Low-dose bisphenol A activates the ERK signaling pathway and attenuates steroidogenic gene expression in human placental cells

Low-dose bisphenol A activates the ERK signaling pathway and attenuates steroidogenic gene... Abstract Bisphenol A (BPA) is an industrial material used for many plastic products and is considered an endocrine disruptor. BPA can be released into the environment and can spread through the food chain. It is well known that BPA exposure leads to lesions, especially in the reproductive system. According to previous studies, BPA reduces newborn numbers in pregnant mice and affects placentation. The placenta is a special endocrine organ during pregnancy. It secretes important hormones, such as progesterone and estrogen, to maintain gestation. In steroid hormone synthesis, two specific enzymes are important: P450scc (CYP11A1) converts cholesterol to pregnenolone and aromatase (CYP19) induces androgen conversion to estrogen. To determine the effects of a low dose of BPA on hormone synthesis in the placenta, we used JEG-3 cells as a model. We found that the steroidogenic genes CYP11A1 and CYP19 were downregulated in human tissues by detectable concentrations of BPA (1–1000 nM), which do not affect cell viability. Furthermore, we demonstrated that BPA influenced the ERK signaling pathway and resulted in hormone reductions. An analysis of trophoblasts in primary culture from a term human placenta showed the same phenomena. Our data demonstrate that treatment with a low dose of BPA does not affect human placental cell survival, but decreases hormone production via to the downregulation of steroidogenic genes and ERK signaling pathway changes. Introduction Bisphenol A (BPA) is synthesized by the condensation of acetone with two equivalents of phenol. It has been used to make plastics since 1957. BPA is one of the most abundant synthetic chemicals in the world, and at least 3.6 million tons are manufactured per year. BPA-based plastic is used to make a variety of common consumer goods, such as water bottles, sports equipment, and dental sealants [1]. It is well known that BPA functions as endocrine-disrupting chemical, which were first found to have harmful effects on fertility in animals, such as sex reversal in fish, decline of ovulation in birds, and abnormal spermatogenesis in mammalians [2]. Furthermore, animals exposed to BPA have elevated rates of diabetes [3], mammary and prostate cancers [4], neurological defects [5], early puberty, and reproductive problems [1, 6]. The reproductive problems include underdeveloped gonads, abnormal spermatogenesis or ovulation, and abortion. Many studies have discussed the effects of BPA on gonads, but far fewer have examined effects on the placenta. The placenta is a special endocrine organ that only exists during gestation. It connects the developing fetus and maternal blood supply to allow nutrient uptake, waste elimination, and gas exchange. The placenta grows throughout pregnancy and functions not only as a selective barrier but also as an immune regulator and hormone supporter. The placenta secretes several hormones that are essential for gestation, such as human chorionic gonadotropin (hCG), estrogen, and progesterone [7]. They play important roles during pregnancy in the support of embryonic development and regulate not only the uterine environment but also immune response of the mother [8]. These hormones could be synthesized directly by trophoblasts and several catalytic enzymes [9]. The regulation of steroidogenic enzymes controls the conversion of cholesterol into various steroid hormones that are important for reproduction and pregnancy. If hormone production is disrupted, placental development is affected, leading to pregnancy failure, such as miscarriage. Several papers have documented that BPA associated with recurrent miscarriage or lower birth weight that implied to increases the risk of pregnancy failure [10–12]. It is well known that BPA could be transferred through the placental barrier and induces damage in both the fetus and placenta [13, 14]. In animals, BPA exposure is associated with a reduced number of embryos, reduced fetal body weight, and abnormal placental development [15]. The rate of premature delivery and intrauterine growth restriction increases in response to BPA [16]. Importantly, investigations of humans have shown similar phenomena [11, 17]. However, studies of the mechanisms by which BPA affects the placenta are limited. It is well known that BPA induces apoptosis and affects gene expression in placental cells at a high concentration [18]. Angiogenesis and the normal morphology of the placenta are disrupted after BPA exposure [19]. Furthermore, aromatase, an important steroidogenic enzyme, is reduced by BPA in placental JEG-3 cells [20]. However, the BPA dosage used in these studies is much higher than clinically detectable concentrations. The range of BPA levels in human serum obtained from different areas is 0.2–200 ng/ml (1–1000 nM) and around 10 ng/g in the human placenta [21, 22]. The tolerable daily intake of BPA was reduced from 50 to 4 μg/kg (body weight)/day by the European Food Standards Agency in 2015. Therefore, we were interested in the effects of low-dose BPA on steroidogenic genes in placental cells and its mechanisms of action. The detectable dosage in human tissues, 1–1000 nM BPA, was used to stimulate human placental JEG-3 cells. These results reliably reflect the effects of typical contact with small amounts of BPA in daily life. Furthermore, the mechanism of BPA effects in placental cells is an important topic, but few has been studied. We investigated the JNK/c-Jun and ERK signaling pathway because previous studies showed that BPA induced the activations in adrenal and breast cells [23, 24]. In this study, we try to verify BPA effects on hormone synthesis of human placental cells in low concentrations and the related signaling pathways. Materials and methods Cell culture and reagents JEG-3, a human choriocarcinoma cell line, was maintained in Dulbecco modified Eagle medium (DMEM) supplemented with 10% fetal calf serum and cultured at 37°C and 5% CO2 in an incubator. Cells that passage 5–15 after thawing were used in experiments. 