LSD1 coordinates with the SIN3A/HDAC complex and maintains sensitivity to chemotherapy in breast cancer

LSD1 coordinates with the SIN3A/HDAC complex and maintains sensitivity to chemotherapy in breast... Abstract Lysine-specific demethylase 1 (LSD1) was the first histone demethylase identified as catalysing the removal of mono- and di-methylation marks on histone H3-K4. Despite the potential broad action of LSD1 in transcription regulation, recent studies indicate that LSD1 may coordinate with multiple epigenetic regulatory complexes including CoREST/HDAC complex, NuRD complex, SIRT1, and PRC2, implying complicated mechanistic actions of this seemingly simple enzyme. Here, we report that LSD1 is also an integral component of the SIN3A/HDAC complex. Transcriptional target analysis using ChIP-on-chip technology revealed that the LSD1/SIN3A/HDAC complex targets several cellular signalling pathways that are critically involved in cell proliferation, survival, metastasis, and apoptosis, especially the p53 signalling pathway. We have demonstrated that LSD1 coordinates with the SIN3A/HDAC complex in inhibiting a series of genes such as CASP7, TGFB2, CDKN1A(p21), HIF1A, TERT, and MDM2, some of which are oncogenic. Our experiments also found that LSD1 and SIN3A are required for optimal survival and growth of breast cancer cells while also essential for the maintenance of epithelial homoeostasis and chemosensitivity. Our data indicate that LSD1 is a functional alternative subunit of the SIN3A/HDAC complex, providing a molecular basis for the interplay of histone demethylation and deacetylation in chromatin remodelling, and suggest that the LSD1/SIN3A/HDAC complex could be a target for breast cancer therapeutic strategies. LSD1, SIN3A, breast cancer, metastasis, chemotherapy sensitivity Introduction The term ‘epigenetic’ refers to heritable changes regulating gene expression that are not a result of changes in the primary DNA sequence. In cancer, aberrant epigenetic silencing of tumour suppressor genes is a common occurrence associated with abnormal DNA methylation patterns and changes in covalent histone modifications (Jenuwein and Allis, 2001). These histone modifications, including acetylation, methylation, and phosphorylation, play major roles in the regulation of chromatin structures and gene transcription (Jenuwein and Allis, 2001), with each modification having a context-dependent association with transcriptional activation or repression. For example, H3-K4 (histone H3 lysine 4) methylation is associated with transcriptional activation, whereas H3-K9 (histone H3 lysine 9) methylation is associated with transcriptional repression. Histone methylation is catalysed by histone methyltransferases (HMTs), and methyl marks are removed by the catalytic activity of enzymes such as the flavin adenine dinucleotide (FAD)-dependent lysine-specific demethylases (LSDs), LSD1 and LSD2, and the Jumonji C domain-containing histone demethylases (Shi et al., 2004; Shi and Whetstine, 2007; Ciccone et al., 2009; Fang et al., 2010). The lysine-specific histone demethylase 1 A (KDM1A; referred to hereafter solely by its alias LSD1) is a FAD-dependent amine oxidase. Biochemically, LSD1 acts to specifically demethylate mono- or dimethylated H3-K4 and H3-K9 (Wissmann et al., 2007) and, functionally, LSD1 impacts the chromatin configuration governing transcription regulation. LSD1 was one of the first histone demethylases identified (Shi et al., 2004) and has been implicated in many cellular processes (Scoumanne and Chen, 2007; Wang et al., 2007b, 2009b). LSD1 is part of both corepressor and coactivator complexes and contributes to regulating the activity of certain transcription factors including nuclear receptors (Metzger et al., 2005). In addition to histone H3, LSD1 has non-histone substrates such as p53, DNA methyltransferase 1, and ERα, regulating their activities and stability (Huang et al., 2007; Perillo et al., 2008; Wang et al., 2009a). Despite progress in understanding dynamic histone-methylation regulation and in revealing the diverse molecular interactions for LSD1, the biological function of LSD1 is just beginning to be uncovered. Although the histone demethylation (HDM)/transcription regulation activity of LSD1 is potentially widespread, evidence suggests that LSD1 nevertheless performs pathway-specific functions (Di Stefano et al., 2007; Shi, 2007). The SIN3A/HDAC complex is identified as a global transcriptional corepressor. The SIN3A protein provides a platform for multiple protein interaction with its four paired amphipathic α-helix motif (Silverstein and Ekwall, 2005). A number of early studies identify that this complex is a multi-subunit protein complex containing eight core components, SIN3A, HDAC1, HDAC2, RbAp46, RbAp48, SAP30, SAP18, and SDS3 (Hassig et al., 1997; Laherty et al., 1997). Over the past few years, other associated proteins have been found, including SAP25, SAP130, SAP180, BRMS1, RBP1, and ING1/2 (Skowyra et al., 2001; Fleischer et al., 2003; Meehan et al., 2004; Shiio et al., 2006). Original studies have found that mSin3A can associate with Mad1 and Mxi1, which antagonizes the activity of the Myc proto-oncogenes (Rao et al., 1996; Sjoblom-Hallen et al., 1999). Subsequent work has discovered that a number of transcriptional factors have association with Sin3A, such as p53 (Murphy et al., 1999), REST (Huang et al., 1999), YY1 (Le May et al., 2008; Lu et al., 2011), SMAR1 (Rampalli et al., 2005), ERα (Ellison-Zelski et al., 2009), and Nanog and Oct4 (Liang et al., 2008). In vivo, no viable homozygous mSin3A−/− embryos could be detected on embryonic day 6.5, indicating that mSin3A is essential for mouse embryo development (Dannenberg et al., 2005). Other studies have found that mSin3A plays an important role in the development of multiple tissues (Cowley et al., 2005; van Oevelen et al., 2010; Pellegrino et al., 2012). Although SIN3A complex controls the expression of many cancer-related genes, the role of SIN3A in cancer remains unclear (Suzuki et al., 2008; Ellison-Zelski and Alarid, 2010). However, SIN3A, which participates extensively in transcriptional networks, is essential for mammalian development and involved in many biological processes, such as cell cycle progression, apoptosis, T-cell proliferation, differentiation, genome integrity, and homoeostasis (Cowley et al., 2005; Dannenberg et al., 2005; Nascimento et al., 2011; McDonel et al., 2012). Here we propose that LSD1 is a functional component of the SIN3A/HDAC complex, adding HDM activity to this complex. We have found that LSD1 and SIN3A are functionally interdependent and required for breast cancer cell optimal survival and growth. We have also shown that LSD1/SIN3A/HDAC complex regulates the survival and oncogenic potential of breast cancer cells, and is essential for the maintenance of epithelial homoeostasis and chemotherapeutic sensitivity, implicating the LSD1/SIN3A/HDAC complex as a target for breast cancer therapeutic strategies. Results LSD1 is an integral component of the SIN3A/HDAC complex In an effort to better understand the mechanistic roles of the SIN3A, a scaffold subunit of the SIN3A/HDAC complex, in breast cancer, we employed affinity purification and mass spectrometry to identify the proteins that are associated with SIN3A. In these experiments, FLAG-tagged SIN3A (FLAG-SIN3A) was stably expressed in human breast carcinoma MCF-7 cells. Cellular extracts were prepared and subjected to affinity purification using an anti-FLAG affinity gel. Mass spectrometric analysis indicated that SIN3A co-purified with SAP180, SAP130, HDAC1, HDAC2, RbAp46, RbAp48, SAP30, and NCOR1 (Alland et al., 1997) as reported previously, all of which are components of the SIN3A/HDAC complex. It is interesting that we found that SIN3A also co-purified with LSD1, the first identified histone lysine demethylase (Figure 1A). In addition, PRMT5 and hnRNPK were also detected in the complex. The presence of LSD1 in the SIN3A/HDAC complex was further confirmed by detecting their antibodies by western blot analysis (Figure 1B), suggesting that LSD1 is associated with the SIN3A/HDAC complex in vivo. The detailed results of the mass spectrometric analysis are provided in Supplementary Table S1. Figure 1 View largeDownload slide LSD1 interacts with the SIN3A/HDAC complex. (A) Immunoaffinity purification of SIN3-containing protein complex. Cellular extracts from MCF-7 cells stably expressing FLAG-vector or FLAG-SIN3A were immunopurified with anti-FLAG affinity columns and eluted with FLAG peptide. These elutes were resolved by SDS-PAGE and silver stained. The protein bands were retrieved and subjected to mass spectrometry. (B) Western blot analysis of the identified proteins in the purified fractions, using antibodies against the identified proteins. (C) Co-fractionation of the LSD1/SIN3A/HDAC complex by FPLC. Nuclear extracts of MCF-7 cells underwent fractionation of Superose 6 size exclusion columns. The fractions were subjected to western blot analysis. The elution positions of calibration proteins with known molecular masses (kDa) were indicated and an equal volume from each fraction was analysed. (D) Association of LSD1 with the SIN3A/HDAC complex in MCF-7 cells. Whole-cell lysates were immunoprecipitated (IP) with antibodies against the indicated proteins. Immunocomplexes were then immunoblotted (IB) using antibodies against the indicated proteins. (E) Reciprocal association of LSD1 with the SIN3A/HDAC complex in T-47D cells. Figure 1 View largeDownload slide LSD1 interacts with the SIN3A/HDAC complex. (A) Immunoaffinity purification of SIN3-containing protein complex. Cellular extracts from MCF-7 cells stably expressing FLAG-vector or FLAG-SIN3A were immunopurified with anti-FLAG affinity columns and eluted with FLAG peptide. These elutes were resolved by SDS-PAGE and silver stained. The protein bands were retrieved and subjected to mass spectrometry. (B) Western blot analysis of the identified proteins in the purified fractions, using antibodies against the identified proteins. (C) Co-fractionation of the LSD1/SIN3A/HDAC complex by FPLC. Nuclear extracts of MCF-7 cells underwent fractionation of Superose 6 size exclusion columns. The fractions were subjected to western blot analysis. The elution positions of calibration proteins with known molecular masses (kDa) were indicated and an equal volume from each fraction was analysed. (D) Association of LSD1 with the SIN3A/HDAC complex in MCF-7 cells. Whole-cell lysates were immunoprecipitated (IP) with antibodies against the indicated proteins. Immunocomplexes were then immunoblotted (IB) using antibodies against the indicated proteins. (E) Reciprocal association of LSD1 with the SIN3A/HDAC complex in T-47D cells. To further demonstrate that LSD1 is associated with the SIN3A/HDAC complex in vivo, protein fractionation experiments were carried out using fast protein liquid chromatography (FPLC) with Superose 6 columns and a high salt extraction and size exclusion approach. The results indicated that native LSD1 from MCF-7 cells was eluted with an apparent molecular mass much greater than that of the monomeric protein; LSD1 immunoreactivity was detected in chromatographic fractions from the Superose 6 column with a relatively symmetrical peak centred between ~667 kDa and ~1200 kDa (Figure 1C). Significantly, the elution pattern of LSD1 largely overlapped with that of the SIN3A/HDAC complex proteins including SIN3A, HDAC1, HDAC2, RbAp46/48, SAP180, SAP130, and SAP30, further supporting the idea that LSD1 is associated with the SIN3A/HDAC complex in vivo. To confirm the in vivo interaction between LSD1 and the SIN3A/HDAC complex, immunoprecipitation (IP) with antibodies against LSD1 followed by immunoblotting (IB) with antibodies against SAP180, SAP130, SIN3A, HDAC1, HDAC2, SAP30, or SAP18 demonstrated that LSD1 co-immunoprecipitated with all common components of the SIN3A/HDAC complex (Figure 1D, left panel). Reciprocally, IP with antibodies against the components of the SIN3A/HDAC complex and IB with antibodies against LSD1 also revealed that the components of the SIN3A/HDAC complex co-immunoprecipitated with LSD1 (Figure 1D, right panel). In addition, similar results were found in human breast carcinoma T-47D cells (Figure 1E). Taken together, these data strongly suggest that LSD1 is associated with the SIN3A/HDAC complex in vivo and is an integral component of the SIN3A/HDAC complex. LSD1 interacts directly with SIN3A and confers H3-K4 demethylation activity In order to determine the molecular basis for the interaction of LSD1 with the SIN3A/HDAC complex, GST pull-down assays were conducted using a GST-fused LSD1 construct and in vitro transcribed/translated individual components of the SIN3A/HDAC complex including SAP180, SAP130, SIN3A, HDAC1, HDAC2, RbAp46, RbAp48, ING1, SAP45, SAP30, and SAP18. MTA3 was used as a positive control (Wang et al., 2009b). These results indicate that LSD1 interacts directly with SIN3A, but not with the other components of the common SIN3A/HDAC complex that we tested (Figure 2A). Figure 2 View largeDownload slide Molecular interaction between LSD1 and the SIN3A/HDAC complex. (A) GST pull-down assays with GST-fused LSD1 and in vitro transcribed/translated components of the SIN3A/HDAC complex as indicated. (B) Schematic diagram depicting the GST-fused deletion constructs of LSD1. GST pull-down experiments with GST-fused LSD1 deletion constructs and in vitro transcribed/translated SIN3A. (C) Schematic diagram depicting the GST-fused deletion constructs of SIN3A. GST pull-down experiments with GST-fused SIN3A deletion constructs and in vitro transcribed/translated LSD1. (D) The SIN3A-containing protein complex possesses both HDM and HDAC activities. Cellular extracts were obtained from MCF-7 cells stably expressing FLAG-SIN3A and were immunoprecipitated with anti-FLAG antibody. The IPs were incubated with bulk histones and HDM or HDAC assay buffer. The reaction mixtures were analysed by western blot using antibodies against the indicated. (E) Schematic diagram depicting the molecular interaction between LSD1 and SIN3A. Figure 2 View largeDownload slide Molecular interaction between LSD1 and the SIN3A/HDAC complex. (A) GST pull-down assays with GST-fused LSD1 and in vitro transcribed/translated components of the SIN3A/HDAC complex as indicated. (B) Schematic diagram depicting the GST-fused deletion constructs of LSD1. GST pull-down experiments with GST-fused LSD1 deletion constructs and in vitro transcribed/translated SIN3A. (C) Schematic diagram depicting the GST-fused deletion constructs of SIN3A. GST pull-down experiments with GST-fused SIN3A deletion constructs and in vitro transcribed/translated LSD1. (D) The SIN3A-containing protein complex possesses both HDM and HDAC activities. Cellular extracts were obtained from MCF-7 cells stably expressing FLAG-SIN3A and were immunoprecipitated with anti-FLAG antibody. The IPs were incubated with bulk histones and HDM or HDAC assay buffer. The reaction mixtures were analysed by western blot using antibodies against the indicated. (E) Schematic diagram depicting the molecular interaction between LSD1 and SIN3A. LSD1 is an asymmetric molecule consisting of several distinct structural domains: the N-terminal putative nuclear localization signal is followed by the SWIRM (Swi3, Rsc8, and Moira) domain; in the C-terminus, a Tower domain protrudes as an elongated helix-turn-helix motif out of the FAD-binding amine oxidase domain (AOD) (Cheng and Zhang, 2007; Forneris et al., 2008). In order to map the interaction interface of LSD1 with the members of the SIN3A, GST pull-down assays were performed with a GST-fused LSD1 N-terminal fragment (1−166 aa), SWIRM domain (167−260 aa), Tower domain (419−520 aa), and AOD domain (260−852 aa) with or without the Tower domain (419−520 aa) with in vitro transcribed/translated SIN3A (Figure 2B, left panel). Our results indicate that the Tower domain is responsible for the interaction of LSD1 with SIN3A (Figure 2B, right panel). Analogously, mapping the interaction interface in SIN3A with GST-fused SIN3A domain constructs and in vitro transcribed/translated LSD1 revealed that the HDAC-interacting domain (HID) of the SIN3A proteins is responsible for the interaction of SIN3A with LSD1 (Figure 2C). To further investigate the physical associations and functional connection between LSD1 and the SIN3A/HDAC complex, the SIN3A-containing protein complex was analysed for enzymatic activities. The immunoprecipitates (IPs) were first incubated with bulk histones and the levels of methylated and acetylated histones in the reactions were then analysed by western blot (Figure 2D). As expected, the SIN3A-containing complex demonstrated an enzymatic activity that led to a significant decrease in the acetylation level of H3. Remarkably, however, the IPs also contained a strong demethylase activity for dimethyl H3-K4 and an evident demethylase activity for mono-methyl H3-K4 on both bulk histones and nucleosomal substrates, whereas no apparent effect on the dimethyl of H3-K9 was detected. In conclusion, these results show that LSD1 participates in the SIN3A/HDAC complex by interacting in the SIN3A-HID domain with its Tower domain. LSD1/SIN3A complexes are mainly implicated in gene transcription repression through their catalytic activities impacting chromatin configuration (Figure 2E). Transcription target analysis for the LSD1/SIN3A complex In order to further investigate the functional association between LSD1 and the SIN3A complex and explore the biological significance of this association, we analysed the genome-wide transcriptional targets of the LSD1/SIN3A complex using a chromatin immunoprecipitation-on-chip (ChIP-on-chip) approach. In these experiments, ChIP experiments were conducted in MCF-7 cells with antibodies against SIN3A. Following ChIP, the SIN3A-associated DNAs were amplified using nonbiased conditions, labelled, and hybridized to AVIVA Hu20K arrays. The data from SIN3A antibody (2127 genes) were then analysed with the data from antibodies against the 1913 target genes of LSD1 (GSE14260) reported previously (Wang et al., 2009b) for overlapping promoters, and these promoters were considered to be the targets of the LSD1/SIN3A complex (Figure 3A, left panel). These experiments identified a total of 310 different promoters targeted by the LSD1/SIN3A/HDAC complex. These data indicate that LSD1 and SIN3A target overlapping yet distinct sets of genes. The detailed results of the ChIP-on-chip experiments are summarized in Supplementary Dataset S1. Figure 3 View largeDownload slide Genome-wide transcription target analysis for the LSD1/SIN3A/HDAC complex. (A) Venn diagram of overlapping promoters bound by LSD1 and SIN3A in MCF-7 cells. The numbers represent the number of promoters that were targeted by the indicated proteins (left). The detailed results of the ChIP-on-chip experiments are summarized in Supplementary Dataset S1. Clustering of the 310 overlapping target genes of LSD1 and SIN3A into functional groups (right). (B) Verification of the ChIP-on-chip results via qChIP analysis of the indicated genes in MCF-7 cells. Results are represented as fold change over control with GAPDH as a negative control. Error bars represent mean ± SD for three independent experiments. (C) Verification of the ChIP-on-chip results by conventional DNA electrophoresis. IgG served as a negative control. (D) Verification of the ChIP-on-chip results by conventional DNA electrophoresis using Re-ChIP experiments on eight selected co-targets in MCF-7 cells with antibodies against LSD1 or SIN3A. IgG served as a negative control. (E) The LSD1 and SIN3A/HDAC complexes exist in the same protein complex on the representative co-target TGFB2 and HIF1A promoters. ChIP and Re-ChIP experiments were performed in MCF-7 cells with the indicated antibodies. S3A, SIN3A; L1, LSD1; HD1, HDAC1; S130, SAP130; S30, SAP30. Figure 3 View largeDownload slide Genome-wide transcription target analysis for the LSD1/SIN3A/HDAC complex. (A) Venn diagram of overlapping promoters bound by LSD1 and SIN3A in MCF-7 cells. The numbers represent the number of promoters that were targeted by the indicated proteins (left). The detailed results of the ChIP-on-chip experiments are summarized in Supplementary Dataset S1. Clustering of the 310 overlapping target genes of LSD1 and SIN3A into functional groups (right). (B) Verification of the ChIP-on-chip results via qChIP analysis of the indicated genes in MCF-7 cells. Results are represented as fold change over control with GAPDH as a negative control. Error bars represent mean ± SD for three independent experiments. (C) Verification of the ChIP-on-chip results by conventional DNA electrophoresis. IgG served as a negative control. (D) Verification of the ChIP-on-chip results by conventional DNA electrophoresis using Re-ChIP experiments on eight selected co-targets in MCF-7 cells with antibodies against LSD1 or SIN3A. IgG served as a negative control. (E) The LSD1 and SIN3A/HDAC complexes exist in the same protein complex on the representative co-target TGFB2 and HIF1A promoters. ChIP and Re-ChIP experiments were performed in MCF-7 cells with the indicated antibodies. S3A, SIN3A; L1, LSD1; HD1, HDAC1; S130, SAP130; S30, SAP30. The