodriguez A. M. , Ryden M. et al. , . ( 2009 ). Contribution of adipose triglyceride lipase and hormone-sensitive lipase to lipolysis in hMADS adipocytes . J. Biol. Chem. 284 , 18282 – 18291 . Google Scholar CrossRef Search ADS PubMed Bolsoni-Lopes A. , Alonso-Vale M. I. ( 2015 ). Lipolysis and lipases in white adipose tissue - An update . Arch. Endocrinol. Metab. 59 , 335 – 342 . Google Scholar CrossRef Search ADS PubMed Bruin J. E. , Petre M. A. , Lehman M. A. , Raha S. , Gerstein H. C. , Morrison K. M. , Holloway A. C. ( 2008 ). Maternal nicotine exposure increases oxidative stress in the offspring . Free Radic. Biol. Med. 44 , 1919 – 1925 . Google Scholar CrossRef Search ADS PubMed Chen W. , Jiang Y. , Han J. , Hu J. , He T. , Yan T. , Huang N. , Zhang Q. , Mei H. , Liao Y. et al. , . ( 2017a ). Atgl deficiency induces podocyte apoptosis and leads to glomerular filtration barrier damage . Febs J. 284 , 1070 – 1081 . Google Scholar CrossRef Search ADS Chen W. , Zhang Q. , Cheng S. , Huang J. , Diao G. , Han J. ( 2017b ). Atgl gene deletion predisposes to proximal tubule damage by impairing the fatty acid metabolism . Biochem. Biophys. Res. Commun. 487 , 160 – 166 . Google Scholar CrossRef Search ADS Chi W. , Dao D. , Lau T. C. , Henriksbo B. D. , Cavallari J. F. , Foley K. P. , Schertzer J. D. ( 2014 ). Bacterial peptidoglycan stimulates adipocyte lipolysis via NOD1 . PLoS One 9 , e97675. Google Scholar CrossRef Search ADS PubMed Chou H. C. , Chen C. M. ( 2014 ). Maternal nicotine exposure during gestation and lactation induces cardiac remodeling in rat offspring . Reprod. Toxicol. 50 , 4 – 10 . Google Scholar CrossRef Search ADS PubMed Cui Y. , Shooshtari S. , Forget E. L. , Clara I. , Cheung K. F. ( 2014 ). Smoking during pregnancy: Findings from the 2009-2010 Canadian Community Health Survey . PLoS One 9 , e84640. Google Scholar CrossRef Search ADS PubMed Cupul-Uicab L. A. , Skjaerven R. , Haug K. , Travlos G. S. , Wilson R. E. , Eggesbo M. , Hoppin J. A. , Whitworth K. W. , Longnecker M. P. ( 2012 ). Exposure to tobacco smoke in utero and subsequent plasma lipids, ApoB, and CRP among adult women in the MoBa cohort . Environ. Health Perspect. 120 , 1532 – 1537 . Google Scholar CrossRef Search ADS PubMed Dasgupta C. , Xiao D. , Xu Z. , Yang S. , Zhang L. ( 2012 ). Developmental nicotine exposure results in programming of alveolar simplification and interstitial pulmonary fibrosis in adult male rats . Reprod. Toxicol. 34 , 370 – 377 . Google Scholar CrossRef Search ADS PubMed Fan J. , Zhang W. X. , Rao Y. S. , Xue J. L. , Wang F. F. , Zhang L. , Yan Y. E. ( 2016 ). Perinatal nicotine exposure increases obesity susceptibility in adult male rat offspring by altering early adipogenesis . Endocrinology 157 , 4276 – 4286 . Google Scholar CrossRef Search ADS PubMed Fox K. A. , Longo M. , Tamayo E. , Gamble P. , Makhlouf M. , Mateus J. F. , Saade G. R. ( 2012 ). Sex-specific effects of nicotine exposure on developmental programming of blood pressure and vascular reactivity in the C57Bl/6J mouse . Am. J. Obstet. Gynecol. 