8-Br-cAMP (B5386; Sigma-Aldrich, St. Louis, MO, USA) at 1 mM was added to JEG-3 cells for 24 h for the positive control. Bisphenol A (133027; Sigma-Aldrich) was prepared in methanol and added to the cell medium at a suitable dose, followed by incubation for 24 h (expose for 48, 72, 96 h only in Figure 1B) in stimulation experiments. Methanol was added to control groups. U0126 (U120; Sigma-Aldrich), an inhibitor of ERK1/2, was used to block specific signals in JEG-3 cells for 4 h of pretreatment before BPA exposure (for 28 h total) at a final concentration 10 μM. Figure 1. View largeDownload slide (A) Cell viability was measured using the MTT assay after BPA treatment for 24 h at various concentrations and durations. The relative viabilities of JEG-3 cells were similar to those of untreated control cells at 1, 50, and 75 mM, and decreased when the BPA concentration was greater than 100 μM. (B) Long-term exposure (48, 72, and 96 h) to low-dose BPA (10 nM, 1 μM) did not significantly reduce cell viability. *P < 0.05 compared to BPA untreated control. Figure 1. View largeDownload slide (A) Cell viability was measured using the MTT assay after BPA treatment for 24 h at various concentrations and durations. The relative viabilities of JEG-3 cells were similar to those of untreated control cells at 1, 50, and 75 mM, and decreased when the BPA concentration was greater than 100 μM. (B) Long-term exposure (48, 72, and 96 h) to low-dose BPA (10 nM, 1 μM) did not significantly reduce cell viability. *P < 0.05 compared to BPA untreated control. Cell viability assay Cell viability was measured using an MTT assay. Reductions of MTT tetrazolium salts were used to detect enzyme activity in the mitochondria, which only takes place in living cells. Thiazolyl Blue Tetrazolium Bromide (MTT) (M5655; Sigma-Aldrich) was prepared in phosphate-buffered saline (PBS), and then diluted in serum-free DMEM at a final concentration 1 mg/ml before use. JEG3 cells were seeded in plates and maintained overnight before BPA treatment at the indicated concentrations (0–200 μM) for the indicated time (0–96 h). Medium was removed and 200 μl of MTT solution/well was added, followed by incubation for 2 h at 37°C. Then, dimethyl sulfoxide (200 μl/well) was added to dissolve crystals. A microplate reader was used for detection at a wavelength of 450 nm. Plasmids and reporter assay Plasmids for CYP11a1-Luc 2.3 kb and CYP19-Luc (–951 to +84) containing the human gene promoters were described previously [25]. JEG-3 cells were transfected using Lipofectamine 2000 (#11668; Invitrogen, Carlsbad, CA, USA) according to manufacturer's suggested procedures. Cells were harvested at 24–48 h after transfection in lysis buffer (100 mM K3PO4, pH 7.8, 0.2% Triton X-100, 0.5 mM DTT, 0.2 mM PMSF) and subjected to luciferase assays using the Dual-Luciferase Reporter Assay System (E1910; Promega, Madison, WI, USA). Methanol and empty vector were added to control groups. Quantitative real-time PCR Real-time PCR was performed using the Rotor-Gene Q Real Time PCR system (Qiagen) with KAP SYBR® FAST qPCR Kit Master Mix (KAPA Biosystems Woburn, MA) according to the instruction manual. The PCR parameters used for CYP11A1, CYP19, and HPRT were as follows: 95°C for 3 min, 95°C for 3 s and 60°C for 20 s (40 cycles). The cycle threshold (Ct) values and related data were analyzed by using the Rotor-Gene Q Real Time PCR System Software (Qiagen). The expression level of CYP19 was normalized with that of HPRT. The relative expression levels (in fold) were determined by using the 2-(▵▵Ct) method. The sequence for the forward primer of CYP11A1 is 5΄- GAGGGAGACGGGCACACA -3΄ and that for the reverse primer is 5΄- GCCCTCGGACTTAAAGAG -3΄. The sequence for the forward primer of CYP19 is 5΄- GGAATTATGAGGGCACAT -3΄ and that for the reverse primer is: 5΄- AGACTCGCATGAATTCTC -3΄. For the HPRT gene (used as an internal control), the sequence for the forward primer is 5΄- GAACCAGGTTATGACCTTGAT -3΄ and that for the reverse primer is 5΄- CCTGTTGACTGGTCATTACAA -3΄. Western blotting and antibodies JEG-3 cells were cultured in 1 × 105/well of 6-well plate, and primary cultures were seeded in 2.5 × 104/well of 24-well plate. Whole cell extracts were harvested in lysis buffer (100 mM potassium phosphate, pH 7.8, 0.2% Triton X-100, 0.5 mM DTT, 0.2 mM PMSF) or SDS gel loading buffer for 24 h after treatment. An equal amount of cell extract (10 μg/l) was separated by SDS-PAGE and transferred to a PVDF membrane (Millipore, Billerica, MA, USA). Membranes were incubated with anti-CYP11A1 (ab75497; Abcam, Cambridge, UK), anti-CYP19 (ab124776; Abcam), anti-ERK (#4695; Cell Signaling Technology, Inc., Danvers, MA, USA), anti-phospho-ERK (#4376; Cell Signaling Technology, Inc.), anti- Cytokeratin-7 (MAB 3226; Millipore), or anti-tubulin (GTX628802; GeneTex, Inc., Irvine, CA, USA) antibodies overnight at 4°C (see Supplementary Table S1 for antibody information). They were then incubated with a horseradish peroxidase-conjugated secondary antibody for 1 h at 25°C. Signals were developed using the ECL detection reagent and revealed in the Smart Chemi chemiluminescence image detection system (ChampChemi, SageCreation). The quantitative level of signal determined by densitometric analysis using Image J and normalized with the internal controls. Enzyme-linked immunosorbent assay for hormones JEG-3 cells were cultured in 1 × 105/well of 6-well plate, and primary cultures were seeded in 2.5 × 104/well of 24-well plate. Samples of cell culture medium were collected and maintained in tubes at –80°C until detection. Samples were determined using an enzyme-linked immunosorbent assay (ELISA)-based direct sandwich technique. Specific hormone kits were used, including the Progesterone EIA Kit obtained from the Cayman Chemical Company (Item Number 582601; Ann Arbor, MI, USA) and the Estradiol ELISA Kit from Calbiotech (ES180S-100; Spring Valley, CA, USA). A standard curve was generated using the reference standard set supplied in the kit. The samples were measured according to the instructions accompanying the kit. All results were read using a microplate reader (Luminescence Scanner; Thermo, Waltham, MA, USA) at wavelengths of 450/415 nm. The hormone concentration was calculated based on the standard curve. Primary culture of trophoblasts Placentas were obtained from women with normal pregnancies between 38 and 40 weeks of gestation by caesarean section or vaginal deliveries at the Tri-Service General Hospital, National Defense Medical Center (NDMC), Taipei, Taiwan. A total of seven placentas were collected and five primary cultures were generated and used in this study. All experiments were performed using three individual placenta samples and repeated at least twice. All procedures were consistent with those of previous studies [26, 27] and were approved by