genes regulated by these promoters were then classified into cellular signalling pathways using the KEGG pathway database (http://www.genome.jp/kegg/pathway.html) with a P-value cut-off of 10−3. These analyses revealed that the LSD1/SIN3A/HDAC complex targets signalling pathways including p53 signalling pathway, cytoskeleton construction, cell cycle regulation, TGFβ signalling pathway, focal adhesion, apoptosis signalling pathway, which are critically involved in cell growth, survival, migration, and invasion (Figure 3A, right panel). Based on the data analysis, we focused on p53 and apoptosis signalling pathway for further study. To validate the ChIP-on-chip analysis, we performed ChIP experiments for 23 LSD1 and SIN3A co-target genes, using GAPDH as a negative control. The ChIP results were quantized by quantitative real-time PCR (qChIP) (Figure 3B) and visualized by conventional ChIP (Figure 3C). Both LSD1 and SIN3A bindings were confirmed for most of the target genes, showing the high accuracy of the ChIP-on-chip analysis. To further investigate the potential functional interplay between LSD1 and SIN3A, we performed sequential ChIP or ChIP/Re-ChIP with antibodies against LSD1 and SIN3A for eight co-target genes including CDKN1A(p21), RHOA, TGFB2, CASP7, CUL4A, TERT, HIF1A, and MDM2 (Figure 3D). We then investigated the co-occupancy of the LSD1/SIN3A/HDAC1 complex. ChIP assays in MCF-7 cells with antibodies against LSD1, SIN3A, HDAC1, SAP130, SAP30, or control IgG revealed that LSD1 and SIN3A/HDAC complexes co-occupied the promoters of TGFB2 and HIF1A (Figure 3E, the first upper bands). To further test our proposition that LSD1 and subunits of the SIN3A/HDAC complex function in the same protein complex at target promoters, sequential ChIP or ChIP/Re-ChIP experiments were performed. In these experiments, soluble chromatins were first immunoprecipitated with antibodies against LSD1, SIN3A, HDAC1, SAP130, or SAP30. The IPs were subsequently re-immunoprecipitated with appropriate antibodies. The results show that in precipitates, the TGFB2 and HIF1A promoters that were immunoprecipitated with antibodies against LSD1 could be re-immunoprecipitated with antibodies against SIN3A, HDAC1, SAP130, or SAP30. Similar results were obtained when initial ChIP was done with antibodies against SIN3A, HDAC1, SAP130, or SAP30 (Figure 3E). Taken together, these results support the idea that LSD1 and subunits of the SIN3A/HDAC complex occupy the target promoters in one multiunit complex. LSD1 is essential for SIN3A/HDAC complex-mediated transcriptional repression To gauge the functional importance of LSD1 incorporated into the SIN3A/HDAC complex, we assayed for the consequences of artificially recruiting SIN3A to chromatin. MCF-7 cells containing the luciferase reporter gene expressed under the control of the CMV promoter with five Gal4 DNA-binding sites (MCF-7-UAS-Luci) were transiently transfected with the plasmid that expressed Gal4-DBD-SIN3A (Gal4-SIN3A) or control Gal4-DBD vector (Gal4). Gal4-SIN3A expression led to significantly decreased reporter gene expression as reported previously (Yang et al., 2002). However, in LSD1-depleted MCF-7-UAS-Luci cells, the transcriptional repression activity of SIN3A was partially impaired by both #1 and #2 LSD1-targeted shRNAs (Figure 4A, left panel), while in the two SIN3A-depleted MCF-7-UAS-Luci cells, the transcriptional repression activity of Gal4-LSD1 was also partially impaired (Figure 4A, right panel), indicating that both LSD1 and SIN3A are required for optimal LSD1/SIN3A/HDAC complex transcriptional repression. Interestingly, we also found that the amount of chromatin-bound SIN3A was positively correlated with the abundance of LSD1 and verse visa (Figure 4B), indicating that the functions of LSD1 and SIN3A are closely connected. Figure 4 View largeDownload slide LSD1 and SIN3A are mutually required for optimal LSD1/SIN3A/HDAC complex transcriptional repression. (A) The control vector (containing Gal4-DBD only), Gal4-SIN3A, or Gal4-LSD1 construct was cloned and transfected alone or with the indicated specific lentivirus-mediated shRNAs into MCF-7 cells stably expressing Gal4-UAS reporter (MCF-7-Gal4-Luc cells). Gal4 luciferase reporter activity was measured. (B) LSD1 and SIN3A were mutually required for chromatin binding. Chromatin-bound fractions were prepared from MCF-7 cells and analysed by IB with the indicated antibodies. Histone H3 served as a loading control. (C) Clones with LSD1 or SIN3A knockdown were compared with the parental cell line for mRNA (left panel) and protein (right panel) levels of the indicated six co-regulated genes in MCF-7 cells. The mRNA levels were normalized to those of GADPH (left panel) and β-actin was served as a loading control for western blot analysis (right panel). (D and E) qChIP analysis of the recruitment of the indicated proteins (D) and histone modifications (E) on the indicated promoters in MCF-7 cells after infection with control lentivirus-mediated shRNA, or shRNAs targeting LSD1, SIN3A, or HDAC1. Results are represented as fold change over control with GAPDH as a negative control (D) or H3 ChIP as an internal control (E). (F) qChIP analysis of the recruitment of SIN3A or LSD1 on the indicated promoters in MCF-7 cells stably infected with LSD1 or SIN3A shRNA or stably expressing LSD1 or SIN3A. Results are represented as fold change over control with GAPDH as a negative control. (G) A graphic model as discussed in the text. In A, C–F, error bars represent mean ± SD of three independent experiments. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). Figure 4 View largeDownload slide LSD1 and SIN3A are mutually required for optimal LSD1/SIN3A/HDAC complex transcriptional repression. (A) The control vector (containing Gal4-DBD only), Gal4-SIN3A, or Gal4-LSD1 construct was cloned and transfected alone or with the indicated specific lentivirus-mediated shRNAs into MCF-7 cells stably expressing Gal4-UAS reporter (MCF-7-Gal4-Luc cells). Gal4 luciferase reporter activity was measured. (B) LSD1 and SIN3A were mutually required for chromatin binding. Chromatin-bound fractions were prepared from MCF-7 cells and analysed by IB with the indicated antibodies. Histone H3 served as a loading control. (C) Clones with LSD1 or SIN3A knockdown were compared with the parental cell line for mRNA (left panel) and protein (right panel) levels of the indicated six co-regulated genes in MCF-7 cells. The mRNA levels were normalized to those of GADPH (left panel) and β-actin was served as a loading control for western blot analysis (right panel). (D and E) qChIP analysis of the recruitment of the indicated proteins (D) and histone modifications (E) on the indicated promoters in MCF-7 cells after infection with control lentivirus-mediated shRNA, or shRNAs targeting LSD1, SIN3A, or HDAC1. Results are represented as fold change over control with GAPDH as a negative control (D) or H3 ChIP as an internal control (E). (F) qChIP analysis of the recruitment of SIN3A or LSD1 on the indicated promoters in MCF-7 cells stably infected with LSD1 or SIN3A shRNA or stably expressing LSD1 or SIN3A. Results are represented as fold change over control with GAPDH as a negative control. (G) A graphic model as discussed in the text. In A, C–F, error bars represent mean ± SD of three independent experiments. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). To further verify the role of LSD1 or SIN3A in LSD1/SIN3A/HDAC complex-mediated transcriptional repression, we tested the effects of inhibiting LSD1 or SIN3A expression on selected representative genes that were previously identified as co-targets of LSD1 and the SIN3A/HDAC complex. For this purpose, we transfected MCF-7 cells with the selected highly efficient shRNA against LSD1 (#2) or SIND3A (#1) (referred to hereafter as shLSD1 and shSIN3A), or control shSCR (scrambled shRNA). RNA was isolated from these cells for real-time PCR analysis and the whole-cell lysates were used for western blot. As shown in Figure 4C, downregulation of either LSD1 or SIN3A leads to increased expression of p21, MDM2, Caspase7, TGFB2, TERT, and HIF1A at both mRNA and protein levels. This demonstrates that LSD1 and SIN3A activities are both required to maintain the repression of the co-target genes of the LSD1/SIN3A/HDAC complex in MCF-7 cells. Importantly, qChIP experiments indicated that depletion of LSD1, SIN3A, or HDAC1 not only caused marked reduction of the recruitment of the corresponding proteins at the target gene promoters but also resulted in the recruitment of the other factor of the LSD1/SIN3A/HDAC complex (Figure 4D), indicating that the integrity of the complex is important for its transcriptional repression function. Consistently, the levels of H3K4me1, H3K4me2, and pan-H3 acetylation (H3Ac) were markedly increased at all the tested target promoters upon knockdown of either LSD1 or SIN3A (Figure 4E), supporting the notion that catalytic activities of LSD1 and SIN3A/HDAC complex appear to be closely interdependent, at least in these representative verified target promoter regions. We also chose six genes regulated by SIN3A only and six genes regulated by LSD1 only (Figure 4F). qChIP experiments indicated that overexpression or knockdown of SIN3A did not affect LSD1 binding to the promoters of genes regulated by LSD1 only (Figure 4F, left panel) or SIN3A only (Figure 4F, right panel). The results showed that LSD1 and SIN3A regulate overlapping and distinct genes. The HDM and histone deacetylation (HDAC) catalytic activities are interdependent at the promoters of their co-target genes. We report in this study that LSD1 interacts with SIN3A/HDAC complex for epigenetic transcriptional silencing. Through physical interaction, LSD1 and SIN3A/HDAC/RbAp46/48 form a larger complex, which can coordinate in catalysing H3-K4 demethylation and H3 deacetylation at target genes such as CASP7, TGFB2, CDKN1A(p21), HIF1A, TERT, and MDM2 (Figure 4G). These results demonstrate the co-existence of LSD1 and SIN3A/HDAC complex on the same target gene promoters and the functional coordination between these chromatin modifiers. LSD1/SIN3A/HDAC complex is essential for breast cancer cell survival and epithelial maintenance Based on the analyses of repetitive target genes previously referred to, p21 and CASP7 are apoptosis-promoting genes, and MDM2 and TERT are oncogenes (Momand et al., 1992; Marcelli et al., 1998; Kang et al., 1999; Zhang et al., 2005). We therefore sought to investigate the possible role of the LSD1/SIN3A/HDAC complex in breast cancer proliferation. To this end, gain-/loss-of-function of LSD1 and/or SIN3A was first studied using growth curve assay (Figure 5A, the upper left two panels). Compared to the control, LSD1 and/or SIN3A overexpression showed little effect on cell growth rate, while knockdown of LSD1 or SIN3A resulted in a marked decrease in the number of living cells, and a more pronounced decrease in growth rate was observed with combined knockdown in MCF-7 cells. The results also showed that wild-type LSD1 or SIN3A protein could rescue the decreased cell viability caused by shLSD1 or shSIN3A, while the catalytic mutated proteins could not (Figure 5A, the upper right two panels). Similar results were found in human breast cancer T-47D, MDA-MB-231, and MDA-MB-468 cells (Figure 5A, lower panel). Using colony formation assays, we found that LSD1 or SIN3A overexpression showed little effect on colony numbers in comparison with the control, whereas LSD1 or SIN3A knockdown was associated with a significant decrease in colony numbers, and a more pronounced decrease of colony numbers was observed with combined knockdown in MCF-7 cells and MDA-MB-468 cells (Figure 5B). Furthermore, enhanced Brdu (EdU) incorporation assay showed that compared to the control, LSD1 or SIN3A depletion had no significant impact on cell proliferation rate (Figure 5C). However, in TUNEL assay, the depletion of LSD1 and/or SIN3A led to an increased apoptosis ratio (Figure 5D). Specifically, the apoptosis-promoting effect of LSD1 and SIN3A depletion was significantly blocked by the addition of TGFB2 or HIF1A-specific shRNA among the verified target genes, of which both TGFB2 and HIF1A are apoptosis-promoting genes (Figure 5D). These data indicate that LSD1 and SIN3A are important to breast cancer cell survival, due to their repression of a cohort of pro-apoptosis genes. Figure 5 View largeDownload slide LSD1 and SIN3A are required for epithelial homoeostasis. (A) LSD1 or SIN3A overexpression did not affect the growth rate of MCF-7 cells, while LSD1 or SIN3A depletion was positively correlated with cell growth rate. MCF-7, MDA-MB-231, MDA-MB-468, and T-47D cells stably expressing the indicated lentivirus-delivered constructs were subjected to growth curve analysis by counting the numbers of living cells. LSD1 res, shLSD1#2-resistant LSD1; SIN3A res, shSIN3A#1-resistant SIN3A; LSD1-mut res, shRNA-resistant LSD1 catalytic mutant; SIN3A-mut res, shRNA-resistant SIN3A-HID mutant. (B) LSD1 or SIN3A overexpression did not affect the colony-forming efficiency of MCF-7 and MDA-MB-468 cells, while LSD1 or SIN3A depletion was positively correlated with the colony-forming efficiency. MCF-7 and MDA-MB-468 cells stably expressing LSD1 and/or SIN3A or stably infected with LSD1 and/or SIN3A shRNA were maintained in culture media for 10 days prior to being stained with crystal violet. Representative photos and statistically analyses are shown. (C) LSD1 or SIN3A depletion did not affect cellular proliferation. EdU incorporation assays were performed using a fluorescence method. Representative photos and statistically analyses are shown. (D) MCF-7 cells were infected with indicated lentivirus-delivered shRNAs. TUNEL assays were performed with a fluorescence method. Representative photos and statistically analyses are shown. (E) The mRNA and protein expression levels of the indicated epithelial or mesenchymal markers and breast cancer stemness markers were measured by real-time RT-PCR (upper) and western blot (lower), respectively, in MCF-7 and MDA-MB-231 cells with LSD1/SIN3A depleted (left panels) or overexpression (right panels). (F) Analysis of the correlations between CD44 and LSD1/SIN3A in public datasets (GSE27562, 29044, 31192, and 36774). The relative level of CD44 was plotted against that of LSD1 or SIN3A, respectively. (G) Wound-healing assays showed the increased migration potential of LSD1 or SIN3A-depleted MDA-MB-231 and T-47D cells compared to the control scramble shRNA-infected group. (H) LSD1/SIN3A repressed the invasiveness of breast cancer cells. MDA-MB-231 cells infected with the indicated lentivirus were starved for 18 h before cell invasion assays were performed using Matrigel transwell filters. In A–E, G, and H, shLSD1#2 and shSIN3A#1 were used. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). Figure 5 View largeDownload slide LSD1 and SIN3A are required for epithelial homoeostasis. (A) LSD1 or SIN3A overexpression did not affect the growth rate of MCF-7 cells, while LSD1 or SIN3A depletion was positively correlated with cell growth rate. MCF-7, MDA-MB-231, MDA-MB-468, and T-47D cells stably expressing the indicated lentivirus-delivered constructs were subjected to growth curve analysis by counting the numbers of living cells. LSD1 res, shLSD1#2-resistant LSD1; SIN3A res, shSIN3A#1-resistant SIN3A; LSD1-mut res, shRNA-resistant LSD1 catalytic mutant; SIN3A-mut res, shRNA-resistant SIN3A-HID mutant. (B) LSD1 or SIN3A overexpression did not affect the colony-forming efficiency of MCF-7 and MDA-MB-468 cells, while LSD1 or SIN3A depletion was positively correlated with the colony-forming efficiency. MCF-7 and MDA-MB-468 cells stably expressing LSD1 and/or SIN3A or stably infected with LSD1 and/or SIN3A shRNA were maintained in culture media for 10 days prior to being stained with crystal violet. Representative photos and statistically analyses are shown. (C) LSD1 or SIN3A depletion did not affect cellular proliferation. EdU incorporation assays were performed using a fluorescence method. Representative photos and statistically analyses are shown. (D) MCF-7 cells were infected with indicated lentivirus-delivered shRNAs. TUNEL assays were performed with a fluorescence method. Representative photos and statistically analyses are shown. (E) The mRNA and protein expression levels of the indicated epithelial or mesenchymal markers and breast cancer stemness markers were measured by real-time RT-PCR (upper) and western blot (lower), respectively, in MCF-7 and MDA-MB-231 cells with LSD1/SIN3A depleted (left panels) or overexpression (right panels). (F) Analysis of the correlations between CD44 and LSD1/SIN3A in public datasets (GSE27562, 29044, 31192, and 36774). The relative level of CD44 was plotted against that of LSD1 or SIN3A, respectively. (G) Wound-healing assays showed the increased migration potential of LSD1 or SIN3A-depleted MDA-MB-231 and T-47D cells compared to the control scramble shRNA-infected group. (H) LSD1/SIN3A repressed the invasiveness of breast cancer cells. MDA-MB-231 cells infected with the indicated lentivirus were starved for 18 h before cell invasion assays were performed using Matrigel transwell filters. In A–E, G, and H, shLSD1#2 and shSIN3A#1 were used. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). Since TGFB2, CUL4A, and HIF1A are key regulators governing the epithelial-to-mesenchymal transition (EMT) (Yang et al., 2008; Shin et al., 2011; Wang et al., 2014), we next sought to determine whether or not LSD1 and SIN3A play a role in EMT and tumour metastasis. We first detected the expression level of some invasion markers of EMT under the influence of loss-of-function of LSD1/SIN3A in MCF-7 and MDA-MB-231 cells. qPCR analysis showed that the expression of the epithelial markers (E-cadherin and γ-catenin) expression decreased remarkable, while the mesenchymal markers (N-cadherin and Vimentin) expression increased significantly. We next detected these EMT markers under the influence of gain-of-function of LSD1/SIN3A in MCF-7 and MDA-MB-231 cells. qPCR analysis revealed opposite results (Figure 5E, upper panel), indicating that LSD1/SIN3A are required to maintain epithelial properties. Moreover, the increase of CD44 and the decrease of CD24 are known changes in responding to EMT induced cancer stemness (Wright et al., 2008). Western blots showed that both E-cadherin and CD24 were positively correlated, while both Vimentin and CD44 were negatively correlated with LSD1 or SIN3A expression levels (Figure 5E, lower panel). A significant negative correlation between the breast cancer stem cell marker CD44 and LSD1/SIN3A existed in four published breast cancer clinical datasets (Figure 5F), further supporting our notion that the LSD1/SIN3A/HDAC complex is essential for epithelial homoeostasis and cancer stemness inhibition. Next, we investigated whether LSD1/SIN3A has a coordinated role in tumour migration and invasion. For this purpose, LSD1/SIN3A was depleted in MDA-MB-231 cells via a lentivirus-mediated stable infection. The impact of loss-of-function of LSD1/SIN3A on the migrating and invasive potential of these cells was assessed using wound-healing assays (Figure 5G) and transwell invasion assays (Figure 5H). In wound-healing assays, compared to the control, the amount of open distance remaining after 12 or 24 h of migration differed: either LSD1 or SIN3A knockdown was associated with an increased migration rate in MDA-MB-231 (Figure 5G, upper panel) and T-47D cells (Figure 5G, lower panel). Furthermore, transwell invasion assay results showed a significant increase in the invasiveness associated with LSD1 and/or SIN3A depletion, which could be restored by combining with TGFB2 or HIF1A depletion (Figure 5H). Collectively, these results indicate that both LSD1 and SIN3A are essential for breast cancer cell growth, invasion inhibition, maintenance of epithelial morphology, and cancer stemness inhibition, possibly by acting in conjunction with the LSD1/SIN3A/HDAC complex and by repressing the expression of a cohort of target genes such as TGFB2 or HIF1A. The LSD1/SIN3A/HDAC complex is essential for breast cancer cell sensitivity to chemotherapy Besides the increased invasion and metastasis potential, breast cancer stem cells are also considered to gain the ability against chemotherapy (Pavlopoulou et al., 2016). We were surprised to find that although LSD1-depleted MCF-7 cells grew slower, they showed higher survival rate, compared to the control, after treatment with chemotherapy drugs such as camptothecin (CPT) for 24 h at the concentration of 100, 300, and 500 nM, indicating that LSD1-depleted MCF-7 cells may partially lose sensitivity to chemotherapy (Figure 6A). Since it has been reported that CPT-induced apoptosis is p53-dependent, and p21, MDM2, CASP7, and TGFB2 are known target genes of p53, we measured whether or not these four target genes respond to CPT treatment at both mRNA and protein levels. Our results showed that all the four tested genes responded well to 300 nM CPT exposure for 24 h (Figure 6B and C). In addition, p53 significantly accumulated, while LSD1 or SIN3A showed little change after CPT treatment (Figure 6C). Compared to the control (Figure 6D, left panel, the third and fourth lanes), LSD1-depleted cells showed little induction of p21 and TGFβ2 protein after CPT treatment (Figure 6D, left panel, the first and second lanes). The western blot results were further semi-quantified by grayscale scanning and normalized to each loading control. It is clear to see that the pro-apoptosis genes such as p21 and TGFβ2 showed greater protein increase in control MCF-7 cells than in LSD1-depleted cells, indicating that the LSD1-depleted cells lost sensitivity to CPT (Figure 6D, right panel). In addition to CPT (the topoisomerase I inhibitor), three other clinical chemotherapeutic agents, doxorubicin (the topoisomerase II inhibitor), paclitaxel (the mitotic inhibitors), and carboplatin (the DNA intrastrand cross-linkers), were also analysed for cell viability assay (Figure 6E). The results showed that stable LSD1-depleted MCF-7 cells exhibited higher survival rate compared to the control after treatment with doxorubicin and paclitaxel, but not with carboplatin. These results indicated that the LSD1/SIN3A complex maintains sensitivity to some of the commonly used clinical chemotherapeutic drugs for breast cancer. Figure 6 View largeDownload slide The LSD1/SIN3A/HDAC complex is essential for breast cancer cell sensitivity to chemotherapy. (A) LSD1-depleted MCF-7 and control cells were treated in the presence or absence of CPT at different concentrations. Cell viability assays were performed 24 h later using a luminescent method. Error bars represent mean ± SD of three independent experiments. (B and C) Verifying the induction of LSD1/SIN3A target genes upon CPT treatment with respect to the mRNA (B) and protein (C) levels in MCF-7 cells. (D) The selected target genes p21 and TGFB2, which respond to CPT treatment, did not show obvious differences in the LSD1-depleted cells. Western blots (left panel) and statistical analysis by grey scale scanning (right panel) are shown. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). (E) LSD1-depleted MCF-7 and control cells were treated in the presence or absence of Doxorubicin, Paclitaxel, or Carboplatin at the indicated concentrations. Cell viability assays were performed 24 h later using a luminescent method. Error bars represent mean ± SD of three independent experiments. (F and G) qChIP analysis of the protein recruitment (F) and histone modifications (G) onto p21, CASP7, TGFB2, and MDM2 promoters in MCF-7 cells stably infected with lentivirus-shSCR, shLSD1, or shSIN3A upon CPT treatment. Histion H3 ChIP was used as an internal control. (H) MCF-7 cells were treated with 2 μM CPT for 4 h (left panels) or 10 Gy X-rays for 1 h (right panels) to induce DNA damage. Whole-cell lysates were immunoprecipitated (IP) with antibodies against the indicated proteins. Immunocomplexes were then immunoblotted (IB) using antibodies against the indicated proteins. γ-H2AX was used as the DNA damage marker, and H2AX and β-actin served as loading controls. In A, B, D–G, error bars represent mean ± SD of three independent experiments. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). Figure 6 View largeDownload slide The LSD1/SIN3A/HDAC complex is essential for breast cancer cell sensitivity to chemotherapy. (A) LSD1-depleted MCF-7 and control cells were treated in the presence or absence of CPT at different concentrations. Cell viability assays were performed 24 h later using a luminescent method. Error bars represent mean ± SD of three independent experiments. (B and C) Verifying the induction of LSD1/SIN3A target genes upon CPT treatment with respect to the mRNA (B) and protein (C) levels in MCF-7 cells. (D) The selected target genes p21 and TGFB2, which respond to CPT treatment, did not show obvious differences in the LSD1-depleted cells. Western blots (left panel) and statistical analysis by grey scale scanning (right panel) are shown. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). (E) LSD1-depleted MCF-7 and control cells were treated in the presence or absence of Doxorubicin, Paclitaxel, or Carboplatin at the indicated concentrations. Cell viability assays were performed 24 h later using a luminescent method. Error bars represent mean ± SD of three independent experiments. (F and G) qChIP analysis of the protein recruitment (F) and histone modifications (G) onto p21, CASP7, TGFB2, and MDM2 promoters in MCF-7 cells stably infected with lentivirus-shSCR, shLSD1, or shSIN3A upon CPT treatment. Histion H3 ChIP was used as an internal control. (H) MCF-7 cells were treated with 2 μM CPT for 4 h (left panels) or 10 Gy X-rays for 1 h (right panels) to induce DNA damage. Whole-cell lysates were immunoprecipitated (IP) with antibodies against the indicated proteins. Immunocomplexes were then immunoblotted (IB) using antibodies against the indicated proteins. γ-H2AX was used as the DNA damage marker, and H2AX and β-actin served as loading controls. In A, B, D–G, error bars represent mean ± SD of three independent experiments. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). We further analysed the binding abundance of epigenetic regulators including transcription factor p53, the coactivator p300 (known p53-recruiting histone acetyltransferase) (Lill et al., 1997), and corepressors LSD1 and SIN3A on the target promoters upon CPT treatment. ChIP results showed that, in control shSCR-infected MCF-7 cells, the recruitments of p53 and p300 to the four representative target promoters were significantly increased upon CPT treatment, while LSD1 and SIN3A decreased remarkably, supporting an epigenetic regulatory mechanism: the transcription factor-directed corepressors and coactivators quickly exchange (Figure 6F, upper panel). However, in shLSD1 and shSIN3A lentivirus-infected MCF-7 cells, the recruitments of p53 and p300 to the four representative target promoters were only lightly increased after adding CPT, while LSD1 and SIN3A to the four representative target promoters had no significant change (Figure 6F, middle and lower panels). In addition, compared to the DMSO groups, the epigenetic modifications, including the transcriptional activation markers H3K4me1/2 and H3Ac, on the four representative target promoters were also significantly increased with CPT added in shSCR MCF-7 cells (Figure 6G, upper panel), but only lightly increased in shLSD1 MCF-7 and shSIN3A MCF-7 cells (Figure 6G, middle and lower panels). Finally, we sought to know whether the interaction of LSD1 and SIN3A was regulated by DNA damage. MCF-7 cells were treated with 2 μM CPT (Figure 6H, left panel) or irradiated with 10 Gy X-rays (Figure 6H, right panel) to induce DNA damage. Co-IP experiments with antibodies detecting the endogenous proteins showed that the interaction between LSD1 and SIN3A was not regulated by DNA damage. These results suggest that LSD1 and SIN3A are necessary for the integrity of transcription factor-directed corepressor and coactivator exchange machinery that is essential for tumour cells to maintain their sensitivity to the small chemical compounds used in chemotherapy. Through analysis of data sourced from published clinical datasets such as GSE35428 (Figure 7A) and GSE36774 (Figure 7B), we have found that both LSD1 and SIN3A were statistically positively correlated with p53 and negatively correlated with representative key target genes including p21, MDM2, and TGFB2 (Figure 7A and B). Kaplan–Meier survival analysis showed that higher expression of LSD1/SIN3A/p53 was associated with improved overall survival in breast cancer patients, while high expression of TGFB2, CUL4A, and CD44 was associated with poor prognosis (Figure 7C). Taken together, these data support a role for LSD1 coordinated with the SIN3A/HDAC complex in repressing tumorigenesis and retaining sensitivity to chemotherapy through maintenance of the epigenetic exchange of corepressor and coactivator complexes. This suggests that LSD1 and SIN3A could serve as novel biomarkers for cancer diagnosis and potential targets for cancer therapy. Figure 7 View largeDownload slide Clinicopathological significance of LSD1/SIN3A in breast cancer. (A and B) Analysis of the correlations between LSD1/SIN3A and p53, p21, TGFB2, and MDM2 in public datasets GSE35428 (A) and GSE36774 (B). The relative level of p53, p21, TGFB2, and MDM2 was plotted against that of LSD1 or SIN3A. (C) Kaplan–Meier survival analysis for the relationship between survival time and LSD1, SIN3A, p53, TGFB2, CUL4A, and CD44 signature in breast cancer using an online tool (http://kmplot.com/analysis/). Figure 7 View largeDownload slide Clinicopathological significance of LSD1/SIN3A in breast cancer. (A and B) Analysis of the correlations between LSD1/SIN3A and p53, p21, TGFB2, and MDM2 in public datasets GSE35428 (A) and GSE36774 (B). The relative level of p53, p21, TGFB2, and MDM2 was plotted against that of LSD1 or SIN3A. (C) Kaplan–Meier survival analysis for the relationship between survival time and LSD1, SIN3A, p53, TGFB2, CUL4A, and CD44 signature in breast cancer using an online tool (http://kmplot.com/analysis/). Discussion Both LSD1 and the SIN3A/HDAC complex primarily function in transcription repression programmes by virtue of their enzymatic activities and through their chromatin remodelling capabilities. Specifically, LSD1 targets H3-K4 for demethylation, and the SIN3A/HDAC complex possesses HDAC activity. As both demethylation and deacetylation are essential epigenetic mechanisms in controlling gene transcription, interplay between deacetylation and demethylation is a logical scenario. Indeed, past studies have indicated that HDAC and demethylation are interdependent and LSD1 is involved in several HDAC complexes including CoREST/HDAC complex, CtBP/HDAC complex, the NuRD complex as well as binding to histone deacethylase HDAC5 and SIRT1 (Denslow and Wade, 2007; Lee et al., 2006; Shi et al., 2005). We propose that LSD1 is an integral component of the SIN3A/HDAC complex, placing deacetylase and demethylase activities into the same protein complex. The question, then, is what is the biological significance of having all of these enzymatic activities in one single assembly? As stated above, these enzymatic activities are part of the whole pact of epigenetic actions that are necessary to bring a gene to a silenced state. Therefore, it is conceivable that evolution favours a physical proximity for more efficient functional interaction of distinct enzymatic activities. Such a stoichiometry would be a benefit for an exquisite coordination of distinct chromatin remodelling activities in finely tuned gene regulation. In fact, in addition to these chromatin modification capacities, the SIN3A complex also interacts with MeCP2, a protein that is connected to DNA methylation, another epigenetic mechanism in gene regulation. It is not expected that the SIN3A complex contains all types of epigenetic modifiers, but it would not be surprising if future investigations uncover additional enzymatic activities that are associated with this complex, especially considering the dynamic nature of the assembly and functioning of this complex. In addition, as H3-K4 methylation encodes for a well-recognized epigenetic message signalling gene activation, it is logical to imagine that the repression function of the SIN3A/HDAC complex contains an enzymatic activity to erase this mark. Moreover, it is believed that at least one of the mechanistic manifestations for functional specificity of different forms of the SIN3A complex is to be recruited by different transcription factors. To date, the SIN3A complex has been shown to mediate transcription repression by distinct sequence-specific transcription factors including REST, p53, Ikaros, TAL1, MMSET, and YY1 (Huang and Brandt, 2000; Dannenberg et al., 2005; Marango et al., 2008; Harris et al., 2016). Interestingly, at least some of these transcription factors, such as REST, p53, Ikaros, TAL1, and MMSET, also recruit LSD1 (Lan et al., 2008; Marango et al., 2008; Hu et al., 2009), again favouring a model in which LSD1 and the SIN3A complex act together. More importantly, the evidence clearly points to a convergent role of LSD1 and the SIN3A/HDAC complex in cell fate determination and differentiation (Nascimento et al., 2011; Whyte et al., 2012). This supports the hypothesis of a physical association and thus a functional connection between LSD1 and the SIN3A complex. It is conceivable that LSD1, through incorporation into the SIN3A/HDAC complex, is recruited by distinct pathway-specific transcription factors to exert its pathway-specific functions. LSD1 has been implicated in cellular growth pathways and it has been linked with several types of cancer (Kahl et al., 2006; Wang et al., 2007a). ChIP-on-chip analyses revealed that the LSD1/SIN3A complex targets the promoters of an array of genes that constitute several important cellular signalling pathways pertinent to cell growth, survival, proliferation, and apoptosis. We provide proof that the LSD1/SIN3A/HDAC complex is essential for cell survival because it transcriptionally represses a series of pro-apoptotic genes such as p21, CASP7, HIF1A, and TGFB2. This is underscored by the observation that LSD1 or Sin3a ablation causes embryonic lethality in mice (Wang et al., 2007b). On the other hand, we have demonstrated that the LSD1/SIN3A/HDAC complex plays important roles in maintaining epithelial portraits and inhibiting the EMT-induced cancer stemness by directly transcriptionally repressing a cohort of EMT promoting genes, such as TERT, CUL4A, TGFB2, MDM2, RHOA, and HIF1A, and indirectly suppressing key EMT markers including N-cadherin and Vimentin, as well as the breast stem cell marker CD44. Our results indicated that LSD1 and SIN3A are important for breast cancer cell survival, due to their repression of apoptosis, but not due to the induction of cell growth (Figure 5A−D). This is also conceivable and logical that the metastatic cells are often paused in G0 phase of the cell cycle. So, proliferation and migration/invasion are not always positive correlated. As pro-apoptosis are such hallmarks events in cancer chemotherapy, the connection of the LSD1/SIN3A/HDAC complex with these cellular behaviours emphasizes the importance of LSD1 and SIN3A in normal physiology and pathobiology. In addition, as important as the activated tumour suppressor p53 mediated exchange of coactivators and corepressors, it is logical to believe that only well-coordinated and sophisticated molecular machinery would make this possible. The association of LSD1 with the SIN3A/HDAC complex in a resting state and the co-depletion from the p21 and TGFB2 promoters upon CPT treatment may provide a clue about the role of LSD1 and SIN3A in this sophisticated coordination. Our results showed that lentivirus-shLSD1 caused resistance of MCF-7 to chemotherapeutic agents such as CPT, doxorubicin, and paclitaxel (Figure 6A and E). Thus, using LSD1 inhibitors to treat breast cancer may inhibit tumour cell growth at first, for LSD1 is essential for cell viability and growth. But the survived cells may gain higher migration/invasive potentials. Therefore, clinical use of LSD1 inhibitors to treat breast cancer should be more cautious. It is reasonable to believe that the aforementioned cell fate determination and differentiation functions of LSD1 and the SIN3A/HDAC complex are due at least in part to the concerted networking of different forms of the LSD1/SIN3A/HDAC complex in response to different signalling pathways or environment stimulations. These functions represent the cellular readouts of the coordinated molecular actions of these complexes in normal development and in breast cancer chemotherapy. The functional association of LSD1 with the SIN3A complex in normal development and physiology remains to be investigated. We also identified Alzheimer’s disease-related genes, such as PSEN1 and BDNF, as the co-targets of LSD1 and SIN3A (Avila-Gomez et al., 2008; Zhao et al., 2017). Futurework will focus on exploring the mechanism by which the coordinated actions of the LSD1/SIN3A complex are achieved in neuronal plasticity and pathology. Interestingly, our experiments identified PRMT5 and hnRNPK as associated partners of the LSD1/SIN3A/HDAC complex. The significance of this association needs further investigation. Notably, ChIP-on-chip identified SAP30 and HDAC2 as common targets of the LSD1/SIN3A complex. Whether feedback regulatory loops exist for the LSD1/SIN3A complex remains to be determined. Nevertheless, if our interpretation is correct, our experiments indicate that LSD1 is a functional subunit of the SIN3A/HDAC complex, expanding the enzymatic repertoire of the SIN3A complex in epigenetic regulation and providing a molecular basis for the interdependence of HDAC and demethylation in chromatin remodelling. We have shown that LSD1/SIN3A represses the transcription of a number of important cellular regulators coordinately and LSD1 is necessary for optimal SIN3A transcriptional repression activity. We have demonstrated that integrity of the LSD1/SIN3A/HDAC complex is required in CPT-mediated breast cancer cell chemosensitivity. These findings may shed new light on the mechanistic understanding and pharmaceutical development of breast cancer therapy. Materials and methods Antibodies and reagents The sources of the antibodies used were as follows: anti-FLAG, anti-LSD1, anti-HDAC1, anti-HDAC2, anti-TGFβ2, and anti-RbAps (Sigma); anti-SIN3A (Santa cruz); anti-SAP180, anti-SAP130, anti-SAP45, anti-SAP30, and anti-SAP18 (Bethyl); anti-H3, anti-MDM2, anti-TERT, and anti-dimethyl H3-K9 (Abcam); anti-acetyl H3, anti-dimethyl H3-K4, and anti-monomethyl H3-K4 (Millpore). Anti-p21, anti-Caspase7, and anti-HIF1α (Cell Signaling Technology). Dynabeads Protein G was from Invitrogen by Thermo Fisher Scientific and the protease inhibitor mixture cocktail was from Roche Applied Science. Glutathione SepharoseTM 4B beads were purchased from GE Healthcare. Camptothecin, Doxorubicin, Paclitaxel, and Carboplatin were purchased from Sigma. Bulk histones were purchased from Sigma (H9250). Cloning pCMV-Tag2B-Flag-SIN3A was made by subcloning a PCR-amplified SIN3A fragment using MCF-7 cDNA as a template in frame into the pCMV-Tag2B vector. LSD1 and SIN3A fragments were cloned by PCR into the pGEX4T3 plasmid (Clotech) for bacterial expression. Plasmids of the subunits of the SIN3A/HDAC complex including SAP130, SAP45, SAP30, and SAP18 were made in the same way. Immunopurification and mass spectrometry Lysates from MCF-7 cells expressing FLAG-SIN3A were applied to an equilibrated FLAG column. The column was then washed and followed by elution with FLAG peptides (Sigma). Fractions of the bed volume were collected, resolved on SDS-PAGE, and silver stained. Gel bands then underwent LC-MS/MS sequencing and analysis. FPLC chromatography MCF-7 nuclear extracts were prepared and dialysed against buffer D (20 mM HEPES, pH 8.0, 10% glycerol, 0.1 mM EDTA, 300 mM NaCl) (Applygen Technologies). Approximately 6 mg of nuclear protein was concentrated to 1 ml using a Millipore Ultrafree centrifugal filter apparatus (10 kDa nominal molecular mass limit), and then applied to an 850 × 20 mm Superose 6 size exclusion column (Amersham Biosciences) that had been equilibrated with buffer D containing 1 mM dithiothreitol and calibrated with protein standards (blue dextran, 2000 kDa; thyroglobulin, 669 kDa; ferritin, 440 kDa; catalase, 232 kDa; bovine serum albumin, 67 kDa; and RNase A, 13.7 kDa; all from Amersham Biosciences). The column was eluted at a flow rate of 0.5 ml/min and fractions were collected. Immunoprecipitation For IP assays, 500 μg of cellular extracts were incubated with appropriate primary antibodies or normal rabbit/mouse immunoglobin G (IgG) on a rotator at 4°C overnight, followed by addition of Dynabeads Protein G for 2 h at 4°C. Beads were then washed four times with lysis buffer (50 mM Tris-Cl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.25% sodium deoxycholate and protease inhibitor mixture). The immune complexes were subjected to SDS-PAGE followed by IB with secondary antibodies. Immunodetection was performed using enhanced chemiluminescence (ECL System, Amersham Biosciences) according to the manufacturer’s instructions. Glutathione S-transferase pull-down Glutathione S-transferase (GST) fusion constructs were expressed in BL21 Escherichia coli cells, and crude bacterial lysates were prepared by sonication in TEDGN (50 mM Tris-HCl, pH 7.4, 1.5 mM EDTA, 1 mM dithiothreitol, 10% (v/v) glycerol, 0.4 M NaCl) in the presence of the protease inhibitor mixture. The in vitro transcription and translation experiments were performed with rabbit reticulocyte lysate (TNT Systems; Promega). In GST pull-down assays, ~10 μg of the appropriate GST fusion proteins were mixed with 5−8 μl of the in vitro transcribed/translated products and incubated in binding buffer (75 mM NaCl, 50 mM HEPES, pH 7.9) at room temperature for 30 min in the presence of the protease inhibitor mixture. The binding reaction was then added to 30 μl of Glutathione Sepharose 4B beads (GE Healthcare) and mixed at 4°C for 2 h. The beads were washed three times with binding buffer, resuspended in 30 μl of 2× SDS-PAGE loading buffer, and resolved on 10% gels. Protein bands were detected with specific antibodies by western blot. ChIP and Re-ChIP ChIPs