207 , 208 e1 – 209 . Google Scholar CrossRef Search ADS Gao Y. J. , Holloway A. C. , Su L. Y. , Takemori K. , Lu C. , Lee R. M. ( 2008 ). Effects of fetal and neonatal exposure to nicotine on blood pressure and perivascular adipose tissue function in adult life . Eur. J. Pharmacol. 590 , 264 – 268 . Google Scholar CrossRef Search ADS PubMed Gao Y. J. , Holloway A. C. , Zeng Z. H. , Lim G. E. , Petrik J. J. , Foster W. G. , Lee R. M. ( 2005 ). Prenatal exposure to nicotine causes postnatal obesity and altered perivascular adipose tissue function. Obes. Res. 13 , 687 – 692 . Gochberg-Sarver A. , Kedmi M. , Gana-Weisz M. , Bar-Shira A. , Orr-Urtreger A. ( 2012 ). Tnfalpha, Cox2 and AdipoQ adipokine gene expression levels are modulated in murine adipose tissues by both nicotine and nACh receptors containing the beta2 subunit . Mol. Genet. Metab. 107 , 561 – 570 . Google Scholar CrossRef Search ADS PubMed Greenwood M. R. , Hirsch J. ( 1974 ). Postnatal development of adipocyte cellularity in the normal rat . J. Lipid Res. 15 , 474 – 483 . Google Scholar PubMed Holloway A. C. , Kellenberger L. D. , Petrik J. J. ( 2006 ). Fetal and neonatal exposure to nicotine disrupts ovarian function and fertility in adult female rats . Endocrine 30 , 213 – 216 . Google Scholar CrossRef Search ADS PubMed Holloway A. C. , Petrik J. J. , Bruin J. E. , Gerstein H. C. ( 2008 ). Rosiglitazone prevents diabetes by increasing beta-cell mass in an animal model of type 2 diabetes characterized by reduced beta-cell mass at birth . Diabetes Obes. Metab. 10 , 763 – 771 . Google Scholar CrossRef Search ADS PubMed Hoogduijn M. J. , Cheng A. , Genever P. G. ( 2009 ). Functional nicotinic and muscarinic receptors on mesenchymal stem cells . Stem Cells Dev. 18 , 103 – 112 . Google Scholar CrossRef Search ADS PubMed Hu Y. , Rosen D. G. , Zhou Y. , Feng L. , Yang G. , Liu J. , Huang P. ( 2005 ). Mitochondrial manganese-superoxide dismutase expression in ovarian cancer: Role in cell proliferation and response to oxidative stress . J. Biol. Chem. 280 , 39485 – 39492 . Google Scholar CrossRef Search ADS PubMed Ji C. , Chen X. , Gao C. , Jiao L. , Wang J. , Xu G. , Fu H. , Guo X. , Zhao Y. ( 2011 ). IL-6 induces lipolysis and mitochondrial dysfunction, but does not affect insulin-mediated glucose transport in 3T3-L1 adipocytes . J. Bioenerg. Biomembr. 43 , 367 – 375 . Google Scholar CrossRef Search ADS PubMed Kershaw E. E. , Hamm J. K. , Verhagen L. A. , Peroni O. , Katic M. , Flier J. S. ( 2006 ). Adipose triglyceride lipase: Function, regulation by insulin, and comparison with adiponutrin . Diabetes 55 , 148 – 157 . Google Scholar CrossRef Search ADS PubMed Kersten S. ( 2014 ). Physiological regulation of lipoprotein lipase . Biochim. Biophys. Acta 1841 , 919 – 933 . Google Scholar CrossRef Search ADS PubMed Lawrence T. ( 2009 ). The nuclear factor NF-kappaB pathway in inflammation . Cold Spring Harb. Perspect. Biol. 1 , a001651. Google Scholar CrossRef Search ADS PubMed Li D. , Zhang Y. , Liu Y. , Sun R. , Xia M. ( 2015 ). Purified anthocyanin supplementation reduces dyslipidemia, enhances antioxidant capacity, and prevents insulin resistance in diabetic patients . J. Nutr. 