the Institutional Review Board (IRB) at NDMC (permission number 2–104-05–149). Term placentas were maintained in cold saline, and 10–15 pieces of tissue (3 cm3) were collected at random. Placental tissues were stored in ice-cold PBS containing 1% penicillin/streptomycin and brought to the laboratory within 1 h of delivery. The tissue was washed with PBS three to five times to remove blood to the greatest extent possible. Then, the placental tissue was cut into small pieces and any blood vessels or clots were removed. This tissue was rewashed several times with cold PBS and dissolved in 0.1% collagenase containing medium for 30 min. The undecomposed tissue was removed using a filter, and RBC lysis buffer was added for 1–2 min. The dispersed placental cells were purified using a 5%–65% Percoll gradient (17–0891; GE Healthcare, Chicago, IL, USA). The cell suspension was centrifuged at 650 × g for 10 min and the supernatants were removed, followed by resuspension in DMEM/F12 medium containing 10% bovine serum albumin and 1% penicillin/streptomycin. The final cell suspension was seeded in 2.5 × 104/well of 24-well plate and cultured a 37°C and 5% CO2 in an incubator. Isolated human cytotrophoblasts were spontaneously aggregate and syncytialization, and we characterized using a spontaneous differentiation marker, syncytin, and hCG production, similar to previous studies [28, 29]. Immunocytochemistryof trophoblast marker cytokeratin-7 (MAB 3226; Millipore) was performed as previous study [28] and detected using flow cytometry (BD; Flowcytometer FACS Verse) or confocal microscope (Zeiss; Confocal Microscopy LSM510). BPA stimulates for 24 h at 9–12 days after seeding. The cultured medium was collected for ELISA analysis, and whole cell extracts were recovered for immune blot. Results JEG3 cell viability after BPA treatment BPA induces apoptosis in many cells [30, 31], but the aim of this study was to use concentrations that are not expected to affect cell viability. Therefore, JEG-3 cell viability after low-dose BPA treatment was detected. Cell viability was determined using the MTT assay after BPA treatment at various concentrations and durations. The results showed that the viabilities of JEG-3 cells were similar to those of untreated controls at 1, 50, and 75 μM BPA, and decreased for BPA concentrations of greater than 100 μM (Figure 1A). For long-term exposure to a low dose of BPA (10 nM, 1 μM), cell viability was not significantly reduced or only slightly reduced (10 nM, 72 h) compared with that of control cells (Figure 1B). These results indicated that JEG-3 placental cells survived when treated with human-detectable BPA concentrations (1–1000 nM). BPA effects of steroidogenic gene expressions and hormone secretions After confirming that JEG-3 placental cells survived using BPA concentrations detectable in the human body, we examined changes in steroidogenesis-related gene expression in JEG-3 cells after exposure to BPA. A luciferase reporter assay was performed and a group treated with 8-Br-cAMP was used as a positive control. CYP11A1, CYP19, and StAR genes were examined. Based on this analysis, the relative expression levels of both CYP11A1 and CYP19 decreased significantly after BPA treatment (Figure 2A and C). Furthermore, quantitative real-time PCR were performed to detect the endogenous gene expression of CYP11A1 and CYP19. The results showed that BPA downregulated CYP11A1 (Figure 2B) and CYP19 (Figure 2D) mRNA levels which were consistent with reporter assay. The protein levels of CYP11A1 and CYP19 were also attenuated (Figure 2E). However, the StAR gene, which controls cholesterol transport, was not affected (Supplementary Figure S1). Downstream hormonal changes were also detected. We examined the concentrations of progesterone and estradiol in the JEG-3 cell culture medium. When JEG-3 cells were exposed to low-dose BPA in the culture medium, the levels of steroidogenesis downstream products, such as progesterone and estradiol, decreased (Figure 3A and B) compared to the levels observed for cells in untreated culture medium. According to these results, we found that JEG-3 cells survived when treated with a low dose of BPA, but the expression levels of steroidogenic genes and final hormone secretion levels were altered. Figure 2. View largeDownload slide Examination of the changes in steroidogenesis-related gene expression in JEG-3 cells after exposure to BPA for 24 h. A luciferase reporter assay was performed and the group treated with 8-Br-cAMP was used as a positive control. CYP11A1 (A) and CYP19 (B) were examined. *P < 0.05 compared to reporter transfection alone (lane 2). Quantitative real-time PCR of CYP11A1 (B) and CYP19 (D) was shown in relative value which was normalized against the internal control, HPRT gene. *P < 0.05 compared with the level of untreated control (lane 1). The relative expression levels of CYP11A1 and CYP19 decreased significantly after BPA treatment. The protein levels of CYP11A1 and CYP19 were detected by western blotting (C). α-Tubulin was used as an internal control. Each number below the gel is the signal density quantification of each land which normalized with the internal control. Figure 2. View largeDownload slide Examination of the changes in steroidogenesis-related gene expression in JEG-3 cells after exposure to BPA for 24 h. A luciferase reporter assay was performed and the group treated with 8-Br-cAMP was used as a positive control. CYP11A1 (A) and CYP19 (B) were examined. *P < 0.05 compared to reporter transfection alone (lane 2). Quantitative real-time PCR of CYP11A1 (B) and CYP19 (D) was shown in relative value which was normalized against the internal control, HPRT gene. *P < 0.05 compared with the level of untreated control (lane 1). The relative expression levels of CYP11A1 and CYP19 decreased significantly after BPA treatment. The protein levels of CYP11A1 and CYP19 were detected by western blotting (C). α-Tubulin was used as an internal control. Each number below the gel is the signal density quantification of each land which normalized with the internal control. Figure 3. View largeDownload slide Changes in hormones regulated by CYP genes were detected. The concentrations of progesterone (A) and estradiol (B) in the JEG-3 cell culture medium after 24 h of BPA treatment were examined. The levels of steroidogenesis final products, such as progesterone and estradiol, decreased. The group treated with 8-Br-cAMP was used as a positive control. *P < 0.05 compared to BPA untreated control. Figure 