were performed in MCF-7 cells as described previously (Zhang et al., 2004, 2006, 2007). Briefly, 5 × 107 cells were cross-linked with 1% formaldehyde, sonicated, pre-cleared, and incubated with 5–10 μg of antibody per reaction. Complexes were washed with low and high salt buffers, and the DNA was extracted and precipitated. For Re-ChIP assays, immune complexes were eluted from the beads with 20 mM dithiothreitol. Eluates were then diluted 30-fold with ChIP dilution buffer and subjected to a second IP reaction. The final elution step was performed using 1% SDS solution in Tris-EDTA buffer, pH 8.0. The enrichment of the DNA template was analysed by conventional PCR using primers specific for each target gene promoter. The primer sequences are listed in Supplementary Table S2. Real-time quantitative RT-PCR Total RNA was isolated from samples with Trizol reagents (Invitrogen). Any potential DNA contamination was removed by RNase-free DNase treatment (Promega). Relative quantitation was determined using the ABI PRISM 7500 sequence detection system (Applied Biosystems) that measures real-time SYBR green fluorescence and then calculated by means of the comparative Ct method (2−ΔΔCt) with the expression of GAPDH as an internal control. The primer sequences used are listed in Supplementary Table S3. Lentiviral production and infection Recombinant lentiviruses expressing shSCR, shLSD1, shSIN3A, shTGFB2, and shHIF1A were constructed by Shanghai GenePharma. Concentrated viruses were used to infect 5 × 105 cells in a 60-mm dish with 8 μg/ml polybrene. Infected cells were then subjected to sorting target expression. The shRNA sequences are listed in Supplementary Table S4. For shRNA-resistant LSD1 overexpression vector, the shLSD1#2 target site 1643–1661 bases were mutated (GGGATAGGCAGATCCTCGA). For shRNA-resistant SIN3A overexpression vector, the shSIN3A# target site 1526–1546 bases were mutated (GAAAGTTTCCCGAATTATTCA). For shRNA-resistant LSD1 catalytic mutant vector, the catalytic domain (525–666AA) was deleted. For shRNA-resistant SIN3A-HID domain mutant vector, the shSIN3A# target site 1526–1546 bases were mutated (GAAAGTTTCCCGAATTATTCA) and HID domain (525–900AA) was delated. Colony formation assay MCF-7 cells and MDA-MB-468 cells were seeded on a fresh 6-well plate at a density of 1000 cells/well and cultured in complete medium at 37°C under 5% CO2. After 10–14 days, cells were fixed in methanol and stained with 0.1% crystal violet. The number of colonies was counted manually. TUNEL assay MCF-7 cells infected with lentivirus-delivered shSCR, shLSD1, shSIN3A, shTGFB2, or shHIF1A were seeded onto 6-well plates for 48 h. Then cells were harvested and TUNEL assays were performed according to the manufacturer’s instructions (#TB235, Promega) with a fluorescence method. Positive and negative controls with the TUNEL assays were performed according to the instructions provided by the manufacturer. EdU incorporation assay MCF-7 cells infected with lentivirus-delivered shSCR, shLSD1, and/or shSIN3A were planted into 6-well dishes at a density of 1 × 105/ml and were allowed to adhere overnight. Then the cells were cultured with 5-ethyny-2′-deoxyuridine (EdU) for 2 h before detection. The proliferative rate of the cells was then evaluated using a Cell-Light™ EdU Cell Proliferation Detection kit (RiboBio) following the manufacturer’s instructions. In vitro wound-healing assay MDA-MB-231 breast cancer cells in a L-15 medium containing 10% FBS and T-47D cells in a DMEM medium containing 10% FBS were seeded into wells of 24-multiwell plates (Becton Dickinson). After the cells grew to confluence, wounds were made using sterile pipette tips. Cells were washed with PBS and refreshed with a medium without FBS. After 12 or 24 h (T-47D cells after 24 or 36 h) incubation at 37°C, the cells were photographed. Data shown are the means for n = 6 wells per group ± SD. Cell invasion assay Transwell chamber filters (Becton Dickinson) were coated with Matrigel. After infection with lentivirus, MDA-MB-231 cells were suspended in serum-free L-15 media and then 2 × 104 cells were seeded into the upper chamber in a volume of 500 μl. The chamber was then cultured in a well containing 500 μl of L-15 media with 10% foetal bovine serum at 37°C for 18 h. Cells on the upper side of the membrane were removed using cotton swabs and those on the other side were stained and counted. Four high-powered fields were counted for each membrane. Statistical analysis Results were reported as mean ± SD unless otherwise noted. Comparisons were performed using two-tailed paired t-test based on a bi-directional hypothesis for continuous variables. Acknowledgements Mammalian expression vectors encoding LSD1 are kind gifts from Dr Yang Shi (Harvard Medical School). Funding This work was supported by grants from the Major State Basic Research Development Program of China (2016YFA0102400 to Y.W.), the National Natural Science Foundation of China (81773017 and 81472733 to Y.W., 81402334 to Y.Y., and 81502446 to R.Q.), China Postdoctoral Science Foundation (2014M561192 and 2015T80224 to Y.Y.), the Tianjin Municipal Science and Technology Commission (15JCQNJC11900 to Y.Y.), and the Science & Technology Development Fund of Tianjin Education Commission for Higher Education (20140105 to R.Q.). Conflict of interest none declared. References Alland , L. , Muhle , R. , Hou , H. , Jr , et al. . ( 1997 ). Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression . Nature 387 , 49 – 55 . Google Scholar Crossref Search ADS PubMed Avila-Gomez , I.C. , Jimenez-Del-Rio , M. , Lopera-Restrepo , F. , et al. . ( 2008 ). Association between HFE 187 C G (H63D) mutation and early-onset familial Alzheimer’s disease PSEN-1 839A C (E280A) mutation . Ann. Hematol. 87 , 671 – 673 . Google Scholar Crossref Search ADS PubMed Cheng , X. , and Zhang , X. ( 2007 ). Structural dynamics of protein lysine methylation and demethylation . Mutat. Res. 618 , 102 – 115 . Google Scholar Crossref Search ADS PubMed Ciccone , D.N. , Su , H. , Hevi , S. , et al. . ( 2009 ). KDM1B is a histone H3K4 demethylase required to establish maternal genomic imprints . Nature 461 , 415 – 418 . Google Scholar Crossref Search ADS PubMed Cowley , S.M. , Iritani , B.M. , Mendrysa , S.M. , et al. . ( 2005 ). The mSin3A chromatin-modifying complex is essential for embryogenesis and T-cell development . Mol. Cell. Biol. 25 , 6990 – 7004 . Google Scholar Crossref Search ADS PubMed Dannenberg , J.H. , David , G. , Zhong , S. , et al. . ( 2005 ). mSin3A corepressor regulates diverse transcriptional networks governing normal and neoplastic growth and survival . Genes Dev. 19 , 1581 – 1595 . Google Scholar Crossref Search ADS PubMed Denslow , S.A. , and Wade , P.A. ( 2007 ). The human Mi-2/NuRD complex and gene regulation . Oncogene 26 , 5433 – 5438 . Google Scholar Crossref Search ADS PubMed Di Stefano , L. , Ji , J.Y. , Moon , N.S. , et al. . ( 2007 ). Mutation of Drosophila Lsd1 disrupts H3-K4 methylation, resulting in tissue-specific defects during development . Curr. Biol. 17 , 808 – 812 . Google Scholar Crossref Search ADS PubMed Ellison-Zelski , S.J. , and Alarid , E.T. ( 2010 ). Maximum growth and survival of estrogen receptor-α positive breast cancer cells requires the Sin3A transcriptional repressor . Mol. Cancer 9 , 263 . Google Scholar Crossref Search ADS PubMed Ellison-Zelski , S.J. , Solodin , N.M. , and Alarid , E.T. ( 2009 ). Repression of ESR1 through actions of estrogen receptor α and Sin3A at the proximal promoter . Mol. Cell. Biol. 29 , 4949 – 4958 . Google Scholar Crossref Search ADS PubMed Fang , R. , Barbera , A.J. , Xu , Y. , et al. . ( 2010 ). Human LSD2/KDM1b/AOF1 regulates gene transcription by modulating intragenic H3K4me2 methylation . Mol. Cell 39 , 222 – 233 . Google Scholar Crossref Search ADS PubMed Fleischer , T.C. , Yun , U.J. , and Ayer , D.E. ( 2003 ). Identification and characterization of three new components of the mSin3A corepressor complex . Mol. Cell. Biol. 23 , 3456 – 3467 . Google Scholar Crossref Search ADS PubMed Forneris , F. , Binda , C. , Battaglioli , E. , et al. . ( 2008 ). LSD1: oxidative chemistry for multifaceted functions in chromatin regulation . Trends Biochem. Sci. 33 , 181 – 189 . Google Scholar Crossref Search ADS PubMed Harris , L.G. , Wang , S.H. , Mani , S.K. , et al. . ( 2016 ). Evidence for a non-canonical role of HDAC5 in regulation of the cardiac Ncx1 and Bnp genes . Nucleic Acids Res. 44 , 3610 – 3617 . Google Scholar Crossref Search ADS PubMed Hassig , C.A. , Fleischer , T.C. , Billin , A.N. , et al. . ( 1997 ). Histone deacetylase activity is required for full transcriptional repression by mSin3A . Cell 89 , 341 – 347 . Google Scholar Crossref Search ADS PubMed Hu , X. , Li , X. , Valverde , K. , et al. . ( 2009 ). LSD1-mediated epigenetic modification is required for TAL1 function and hematopoiesis . Proc. Natl Acad. Sci. USA 106 , 10141 – 10146 . Google Scholar Crossref Search ADS Huang , S. , and Brandt , S.J. ( 2000 ). mSin3A regulates murine erythroleukemia cell differentiation through association with the TAL1 (or SCL) transcription factor . Mol. Cell. Biol. 20 , 2248 – 2259 . Google Scholar Crossref Search ADS PubMed Huang , Y. , Myers , S.J. , and Dingledine , R. ( 1999 ). Transcriptional repression by REST: recruitment of Sin3A and histone deacetylase to neuronal genes . Nat. Neurosci. 2 , 867 – 872 . Google Scholar Crossref Search ADS PubMed Huang , J. , Sengupta , R. , Espejo , A.B. , et al. . ( 2007 ). p53 is regulated by the lysine demethylase LSD1 . Nature 449 , 105 – 108 . Google Scholar Crossref Search ADS PubMed Jenuwein , T. , and Allis , C.D. ( 2001 ). Translating the histone code . Science 293 , 1074 – 1080 . Google Scholar Crossref Search ADS PubMed Kahl , P. , Gullotti , L. , Heukamp , L.C. , et al. . ( 2006 ). Androgen receptor coactivators lysine-specific histone demethylase 1 and four and a half LIM domain protein 2 predict risk of prostate cancer recurrence . Cancer Res. 66 , 11341 – 11347 . Google Scholar Crossref Search ADS PubMed Kang , K.H. , Kim , W.H. , and Choi , K.H. ( 1999 ). p21 promotes ceramide-induced apoptosis and antagonizes the antideath effect of Bcl-2 in human hepatocarcinoma cells . Exp. Cell Res. 253 , 403 – 412 . Google Scholar Crossref Search ADS PubMed Laherty , C.D. , Yang , W.M. , Sun , J.M. , et al. . ( 1997 ). Histone deacetylases associated with the mSin3 corepressor mediate mad transcriptional repression . Cell 89 , 349 – 356 . Google Scholar Crossref Search ADS PubMed Lan , F. , Nottke , A.C. , and Shi , Y. ( 2008 ). Mechanisms involved in the regulation of histone lysine demethylases . Curr. Opin. Cell Biol. 20 , 316 – 25 . Google Scholar Crossref Search ADS PubMed Le May , N. , Mansuroglu , Z. , Leger , P. , et al. . ( 2008 ). A SAP30 complex inhibits IFN-β expression in Rift Valley fever virus infected cells . PLoS Pathog. 4 , e13 . Google Scholar Crossref Search ADS PubMed Lee , M.G. , Wynder , C. , Bochar , D.A. , et al. . ( 2006 ). Functional interplay between histone demethylase and deacetylase enzymes . Mol. Cell. Biol. 26 , 6395 – 6402 . Google Scholar Crossref Search ADS PubMed Liang , J. , Wan , M. , Zhang , Y. , et al. . ( 2008 ). Nanog and Oct4 associate with unique transcriptional repression complexes in embryonic stem cells . Nat. Cell Biol. 10 , 731 – 739 . Google Scholar Crossref Search ADS PubMed Lill , N.L. , Grossman , S.R. , Ginsberg , D. , et al. . ( 1997 ). Binding and modulation of p53 by p300/CBP coactivators . Nature 387 , 823 – 827 . Google Scholar Crossref Search ADS PubMed Lu , P. , Hankel , I.L. , Hostager , B.S. , et al. . ( 2011 ). The developmental regulator protein Gon4l associates with protein YY1, co-repressor Sin3a, and histone deacetylase 1 and mediates transcriptional repression . J. Biol. Chem. 286 , 18311 – 18319 . Google Scholar Crossref Search ADS PubMed Marango , J. , Shimoyama , M. , Nishio , H. , et al. . ( 2008 ). The MMSET protein is a histone methyltransferase with characteristics of a transcriptional corepressor . Blood 111 , 3145 – 3154 . Google Scholar Crossref Search ADS PubMed Marcelli , M. , Cunningham , G.R. , Haidacher , S.J. , et al. . ( 1998 ). Caspase-7 is activated during lovastatin-induced apoptosis of the prostate cancer cell line LNCaP . Cancer Res. 58 , 76 – 83 . Google Scholar PubMed McDonel , P. , Demmers , J. , Tan , D.W. , et al. . ( 2012 ). Sin3a is essential for the genome integrity and viability of pluripotent cells . Dev. Biol. 363 , 62 – 73 . Google Scholar Crossref Search ADS PubMed Meehan , W.J. , Samant , R.S. , Hopper , J.E. , et al. . ( 2004 ). Breast cancer metastasis suppressor 1 (BRMS1) forms complexes with retinoblastoma-binding protein 1 (RBP1) and the mSin3 histone deacetylase complex and represses transcription . J. Biol. Chem. 279 , 1562 – 1569 . Google Scholar Crossref Search ADS PubMed Metzger , E. , Wissmann , M. , Yin , N. , et al. . ( 2005 ). LSD1 demethylates repressive histone marks to promote androgen-receptor-dependent transcription . Nature 437 , 436 – 439 . Google Scholar Crossref Search ADS PubMed Momand , J. , Zambetti , G.P. , Olson , D.C. , et al. . ( 1992 ). The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation . Cell 69 , 1237 – 1245 . Google Scholar Crossref Search ADS PubMed Murphy , M. , Ahn , J. , Walker , K.K. , et al. . ( 1999 ). Transcriptional repression by wild-type p53 utilizes histone deacetylases, mediated by interaction with mSin3a . Genes Dev. 13 , 2490 – 2501 . Google Scholar Crossref Search ADS PubMed Nascimento , E.M. , Cox , C.L. , MacArthur , S. , et al. . ( 2011 ). The opposing transcriptional functions of Sin3a and c-Myc are required to maintain tissue homeostasis . Nat. Cell Biol. 13 , 1395 – 1405 . Google Scholar Crossref Search ADS PubMed Pavlopoulou , A. , Oktay , Y. , Vougas , K. , et al. . ( 2016 ). Determinants of resistance to chemotherapy and ionizing radiation in breast cancer stem cells . Cancer Lett. 380 , 485 – 493 . Google Scholar Crossref Search ADS PubMed Pellegrino , J. , Castrillon , D.H. , and David , G. ( 2012 ). Chromatin associated Sin3A is essential for male germ cell lineage in the mouse . Dev. Biol. 369 , 349 – 355 . Google Scholar Crossref Search ADS PubMed Perillo , B. , Ombra , M.N. , Bertoni , A. , et al. . ( 2008 ). DNA oxidation as triggered by H3K9me2 demethylation drives estrogen-induced gene expression . Science 319 , 202 – 206 . Google Scholar Crossref Search ADS PubMed Rampalli , S. , Pavithra , L. , Bhatt , A. , et al. . ( 2005 ). Tumor suppressor SMAR1 mediates cyclin D1 repression by recruitment of the SIN3/histone deacetylase 1 complex . Mol. Cell. Biol. 25 , 8415 – 8429 . Google Scholar Crossref Search ADS PubMed Rao , G. , Alland , L. , Guida , P. , et al. . ( 1996 ). Mouse Sin3A interacts with and can functionally substitute for the amino-terminal repression of the Myc antagonist Mxi1 . Oncogene 12 , 1165 – 1172 . Google Scholar PubMed Scoumanne , A. , and Chen , X. ( 2007 ). The lysine-specific demethylase 1 is required for cell proliferation in both p53-dependent and -independent manners . J. Biol. Chem. 282 , 15471 – 15475 . Google Scholar Crossref Search ADS PubMed Shi , Y. ( 2007 ). Histone lysine demethylases: emerging roles in development, physiology and disease . Nat. Rev. Genet. 8 , 829 – 833 . Google Scholar Crossref Search ADS PubMed Shi , Y. , Lan , F. , Matson , C. , et al. . ( 2004 ). Histone demethylation mediated by the nuclear amine oxidase homolog LSD1 . Cell 119 , 941 – 953 . Google Scholar Crossref Search ADS PubMed Shi , Y.J. , Matson , C. , Lan , F. , et al. . ( 2005 ). Regulation of LSD1 histone demethylase activity by its associated factors . Mol. Cell 19 , 857 – 864 . Google Scholar Crossref Search ADS PubMed Shi , Y. , and Whetstine , J.R. ( 2007 ). Dynamic regulation of histone lysine methylation by demethylases . Mol. Cell 25 , 1 – 14 . Google Scholar Crossref Search ADS PubMed Shiio , Y. , Rose , D.W. , Aur , R. , et al. . ( 2006 ). Identification and characterization of SAP25, a novel component of the mSin3 corepressor complex . Mol. Cell. Biol. 26 , 1386 – 1397 . Google Scholar Crossref Search ADS PubMed Shin , J.A. , Hong , O.K. , Lee , H.J. , et al. . ( 2011 ). Transforming growth factor-β induces epithelial to mesenchymal transition and suppresses the proliferation and transdifferentiation of cultured human pancreatic duct cells . J. Cell. Biochem. 112 , 179 – 188 . Google Scholar Crossref Search ADS PubMed Silverstein , R.A. , and Ekwall , K. ( 2005 ). Sin3: a flexible regulator of global gene expression and genome stability . Curr. Genet. 47 , 1 – 17 . Google Scholar Crossref Search ADS PubMed Sjoblom-Hallen , A. , Yang , W. , Jansson , A. , et al. . ( 1999 ). Silencing of the Epstein–Barr virus latent membrane protein 1 gene by the Max-Mad1-mSin3A modulator of chromatin structure . J. Virol. 73 , 2983 – 2993 . Google Scholar PubMed Skowyra , D. , Zeremski , M. , Neznanov , N. , et al. . ( 2001 ). Differential association of products of alternative transcripts of the candidate tumor suppressor ING1 with the mSin3/HDAC1 transcriptional corepressor complex . J. Biol. Chem. 276 , 8734 – 8739 . Google Scholar Crossref Search ADS PubMed Suzuki , H. , Ouchida , M. , Yamamoto , H. , et al. . ( 2008 ). Decreased expression of the SIN3A gene, a candidate tumor suppressor located at the prevalent allelic loss region 15q23 in non-small cell lung cancer . Lung Cancer 59 , 24 – 31 . Google Scholar Crossref Search ADS PubMed van Oevelen , C. , Bowman , C. , Pellegrino , J. , et al. . ( 2010 ). The mammalian Sin3 proteins are required for muscle development and sarcomere specification . Mol. Cell. Biol. 30 , 5686 – 5697 . Google Scholar Crossref Search ADS PubMed Wang , G.G. , Allis , C.D. , and Chi , P. ( 2007 a). Chromatin remodeling and cancer, part I: covalent histone modifications . Trends Mol. Med. 13 , 363 – 372 . Google Scholar Crossref Search ADS PubMed Wang , J. , Hevi , S. , Kurash , J.K. , et al. . ( 2009 a). The lysine demethylase LSD1 (KDM1) is required for maintenance of global DNA methylation . Nat. Genet. 41 , 125 – 129 . Google Scholar Crossref Search ADS PubMed Wang , J. , Scully , K. , Zhu , X. , et al. . ( 2007 b). Opposing LSD1 complexes function in developmental gene activation and repression programmes . Nature 446 , 882 – 887 . Google Scholar Crossref Search ADS PubMed Wang , Y. , Wen , M. , Kwon , Y. , et al. . ( 2014 ). CUL4A induces epithelial–mesenchymal transition and promotes cancer metastasis by regulating ZEB1 expression . Cancer Res. 74 , 520 – 531 . Google Scholar Crossref Search ADS PubMed Wang , Y. , Zhang , H. , Chen , Y. , et al. . ( 2009 b). LSD1 is a subunit of the NuRD complex and targets the metastasis programs in breast cancer . Cell 138 , 660 – 672 . Google Scholar Crossref Search ADS PubMed Whyte , W.A. , Bilodeau , S. , Orlando , D.A. , et al. . ( 2012 ). Enhancer decommissioning by LSD1 during embryonic stem cell differentiation . Nature 482 , 221 – 225 . Google Scholar Crossref Search ADS PubMed Wissmann , M. , Yin , N. , Muller , J.M. , et al. . ( 2007 ). Cooperative demethylation by JMJD2C and LSD1 promotes androgen receptor-dependent gene expression . Nat. Cell Biol. 9 , 347 – 353 . Google Scholar Crossref Search ADS PubMed Wright , M.H. , Calcagno , A.M. , Salcido , C.D. , et al. . ( 2008 ). Brca1 breast tumors contain distinct CD44+/CD24− and CD133+ cells with cancer stem cell characteristics . Breast Cancer Res. 10 , R10 . Google Scholar Crossref Search ADS PubMed Yang , M.H. , Wu , M.Z. , Chiou , S.H. , et al. . ( 2008 ). Direct regulation of TWIST by HIF-1α promotes metastasis . Nat. Cell Biol. 10 , 295 – 305 . Google Scholar Crossref Search ADS PubMed Yang , X. , Zhang , F. , and Kudlow , J.E. ( 2002 ). Recruitment of O-GlcNAc transferase to promoters by corepressor mSin3A: coupling protein O-GlcNAcylation to transcriptional repression . Cell 110 , 69 – 80 . Google Scholar Crossref Search ADS PubMed Zhang , F. , Liu , J. , Yuan , T. , et al. . ( 2005 ). Expression and significance of TERT and c-Myc oncogene protein product on cholesteatoma epithelium . Lin Chuang Er Bi Yan Hou Ke Za Zhi 19 , 302 – 304 . Google Scholar PubMed Zhang , H. , Sun , L. , Liang , J. , et al. . ( 2006 ). The catalytic subunit of the proteasome is engaged in the entire process of estrogen receptor-regulated transcription . EMBO J. 25 , 4223 – 4233 . Google Scholar Crossref Search ADS PubMed Zhang , H. , Yi , X. , Sun , X. , et al. . ( 2004 ). Differential gene regulation by the SRC family of coactivators . Genes Dev. 18 , 1753 – 1765 . Google Scholar Crossref Search ADS PubMed Zhang , Y. , Zhang , H. , Liang , J. , et al. . ( 2007 ). SIP, a novel ankyrin repeat containing protein, sequesters steroid receptor coactivators in the cytoplasm . EMBO J. 26 , 2645 – 2657 . Google Scholar Crossref Search ADS PubMed Zhao , H. , Alam , A. , San , C.Y. , et al. . ( 2017 ). Molecular mechanisms of brain-derived neurotrophic factor in neuro-protection: recent developments . Brain Res. 1665 , 1 – 21 . Google Scholar Crossref Search ADS PubMed © The Author(s) (2018). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Molecular Cell Biology Oxford University Press

LSD1 coordinates with the SIN3A/HDAC complex and maintains sensitivity to chemotherapy in breast cancer

Loading next page...