145 , 742 – 748 . Google Scholar CrossRef Search ADS PubMed Li N. , Karin M. ( 1999 ). Is NF-kappaB the sensor of oxidative stress? Faseb J. 13 , 1137 – 1143 . Google Scholar CrossRef Search ADS PubMed Lin F. T. , Lane M. D. ( 1994 ). CCAAT/enhancer binding protein alpha is sufficient to initiate the 3T3-L1 adipocyte differentiation program . Proc. Natl. Acad. Sci. U.S.A. 91 , 8757 – 8761 . Google Scholar CrossRef Search ADS PubMed Lin F. T. , MacDougald O. A. , Diehl A. M. , Lane M. D. ( 1993 ). A 30-kDa alternative translation product of the CCAAT/enhancer binding protein alpha message: Transcriptional activator lacking antimitotic activity . Proc. Natl. Acad. Sci. U.S.A. 90 , 9606 – 9610 . Google Scholar CrossRef Search ADS PubMed Liu M. , Chuang Key C. C. , Weckerle A. , Boudyguina E. , Sawyer J. K. , Gebre A. K. , Spoo W. , Makwana O. , Parks J. S. ( 2018 ). Feeding of tobacco blend or nicotine induced weight loss associated with decreased adipocyte size and increased physical activity in male mice . Food Chem. Toxicol. 113 , 287 – 295 . Google Scholar CrossRef Search ADS PubMed Luck W. , Nau H. ( 1987 ). Nicotine and cotinine concentrations in the milk of smoking mothers: Influence of cigarette consumption and diurnal variation . Eur. J. Pediatr. 146 , 21 – 26 . Google Scholar CrossRef Search ADS PubMed Luck W. , Nau H. , Hansen R. , Steldinger R. ( 1985 ). Extent of nicotine and cotinine transfer to the human fetus, placenta and amniotic fluid of smoking mothers . Dev. Pharmacol. Ther. 8 , 384 – 395 . Google Scholar CrossRef Search ADS PubMed Ma N. , Nicholson C. J. , Wong M. , Holloway A. C. , Hardy D. B. ( 2014 ). Fetal and neonatal exposure to nicotine leads to augmented hepatic and circulating triglycerides in adult male offspring due to increased expression of fatty acid synthase . Toxicol. Appl. Pharmacol. 275 , 1 – 11 . Google Scholar CrossRef Search ADS PubMed Macdonald T. L. , Wan Z. , Frendo-Cumbo S. , Dyck D. J. , Wright D. C. ( 2013 ). IL-6 and epinephrine have divergent fiber type effects on intramuscular lipolysis . J. Appl. Physiol. (1985) 115 , 1457 – 1463 . Google Scholar CrossRef Search ADS PubMed Mohsenzadeh Y. , Rahmani A. , Cheraghi J. , Pyrani M. , Asadollahi K. ( 2014 ). Prenatal exposure to nicotine in pregnant rat increased inflammatory marker in newborn rat . Mediators Inflamm. 2014 , 1. Google Scholar CrossRef Search ADS Morgan M. J. , Liu Z. G. ( 2011 ). Crosstalk of reactive oxygen species and NF-kappaB signaling . Cell Res. 21 , 103 – 115 . Google Scholar CrossRef Search ADS PubMed Oncken C. A. , Kranzler H. R. ( 2003 ). Pharmacotherapies to enhance smoking cessation during pregnancy . Drug Alcohol Rev. 22 , 191 – 202 . Google Scholar CrossRef Search ADS PubMed Orellana J. A. , Busso D. , Ramirez G. , Campos M. , Rigotti A. , Eugenin J. , von Bernhardi R. ( 2014 ). Prenatal nicotine exposure enhances Cx43 and Panx1 unopposed channel activity in brain cells of adult offspring mice fed a high-fat/cholesterol diet . Front. Cell Neurosci. 