3. View largeDownload slide Changes in hormones regulated by CYP genes were detected. The concentrations of progesterone (A) and estradiol (B) in the JEG-3 cell culture medium after 24 h of BPA treatment were examined. The levels of steroidogenesis final products, such as progesterone and estradiol, decreased. The group treated with 8-Br-cAMP was used as a positive control. *P < 0.05 compared to BPA untreated control. ERK signaling pathway participated in BPA influences to steriodogenesis In addition, we explored the signaling pathway through which BPA influenced the expression of CYP genes and consequently affected hormone levels. Based on a literature search and our preliminary study, we decided to examine the correlation between JNK/c-Jun or ERK signaling pathway and BPA exposure. We found that the addition of BPA increased phosphorylated ERK (Figure 4A), but c-Jun phosphorylation had no significantly difference (data not shown). After the addition of U0126, a specific inhibitor of ERK1/2, to the culture medium, the attenuation of CYP gene activity was recovered, and this was statistically significant compared to BPA treated alone (Figure 4B and C). When we performed a western blotting analysis, we found that BPA exposure decreased the expression of CYP proteins, and this expression was recovered using U0126 (Figure 5A). Consequent hormonal changes (i.e. the concentrations of progesterone and estradiol) also declined. Hormonal changes also recovered after treatment with U0126 (Figure 5B and C). Figure 4. View largeDownload slide To explore the ERK signaling pathway and its relationship to the addition of BPA for 24 h, protein levels of phosphorylated ERK and total ERK were measured by western blotting (A). BPA led to an increase in phosphorylated ERK. Each number below the gel represents the signal density quantification of each land which normalized with total ERK. With the addition of U0126, a specific inhibitor of ERK1/2, the attenuation of steroidogenic genes, CYP11A1 (B) and CYP19 (C), was recovered, with a statistically significant difference. *P < 0.05 compared to BPA untreated control. #P < 0.05 for comparisons between indicated groups. Figure 4. View largeDownload slide To explore the ERK signaling pathway and its relationship to the addition of BPA for 24 h, protein levels of phosphorylated ERK and total ERK were measured by western blotting (A). BPA led to an increase in phosphorylated ERK. Each number below the gel represents the signal density quantification of each land which normalized with total ERK. With the addition of U0126, a specific inhibitor of ERK1/2, the attenuation of steroidogenic genes, CYP11A1 (B) and CYP19 (C), was recovered, with a statistically significant difference. *P < 0.05 compared to BPA untreated control. #P < 0.05 for comparisons between indicated groups. Figure 5. View largeDownload slide (A) Western blotting showed that BPA exposure for 24 h decreased the expression of CYP proteins, and expression levels were recovered using U0126. Each number below the gel is the signal density quantification of each land which normalized with internal control or total ERK. Consequent hormonal changes in progesterone (B) and estradiol (C) were also declined. Recovery of hormone reductions was also detected after treatment with U0126. *P < 0.05 compared to BPA untreated control. #P < 0.05 for comparisons between the same dose of BPA with or without U0126. Figure 5. View largeDownload slide (A) Western blotting showed that BPA exposure for 24 h decreased the expression of CYP proteins, and expression levels were recovered using U0126. Each number below the gel is the signal density quantification of each land which normalized with internal control or total ERK. Consequent hormonal changes in progesterone (B) and estradiol (C) were also declined. Recovery of hormone reductions was also detected after treatment with U0126. *P < 0.05 compared to BPA untreated control. #P < 0.05 for comparisons between the same dose of BPA with or without U0126. Identical response to BPA in human primary trophoblast culture Next, the primary trophoblast culture from the human placenta was used to confirm previous findings using the JEG3 cell line. The primary cultures of term placenta were generated following previous reports [26, 28], and the details of experimental procure were described in ‘Primary culture of trophoblasts’ under Materials and Methods section. The cell purity of trophopblast in our system was over than 70% of total collected placental cells according to cytokeratin-7 expression (Supplementary Figure S2). The isolated trophoblast cells would spontaneously aggregate and fuse to form multinucleated cells, and differentiate to syncytiotrophoblast according to previous study [26, 28]. The cell morphology was observed at day 7 after seeding (Figure 6A). The cells attached the plate and become multinucleated (Figure 6A, arrow pointed). The syncytiotrophoblast properties were characterized based on hCG secretion (Figure 6B) and expression of the marker protein syncytin (Figure 6C), which were not affected by BPA. After 5 days of culture, primary trophoblasts were treated with BPA and the expression levels of CYP11A1, CYP19, and phosphorylated ERK were measured. ERK phosphorylation was activated and CYP genes were downregulated (Figure 6C), consistent with previous data in JEG3 cells. Reductions in progesterone and estradiol production were also observed in primary cultures with BPA treatment (Figure 6D). Figure 6. View largeDownload slide (A) Cell morphology of placental primary culture at day 7 was observed using confocal microscope. The trophoblast was stained with cytokeratin-7 (red) and DAPI (blue). The arrows indicated multinucleated cells. Two panels were shown from individual placentas. (B) Detection of hCG secretion by ELISA in culture medium from day 1 to day 5 after collection. Secretion increased as culture time increased. BPA stimulate for 24 h at 9–12 days after seeding. The cultured medium was collected for ELISA analysis, and whole cell extracts were recovered for protein detection. (C) Western blotting was performed to detect protein expression levels of the syncytiotrophoblast marker, syncytin, CYP proteins, and ERK phosphorylation with or without BPA treatment. Number 1–3 in the top of the gel indicated three individual samples. Each number below the gel represents the signal density quantification of each land which normalized with internal control or total ERK. (D) The steroid hormone, progesterone, and