 
/lp/ou_press/lsd1-coordinates-with-the-sin3a-hdac-complex-and-maintains-sensitivity-6i3VrP3cXk
Publisher
Oxford University Press
Copyright
© The Author(s) (2018). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.
ISSN
1674-2788
eISSN
1759-4685
D.O.I.
10.1093/jmcb/mjy021
Publisher site
See Article on Publisher Site

Abstract

Abstract Lysine-specific demethylase 1 (LSD1) was the first histone demethylase identified as catalysing the removal of mono- and di-methylation marks on histone H3-K4. Despite the potential broad action of LSD1 in transcription regulation, recent studies indicate that LSD1 may coordinate with multiple epigenetic regulatory complexes including CoREST/HDAC complex, NuRD complex, SIRT1, and PRC2, implying complicated mechanistic actions of this seemingly simple enzyme. Here, we report that LSD1 is also an integral component of the SIN3A/HDAC complex. Transcriptional target analysis using ChIP-on-chip technology revealed that the LSD1/SIN3A/HDAC complex targets several cellular signalling pathways that are critically involved in cell proliferation, survival, metastasis, and apoptosis, especially the p53 signalling pathway. We have demonstrated that LSD1 coordinates with the SIN3A/HDAC complex in inhibiting a series of genes such as CASP7, TGFB2, CDKN1A(p21), HIF1A, TERT, and MDM2, some of which are oncogenic. Our experiments also found that LSD1 and SIN3A are required for optimal survival and growth of breast cancer cells while also essential for the maintenance of epithelial homoeostasis and chemosensitivity. Our data indicate that LSD1 is a functional alternative subunit of the SIN3A/HDAC complex, providing a molecular basis for the interplay of histone demethylation and deacetylation in chromatin remodelling, and suggest that the LSD1/SIN3A/HDAC complex could be a target for breast cancer therapeutic strategies. LSD1, SIN3A, breast cancer, metastasis, chemotherapy sensitivity Introduction The term ‘epigenetic’ refers to heritable changes regulating gene expression that are not a result of changes in the primary DNA sequence. In cancer, aberrant epigenetic silencing of tumour suppressor genes is a common occurrence associated with abnormal DNA methylation patterns and changes in covalent histone modifications (Jenuwein and Allis, 2001). These histone modifications, including acetylation, methylation, and phosphorylation, play major roles in the regulation of chromatin structures and gene transcription (Jenuwein and Allis, 2001), with each modification having a context-dependent association with transcriptional activation or repression. For example, H3-K4 (histone H3 lysine 4) methylation is associated with transcriptional activation, whereas H3-K9 (histone H3 lysine 9) methylation is associated with transcriptional repression. Histone methylation is catalysed by histone methyltransferases (HMTs), and methyl marks are removed by the catalytic activity of enzymes such as the flavin adenine dinucleotide (FAD)-dependent lysine-specific demethylases (LSDs), LSD1 and LSD2, and the Jumonji C domain-containing histone demethylases (Shi et al., 2004; Shi and Whetstine, 2007; Ciccone et al., 2009; Fang et al., 2010). The lysine-specific histone demethylase 1 A (KDM1A; referred to hereafter solely by its alias LSD1) is a FAD-dependent amine oxidase. Biochemically, LSD1 acts to specifically demethylate mono- or dimethylated H3-K4 and H3-K9 (Wissmann et al., 2007) and, functionally, LSD1 impacts the chromatin configuration governing transcription regulation. LSD1 was one of the first histone demethylases identified (Shi et al., 2004) and has been implicated in many cellular processes (Scoumanne and Chen, 2007; Wang et al., 2007b, 2009b). LSD1 is part of both corepressor and coactivator complexes and contributes to regulating the activity of certain transcription factors including nuclear receptors (Metzger et al., 2005). In addition to histone H3, LSD1 has non-histone substrates such as p53, DNA methyltransferase 1, and ERα, regulating their activities and stability (Huang et al., 2007; Perillo et al., 2008; Wang et al., 2009a). Despite progress in understanding dynamic histone-methylation regulation and in revealing the diverse molecular interactions for LSD1, the biological function of LSD1 is just beginning to be uncovered. Although the histone demethylation (HDM)/transcription regulation activity of LSD1 is potentially widespread, evidence suggests that LSD1 nevertheless performs pathway-specific functions (Di Stefano et al., 2007; Shi, 2007). The SIN3A/HDAC complex is identified as a global transcriptional corepressor. The SIN3A protein provides a platform for multiple protein interaction with its four paired amphipathic α-helix motif (Silverstein and Ekwall, 2005). A number of early studies identify that this complex is a multi-subunit protein complex containing eight core components, SIN3A, HDAC1, HDAC2, RbAp46, RbAp48, SAP30, SAP18, and SDS3 (Hassig et al., 1997; Laherty et al., 1997). Over the past few years, other associated proteins have been found, including SAP25, SAP130, SAP180, BRMS1, RBP1, and ING1/2 (Skowyra et al., 2001; Fleischer et al., 2003; Meehan et al., 2004; Shiio et al., 2006). Original studies have found that mSin3A can associate with Mad1 and Mxi1, which antagonizes the activity of the Myc proto-oncogenes (Rao et al., 1996; Sjoblom-Hallen et al., 1999). Subsequent work has discovered that a number of transcriptional factors have association with Sin3A, such as p53 (Murphy et al., 1999), REST (Huang et al., 1999), YY1 (Le May et al., 2008; Lu et al., 2011), SMAR1 (Rampalli et al., 2005), ERα (Ellison-Zelski et al., 2009), and Nanog and Oct4 (Liang et al., 2008). In vivo, no viable homozygous mSin3A−/− embryos could be detected on embryonic day 6.5, indicating that mSin3A is essential for mouse embryo development (Dannenberg et al., 2005). Other studies have found that mSin3A plays an important role in the development of multiple tissues (Cowley et al., 2005; van Oevelen et al., 2010; Pellegrino et al., 2012). Although SIN3A complex controls the expression of many cancer-related genes, the role of SIN3A in cancer remains unclear (Suzuki et al., 2008; Ellison-Zelski and Alarid, 2010). However, SIN3A, which participates extensively in transcriptional networks, is essential for mammalian development and involved in many biological processes, such as cell cycle progression, apoptosis, T-cell proliferation, differentiation, genome integrity, and homoeostasis (Cowley et al., 2005; Dannenberg et al., 2005; Nascimento et al., 2011; McDonel et al., 2012). Here we propose that LSD1 is a functional component of the SIN3A/HDAC complex, adding HDM activity to this complex. We have found that LSD1 and SIN3A are functionally interdependent and required for breast cancer cell optimal survival and growth. We have also shown that LSD1/SIN3A/HDAC complex regulates the survival and oncogenic potential of breast cancer cells, and is essential for the maintenance of epithelial homoeostasis and chemotherapeutic sensitivity, implicating the LSD1/SIN3A/HDAC complex as a target for breast cancer therapeutic strategies. Results LSD1 is an integral component of the SIN3A/HDAC complex In an effort to better understand the mechanistic roles of the SIN3A, a scaffold subunit of the SIN3A/HDAC complex, in breast cancer, we employed affinity purification and mass spectrometry to identify the proteins that are associated with SIN3A. In these experiments, FLAG-tagged SIN3A (FLAG-SIN3A) was stably expressed in human breast carcinoma MCF-7 cells. Cellular extracts were prepared and subjected to affinity purification using an anti-FLAG affinity gel. Mass spectrometric analysis indicated that SIN3A co-purified with SAP180, SAP130, HDAC1, HDAC2, RbAp46, RbAp48, SAP30, and NCOR1 (Alland et al., 1997) as reported previously, all of which are components of the SIN3A/HDAC complex. It is interesting that we found that SIN3A also co-purified with LSD1, the first identified histone lysine demethylase (Figure 1A). In addition, PRMT5 and hnRNPK were also detected in the complex. The presence of LSD1 in the SIN3A/HDAC complex was further confirmed by detecting their antibodies by western blot analysis (Figure 1B), suggesting that LSD1 is associated with the SIN3A/HDAC complex in vivo. The detailed results of the mass spectrometric analysis are provided in Supplementary Table S1. Figure 1 View largeDownload slide LSD1 interacts with the SIN3A/HDAC complex. (A) Immunoaffinity purification of SIN3-containing protein complex. Cellular extracts from MCF-7 cells stably expressing FLAG-vector or FLAG-SIN3A were immunopurified with anti-FLAG affinity columns and eluted with FLAG peptide. These elutes were resolved by SDS-PAGE and silver stained. The protein bands were retrieved and subjected to mass spectrometry. (B) Western blot analysis of the identified proteins in the purified fractions, using antibodies against the identified proteins. (C) Co-fractionation of the LSD1/SIN3A/HDAC complex by FPLC. Nuclear extracts of MCF-7 cells underwent fractionation of Superose 6 size exclusion columns. The fractions were subjected to western blot analysis. The elution positions of calibration proteins with known molecular masses (kDa) were indicated and an equal volume from each fraction was analysed. (D) Association of LSD1 with the SIN3A/HDAC complex in MCF-7 cells. Whole-cell lysates were immunoprecipitated (IP) with antibodies against the indicated proteins. Immunocomplexes were then immunoblotted (IB) using antibodies against the indicated proteins. (E) Reciprocal association of LSD1 with the SIN3A/HDAC complex in T-47D cells. Figure 1 View largeDownload slide LSD1 interacts with the SIN3A/HDAC complex. (A) Immunoaffinity purification of SIN3-containing protein complex. Cellular extracts from MCF-7 cells stably expressing FLAG-vector or FLAG-SIN3A were immunopurified with anti-FLAG affinity columns and eluted with FLAG peptide. These elutes were resolved by SDS-PAGE and silver stained. The protein bands were retrieved and subjected to mass spectrometry. (B) Western blot analysis of the identified proteins in the purified fractions, using antibodies against the identified proteins. (C) Co-fractionation of the LSD1/SIN3A/HDAC complex by FPLC. Nuclear extracts of MCF-7 cells underwent fractionation of Superose 6 size exclusion columns. The fractions were subjected to western blot analysis. The elution positions of calibration proteins with known molecular masses (kDa) were indicated and an equal volume from each fraction was analysed. (D) Association of LSD1 with the SIN3A/HDAC complex in MCF-7 cells. Whole-cell lysates were immunoprecipitated (IP) with antibodies against the indicated proteins. Immunocomplexes were then immunoblotted (IB) using antibodies against the indicated proteins. (E) Reciprocal association of LSD1 with the SIN3A/HDAC complex in T-47D cells. To further demonstrate that LSD1 is associated with the SIN3A/HDAC complex in vivo, protein fractionation experiments were carried out using fast protein liquid chromatography (FPLC) with Superose 6 columns and a high salt extraction and size exclusion approach. The results indicated that native LSD1 from MCF-7 cells was eluted with an apparent molecular mass much greater than that of the monomeric protein; LSD1 immunoreactivity was detected in chromatographic fractions from the Superose 6 column with a relatively symmetrical peak centred between ~667 kDa and ~1200 kDa (Figure 1C). Significantly, the elution pattern of LSD1 largely overlapped with that of the SIN3A/HDAC complex proteins including SIN3A, HDAC1, HDAC2, RbAp46/48, SAP180, SAP130, and SAP30, further supporting the idea that LSD1 is associated with the SIN3A/HDAC complex in vivo. To confirm the in vivo interaction between LSD1 and the SIN3A/HDAC complex, immunoprecipitation (IP) with antibodies against LSD1 followed by immunoblotting (IB) with antibodies against SAP180, SAP130, SIN3A, HDAC1, HDAC2, SAP30, or SAP18 demonstrated that LSD1 co-immunoprecipitated with all common components of the SIN3A/HDAC complex (Figure 1D, left panel). Reciprocally, IP with antibodies against the components of the SIN3A/HDAC complex and IB with antibodies against LSD1 also revealed that the components of the SIN3A/HDAC complex co-immunoprecipitated with LSD1 (Figure 1D, right panel). In addition, similar results were found in human breast carcinoma T-47D cells (Figure 1E). Taken together, these data strongly suggest that LSD1 is associated with the SIN3A/HDAC complex in vivo and is an integral component of the SIN3A/HDAC complex. LSD1 interacts directly with SIN3A and confers H3-K4 demethylation activity In order to determine the molecular basis for the interaction of LSD1 with the SIN3A/HDAC complex, GST pull-down assays were conducted using a GST-fused LSD1 construct and in vitro transcribed/translated individual components of the SIN3A/HDAC complex including SAP180, SAP130, SIN3A, HDAC1, HDAC2, RbAp46, RbAp48, ING1, SAP45, SAP30, and SAP18. MTA3 was used as a positive control (Wang et al., 2009b). These results indicate that LSD1 interacts directly with SIN3A, but not with the other components of the common SIN3A/HDAC complex that we tested (Figure 2A). Figure 2 View largeDownload slide Molecular interaction between LSD1 and the SIN3A/HDAC complex. (A) GST pull-down assays with GST-fused LSD1 and in vitro transcribed/translated components of the SIN3A/HDAC complex as indicated. (B) Schematic diagram depicting the GST-fused deletion constructs of LSD1. GST pull-down experiments with GST-fused LSD1 deletion constructs and in vitro transcribed/translated SIN3A. (C) Schematic diagram depicting the GST-fused deletion constructs of SIN3A. GST pull-down experiments with GST-fused SIN3A deletion constructs and in vitro transcribed/translated LSD1. (D) The SIN3A-containing protein complex possesses both HDM and HDAC activities. Cellular extracts were obtained from MCF-7 cells stably expressing FLAG-SIN3A and were immunoprecipitated with anti-FLAG antibody. The IPs were incubated with bulk histones and HDM or HDAC assay buffer. The reaction mixtures were analysed by western blot using antibodies against the indicated. (E) Schematic diagram depicting the molecular interaction between LSD1 and SIN3A. Figure 2 View largeDownload slide Molecular interaction between LSD1 and the SIN3A/HDAC complex. (A) GST pull-down assays with GST-fused LSD1 and in vitro transcribed/translated components of the SIN3A/HDAC complex as indicated. (B) Schematic diagram depicting the GST-fused deletion constructs of LSD1. GST pull-down experiments with GST-fused LSD1 deletion constructs and in vitro transcribed/translated SIN3A. (C) Schematic diagram depicting the GST-fused deletion constructs of SIN3A. GST pull-down experiments with GST-fused SIN3A deletion constructs and in vitro transcribed/translated LSD1. (D) The SIN3A-containing protein complex possesses both HDM and HDAC activities. Cellular extracts were obtained from MCF-7 cells stably expressing FLAG-SIN3A and were immunoprecipitated with anti-FLAG antibody. The IPs were incubated with bulk histones and HDM or HDAC assay buffer. The reaction mixtures were analysed by western blot using antibodies against the indicated. (E) Schematic diagram depicting the molecular interaction between LSD1 and SIN3A. LSD1 is an asymmetric molecule consisting of several distinct structural domains: the N-terminal putative nuclear localization signal is followed by the SWIRM (Swi3, Rsc8, and Moira) domain; in the C-terminus, a Tower domain protrudes as an elongated helix-turn-helix motif out of the FAD-binding amine oxidase domain (AOD) (Cheng and Zhang, 2007; Forneris et al., 2008). In order to map the interaction interface of LSD1 with the members of the SIN3A, GST pull-down assays were performed with a GST-fused LSD1 N-terminal fragment (1−166 aa), SWIRM domain (167−260 aa), Tower domain (419−520 aa), and AOD domain (260−852 aa) with or without the Tower domain (419−520 aa) with in vitro transcribed/translated SIN3A (Figure 2B, left panel). Our results indicate that the Tower domain is responsible for the interaction of LSD1 with SIN3A (Figure 2B, right panel). Analogously, mapping the interaction interface in SIN3A with GST-fused SIN3A domain constructs and in vitro transcribed/translated LSD1 revealed that the HDAC-interacting domain (HID) of the SIN3A proteins is responsible for the interaction of SIN3A with LSD1 (Figure 2C). To further investigate the physical associations and functional connection between LSD1 and the SIN3A/HDAC complex, the SIN3A-containing protein complex was analysed for enzymatic activities. The immunoprecipitates (IPs) were first incubated with bulk histones and the levels of methylated and acetylated histones in the reactions were then analysed by western blot (Figure 2D). As expected, the SIN3A-containing complex demonstrated an enzymatic activity that led to a significant decrease in the acetylation level of H3. Remarkably, however, the IPs also contained a strong demethylase activity for dimethyl H3-K4 and an evident demethylase activity for mono-methyl H3-K4 on both bulk histones and nucleosomal substrates, whereas no apparent effect on the dimethyl of H3-K9 was detected. In conclusion, these results show that LSD1 participates in the SIN3A/HDAC complex by interacting in the SIN3A-HID domain with its Tower domain. LSD1/SIN3A complexes are mainly implicated in gene transcription repression through their catalytic activities impacting chromatin configuration (Figure 2E). Transcription target analysis for the LSD1/SIN3A complex In order to further investigate the functional association between LSD1 and the SIN3A complex and explore the biological significance of this association, we analysed the genome-wide transcriptional targets of the LSD1/SIN3A complex using a chromatin immunoprecipitation-on-chip (ChIP-on-chip) approach. In these experiments, ChIP experiments were conducted in MCF-7 cells with antibodies against SIN3A. Following ChIP, the SIN3A-associated DNAs were amplified using nonbiased conditions, labelled, and hybridized to AVIVA Hu20K arrays. The data from SIN3A antibody (2127 genes) were then analysed with the data from antibodies against the 1913 target genes of LSD1 (GSE14260) reported previously (Wang et al., 2009b) for overlapping promoters, and these promoters were considered to be the targets of the LSD1/SIN3A complex (Figure 3A, left panel). These experiments identified a total of 310 different promoters targeted by the LSD1/SIN3A/HDAC complex. These data indicate that LSD1 and SIN3A target overlapping yet distinct sets of genes. The detailed results of the ChIP-on-chip experiments are summarized in Supplementary Dataset S1. Figure 3 View largeDownload slide Genome-wide transcription target analysis for the LSD1/SIN3A/HDAC complex. (A) Venn diagram of overlapping promoters bound by LSD1 and SIN3A in MCF-7 cells. The numbers represent the number of promoters that were targeted by the indicated proteins (left). The detailed results of the ChIP-on-chip experiments are summarized in Supplementary Dataset S1. Clustering of the 310 overlapping target genes of LSD1 and SIN3A into functional groups (right). (B) Verification of the ChIP-on-chip results via qChIP analysis of the indicated genes in MCF-7 cells. Results are represented as fold change over control with GAPDH as a negative control. Error bars represent mean ± SD for three independent experiments. (C) Verification of the ChIP-on-chip results by conventional DNA electrophoresis. IgG served as a negative control. (D) Verification of the ChIP-on-chip results by conventional DNA electrophoresis using Re-ChIP experiments on eight selected co-targets in MCF-7 cells with antibodies against LSD1 or SIN3A. IgG served as a negative control. (E) The LSD1 and SIN3A/HDAC complexes exist in the same protein complex on the representative co-target TGFB2 and HIF1A promoters. ChIP and Re-ChIP experiments were performed in MCF-7 cells with the indicated antibodies. S3A, SIN3A; L1, LSD1; HD1, HDAC1; S130, SAP130; S30, SAP30. Figure 3 View largeDownload slide Genome-wide transcription target analysis for the LSD1/SIN3A/HDAC complex. (A) Venn diagram of overlapping promoters bound by LSD1 and SIN3A in MCF-7 cells. The numbers represent the number of promoters that were targeted by the indicated proteins (left). The detailed results of the ChIP-on-chip experiments are summarized in Supplementary Dataset S1. Clustering of the 310 overlapping target genes of LSD1 and SIN3A into functional groups (right). (B) Verification of the ChIP-on-chip results via qChIP analysis of the indicated genes in MCF-7 cells. Results are represented as fold change over control with GAPDH as a negative control. Error bars represent mean ± SD for three independent experiments. (C) Verification of the ChIP-on-chip results by conventional DNA electrophoresis. IgG served as a negative control. (D) Verification of the ChIP-on-chip results by conventional DNA electrophoresis using Re-ChIP experiments on eight selected co-targets in MCF-7 cells with antibodies against LSD1 or SIN3A. IgG served as a negative control. (E) The LSD1 and SIN3A/HDAC complexes exist in the same protein complex on the representative co-target TGFB2 and HIF1A promoters. ChIP and Re-ChIP experiments were