8 , 403. Google Scholar CrossRef Search ADS PubMed Ossipow V. , Descombes P. , Schibler U. ( 1993 ). CCAAT/enhancer-binding protein mRNA is translated into multiple proteins with different transcription activation potentials . Proc. Natl. Acad. Sci. U.S.A. 90 , 8219 – 8223 . Google Scholar CrossRef Search ADS PubMed Pauly J. R. , Slotkin T. A. ( 2008 ). Maternal tobacco smoking, nicotine replacement and neurobehavioural development . Acta Paediatr. 97 , 1331 – 1337 . Google Scholar CrossRef Search ADS PubMed Poissonnet C. M. , Burdi A. R. , Garn S. M. ( 1984 ). The chronology of adipose tissue appearance and distribution in the human fetus . Early Hum. Dev. 10 , 1 – 11 . Google Scholar CrossRef Search ADS PubMed Roman-Galvez R. M. , Amezcua-Prieto C. , Olmedo-Requena R. , Lewis-Mikhael Saad A. M. , Martinez-Galiano J. M. , Bueno-Cavanillas A. ( 2017 ). Partner smoking influences whether mothers quit smoking during pregnancy: A prospective cohort study . BJOG Oct 20. doi: 10.1111/1471-0528.14986, 1 – 8 . Ryden M. , Dicker A. , van Harmelen V. , Hauner H. , Brunnberg M. , Perbeck L. , Lonnqvist F. , Arner P. ( 2002 ). Mapping of early signaling events in tumor necrosis factor-alpha -mediated lipolysis in human fat cells . J. Biol. Chem. 277 , 1085 – 1091 . Google Scholar CrossRef Search ADS PubMed Sbrana E. , Suter M. A. , Abramovici A. R. , Hawkins H. K. , Moss J. E. , Patterson L. , Shope C. , Aagaard-Tillery K. ( 2011 ). Maternal tobacco use is associated with increased markers of oxidative stress in the placenta . Am. J. Obstet. Gynecol. 205 , 246 e1 – 247 . Google Scholar CrossRef Search ADS Sena L. A. , Chandel N. S. ( 2012 ). Physiological roles of mitochondrial reactive oxygen species . Mol Cell 48 , 158 – 167 . Google Scholar CrossRef Search ADS PubMed Shahab L. , Dobbie F. , Hiscock R. , McNeill A. , Bauld L. ( 2017 ). Prevalence and impact of long-term use of nicotine replacement therapy in UK stop-smoking services: Findings from the ELONS study . Nicotine Tob. Res. 20 1 , 81 – 88 . Google Scholar PubMed Somm E. , Schwitzgebel V. M. , Vauthay D. M. , Camm E. J. , Chen C. Y. , Giacobino J. P. , Sizonenko S. V. , Aubert M. L. , Huppi P. S. ( 2008 ). Prenatal nicotine exposure alters early pancreatic islet and adipose tissue development with consequences on the control of body weight and glucose metabolism later in life . Endocrinology 149 , 6289 – 6299 . Google Scholar CrossRef Search ADS PubMed Spalding K. L. , Arner E. , Westermark P. O. , Bernard S. , Buchholz B. A. , Bergmann O. , Blomqvist L. , Hoffstedt J. , Naslund E. , Britton T. ( 2008 ). Dynamics of fat cell turnover in humans . Nature 453 , 783 – 787 . Google Scholar CrossRef Search ADS PubMed Talirevic E. , Jelena S. ( 2012 ). Quercetin in the treatment of dyslipidemia . Med. Arh. 66 , 87 – 88 . Google Scholar CrossRef Search ADS PubMed Tappin D. M. , MacAskill S. , Bauld L. , Eadie D. , Shipton D. , Galbraith L. ( 2010 ). Smoking prevalence and smoking cessation services for pregnant women in Scotland . Subst. Abuse Treat. Prev. Policy 5 , 1. Google Scholar CrossRef Search ADS PubMed Tong V. T. , Dietz P. M. , Morrow B. , D’Angelo D. V. , Farr S. L. , Rockhill K. M. , England L. J. , Centers for Disease, C., and Prevention ( 2013 ). Trends in smoking before, during, and after pregnancy–Pregnancy Risk Assessment Monitoring System, United States, 40 sites, 2000-2010 . MMWR Surveill. Summ . 