estradiol were also measured in primary culture medium with BPA treatment. Relative hormone level were shown, and BPA untreated control was set as 100. *P < 0.05 compared to BPA untreated control. Figure 6. View largeDownload slide (A) Cell morphology of placental primary culture at day 7 was observed using confocal microscope. The trophoblast was stained with cytokeratin-7 (red) and DAPI (blue). The arrows indicated multinucleated cells. Two panels were shown from individual placentas. (B) Detection of hCG secretion by ELISA in culture medium from day 1 to day 5 after collection. Secretion increased as culture time increased. BPA stimulate for 24 h at 9–12 days after seeding. The cultured medium was collected for ELISA analysis, and whole cell extracts were recovered for protein detection. (C) Western blotting was performed to detect protein expression levels of the syncytiotrophoblast marker, syncytin, CYP proteins, and ERK phosphorylation with or without BPA treatment. Number 1–3 in the top of the gel indicated three individual samples. Each number below the gel represents the signal density quantification of each land which normalized with internal control or total ERK. (D) The steroid hormone, progesterone, and estradiol were also measured in primary culture medium with BPA treatment. Relative hormone level were shown, and BPA untreated control was set as 100. *P < 0.05 compared to BPA untreated control. Discussion According to our results, a low dose of BPA (1–1000 nM), which does not affect cell viability, affects some signaling molecules, such as phosphorylated ERK. The activation of ERK phosphorylation reduced CYP11A1 and CYP19 expression and resulted in decreased estradiol and progesterone production. The disruption of hormone secretion might cause placental insufficiency and contribute to pregnancy failure. These findings suggest a potential mechanism by which BPA causes reproductive toxicity. Although this is not the first study of the effects of BPA on CYP19 in the placenta, the concentrations examined and findings are absolutely different. In a previous study, Huang showed that CYP19 mRNA expression was significantly reduced in response to approximately 20 μM BPA [20]; however, the apoptosis rate of JEG3 cells was elevated for this dosage [18]. Therefore, a decreased expression level of CYP19 using a high dose of BPA may be explained by proapoptotic activity. On the other hand, treatment with BPA at less than 1 μM does not cause cell death; according to our results and those of a previous study [18], CYP19 expression still decreased. However, the effects of BPA at low concentrations are probably mediated by the regulation of signaling pathways rather than cell toxicity. It is well known that BPA activates different signaling pathways and results in different outcomes depending on its concentration [32]. In addition to concentration-dependent differences, BPA has multiple functions in different tissues. In human osteoblastic (SV-HFO) and ovarian granulosa-like (KGN) cell lines, BPA suppresses CYP19 activity [33], similar to our results. However, in 2010, Kim indicated that BPA induces aromatase (CYP19) activity and enhances estrogen production in Leydig cells of the testis [34]. The differences in observed effects may be explained by the tissue specificity of the CYP19 promoter, as demonstrated previously [35]. For example, the placenta-specific promoter is I.1 and promoter I.4 can be induced in preadipocytes; thus, the same gene shows different responses to a chemical owing to promoter differences. Furthermore, in studies of another key enzyme, CYP11A1, BPA also exhibited multiple effects. In a mouse adrenocortical cell line, BPA induces CYP11a1 expression and activates steroidogenesis [24], but BPA downregulates Cyp11a1 to inhibit steroidogenesis in cultured mouse antral follicles [36]. Therefore, the effects of BPA uniquely depend on cell type and dosage, and we found that steroidogenic genes are downregulated in human placental JEG3 cells. In an investigation of signal transduction of steroidogenic genes, we determined that the ERK pathway may participate in BPA function. The ERK signaling pathway is important for cell proliferation, but it downregulates hormone production in response to treatment with various drugs. Metformin, which is used to treat polycystic ovary syndrome, inhibits aromatase via ERK signaling [37]. Bufalin and cinobufagin inhibit steroidogenesis in adrenocortical cells via ERK [38]. In granulosa cells, ERK signaling inhibits gonadotropin-stimulated steroidogenesis [39]. In our study, BPA inhibited steroidogenic genes and reduced hormone production via the ERK signaling pathway. A previous study also showed that BPA induces ERK phosphorylation, which is involved in apoptosis [31] and cancer cell proliferation [23, 40]. Although BPA activation of ERK signaling is not a novel finding, this is the first paper to examine the role of the ERK signaling pathway in placenta cells under BPA stimulation. Interestingly, we found that ERK inhibitor (U0126) alone could activate steroidogenesis in placental cells (Figures 4B, C and 5) without BPA. It implied there are some endogenous ERK signaling that inhibit steroidogenic genes in background and could be blocked by U0126. We think the endogenous ERK signaling may come from the 10% serum in cultured medium because previous study also revealed the ERK1/2 signaling in placenta cells under 10% serum cultured without drug treatment [41]. In addition to ERK, many signaling molecules could be activated by BPA, such as CREB, and p53 [30, 34], and the roles of these molecules cannot be ruled out in our system. Other signaling pathways involved in BPA effects on placental cells need to be further studied. The inhibition of steroidogenic gene expression resulted in a decrease in hormone secretion. According to our results, after treatment with 1 μM BPA, progesterone levels were 30% and estradiol levels were 50% of the levels observed in control treatments (Figure 3). It is well known that hormone insufficiency causes pregnancy failure, which is also observed in BPA-exposed animals [15]. Estrogen and progesterone are two major steroid hormones secreted in the placenta [8]. Estrogen is important to stimulate myometrium growth of the uterus and mammary gland development. Major functions of progesterone are the maintenance of the endometrium and providing an environment for embryonic development. In addition, progesterone also regulates contractility in uterine smooth muscle