performed in MCF-7 cells with the indicated antibodies. S3A, SIN3A; L1, LSD1; HD1, HDAC1; S130, SAP130; S30, SAP30. The genes regulated by these promoters were then classified into cellular signalling pathways using the KEGG pathway database (http://www.genome.jp/kegg/pathway.html) with a P-value cut-off of 10−3. These analyses revealed that the LSD1/SIN3A/HDAC complex targets signalling pathways including p53 signalling pathway, cytoskeleton construction, cell cycle regulation, TGFβ signalling pathway, focal adhesion, apoptosis signalling pathway, which are critically involved in cell growth, survival, migration, and invasion (Figure 3A, right panel). Based on the data analysis, we focused on p53 and apoptosis signalling pathway for further study. To validate the ChIP-on-chip analysis, we performed ChIP experiments for 23 LSD1 and SIN3A co-target genes, using GAPDH as a negative control. The ChIP results were quantized by quantitative real-time PCR (qChIP) (Figure 3B) and visualized by conventional ChIP (Figure 3C). Both LSD1 and SIN3A bindings were confirmed for most of the target genes, showing the high accuracy of the ChIP-on-chip analysis. To further investigate the potential functional interplay between LSD1 and SIN3A, we performed sequential ChIP or ChIP/Re-ChIP with antibodies against LSD1 and SIN3A for eight co-target genes including CDKN1A(p21), RHOA, TGFB2, CASP7, CUL4A, TERT, HIF1A, and MDM2 (Figure 3D). We then investigated the co-occupancy of the LSD1/SIN3A/HDAC1 complex. ChIP assays in MCF-7 cells with antibodies against LSD1, SIN3A, HDAC1, SAP130, SAP30, or control IgG revealed that LSD1 and SIN3A/HDAC complexes co-occupied the promoters of TGFB2 and HIF1A (Figure 3E, the first upper bands). To further test our proposition that LSD1 and subunits of the SIN3A/HDAC complex function in the same protein complex at target promoters, sequential ChIP or ChIP/Re-ChIP experiments were performed. In these experiments, soluble chromatins were first immunoprecipitated with antibodies against LSD1, SIN3A, HDAC1, SAP130, or SAP30. The IPs were subsequently re-immunoprecipitated with appropriate antibodies. The results show that in precipitates, the TGFB2 and HIF1A promoters that were immunoprecipitated with antibodies against LSD1 could be re-immunoprecipitated with antibodies against SIN3A, HDAC1, SAP130, or SAP30. Similar results were obtained when initial ChIP was done with antibodies against SIN3A, HDAC1, SAP130, or SAP30 (Figure 3E). Taken together, these results support the idea that LSD1 and subunits of the SIN3A/HDAC complex occupy the target promoters in one multiunit complex. LSD1 is essential for SIN3A/HDAC complex-mediated transcriptional repression To gauge the functional importance of LSD1 incorporated into the SIN3A/HDAC complex, we assayed for the consequences of artificially recruiting SIN3A to chromatin. MCF-7 cells containing the luciferase reporter gene expressed under the control of the CMV promoter with five Gal4 DNA-binding sites (MCF-7-UAS-Luci) were transiently transfected with the plasmid that expressed Gal4-DBD-SIN3A (Gal4-SIN3A) or control Gal4-DBD vector (Gal4). Gal4-SIN3A expression led to significantly decreased reporter gene expression as reported previously (Yang et al., 2002). However, in LSD1-depleted MCF-7-UAS-Luci cells, the transcriptional repression activity of SIN3A was partially impaired by both #1 and #2 LSD1-targeted shRNAs (Figure 4A, left panel), while in the two SIN3A-depleted MCF-7-UAS-Luci cells, the transcriptional repression activity of Gal4-LSD1 was also partially impaired (Figure 4A, right panel), indicating that both LSD1 and SIN3A are required for optimal LSD1/SIN3A/HDAC complex transcriptional repression. Interestingly, we also found that the amount of chromatin-bound SIN3A was positively correlated with the abundance of LSD1 and verse visa (Figure 4B), indicating that the functions of LSD1 and SIN3A are closely connected. Figure 4 View largeDownload slide LSD1 and SIN3A are mutually required for optimal LSD1/SIN3A/HDAC complex transcriptional repression. (A) The control vector (containing Gal4-DBD only), Gal4-SIN3A, or Gal4-LSD1 construct was cloned and transfected alone or with the indicated specific lentivirus-mediated shRNAs into MCF-7 cells stably expressing Gal4-UAS reporter (MCF-7-Gal4-Luc cells). Gal4 luciferase reporter activity was measured. (B) LSD1 and SIN3A were mutually required for chromatin binding. Chromatin-bound fractions were prepared from MCF-7 cells and analysed by IB with the indicated antibodies. Histone H3 served as a loading control. (C) Clones with LSD1 or SIN3A knockdown were compared with the parental cell line for mRNA (left panel) and protein (right panel) levels of the indicated six co-regulated genes in MCF-7 cells. The mRNA levels were normalized to those of GADPH (left panel) and β-actin was served as a loading control for western blot analysis (right panel). (D and E) qChIP analysis of the recruitment of the indicated proteins (D) and histone modifications (E) on the indicated promoters in MCF-7 cells after infection with control lentivirus-mediated shRNA, or shRNAs targeting LSD1, SIN3A, or HDAC1. Results are represented as fold change over control with GAPDH as a negative control (D) or H3 ChIP as an internal control (E). (F) qChIP analysis of the recruitment of SIN3A or LSD1 on the indicated promoters in MCF-7 cells stably infected with LSD1 or SIN3A shRNA or stably expressing LSD1 or SIN3A. Results are represented as fold change over control with GAPDH as a negative control. (G) A graphic model as discussed in the text. In A, C–F, error bars represent mean ± SD of three independent experiments. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). Figure 4 View largeDownload slide LSD1 and SIN3A are mutually required for optimal LSD1/SIN3A/HDAC complex transcriptional repression. (A) The control vector (containing Gal4-DBD only), Gal4-SIN3A, or Gal4-LSD1 construct was cloned and transfected alone or with the indicated specific lentivirus-mediated shRNAs into MCF-7 cells stably expressing Gal4-UAS reporter (MCF-7-Gal4-Luc cells). Gal4 luciferase reporter activity was measured. (B) LSD1 and SIN3A were mutually required for chromatin binding. Chromatin-bound fractions were prepared from MCF-7 cells and analysed by IB with the indicated antibodies. Histone H3 served as a loading control. (C) Clones with LSD1 or SIN3A knockdown were compared with the parental cell line for mRNA (left panel) and protein (right panel) levels of the indicated six co-regulated genes in MCF-7 cells. The mRNA levels were normalized to those of GADPH (left panel) and β-actin was served as a loading control for western blot analysis (right panel). (D and E) qChIP analysis of the recruitment of the indicated proteins (D) and histone modifications (E) on the indicated promoters in MCF-7 cells after infection with control lentivirus-mediated shRNA, or shRNAs targeting LSD1, SIN3A, or HDAC1. Results are represented as fold change over control with GAPDH as a negative control (D) or H3 ChIP as an internal control (E). (F) qChIP analysis of the recruitment of SIN3A or LSD1 on the indicated promoters in MCF-7 cells stably infected with LSD1 or SIN3A shRNA or stably expressing LSD1 or SIN3A. Results are represented as fold change over control with GAPDH as a negative control. (G) A graphic model as discussed in the text. In A, C–F, error bars represent mean ± SD of three independent experiments. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). To further verify the role of LSD1 or SIN3A in LSD1/SIN3A/HDAC complex-mediated transcriptional repression, we tested the effects of inhibiting LSD1 or SIN3A expression on selected representative genes that were previously identified as co-targets of LSD1 and the SIN3A/HDAC complex. For this purpose, we transfected MCF-7 cells with the selected highly efficient shRNA against LSD1 (#2) or SIND3A (#1) (referred to hereafter as shLSD1 and shSIN3A), or control shSCR (scrambled shRNA). RNA was isolated from these cells for real-time PCR analysis and the whole-cell lysates were used for western blot. As shown in Figure 4C, downregulation of either LSD1 or SIN3A leads to increased expression of p21, MDM2, Caspase7, TGFB2, TERT, and HIF1A at both mRNA and protein levels. This demonstrates that LSD1 and SIN3A activities are both required to maintain the repression of the co-target genes of the LSD1/SIN3A/HDAC complex in MCF-7 cells. Importantly, qChIP experiments indicated that depletion of LSD1, SIN3A, or HDAC1 not only caused marked reduction of the recruitment of the corresponding proteins at the target gene promoters but also resulted in the recruitment of the other factor of the LSD1/SIN3A/HDAC complex (Figure 4D), indicating that the integrity of the complex is important for its transcriptional repression function. Consistently, the levels of H3K4me1, H3K4me2, and pan-H3 acetylation (H3Ac) were markedly increased at all the tested target promoters upon knockdown of either LSD1 or SIN3A (Figure 4E), supporting the notion that catalytic activities of LSD1 and SIN3A/HDAC complex appear to be closely interdependent, at least in these representative verified target promoter regions. We also chose six genes regulated by SIN3A only and six genes regulated by LSD1 only (Figure 4F). qChIP experiments indicated that overexpression or knockdown of SIN3A did not affect LSD1 binding to the promoters of genes regulated by LSD1 only (Figure 4F, left panel) or SIN3A only (Figure 4F, right panel). The results showed that LSD1 and SIN3A regulate overlapping and distinct genes. The HDM and histone deacetylation (HDAC) catalytic activities are interdependent at the promoters of their co-target genes. We report in this study that LSD1 interacts with SIN3A/HDAC complex for epigenetic transcriptional silencing. Through physical interaction, LSD1 and SIN3A/HDAC/RbAp46/48 form a larger complex, which can coordinate in catalysing H3-K4 demethylation and H3 deacetylation at target genes such as CASP7, TGFB2, CDKN1A(p21), HIF1A, TERT, and MDM2 (Figure 4G). These results demonstrate the co-existence of LSD1 and SIN3A/HDAC complex on the same target gene promoters and the functional coordination between these chromatin modifiers. LSD1/SIN3A/HDAC complex is essential for breast cancer cell survival and epithelial maintenance Based on the analyses of repetitive target genes previously referred to, p21 and CASP7 are apoptosis-promoting genes, and MDM2 and TERT are oncogenes (Momand et al., 1992; Marcelli et al., 1998; Kang et al., 1999; Zhang et al., 2005). We therefore sought to investigate the possible role of the LSD1/SIN3A/HDAC complex in breast cancer proliferation. To this end, gain-/loss-of-function of LSD1 and/or SIN3A was first studied using growth curve assay (Figure 5A, the upper left two panels). Compared to the control, LSD1 and/or SIN3A overexpression showed little effect on cell growth rate, while knockdown of LSD1 or SIN3A resulted in a marked decrease in the number of living cells, and a more pronounced decrease in growth rate was observed with combined knockdown in MCF-7 cells. The results also showed that wild-type LSD1 or SIN3A protein could rescue the decreased cell viability caused by shLSD1 or shSIN3A, while the catalytic mutated proteins could not (Figure 5A, the upper right two panels). Similar results were found in human breast cancer T-47D, MDA-MB-231, and MDA-MB-468 cells (Figure 5A, lower panel). Using colony formation assays, we found that LSD1 or SIN3A overexpression showed little effect on colony numbers in comparison with the control, whereas LSD1 or SIN3A knockdown was associated with a significant decrease in colony numbers, and a more pronounced decrease of colony numbers was observed with combined knockdown in MCF-7 cells and MDA-MB-468 cells (Figure 5B). Furthermore, enhanced Brdu (EdU) incorporation assay showed that compared to the control, LSD1 or SIN3A depletion had no significant impact on cell proliferation rate (Figure 5C). However, in TUNEL assay, the depletion of LSD1 and/or SIN3A led to an increased apoptosis ratio (Figure 5D). Specifically, the apoptosis-promoting effect of LSD1 and SIN3A depletion was significantly blocked by the addition of TGFB2 or HIF1A-specific shRNA among the verified target genes, of which both TGFB2 and HIF1A are apoptosis-promoting genes (Figure 5D). These data indicate that LSD1 and SIN3A are important to breast cancer cell survival, due to their repression of a cohort of pro-apoptosis genes. Figure 5 View largeDownload slide LSD1 and SIN3A are required for epithelial homoeostasis. (A) LSD1 or SIN3A overexpression did not affect the growth rate of MCF-7 cells, while LSD1 or SIN3A depletion was positively correlated with cell growth rate. MCF-7, MDA-MB-231, MDA-MB-468, and T-47D cells stably expressing the indicated lentivirus-delivered constructs were subjected to growth curve analysis by counting the numbers of living cells. LSD1 res, shLSD1#2-resistant LSD1; SIN3A res, shSIN3A#1-resistant SIN3A; LSD1-mut res, shRNA-resistant LSD1 catalytic mutant; SIN3A-mut res, shRNA-resistant SIN3A-HID mutant. (B) LSD1 or SIN3A overexpression did not affect the colony-forming efficiency of MCF-7 and MDA-MB-468 cells, while LSD1 or SIN3A depletion was positively correlated with the colony-forming efficiency. MCF-7 and MDA-MB-468 cells stably expressing LSD1 and/or SIN3A or stably infected with LSD1 and/or SIN3A shRNA were maintained in culture media for 10 days prior to being stained with crystal violet. Representative photos and statistically analyses are shown. (C) LSD1 or SIN3A depletion did not affect cellular proliferation. EdU incorporation assays were performed using a fluorescence method. Representative photos and statistically analyses are shown. (D) MCF-7 cells were infected with indicated lentivirus-delivered shRNAs. TUNEL assays were performed with a fluorescence method. Representative photos and statistically analyses are shown. (E) The mRNA and protein expression levels of the indicated epithelial or mesenchymal markers and breast cancer stemness markers were measured by real-time RT-PCR (upper) and western blot (lower), respectively, in MCF-7 and MDA-MB-231 cells with LSD1/SIN3A depleted (left panels) or overexpression (right panels). (F) Analysis of the correlations between CD44 and LSD1/SIN3A in public datasets (GSE27562, 29044, 31192, and 36774). The relative level of CD44 was plotted against that of LSD1 or SIN3A, respectively. (G) Wound-healing assays showed the increased migration potential of LSD1 or SIN3A-depleted MDA-MB-231 and T-47D cells compared to the control scramble shRNA-infected group. (H) LSD1/SIN3A repressed the invasiveness of breast cancer cells. MDA-MB-231 cells infected with the indicated lentivirus were starved for 18 h before cell invasion assays were performed using Matrigel transwell filters. In A–E, G, and H, shLSD1#2 and shSIN3A#1 were used. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). Figure 5 View largeDownload slide LSD1 and SIN3A are required for epithelial homoeostasis. (A) LSD1 or SIN3A overexpression did not affect the growth rate of MCF-7 cells, while LSD1 or SIN3A depletion was positively correlated with cell growth rate. MCF-7, MDA-MB-231, MDA-MB-468, and T-47D cells stably expressing the indicated lentivirus-delivered constructs were subjected to growth curve analysis by counting the numbers of living cells. LSD1 res, shLSD1#2-resistant LSD1; SIN3A res, shSIN3A#1-resistant SIN3A; LSD1-mut res, shRNA-resistant LSD1 catalytic mutant; SIN3A-mut res, shRNA-resistant SIN3A-HID mutant. (B) LSD1 or SIN3A overexpression did not affect the colony-forming efficiency of MCF-7 and MDA-MB-468 cells, while LSD1 or SIN3A depletion was positively correlated with the colony-forming efficiency. MCF-7 and MDA-MB-468 cells stably expressing LSD1 and/or SIN3A or stably infected with LSD1 and/or SIN3A shRNA were maintained in culture media for 10 days prior to being stained with crystal violet. Representative photos and statistically analyses are shown. (C) LSD1 or SIN3A depletion did not affect cellular proliferation. EdU incorporation assays were performed using a fluorescence method. Representative photos and statistically analyses are shown. (D) MCF-7 cells were infected with indicated lentivirus-delivered shRNAs. TUNEL assays were performed with a fluorescence method. Representative photos and statistically analyses are shown. (E) The mRNA and protein expression levels of the indicated epithelial or mesenchymal markers and breast cancer stemness markers were measured by real-time RT-PCR (upper) and western blot (lower), respectively, in MCF-7 and MDA-MB-231 cells with LSD1/SIN3A depleted (left panels) or overexpression (right panels). (F) Analysis of the correlations between CD44 and LSD1/SIN3A in public datasets (GSE27562, 29044, 31192, and 36774). The relative level of CD44 was plotted against that of LSD1 or SIN3A, respectively. (G) Wound-healing assays showed the increased migration potential of LSD1 or SIN3A-depleted MDA-MB-231 and T-47D cells compared to the control scramble shRNA-infected group. (H) LSD1/SIN3A repressed the invasiveness of breast cancer cells. MDA-MB-231 cells infected with the indicated lentivirus were starved for 18 h before cell invasion assays were performed using Matrigel transwell filters. In A–E, G, and H, shLSD1#2 and shSIN3A#1 were used. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). Since TGFB2, CUL4A, and HIF1A are key regulators governing the epithelial-to-mesenchymal transition (EMT) (Yang et al., 2008; Shin et al., 2011; Wang et al., 2014), we next sought to determine whether or not LSD1 and SIN3A play a role in EMT and tumour metastasis. We first detected the expression level of some invasion markers of EMT under the influence of loss-of-function of LSD1/SIN3A in MCF-7 and MDA-MB-231 cells. qPCR analysis showed that the expression of the epithelial markers (E-cadherin and γ-catenin) expression decreased remarkable, while the mesenchymal markers (N-cadherin and Vimentin) expression increased significantly. We next detected these EMT markers under the influence of gain-of-function of LSD1/SIN3A in MCF-7 and MDA-MB-231 cells. qPCR analysis revealed opposite results (Figure 5E, upper panel), indicating that LSD1/SIN3A are required to maintain epithelial properties. Moreover, the increase of CD44 and the decrease of CD24 are known changes in responding to EMT induced cancer stemness (Wright et al., 2008). Western blots showed that both E-cadherin and CD24 were positively correlated, while both Vimentin and CD44 were negatively correlated with LSD1 or SIN3A expression levels (Figure 5E, lower panel). A significant negative correlation between the breast cancer stem cell marker CD44 and LSD1/SIN3A existed in four published breast cancer clinical datasets (Figure 5F), further supporting our notion that the LSD1/SIN3A/HDAC complex is essential for epithelial homoeostasis and cancer stemness inhibition. Next, we investigated whether LSD1/SIN3A has a coordinated role in tumour migration and invasion. For this purpose, LSD1/SIN3A was depleted in MDA-MB-231 cells via a lentivirus-mediated stable infection. The impact of loss-of-function of LSD1/SIN3A on the migrating and invasive potential of these cells was assessed using wound-healing assays (Figure 5G) and transwell invasion assays (Figure 5H). In wound-healing assays, compared to the control, the amount of open distance remaining after 12 or 24 h of migration differed: either LSD1 or SIN3A knockdown was associated with an increased migration rate in MDA-MB-231 (Figure 5G, upper panel) and T-47D cells (Figure 5G, lower panel). Furthermore, transwell invasion assay results showed a significant increase in the invasiveness associated with LSD1 and/or SIN3A depletion, which could be restored by combining with TGFB2 or HIF1A depletion (Figure 5H). Collectively, these results indicate that both LSD1 and SIN3A are essential for breast cancer cell growth, invasion inhibition, maintenance of epithelial morphology, and cancer stemness inhibition, possibly by acting in conjunction with the LSD1/SIN3A/HDAC complex and by repressing the expression of a cohort of target genes such as TGFB2 or HIF1A. The LSD1/SIN3A/HDAC complex is essential for breast cancer cell sensitivity to chemotherapy Besides the increased invasion and metastasis potential, breast cancer stem cells are also considered to gain the ability against chemotherapy (Pavlopoulou et al., 2016). We were surprised to find that although LSD1-depleted MCF-7 cells grew slower, they showed higher survival rate, compared to the control, after treatment with chemotherapy drugs such as camptothecin (CPT) for 24 h at the concentration of 100, 300, and 500 nM, indicating that LSD1-depleted MCF-7 cells may partially lose sensitivity to chemotherapy (Figure 6A). Since it has been reported that CPT-induced apoptosis is p53-dependent, and p21, MDM2, CASP7, and TGFB2 are known target genes of p53, we measured whether or not these four target genes respond to CPT treatment at both mRNA and protein levels. Our results showed that all the four tested genes responded well to 300 nM CPT exposure for 24 h (Figure 6B and C). In addition, p53 significantly accumulated, while LSD1 or SIN3A showed little change after CPT treatment (Figure 6C). Compared to the control (Figure 6D, left panel, the third and fourth lanes), LSD1-depleted cells showed little induction of p21 and TGFβ2 protein after CPT treatment (Figure 6D, left panel, the first and second lanes). The western blot results were further semi-quantified by grayscale scanning and normalized to each loading control. It is clear to see that the pro-apoptosis genes such as p21 and TGFβ2 showed greater protein increase in control MCF-7 cells than in LSD1-depleted cells, indicating that the LSD1-depleted cells lost sensitivity to CPT (Figure 6D, right panel). In addition to CPT (the topoisomerase I inhibitor), three other clinical chemotherapeutic agents, doxorubicin (the topoisomerase II inhibitor), paclitaxel (the mitotic inhibitors), and carboplatin (the DNA intrastrand cross-linkers), were also analysed for cell viability assay (Figure 6E). The results showed that stable LSD1-depleted MCF-7 cells exhibited higher survival rate compared to the control after treatment with doxorubicin and paclitaxel, but not with carboplatin. These results indicated that the LSD1/SIN3A complex maintains sensitivity to some of the commonly used clinical chemotherapeutic drugs for breast cancer. Figure 6 View largeDownload slide The LSD1/SIN3A/HDAC complex is essential for breast cancer cell sensitivity to chemotherapy. (A) LSD1-depleted MCF-7 and control cells were treated in the presence or absence of CPT at different concentrations. Cell viability assays were performed 24 h later using a luminescent method. Error bars represent mean ± SD of three independent experiments. (B and C) Verifying the induction of LSD1/SIN3A target genes upon CPT treatment with respect to the mRNA (B) and protein (C) levels in MCF-7 cells. (D) The selected target genes p21 and TGFB2, which respond to CPT treatment, did not show obvious differences in the LSD1-depleted cells. Western blots (left panel) and statistical analysis by grey scale scanning (right panel) are shown. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). (E) LSD1-depleted MCF-7 and control cells were treated in the presence or absence of Doxorubicin, Paclitaxel, or Carboplatin at the indicated concentrations. Cell viability assays were performed 24 h later using a luminescent method. Error bars represent mean ± SD of three independent experiments. (F and G) qChIP analysis of the protein recruitment (F) and histone modifications (G) onto p21, CASP7, TGFB2, and MDM2 promoters in MCF-7 cells stably infected with lentivirus-shSCR, shLSD1, or shSIN3A upon CPT treatment. Histion H3 ChIP was used as an internal control. (H) MCF-7 cells were treated with 2 μM CPT for 4 h (left panels) or 10 Gy X-rays for 1 h (right panels) to induce DNA damage. Whole-cell lysates were immunoprecipitated (IP) with antibodies against the indicated proteins. Immunocomplexes were then immunoblotted (IB) using antibodies against the indicated proteins. γ-H2AX was used as the DNA damage marker, and H2AX and β-actin served as loading controls. In A, B, D–G, error bars represent mean ± SD of three independent experiments. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). Figure 6 View largeDownload slide The LSD1/SIN3A/HDAC complex is essential for breast cancer cell sensitivity to chemotherapy. (A) LSD1-depleted MCF-7 and control cells were treated in the presence or absence of CPT at different concentrations. Cell viability assays were performed 24 h later using a luminescent method. Error bars represent mean ± SD of three independent experiments. (B and C) Verifying the induction of LSD1/SIN3A target genes upon CPT treatment with respect to the mRNA (B) and protein (C) levels in MCF-7 cells. (D) The selected target genes p21 and TGFB2, which respond to CPT treatment, did not show obvious differences in the LSD1-depleted cells. Western blots (left panel) and statistical analysis by grey scale scanning (right panel) are shown. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). (E) LSD1-depleted MCF-7 and control cells were treated in the presence or absence of Doxorubicin, Paclitaxel, or Carboplatin at the indicated concentrations. Cell viability assays were performed 24 h later using a luminescent method. Error bars represent mean ± SD of three independent experiments. (F and G) qChIP analysis of the protein recruitment (F) and histone modifications (G) onto p21, CASP7, TGFB2, and MDM2 promoters in MCF-7 cells stably infected with lentivirus-shSCR, shLSD1, or shSIN3A upon CPT treatment. Histion H3 ChIP was used as an internal control. (H) MCF-7 cells were treated with 2 μM CPT for 4 h (left panels) or 10 Gy X-rays for 1 h (right panels) to induce DNA damage. Whole-cell lysates were immunoprecipitated (IP) with antibodies against the indicated proteins. Immunocomplexes were then immunoblotted (IB) using antibodies against the indicated proteins. γ-H2AX was used as the DNA damage marker, and H2AX and β-actin served as loading controls. In A, B, D–G, error bars represent mean ± SD of three independent experiments. *P < 0.05 and **P < 0.01 (two-tailed unpaired t-test). We further analysed the binding abundance of epigenetic regulators including transcription factor p53, the coactivator p300 (known p53-recruiting histone acetyltransferase) (Lill et al., 1997), and corepressors LSD1 and SIN3A on the target promoters upon CPT treatment. ChIP results showed that, in control shSCR-infected MCF-7 cells, the recruitments of p53 and p300 to the four representative target promoters were significantly increased upon CPT treatment, while LSD1 and SIN3A decreased remarkably, supporting an epigenetic regulatory mechanism: the transcription factor-directed corepressors and coactivators quickly exchange (Figure 6F, upper panel). However, in shLSD1 and shSIN3A lentivirus-infected MCF-7 cells, the recruitments of p53 and p300 to the four representative target promoters were only lightly increased after adding CPT, while LSD1 and SIN3A to the four representative target promoters had no significant change (Figure 6F, middle and lower panels). In addition, compared to the DMSO groups, the epigenetic modifications, including the transcriptional activation markers H3K4me1/2 and H3Ac, on the four representative target promoters were also significantly increased with CPT added in shSCR MCF-7 cells (Figure 6G, upper panel), but only lightly increased in shLSD1 MCF-7 and shSIN3A MCF-7 cells (Figure 6G, middle and lower panels). Finally, we sought to know whether the interaction of LSD1 and SIN3A was regulated by DNA damage. MCF-7 cells were treated with 2 μM CPT (Figure 6H, left panel) or irradiated with 10 Gy X-rays (Figure 6H, right panel) to induce DNA damage. Co-IP experiments with antibodies detecting the endogenous proteins showed that the interaction between LSD1 and SIN3A was not regulated by DNA damage. These results suggest that LSD1 and SIN3A are necessary for the integrity of transcription factor-directed corepressor and coactivator exchange machinery that is essential for tumour cells to maintain their sensitivity to the small chemical compounds used in chemotherapy. Through analysis of data sourced from published clinical datasets such as GSE35428 (Figure 7A) and GSE36774 (Figure 7B), we have found that both LSD1 and SIN3A were statistically positively correlated with p53 and negatively correlated with representative key target genes including p21, MDM2, and TGFB2 (Figure 7A and B). Kaplan–Meier survival analysis showed that higher expression of LSD1/SIN3A/p53 was associated with improved overall survival in breast cancer patients, while high expression of TGFB2, CUL4A, and CD44 was associated with poor prognosis (Figure 7C). Taken together, these data support a role for LSD1 coordinated with the SIN3A/HDAC complex in repressing tumorigenesis and retaining sensitivity to chemotherapy through maintenance of the epigenetic exchange of corepressor and coactivator complexes. This suggests that LSD1 and SIN3A could serve as novel biomarkers for cancer diagnosis and potential targets for cancer therapy. Figure 7 View largeDownload slide Clinicopathological significance of LSD1/SIN3A in breast cancer. (A and B) Analysis of the correlations between LSD1/SIN3A and p53, p21, TGFB2, and MDM2 in public datasets GSE35428 (A) and GSE36774 (B). The relative level of p53, p21, TGFB2, and MDM2 was plotted against that of LSD1 or SIN3A. (C) Kaplan–Meier survival analysis for the relationship between survival time and LSD1, SIN3A, p53, TGFB2, CUL4A, and CD44 signature in breast cancer using an online tool (http://kmplot.com/analysis/). Figure 7 View largeDownload slide Clinicopathological significance of LSD1/SIN3A in breast cancer. (A and B) Analysis of the correlations between LSD1/SIN3A and p53, p21, TGFB2, and MDM2 in public datasets GSE35428 (A) and GSE36774 (B). The relative level of p53, p21, TGFB2, and MDM2 was plotted against that of LSD1 or SIN3A. (C) Kaplan–Meier survival analysis for the relationship between survival time and LSD1, SIN3A, p53, TGFB2, CUL4A, and CD44 signature in breast cancer using an online tool (http://kmplot.com/analysis/). Discussion Both LSD1 and the SIN3A/HDAC complex primarily function in transcription repression programmes by virtue of their enzymatic activities and through their chromatin remodelling capabilities. Specifically, LSD1 targets H3-K4 for demethylation, and the SIN3A/HDAC complex possesses HDAC activity. As both demethylation and deacetylation are essential epigenetic mechanisms in controlling gene transcription, interplay between deacetylation and demethylation is a logical scenario. Indeed, past studies have indicated that HDAC and demethylation are interdependent and LSD1 is involved in several HDAC complexes including CoREST/HDAC complex, CtBP/HDAC complex, the NuRD complex as well as binding to histone deacethylase HDAC5 and SIRT1 (Denslow and Wade, 2007; Lee et al., 2006; Shi et al., 2005). We propose that LSD1 is an integral component of the SIN3A/HDAC complex, placing deacetylase and demethylase activities into the same protein complex. The question, then, is what is the biological significance of having all of these enzymatic activities in one single assembly? As stated above, these enzymatic activities are part of the whole pact of epigenetic actions that are necessary to bring a gene to a silenced state. Therefore, it is conceivable that evolution favours a physical proximity for more efficient functional interaction of distinct enzymatic activities. Such a stoichiometry would be a benefit for an exquisite coordination of distinct chromatin remodelling activities in finely tuned gene regulation. In fact, in addition to these chromatin modification capacities, the SIN3A complex also interacts with MeCP2, a protein that is connected to DNA methylation, another epigenetic mechanism in gene regulation. It is not expected that the SIN3A complex contains all types of epigenetic modifiers, but it would not be surprising if future investigations uncover additional enzymatic activities that are associated with this complex, especially considering the dynamic nature of the assembly and functioning of this complex. In addition, as H3-K4 methylation encodes for a well-recognized epigenetic message signalling gene activation, it is logical to imagine that the repression function of the SIN3A/HDAC complex contains an enzymatic activity to erase this mark. Moreover, it is believed that at least one of the mechanistic manifestations for functional specificity of different forms of the SIN3A complex is to be recruited by different transcription factors. To date, the SIN3A complex has been shown to mediate transcription repression by distinct sequence-specific transcription factors including REST, p53, Ikaros, TAL1, MMSET, and YY1 (Huang and Brandt, 2000; Dannenberg et al., 2005; Marango et al., 2008; Harris et al., 2016). Interestingly, at least some of these transcription factors, such as REST, p53, Ikaros, TAL1, and MMSET, also recruit LSD1 (Lan et al., 2008; Marango et al., 2008; Hu et al., 2009), again favouring a model in which LSD1 and the SIN3A complex act together. More importantly, the evidence clearly points to a convergent role of LSD1 and the SIN3A/HDAC complex in cell fate determination and differentiation (Nascimento et al., 2011; Whyte et al., 2012). This supports the hypothesis of a physical association and thus a functional connection between LSD1 and the SIN3A complex. It is conceivable that LSD1, through incorporation into the SIN3A/HDAC complex, is recruited by distinct pathway-specific transcription factors to exert its pathway-specific functions. LSD1 has been implicated in cellular growth pathways and it has been linked with several types of cancer (Kahl et al., 2006; Wang et al., 2007a). ChIP-on-chip analyses revealed that the LSD1/SIN3A complex targets the promoters of an array of genes that constitute several important cellular signalling pathways pertinent to cell growth, survival, proliferation, and apoptosis. We provide proof that the LSD1/SIN3A/HDAC complex is essential for cell survival because it transcriptionally represses a series of pro-apoptotic genes such as p21, CASP7, HIF1A, and TGFB2. This is underscored by the observation that LSD1 or Sin3a ablation causes embryonic lethality in mice (Wang et al., 2007b). On the other hand, we have demonstrated that the LSD1/SIN3A/HDAC complex plays important roles in maintaining epithelial portraits and inhibiting the EMT-induced cancer stemness by directly transcriptionally repressing a cohort of EMT promoting genes, such as TERT, CUL4A, TGFB2, MDM2, RHOA, and HIF1A, and indirectly suppressing key EMT markers including N-cadherin and Vimentin, as well as the breast stem cell marker CD44. Our results indicated that LSD1 and SIN3A are important for breast cancer cell survival, due to their repression of apoptosis, but not due to the induction of cell growth (Figure 5A−D). This is also conceivable and logical that the metastatic cells are often paused in G0 phase of the cell cycle. So, proliferation and migration/invasion are not always positive correlated. As pro-apoptosis are such hallmarks events in cancer chemotherapy, the connection of the LSD1/SIN3A/HDAC complex with these cellular behaviours emphasizes the importance of LSD1 and SIN3A in normal physiology and pathobiology. In addition, as important as the activated tumour suppressor p53 mediated exchange of coactivators and corepressors, it is logical to believe that only well-coordinated and sophisticated molecular machinery would make this possible. The association of LSD1 with the SIN3A/HDAC complex in a resting state and the co-depletion from the p21 and TGFB2 promoters upon CPT treatment may provide a clue about the role of LSD1 and SIN3A in this sophisticated coordination. Our results showed that lentivirus-shLSD1 caused resistance of MCF-7 to chemotherapeutic agents such as CPT, doxorubicin, and paclitaxel (Figure 6A and E). Thus, using LSD1 inhibitors to treat breast cancer may inhibit tumour cell growth at first, for LSD1 is essential for cell viability and growth. But the survived cells may gain higher migration/invasive potentials. Therefore, clinical use of LSD1 inhibitors to treat breast cancer should be more cautious. It is reasonable to believe that the aforementioned cell fate determination and differentiation functions of LSD1 and the SIN3A/HDAC complex are due at least in part to the concerted networking of different forms of the LSD1/SIN3A/HDAC complex in response to different signalling pathways or environment stimulations. These functions represent the cellular readouts of the coordinated molecular actions of these complexes in normal development and in breast cancer chemotherapy. The functional association of LSD1 with the SIN3A complex in normal development and physiology remains to be investigated. We also identified Alzheimer’s disease-related genes, such as PSEN1 and BDNF, as the co-targets of LSD1 and SIN3A (Avila-Gomez et al., 2008; Zhao et al., 2017). Futurework will focus on exploring the mechanism by which the coordinated actions of the LSD1/SIN3A complex are achieved in neuronal plasticity and pathology. Interestingly, our experiments identified PRMT5 and hnRNPK as associated partners of the LSD1/SIN3A/HDAC complex. The significance of this association needs further investigation. Notably, ChIP-on-chip identified SAP30 and HDAC2 as common targets of the LSD1/SIN3A complex. Whether feedback regulatory loops exist for the LSD1/SIN3A complex remains to be determined. Nevertheless, if our interpretation is correct, our experiments indicate that LSD1 is a functional subunit of the SIN3A/HDAC complex, expanding the enzymatic repertoire of the SIN3A complex in epigenetic regulation and providing a molecular basis for the interdependence of HDAC and demethylation in chromatin remodelling. We have shown that LSD1/SIN3A represses the transcription of a number of important cellular regulators coordinately and LSD1 is necessary for optimal SIN3A transcriptional repression activity. We have demonstrated that integrity of the LSD1/SIN3A/HDAC complex is required in CPT-mediated breast cancer cell chemosensitivity. These findings may shed new light on the mechanistic understanding and pharmaceutical development of breast cancer therapy. Materials and methods Antibodies and reagents The sources of the antibodies used were as follows: anti-FLAG, anti-LSD1, anti-HDAC1, anti-HDAC2, anti-TGFβ2, and anti-RbAps (Sigma); anti-SIN3A (Santa cruz); anti-SAP180, anti-SAP130, anti-SAP45, anti-SAP30, and anti-SAP18 (Bethyl); anti-H3, anti-MDM2, anti-TERT, and anti-dimethyl H3-K9 (Abcam); anti-acetyl H3, anti-dimethyl H3-K4, and anti-monomethyl H3-K4 (Millpore). Anti-p21, anti-Caspase7, and anti-HIF1α (Cell Signaling Technology). Dynabeads Protein G was from Invitrogen by Thermo Fisher Scientific and the protease inhibitor mixture cocktail was from Roche Applied Science. Glutathione SepharoseTM 4B beads were purchased from GE Healthcare. Camptothecin, Doxorubicin, Paclitaxel, and Carboplatin were purchased from Sigma. Bulk histones were purchased from Sigma (H9250). Cloning pCMV-Tag2B-Flag-SIN3A was made by subcloning a PCR-amplified SIN3A fragment using MCF-7 cDNA as a template in frame into the pCMV-Tag2B vector. LSD1 and SIN3A fragments were cloned by PCR into the pGEX4T3 plasmid (Clotech) for bacterial expression. Plasmids of the subunits of the SIN3A/HDAC complex including SAP130, SAP45, SAP30, and SAP18 were made in the same way. Immunopurification and mass spectrometry Lysates from MCF-7 cells expressing FLAG-SIN3A were applied to an equilibrated FLAG column. The column was then washed and followed by elution with FLAG peptides (Sigma). Fractions of the bed volume were collected, resolved on SDS-PAGE, and silver stained. Gel bands then underwent LC-MS/MS sequencing and analysis. FPLC chromatography MCF-7 nuclear extracts were prepared and dialysed against buffer D (20 mM HEPES, pH 8.0, 10% glycerol, 0.1 mM EDTA, 300 mM NaCl) (Applygen Technologies). Approximately 6 mg of nuclear protein was concentrated to 1 ml using a Millipore Ultrafree centrifugal filter apparatus (10 kDa nominal molecular mass limit), and then applied to an 850 × 20 mm Superose 6 size exclusion column (Amersham Biosciences) that had been equilibrated with buffer D containing 1 mM dithiothreitol and calibrated with protein standards (blue dextran, 2000 kDa; thyroglobulin, 669 kDa; ferritin, 440 kDa; catalase, 232 kDa; bovine serum albumin, 67 kDa; and RNase A, 13.7 kDa; all from Amersham Biosciences). The column was eluted at a flow rate of 0.5 ml/min and fractions were collected. Immunoprecipitation For IP assays, 500 μg of cellular extracts were incubated with appropriate primary antibodies or normal rabbit/mouse immunoglobin G (IgG) on a rotator at 4°C overnight, followed by addition of Dynabeads Protein G for 2 h at 4°C. Beads were then washed four times with lysis buffer (50 mM Tris-Cl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.25% sodium deoxycholate and protease inhibitor mixture). The immune complexes were subjected to SDS-PAGE followed by IB with secondary antibodies. Immunodetection was performed using enhanced chemiluminescence (ECL System, Amersham Biosciences) according to the manufacturer’s instructions. Glutathione S-transferase pull-down Glutathione S-transferase (GST) fusion constructs were expressed in BL21 Escherichia coli cells, and crude bacterial lysates were prepared by sonication in TEDGN (50 mM Tris-HCl, pH 7.4, 1.5 mM EDTA, 1 mM dithiothreitol, 10% (v/v) glycerol, 0.4 M NaCl) in the presence of the protease inhibitor mixture. The in vitro transcription and translation experiments were performed with rabbit reticulocyte lysate (TNT Systems; Promega). In GST pull-down assays, ~10 μg of the appropriate GST fusion proteins were mixed with 5−8 μl of the in vitro transcribed/translated products and incubated in binding buffer (75 mM NaCl, 50 mM HEPES, pH 7.9) at room temperature for 30 min in the presence of the protease inhibitor mixture. The binding reaction was then added to 30 μl of Glutathione Sepharose 4B beads (GE Healthcare) and mixed at 4°C for 2 h. The beads were washed three times with binding buffer, resuspended in 30 μl of 2× SDS-PAGE loading buffer, and resolved on 10% gels. Protein bands were detected with