62 , 1 – 19 . Google Scholar PubMed Villa A. , Della Torre S. , Stell A. , Cook J. , Brown M. , Maggi A. ( 2012 ). Tetradian oscillation of estrogen receptor alpha is necessary to prevent liver lipid deposition . Proc. Natl. Acad. Sci. U.S.A. 109 , 11806 – 11811 . Google Scholar CrossRef Search ADS PubMed Vogel C. , Marcotte E. M. ( 2012 ). Insights into the regulation of protein abundance from proteomic and transcriptomic analyses . Nat. Rev. Genet. 13 , 227 – 232 . Google Scholar CrossRef Search ADS PubMed Wen X. , Triche E. W. , Hogan J. W. , Shenassa E. D. , Buka S. L. ( 2010 ). Birth weight and adult hypercholesterolemia: Subgroups of small-for-gestational-age based on maternal smoking status during pregnancy . Epidemiology 21 , 786 – 790 . Google Scholar CrossRef Search ADS PubMed Weng S. F. , Redsell S. A. , Swift J. A. , Yang M. , Glazebrook C. P. ( 2012 ). Systematic review and meta-analyses of risk factors for childhood overweight identifiable during infancy . Arch. Dis. Child 97 , 1019 – 1026 . Google Scholar CrossRef Search ADS PubMed Yang X. , Zhang X. , Heckmann B. L. , Lu X. , Liu J. ( 2011 ). Relative contribution of adipose triglyceride lipase and hormone-sensitive lipase to tumor necrosis factor-alpha (TNF-alpha)-induced lipolysis in adipocytes . J. Biol. Chem. 286 , 40477 – 40485 . Google Scholar CrossRef Search ADS PubMed Zarrouki B. , Soares A. F. , Guichardant M. , Lagarde M. , Geloen A. ( 2007 ). The lipid peroxidation end-product 4-HNE induces COX-2 expression through p38MAPK activation in 3T3-L1 adipose cell . FEBS Lett 581 , 2394 – 2400 . Google Scholar CrossRef Search ADS PubMed Zechner R. , Kienesberger P. C. , Haemmerle G. , Zimmermann R. , Lass A. ( 2009 ). Adipose triglyceride lipase and the lipolytic catabolism of cellular fat stores . J. Lipid Res. 50 , 3 – 21 . Google Scholar CrossRef Search ADS PubMed Zhang H. H. , Halbleib M. , Ahmad F. , Manganiello V. C. , Greenberg A. S. ( 2002 ). Tumor necrosis factor-alpha stimulates lipolysis in differentiated human adipocytes through activation of extracellular signal-related kinase and elevation of intracellular cAMP . Diabetes 51 , 2929 – 2935 . Google Scholar CrossRef Search ADS PubMed Zhang X. , Wang Z. , Li J. , Gu D. , Li S. , Shen C. , Song Z. ( 2013 ). Increased 4-hydroxynonenal formation contributes to obesity-related lipolytic activation in adipocytes . PLoS One 8 , e70663. Google Scholar CrossRef Search ADS PubMed Zhang Y. , Li J. , Wen X. ( 2017 ). Jueming prescription and its ingredients, semen cassiae and Rhizoma Curcumae Longae, stimulate lipolysis and enhance the phosphorylation of hormonesensitive lipase in cultured rat white adipose tissue . Mol. Med. Rep. 16 , 6200 – 6207 . Google Scholar CrossRef Search ADS PubMed © The Author(s) 2018. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Toxicological Sciences – Oxford University Press

Published: Mar 30, 2018

There are no references for this article.