tissues and inhibits the secretion of gonadotropins of the pituitary. Blocking progesterone action by an antagonist, RU-486, causes abortion [42]. The abortion rate and recurrent miscarriage in humans are associated with BPA concentrations in the body [1, 10]. We suggest that these defects related to BPA may be due to the suppression of steroidogenic gene expression and consequent reductions in hormone production. However, the precise physiological effects of BPA in maternal tissues and the fetus require further study, and future studies should examine whether hormone supplementation rescues pregnancy defects caused by BPA. Conclusion In human placental cells, the steroidogenic genes CYP11A1 and CYP19 were downregulated via the ERK signaling pathway for BPA doses detectable in human tissues (1–1000 nM). The final hormone production levels of estrogen and progesterone by placental cells were significantly reduced after BPA treatment. These findings may explain the association between the abortion rate and recurrent miscarriage in humans with BPA exposure. Supplementary data Supplementary data are available at BIOLRE online. Supplementary Table S1. Primary antibodies used in the study. Supplementary Figure S1. (A) A StAR reporter construct was used to test the transcriptional activities of steroidogenic genes. After 24 h of BPA treatment using a low dose (1 nM to 1 μM), the transcriptional activity of StAR, which controls cholesterol transport, was not affected. (B) Protein expression of StAR was not changed by BPA based on western blotting. Each number below the gel represents the signal density quantification of each land which normalized with internal control. Supplementary Figure S2. To reveal the cell purity of primary culture, expression of cytokeratin-7 was analyzed using flow cytometry. Unstaining control (A) was performed without first antibody, and JEG-3 cell (B) was stained as the positive control. (C) Human placental primary culture showed over 70% of positive staining. (D) The statistic results of trophoblast staining were shown from 3 independent experiments. Acknowledgments We thank Dr Meng-Chun Hu of the Institute of Physiology, National Taiwan University College of Medicine, Taipei, for providing the CYP19-Luc construct, and Dr Ying Chen of Institute of Biology and Anatomy, National Defense Medical Center, Taipei, for providing E-cadherin antibody. Conflict of interest: The authors have no conflicts of interest to declare. Footnotes † Grant Support: This work was supported by the Ministry of Science and Technology (Grant number MOST 104–2320-B-016–015 and MOST 105–2320-B-016–013) and the Ministry of National Defense in Taiwan (Grant number MAB-104–090 and MAB-105–060). References 1. Tsai WT. Human health risk on environmental exposure to Bisphenol-A: a review. J Environ Sci Health C Environ Carcinog Ecotoxicol Rev  2006; 24( 2): 225– 255. Google Scholar CrossRef Search ADS PubMed  2. Flint S, Markle T, Thompson S, Wallace E. Bisphenol A exposure, effects, and policy: a wildlife perspective. J Environ Manage  2012; 104: 19– 34. Google Scholar CrossRef Search ADS PubMed  3. Ahmadkhaniha R, Mansouri M, Yunesian M, Omidfar K, Jeddi MZ, Larijani B, Mesdaghinia A, Rastkari N. Association of urinary bisphenol a concentration with type-2 diabetes mellitus. J Environ Health Sci Eng  2014; 12( 1): 64. Google Scholar CrossRef Search ADS PubMed  4. Soto AM, Sonnenschein C. Environmental causes of cancer: endocrine disruptors as carcinogens. Nat Rev Endocrinol  2010; 6( 7): 363– 370. Google Scholar CrossRef Search ADS PubMed  5. Hajszan T, Leranth C. Bisphenol A interferes with synaptic remodeling. Front Neuroendocrinol  2010; 31( 4): 519– 530. Google Scholar CrossRef Search ADS PubMed  6. Maffini MV, Rubin BS, Sonnenschein C, Soto AM. Endocrine disruptors and reproductive health: the case of bisphenol-A. Mol Cell Endocrinol  2006; 254–255: 179– 186. Google Scholar CrossRef Search ADS PubMed  7. Hobson BM. Production of gonadotrophin, oestrogens and progesterone by the primate placenta. Adv Reprod Physiol  1971; 5: 67– 102. Google Scholar PubMed  8. Pepe GJ, Albrecht ED. Actions of placental and fetal adrenal steroid hormones in primate pregnancy. Endocr Rev  1995; 16: 608– 648. Google Scholar PubMed  9. Miller WL. Molecular biology of steroid hormone synthesis. Endocrine Rev  1988; 9( 3): 295– 318. Google Scholar CrossRef Search ADS   10. Sugiura-Ogasawara M, Ozaki Y, Sonta S, Makino T, Suzumori K. Exposure to bisphenol A is associated with recurrent miscarriage. Hum Reprod  2005; 20( 8): 2325– 2329. Google Scholar CrossRef Search ADS PubMed  11. Pinney SE, Mesaros CA, Snyder NW, Busch CM, Xiao R, Aijaz S, Ijaz N, Blair IA, Manson JM. Second trimester amniotic fluid bisphenol A concentration is associated with decreased birth weight in term infants. Reprod Toxicol  2017; 67: 1– 9. Google Scholar CrossRef Search ADS PubMed  12. Shen Y, Zheng Y, Jiang J, Liu Y, Luo X, Shen Z, Chen X, Wang Y, Dai Y, Zhao J, Liang H, Chen A et al.   Higher urinary bisphenol A concentration is associated with unexplained recurrent miscarriage risk: evidence from a case-control study in eastern China. PLoS One  2015; 10( 5): e0127886. Google Scholar CrossRef Search ADS PubMed  13. Balakrishnan B, Henare K, Thorstensen EB, Ponnampalam AP, Mitchell MD. Transfer of bisphenol A across the human placenta. Am J Obstet Gynecol  2010; 202( 393): e391– e397. 14. Schonfelder G, Wittfoht W, Hopp H, Talsness CE, Paul M, Chahoud I. Parent bisphenol A accumulation in the human maternal-fetal-placental unit. Environ Health Perspect  2002; 110: a703– a707. Google Scholar CrossRef Search ADS PubMed  15. Tachibana T, Wakimoto Y, Nakamuta N, Phichitraslip T, Wakitani S, Kusakabe K, Hondo E, Kiso Y. Effects of bisphenol A (BPA) on placentation and survival of the neonates in mice. J Reprod Dev  2007; 53: 509– 514. Google Scholar CrossRef Search ADS PubMed  16. Ranjit N, Siefert K, Padmanabhan V. Bisphenol-A and disparities in birth outcomes: a review and directions for future research. J Perinatol  2010; 30: 2– 9. Google Scholar CrossRef Search ADS PubMed  17. Yamada H, Furuta I, Kato EH, Kataoka S, Usuki Y, Kobashi G, Sata F, Kishi R, Fujimoto S. Maternal serum and amniotic fluid bisphenol A concentrations in the early second trimester. Reprod Toxicol  2002; 16: 735– 739. Google Scholar CrossRef Search ADS PubMed  18. Morice L, Benaitreau D, Dieudonne MN, Morvan C, Serazin V, de Mazancourt P, Pecquery R, Dos Santos E. Antiproliferative and proapoptotic effects of bisphenol A on