specific antibodies by western blot. ChIP and Re-ChIP ChIPs were performed in MCF-7 cells as described previously (Zhang et al., 2004, 2006, 2007). Briefly, 5 × 107 cells were cross-linked with 1% formaldehyde, sonicated, pre-cleared, and incubated with 5–10 μg of antibody per reaction. Complexes were washed with low and high salt buffers, and the DNA was extracted and precipitated. For Re-ChIP assays, immune complexes were eluted from the beads with 20 mM dithiothreitol. Eluates were then diluted 30-fold with ChIP dilution buffer and subjected to a second IP reaction. The final elution step was performed using 1% SDS solution in Tris-EDTA buffer, pH 8.0. The enrichment of the DNA template was analysed by conventional PCR using primers specific for each target gene promoter. The primer sequences are listed in Supplementary Table S2. Real-time quantitative RT-PCR Total RNA was isolated from samples with Trizol reagents (Invitrogen). Any potential DNA contamination was removed by RNase-free DNase treatment (Promega). Relative quantitation was determined using the ABI PRISM 7500 sequence detection system (Applied Biosystems) that measures real-time SYBR green fluorescence and then calculated by means of the comparative Ct method (2−ΔΔCt) with the expression of GAPDH as an internal control. The primer sequences used are listed in Supplementary Table S3. Lentiviral production and infection Recombinant lentiviruses expressing shSCR, shLSD1, shSIN3A, shTGFB2, and shHIF1A were constructed by Shanghai GenePharma. Concentrated viruses were used to infect 5 × 105 cells in a 60-mm dish with 8 μg/ml polybrene. Infected cells were then subjected to sorting target expression. The shRNA sequences are listed in Supplementary Table S4. For shRNA-resistant LSD1 overexpression vector, the shLSD1#2 target site 1643–1661 bases were mutated (GGGATAGGCAGATCCTCGA). For shRNA-resistant SIN3A overexpression vector, the shSIN3A# target site 1526–1546 bases were mutated (GAAAGTTTCCCGAATTATTCA). For shRNA-resistant LSD1 catalytic mutant vector, the catalytic domain (525–666AA) was deleted. For shRNA-resistant SIN3A-HID domain mutant vector, the shSIN3A# target site 1526–1546 bases were mutated (GAAAGTTTCCCGAATTATTCA) and HID domain (525–900AA) was delated. Colony formation assay MCF-7 cells and MDA-MB-468 cells were seeded on a fresh 6-well plate at a density of 1000 cells/well and cultured in complete medium at 37°C under 5% CO2. After 10–14 days, cells were fixed in methanol and stained with 0.1% crystal violet. The number of colonies was counted manually. TUNEL assay MCF-7 cells infected with lentivirus-delivered shSCR, shLSD1, shSIN3A, shTGFB2, or shHIF1A were seeded onto 6-well plates for 48 h. Then cells were harvested and TUNEL assays were performed according to the manufacturer’s instructions (#TB235, Promega) with a fluorescence method. Positive and negative controls with the TUNEL assays were performed according to the instructions provided by the manufacturer. EdU incorporation assay MCF-7 cells infected with lentivirus-delivered shSCR, shLSD1, and/or shSIN3A were planted into 6-well dishes at a density of 1 × 105/ml and were allowed to adhere overnight. Then the cells were cultured with 5-ethyny-2′-deoxyuridine (EdU) for 2 h before detection. The proliferative rate of the cells was then evaluated using a Cell-Light™ EdU Cell Proliferation Detection kit (RiboBio) following the manufacturer’s instructions. In vitro wound-healing assay MDA-MB-231 breast cancer cells in a L-15 medium containing 10% FBS and T-47D cells in a DMEM medium containing 10% FBS were seeded into wells of 24-multiwell plates (Becton Dickinson). After the cells grew to confluence, wounds were made using sterile pipette tips. Cells were washed with PBS and refreshed with a medium without FBS. After 12 or 24 h (T-47D cells after 24 or 36 h) incubation at 37°C, the cells were photographed. Data shown are the means for n = 6 wells per group ± SD. Cell invasion assay Transwell chamber filters (Becton Dickinson) were coated with Matrigel. After infection with lentivirus, MDA-MB-231 cells were suspended in serum-free L-15 media and then 2 × 104 cells were seeded into the upper chamber in a volume of 500 μl. The chamber was then cultured in a well containing 500 μl of L-15 media with 10% foetal bovine serum at 37°C for 18 h. Cells on the upper side of the membrane were removed using cotton swabs and those on the other side were stained and counted. Four high-powered fields were counted for each membrane. Statistical analysis Results were reported as mean ± SD unless otherwise noted. Comparisons were performed using two-tailed paired t-test based on a bi-directional hypothesis for continuous variables. Acknowledgements Mammalian expression vectors encoding LSD1 are kind gifts from Dr Yang Shi (Harvard Medical School). Funding This work was supported by grants from the Major State Basic Research Development Program of China (2016YFA0102400 to Y.W.), the National Natural Science Foundation of China (81773017 and 81472733 to Y.W., 81402334 to Y.Y., and 81502446 to R.Q.), China Postdoctoral Science Foundation (2014M561192 and 2015T80224 to Y.Y.), the Tianjin Municipal Science and Technology Commission (15JCQNJC11900 to Y.Y.), and the Science & Technology Development Fund of Tianjin Education Commission for Higher Education (20140105 to R.Q.). Conflict of interest none declared. References Alland , L. , Muhle , R. , Hou , H. , Jr , et al. . ( 1997 ). Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression . Nature 387 , 49 – 55 . Google Scholar Crossref Search ADS PubMed Avila-Gomez , I.C. , Jimenez-Del-Rio , M. , Lopera-Restrepo , F. , et al. . ( 2008 ). Association between HFE 187 C G (H63D) mutation and early-onset familial Alzheimer’s disease PSEN-1 839A C (E280A) mutation . Ann. Hematol. 87 , 671 – 673 . Google Scholar Crossref Search ADS PubMed Cheng , X. , and Zhang , X. ( 2007 ). Structural dynamics of protein lysine methylation and demethylation . Mutat. Res. 618 , 102 – 115 . Google Scholar Crossref Search ADS PubMed Ciccone , D.N. , Su , H. , Hevi , S. , et al. . ( 2009 ). KDM1B is a histone H3K4 demethylase required to establish maternal genomic imprints . Nature 461 , 415 – 418 . Google Scholar Crossref Search ADS PubMed Cowley , S.M. , Iritani , B.M. , Mendrysa , S.M. , et al. . ( 2005 ). The mSin3A chromatin-modifying complex is essential for embryogenesis and T-cell development . Mol. Cell. Biol. 25 , 6990 – 7004 . Google Scholar Crossref Search ADS PubMed Dannenberg , J.H. , David , G. , Zhong , S. , et al. . ( 2005 ). mSin3A corepressor regulates diverse transcriptional networks governing normal and neoplastic growth and survival . Genes Dev. 19 , 1581 – 1595 . Google Scholar Crossref Search ADS PubMed Denslow , S.A. , and Wade , P.A. ( 2007 ). The human Mi-2/NuRD complex and gene regulation . Oncogene 26 , 5433 – 5438 . Google Scholar Crossref Search ADS PubMed Di Stefano , L. , Ji , J.Y. , Moon , N.S. , et al. . ( 2007 ). Mutation of Drosophila Lsd1 disrupts H3-K4 methylation, resulting in tissue-specific defects during development . Curr. Biol. 17 , 808 – 812 . Google Scholar Crossref Search ADS PubMed Ellison-Zelski , S.J. , and Alarid , E.T. ( 2010 ). Maximum growth and survival of estrogen receptor-α positive breast cancer cells requires the Sin3A transcriptional repressor . Mol. Cancer 9 , 263 . Google Scholar Crossref Search ADS PubMed Ellison-Zelski , S.J. , Solodin , N.M. , and Alarid , E.T. ( 2009 ). Repression of ESR1 through actions of estrogen receptor α and Sin3A at the proximal promoter . Mol. Cell. Biol. 29 , 4949 – 4958 . Google Scholar Crossref Search ADS PubMed Fang , R. , Barbera , A.J. , Xu , Y. , et al. . ( 2010 ). Human LSD2/KDM1b/AOF1 regulates gene transcription by modulating intragenic H3K4me2 methylation . Mol. Cell 39 , 222 – 233 . Google Scholar Crossref Search ADS PubMed Fleischer , T.C. , Yun , U.J. , and Ayer , D.E. ( 2003 ). Identification and characterization of three new components of the mSin3A corepressor complex . Mol. Cell. Biol. 23 , 3456 – 3467 . Google Scholar Crossref Search ADS PubMed Forneris , F. , Binda , C. , Battaglioli , E. , et al. . ( 2008 ). LSD1: oxidative chemistry for multifaceted functions in chromatin regulation . Trends Biochem. Sci. 33 , 181 – 189 . Google Scholar Crossref Search ADS PubMed Harris , L.G. , Wang , S.H. , Mani , S.K. , et al. . ( 2016 ). Evidence for a non-canonical role of HDAC5 in regulation of the cardiac Ncx1 and Bnp genes . Nucleic Acids Res. 44 , 3610 – 3617 . Google Scholar Crossref Search ADS PubMed Hassig , C.A. , Fleischer , T.C. , Billin , A.N. , et al. . ( 1997 ). Histone deacetylase activity is required for full transcriptional repression by mSin3A . Cell 89 , 341 – 347 . Google Scholar Crossref Search ADS PubMed Hu , X. , Li , X. , Valverde , K. , et al. . ( 2009 ). LSD1-mediated epigenetic modification is required for TAL1 function and hematopoiesis . Proc. Natl Acad. Sci. USA 106 , 10141 – 10146 . Google Scholar Crossref Search ADS Huang , S. , and Brandt , S.J. ( 2000 ). mSin3A regulates murine erythroleukemia cell differentiation through association with the TAL1 (or SCL) transcription factor . Mol. Cell. Biol. 20 , 2248 – 2259 . Google Scholar Crossref Search ADS PubMed Huang , Y. , Myers , S.J. , and Dingledine , R. ( 1999 ). Transcriptional repression by REST: recruitment of Sin3A and histone deacetylase to neuronal genes . Nat. Neurosci. 2 , 867 – 872 . Google Scholar Crossref Search ADS PubMed Huang , J. , Sengupta , R. , Espejo , A.B. , et al. . ( 2007 ). p53 is regulated by the lysine demethylase LSD1 . Nature 449 , 105 – 108 . Google Scholar Crossref Search ADS PubMed Jenuwein , T. , and Allis , C.D. ( 2001 ). Translating the histone code . Science 293 , 1074 – 1080 . Google Scholar Crossref Search ADS PubMed Kahl , P. , Gullotti , L. , Heukamp , L.C. , et al. . ( 2006 ). Androgen receptor coactivators lysine-specific histone demethylase 1 and four and a half LIM domain protein 2 predict risk of prostate cancer recurrence . Cancer Res. 66 , 11341 – 11347 . Google Scholar Crossref Search ADS PubMed Kang , K.H. , Kim , W.H. , and Choi , K.H. ( 1999 ). p21 promotes ceramide-induced apoptosis and antagonizes the antideath effect of Bcl-2 in human hepatocarcinoma cells . Exp. Cell Res. 253 , 403 – 412 . Google Scholar Crossref Search ADS PubMed Laherty , C.D. , Yang , W.M. , Sun , J.M. , et al. . ( 1997 ). Histone deacetylases associated with the mSin3 corepressor mediate mad transcriptional repression . Cell 89 , 349 – 356 . Google Scholar Crossref Search ADS PubMed Lan , F. , Nottke , A.C. , and Shi , Y. ( 2008 ). Mechanisms involved in the regulation of histone lysine demethylases . Curr. Opin. Cell Biol. 20 , 316 – 25 . Google Scholar Crossref Search ADS PubMed Le May , N. , Mansuroglu , Z. , Leger , P. , et al. . ( 2008 ). A SAP30 complex inhibits IFN-β expression in Rift Valley fever virus infected cells . PLoS Pathog. 4 , e13 . Google Scholar Crossref Search ADS PubMed Lee , M.G. , Wynder , C. , Bochar , D.A. , et al. . ( 2006 ). Functional interplay between histone demethylase and deacetylase enzymes . Mol. Cell. Biol. 26 , 6395 – 6402 . Google Scholar Crossref Search ADS PubMed Liang , J. , Wan , M. , Zhang , Y. , et al. . ( 2008 ). Nanog and Oct4 associate with unique transcriptional repression complexes in embryonic stem cells . Nat. Cell Biol. 10 , 731 – 739 . Google Scholar Crossref Search ADS PubMed Lill , N.L. , Grossman , S.R. , Ginsberg , D. , et al. . ( 1997 ). Binding and modulation of p53 by p300/CBP coactivators . Nature 387 , 823 – 827 . Google Scholar Crossref Search ADS PubMed Lu , P. , Hankel , I.L. , Hostager , B.S. , et al. . ( 2011 ). The developmental regulator protein Gon4l associates with protein YY1, co-repressor Sin3a, and histone deacetylase 1 and mediates transcriptional repression . J. Biol. Chem. 286 , 18311 – 18319 . Google Scholar Crossref Search ADS PubMed Marango , J. , Shimoyama , M. , Nishio , H. , et al. . ( 2008 ). The MMSET protein is a histone methyltransferase with characteristics of a transcriptional corepressor . Blood 111 , 3145 – 3154 . Google Scholar Crossref Search ADS PubMed Marcelli , M. , Cunningham , G.R. , Haidacher , S.J. , et al. . ( 1998 ). Caspase-7 is activated during lovastatin-induced apoptosis of the prostate cancer cell line LNCaP . Cancer Res. 58 , 76 – 83 . Google Scholar PubMed McDonel , P. , Demmers , J. , Tan , D.W. , et al. . ( 2012 ). Sin3a is essential for the genome integrity and viability of pluripotent cells . Dev. Biol. 363 , 62 – 73 . Google Scholar Crossref Search ADS PubMed Meehan , W.J. , Samant , R.S. , Hopper , J.E. , et al. . ( 2004 ). Breast cancer metastasis suppressor 1 (BRMS1) forms complexes with retinoblastoma-binding protein 1 (RBP1) and the mSin3 histone deacetylase complex and represses transcription . J. Biol. Chem. 279 , 1562 – 1569 . Google Scholar Crossref Search ADS PubMed Metzger , E. , Wissmann , M. , Yin , N. , et al. . ( 2005 ). LSD1 demethylates repressive histone marks to promote androgen-receptor-dependent transcription . Nature 437 , 436 – 439 . Google Scholar Crossref Search ADS PubMed Momand , J. , Zambetti , G.P. , Olson , D.C. , et al. . ( 1992 ). The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation . Cell 69 , 1237 – 1245 . Google Scholar Crossref Search ADS PubMed Murphy , M. , Ahn , J. , Walker , K.K. , et al. . ( 1999 ). Transcriptional repression by wild-type p53 utilizes histone deacetylases, mediated by interaction with mSin3a . Genes Dev. 13 , 2490 – 2501 . Google Scholar Crossref Search ADS PubMed Nascimento , E.M. , Cox , C.L. , MacArthur , S. , et al. . ( 2011 ). The opposing transcriptional functions of Sin3a and c-Myc are required to maintain tissue homeostasis . Nat. Cell Biol. 13 , 1395 – 1405 . Google Scholar Crossref Search ADS PubMed Pavlopoulou , A. , Oktay , Y. , Vougas , K. , et al. . ( 2016 ). Determinants of resistance to chemotherapy and ionizing radiation in breast cancer stem cells . Cancer Lett. 380 , 485 – 493 . Google Scholar Crossref Search ADS PubMed Pellegrino , J. , Castrillon , D.H. , and David , G. ( 2012 ). Chromatin associated Sin3A is essential for male germ cell lineage in the mouse . Dev. Biol. 369 , 349 – 355 . Google Scholar Crossref Search ADS PubMed Perillo , B. , Ombra , M.N. , Bertoni , A. , et al. . ( 2008 ). DNA oxidation as triggered by H3K9me2 demethylation drives estrogen-induced gene expression . Science 319 , 202 – 206 . Google Scholar Crossref Search ADS PubMed Rampalli , S. , Pavithra , L. , Bhatt , A. , et al. . ( 2005 ). Tumor suppressor SMAR1 mediates cyclin D1 repression by recruitment of the SIN3/histone deacetylase 1 complex . Mol. Cell. Biol. 25 , 8415 – 8429 . Google Scholar Crossref Search ADS PubMed Rao , G. , Alland , L. , Guida , P. , et al. . ( 1996 ). Mouse Sin3A interacts with and can functionally substitute for the amino-terminal repression of the Myc antagonist Mxi1 . Oncogene 12 , 1165 – 1172 . Google Scholar PubMed Scoumanne , A. , and Chen , X. ( 2007 ). The lysine-specific demethylase 1 is required for cell proliferation in both p53-dependent and -independent manners . J. Biol. Chem. 282 , 15471 – 15475 . Google Scholar Crossref Search ADS PubMed Shi , Y. ( 2007 ). Histone lysine demethylases: emerging roles in development, physiology and disease . Nat. Rev. Genet. 8 , 829 – 833 . Google Scholar Crossref Search ADS PubMed Shi , Y. , Lan , F. , Matson , C. , et al. . ( 2004 ). Histone demethylation mediated by the nuclear amine oxidase homolog LSD1 . Cell 119 , 941 – 953 . Google Scholar Crossref Search ADS PubMed Shi , Y.J. , Matson , C. , Lan , F. , et al. . ( 2005 ). Regulation of LSD1 histone demethylase activity by its associated factors . Mol. Cell 19 , 857 – 864 . Google Scholar Crossref Search ADS PubMed Shi , Y. , and Whetstine , J.R. ( 2007 ). Dynamic regulation of histone lysine methylation by demethylases . Mol. Cell 25 , 1 – 14 . Google Scholar Crossref Search ADS PubMed Shiio , Y. , Rose , D.W. , Aur , R. , et al. . ( 2006 ). Identification and characterization of SAP25, a novel component of the mSin3 corepressor complex . Mol. Cell. Biol. 26 , 1386 – 1397 . Google Scholar Crossref Search ADS PubMed Shin , J.A. , Hong , O.K. , Lee , H.J. , et al. . ( 2011 ). Transforming growth factor-β induces epithelial to mesenchymal transition and suppresses the proliferation and transdifferentiation of cultured human pancreatic duct cells . J. Cell. Biochem. 112 , 179 – 188 . Google Scholar Crossref Search ADS PubMed Silverstein , R.A. , and Ekwall , K. ( 2005 ). Sin3: a flexible regulator of global gene expression and genome stability . Curr. Genet. 47 , 1 – 17 . Google Scholar Crossref Search ADS PubMed Sjoblom-Hallen , A. , Yang , W. , Jansson , A. , et al. . ( 1999 ). Silencing of the Epstein–Barr virus latent membrane protein 1 gene by the Max-Mad1-mSin3A modulator of chromatin structure . J. Virol. 73 , 2983 – 2993 . Google Scholar PubMed Skowyra , D. , Zeremski , M. , Neznanov , N. , et al. . ( 2001 ). Differential association of products of alternative transcripts of the candidate tumor suppressor ING1 with the mSin3/HDAC1 transcriptional corepressor complex . J. Biol. Chem. 276 , 8734 – 8739 . Google Scholar Crossref Search ADS PubMed Suzuki , H. , Ouchida , M. , Yamamoto , H. , et al. . ( 2008 ). Decreased expression of the SIN3A gene, a candidate tumor suppressor located at the prevalent allelic loss region 15q23 in non-small cell lung cancer . Lung Cancer 59 , 24 – 31 . Google Scholar Crossref Search ADS PubMed van Oevelen , C. , Bowman , C. , Pellegrino , J. , et al. . ( 2010 ). The mammalian Sin3 proteins are required for muscle development and sarcomere specification . Mol. Cell. Biol. 30 , 5686 – 5697 . Google Scholar Crossref Search ADS PubMed Wang , G.G. , Allis , C.D. , and Chi , P. ( 2007 a). Chromatin remodeling and cancer, part I: covalent histone modifications . Trends Mol. Med. 13 , 363 – 372 . Google Scholar Crossref Search ADS PubMed Wang , J. , Hevi , S. , Kurash , J.K. , et al. . ( 2009 a). The lysine demethylase LSD1 (KDM1) is required for maintenance of global DNA methylation . Nat. Genet. 41 , 125 – 129 . Google Scholar Crossref Search ADS PubMed Wang , J. , Scully , K. , Zhu , X. , et al. . ( 2007 b). Opposing LSD1 complexes function in developmental gene activation and repression programmes . Nature 446 , 882 – 887 . Google Scholar Crossref Search ADS PubMed Wang , Y. , Wen , M. , Kwon , Y. , et al. . ( 2014 ). CUL4A induces epithelial–mesenchymal transition and promotes cancer metastasis by regulating ZEB1 expression . Cancer Res. 74 , 520 – 531 . Google Scholar Crossref Search ADS PubMed Wang , Y. , Zhang , H. , Chen , Y. , et al. . ( 2009 b). LSD1 is a subunit of the NuRD complex and targets the metastasis programs in breast cancer . Cell 138 , 660 – 672 . Google Scholar Crossref Search ADS PubMed Whyte , W.A. , Bilodeau , S. , Orlando , D.A. , et al. . ( 2012 ). Enhancer decommissioning by LSD1 during embryonic stem cell differentiation . Nature 482 , 221 – 225 . Google Scholar Crossref Search ADS PubMed Wissmann , M. , Yin , N. , Muller , J.M. , et al. . ( 2007 ). Cooperative demethylation by JMJD2C and LSD1 promotes androgen receptor-dependent gene expression . Nat. Cell Biol. 9 , 347 – 353 . Google Scholar Crossref Search ADS PubMed Wright , M.H. , Calcagno , A.M. , Salcido , C.D. , et al. . ( 2008 ). Brca1 breast tumors contain distinct CD44+/CD24− and CD133+ cells with cancer stem cell characteristics . Breast Cancer Res. 10 , R10 . Google Scholar Crossref Search ADS PubMed Yang , M.H. , Wu , M.Z. , Chiou , S.H. , et al. . ( 2008 ). Direct regulation of TWIST by HIF-1α promotes metastasis . Nat. Cell Biol. 10 , 295 – 305 . Google Scholar Crossref Search ADS PubMed Yang , X. , Zhang , F. , and Kudlow , J.E. ( 2002 ). Recruitment of O-GlcNAc transferase to promoters by corepressor mSin3A: coupling protein O-GlcNAcylation to transcriptional repression . Cell 110 , 69 – 80 . Google Scholar Crossref Search ADS PubMed Zhang , F. , Liu , J. , Yuan , T. , et al. . ( 2005 ). Expression and significance of TERT and c-Myc oncogene protein product on cholesteatoma epithelium . Lin Chuang Er Bi Yan Hou Ke Za Zhi 19 , 302 – 304 . Google Scholar PubMed Zhang , H. , Sun , L. , Liang , J. , et al. . ( 2006 ). The catalytic subunit of the proteasome is engaged in the entire process of estrogen receptor-regulated transcription . EMBO J. 25 , 4223 – 4233 . Google Scholar Crossref Search ADS PubMed Zhang , H. , Yi , X. , Sun , X. , et al. . ( 2004 ). Differential gene regulation by the SRC family of coactivators . Genes Dev. 18 , 1753 – 1765 . Google Scholar Crossref Search ADS PubMed Zhang , Y. , Zhang , H. , Liang , J. , et al. . ( 2007 ). SIP, a novel ankyrin repeat containing protein, sequesters steroid receptor coactivators in the cytoplasm . EMBO J. 26 , 2645 – 2657 . Google Scholar Crossref Search ADS PubMed Zhao , H. , Alam , A. , San , C.Y. , et al. . ( 2017 ). Molecular mechanisms of brain-derived neurotrophic factor in neuro-protection: recent developments . Brain Res. 1665 , 1 – 21 . Google Scholar Crossref Search ADS PubMed © The Author(s) (2018). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Journal

Journal of Molecular Cell BiologyOxford University Press

Published: Aug 1, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off