human trophoblastic JEG-3 cells. Reprod Toxicol  2011; 32: 69– 76. Google Scholar CrossRef Search ADS PubMed  19. Tait S, Tassinari R, Maranghi F, Mantovani A. Bisphenol A affects placental layers morphology and angiogenesis during early pregnancy phase in mice. J Appl Toxicol  2015; 35: 1278– 1291. Google Scholar CrossRef Search ADS PubMed  20. Huang H, Leung LK. Bisphenol A downregulates CYP19 transcription in JEG-3 cells. Toxicol Lett  2009; 189: 248– 252. Google Scholar CrossRef Search ADS PubMed  21. Vandenberg LN, Chahoud I, Heindel JJ, Padmanabhan V, Paumgartten FJ, Schoenfelder G. Urinary, circulating, and tissue biomonitoring studies indicate widespread exposure to bisphenol A. Environ Health Perspect  2010; 118: 1055– 1070. Google Scholar CrossRef Search ADS PubMed  22. Vandenberg LN, Hauser R, Marcus M, Olea N, Welshons WV. Human exposure to bisphenol A (BPA). Reprod Toxicol  2007; 24: 139– 177. Google Scholar CrossRef Search ADS PubMed  23. Dong S, Terasaka S, Kiyama R. Bisphenol A induces a rapid activation of Erk1/2 through GPR30 in human breast cancer cells. Environ Pollut  2011; 159: 212– 218. Google Scholar CrossRef Search ADS PubMed  24. Lan HC, Lin IW, Yang ZJ, Lin JH. Low-dose bisphenol A activates Cyp11a1 gene expression and corticosterone secretion in adrenal gland via the JNK signaling pathway. Toxicol Sci  2015; 148: 26– 34. Google Scholar CrossRef Search ADS PubMed  25. Hu MC, Chou SJ, Huang YY, Hsu NC, Li H, Chung BC. Tissue-specific, hormonal, and developmental regulation of SCC-LacZ expression in transgenic mice leads to adrenocortical zone characterization. Endocrinology  1999; 140: 5609– 5618. Google Scholar CrossRef Search ADS PubMed  26. Morrish DW, Dakour J, Li H, Xiao J, Miller R, Sherburne R, Berdan RC, Guilbert LJ. In vitro cultured human term cytotrophoblast: a model for normal primary epithelial cells demonstrating a spontaneous differentiation programme that requires EGF for extensive development of syncytium. Placenta  1997; 18: 577– 585. Google Scholar CrossRef Search ADS PubMed  27. Sooranna SR, Oteng-Ntim E, Meah R, Ryder TA, Bajoria R. Characterization of human placental explants: morphological, biochemical and physiological studies using first and third trimester placenta. Human Reprod  1999; 14: 536– 541. Google Scholar CrossRef Search ADS   28. Li L, Schust DJ. Isolation, purification and in vitro differentiation of cytotrophoblast cells from human term placenta. Reprod Biol Endocrinol  2015; 13: 71. Google Scholar CrossRef Search ADS PubMed  29. Zhang N, Wang WS, Li WJ, Liu C, Wang Y, Sun K. Reduction of progesterone, estradiol and hCG secretion by perfluorooctane sulfonate via induction of apoptosis in human placental syncytiotrophoblasts. Placenta  2015; 36: 575– 580. Google Scholar CrossRef Search ADS PubMed  30. Liu R, Xing L, Kong D, Jiang J, Shang L, Hao W. Bisphenol A inhibits proliferation and induces apoptosis in micromass cultures of rat embryonic midbrain cells through the JNK, CREB and p53 signaling pathways. Food Chem Toxicol  2013; 52: 76– 82. Google Scholar CrossRef Search ADS PubMed  31. Qian W, Zhu J, Mao C, Liu J, Wang Y, Wang Q, Liu Y, Gao R, Xiao H, Wang J. Involvement of CaM-CaMKII-ERK in bisphenol A-induced Sertoli cell apoptosis. Toxicology  2014; 324: 27– 34. Google Scholar CrossRef Search ADS PubMed  32. Vandenberg LN, Colborn T, Hayes TB, Heindel JJ, Jacobs DR Jr, Lee DH, Shioda T, Soto AM, vom Saal FS, Welshons WV, Zoeller RT, Myers JP. Hormones and endocrine-disrupting chemicals: low-dose effects and nonmonotonic dose responses. Endocrine Rev  2012; 33: 378– 455. Google Scholar CrossRef Search ADS   33. Watanabe M, Ohno S, Nakajin S. Effects of bisphenol A on the expression of cytochrome P450 aromatase (CYP19) in human fetal osteoblastic and granulosa cell-like cell lines. Toxicol Lett  2012; 210: 95– 99. Google Scholar CrossRef Search ADS PubMed  34. Kim JY, Han EH, Kim HG, Oh KN, Kim SK, Lee KY, Jeong HG. Bisphenol A-induced aromatase activation is mediated by cyclooxygenase-2 up-regulation in rat testicular Leydig cells. Toxicol Lett  2010; 193: 200– 208. Google Scholar CrossRef Search ADS PubMed  35. Harada N, Utsumi T, Takagi Y. Tissue-specific expression of the human aromatase cytochrome P-450 gene by alternative use of multiple exons 1 and promoters, and switching of tissue-specific exons 1 in carcinogenesis. Proc Natl Acad Sci  1993; 90: 11312– 11316. Google Scholar CrossRef Search ADS PubMed  36. Peretz J, Flaws JA. Bisphenol A down-regulates rate-limiting Cyp11a1 to acutely inhibit steroidogenesis in cultured mouse antral follicles. Toxicol Appl Pharmacol  2013; 271: 249– 256. Google Scholar CrossRef Search ADS PubMed  37. Rice S, Pellatt L, Ramanathan K, Whitehead SA, Mason HD. Metformin inhibits aromatase via an extracellular signal-regulated kinase-mediated pathway. Endocrinology  2009; 150: 4794– 4801. Google Scholar CrossRef Search ADS PubMed  38. Kau MM, Wang JR, Tsai SC, Yu CH, Wang PS. Inhibitory effect of bufalin and cinobufagin on steroidogenesis via the activation of ERK in human adrenocortical cells. Br J Pharmacol  2012; 165: 1868– 1876. Google Scholar CrossRef Search ADS PubMed  39. Seger R, Hanoch T, Rosenberg R, Dantes A, Merz WE, Strauss JF 3rd, Amsterdam A. The ERK signaling cascade inhibits gonadotropin-stimulated steroidogenesis. J Biol Chem  2001; 276: 13957– 13964. Google Scholar CrossRef Search ADS PubMed  40. Bouskine A, Nebout M, Brucker-Davis F, Benahmed M, Fenichel P. Low doses of bisphenol A promote human seminoma cell proliferation by activating PKA and PKG via a membrane G-protein– coupled estrogen receptor. Environ Health Perspect  2009; 117: 1053– 1058. Google Scholar CrossRef Search ADS PubMed  41. Daoud G, Amyot M, Rassart E, Masse A, Simoneau L, Lafond J. ERK1/2 and p38 regulate trophoblasts differentiation in human term placenta. J Physiol  2005; 566: 409– 423. Google Scholar CrossRef Search ADS PubMed  42. Cadepond F, Ulmann A, Baulieu EE. RU486 (mifepristone): mechanisms of action and clinical uses. Annu Rev Med  1997; 48: 129– 156. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Biology of Reproduction Oxford University Press

Low-dose bisphenol A activates the ERK signaling pathway and attenuates steroidogenic gene expression in human placental cells

Loading next page...
 
/lp/ou_press/low-dose-bisphenol-a-activates-the-erk-signaling-pathway-and-Pk2pmVbi8o
Publisher
Society for the Study of Reproduction
Copyright
© The Author(s) 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
0006-3363
eISSN
1529-7268
D.O.I.
10.1093/biolre/iox162
Publisher site
See Article on Publisher Site

Abstract

Abstract Bisphenol A (BPA) is an industrial material used for many plastic products and is considered an endocrine disruptor. BPA can be released into the environment and can spread through the food chain. It is well known that BPA exposure leads to lesions, especially in the reproductive system. According to previous studies, BPA reduces newborn numbers in pregnant mice and affects placentation. The placenta is a special endocrine organ during pregnancy. It secretes important hormones, such as progesterone and estrogen, to maintain gestation. In steroid hormone synthesis, two specific enzymes are important: P450scc (CYP11A1) converts cholesterol to pregnenolone and aromatase (CYP19) induces androgen conversion to estrogen. To determine the effects of a low dose of BPA on hormone synthesis in the placenta, we used JEG-3 cells as a model. We found that the steroidogenic genes CYP11A1 and CYP19 were downregulated in human tissues by detectable concentrations of BPA (1–1000 nM), which do not affect cell viability. Furthermore, we demonstrated that BPA influenced the ERK signaling pathway and resulted in hormone reductions. An analysis of trophoblasts in primary culture from a term human placenta showed the same phenomena. Our data demonstrate that treatment with a low dose of BPA does not affect human placental cell survival, but decreases hormone production via to the downregulation of steroidogenic genes and ERK signaling pathway changes. Introduction Bisphenol A (BPA) is synthesized by the condensation of acetone with two equivalents of phenol. It has been used to make plastics since 1957. BPA is one of the most abundant synthetic chemicals in the world, and at least 3.6 million tons are manufactured per year. BPA-based plastic is used to make a variety of common consumer goods, such as water bottles, sports equipment, and dental sealants [1]. It is well known that BPA functions as endocrine-disrupting chemical, which were first found to have harmful effects on fertility in animals, such as sex reversal in fish, decline of ovulation in birds, and abnormal spermatogenesis in mammalians [2]. Furthermore, animals exposed to BPA have elevated rates of diabetes [3], mammary and prostate cancers [4], neurological defects [5], early puberty, and reproductive problems [1, 6]. The reproductive problems include underdeveloped gonads, abnormal spermatogenesis or ovulation, and abortion. Many studies have discussed the effects of BPA on gonads, but far fewer have examined effects on the placenta. The placenta is a special endocrine organ that only exists during gestation. It connects the developing fetus and maternal blood supply to allow nutrient uptake, waste elimination, and gas exchange. The placenta grows throughout pregnancy and functions not only as a selective barrier but also as an immune regulator and hormone supporter. The placenta secretes several hormones that are essential for gestation, such as human chorionic gonadotropin (hCG), estrogen, and progesterone [7]. They play important roles during pregnancy in the support of embryonic development and regulate not only the uterine environment but also immune response of the mother [8]. These hormones could be synthesized directly by trophoblasts and several catalytic enzymes [9]. The regulation of steroidogenic enzymes controls the conversion of cholesterol into various steroid hormones that are important for reproduction and pregnancy. If hormone production is disrupted, placental development is affected, leading to pregnancy failure, such as miscarriage. Several papers have documented that BPA associated with recurrent miscarriage or lower birth weight that implied to increases the risk of pregnancy failure [10–12]. It is well known that BPA could be transferred through the placental barrier and induces damage in both the fetus and placenta [13, 14]. In animals, BPA exposure is associated with a reduced number of embryos, reduced fetal body weight, and abnormal placental development [15]. The rate of premature delivery and intrauterine growth restriction increases in response to BPA [16]. Importantly, investigations of humans have shown similar phenomena [11, 17]. However, studies of the mechanisms by which BPA affects the placenta are limited. It is well known that BPA induces apoptosis and affects gene expression in placental cells at a high concentration [18]. Angiogenesis and the normal morphology of the placenta are disrupted after BPA exposure [19]. Furthermore, aromatase, an important steroidogenic enzyme, is reduced by BPA in placental JEG-3 cells [20]. However, the BPA dosage used in these studies is much higher than clinically detectable concentrations. The range of BPA levels in human serum obtained from different areas is 0.2–200 ng/ml (1–1000 nM) and around 10 ng/g in the human placenta [21, 22]. The tolerable daily intake of BPA was reduced from 50 to 4 μg/kg (body weight)/day by the European Food Standards Agency in 2015. Therefore, we were interested in the effects of low-dose BPA on steroidogenic genes in placental cells and its mechanisms of action. The detectable dosage in human tissues, 1–1000 nM BPA, was used to stimulate human placental JEG-3 cells. These results reliably reflect the effects of typical contact with small amounts of BPA in daily life. Furthermore, the mechanism of BPA effects in placental cells is an important topic, but few has been studied. We investigated the JNK/c-Jun and ERK signaling pathway because previous studies showed that BPA induced the activations in adrenal and breast cells [23, 24]. In this study, we try to verify BPA effects on hormone synthesis of human placental cells in low concentrations and the related signaling pathways. Materials and methods Cell culture and reagents JEG-3, a human choriocarcinoma cell line, was maintained in Dulbecco modified Eagle medium (DMEM) supplemented with 10% fetal calf serum and cultured at 37°C and 5% CO2 in an incubator. Cells that passage 5–15 after thawing were used in experiments. 8-Br-cAMP (B5386; Sigma-Aldrich, St. Louis, MO, USA) at 1 mM was added to JEG-3 cells for 24 h for the positive control. Bisphenol A (133027; Sigma-Aldrich) was prepared in methanol and added to the cell medium at a suitable dose, followed by incubation for 24 h (expose for 48, 72, 96 h only in Figure 1B) in stimulation experiments. Methanol was added to control groups. U0126 (U120; Sigma-Aldrich), an inhibitor of ERK1/2, was used to block specific signals in JEG-3 cells for 4 h of pretreatment before BPA exposure (for 28 h total) at a final concentration 10 μM. Figure 1. View largeDownload slide (A) Cell viability was measured using the MTT assay after BPA treatment for 24 h at various concentrations and durations. The relative viabilities of JEG-3 cells were similar to those of untreated control cells at 1, 50, and 75 mM, and decreased when the BPA concentration was greater than 100 μM. (B) Long-term exposure (48, 72, and 96 h) to low-dose BPA (10 nM, 1 μM) did not significantly reduce cell viability. *P < 0.05 compared to BPA untreated control. Figure 1. View largeDownload slide (A) Cell viability was measured using the MTT assay after BPA treatment for 24 h at various concentrations and durations. The relative viabilities of JEG-3 cells were similar to those of untreated control cells at 1, 50, and 75 mM, and decreased when the BPA concentration was greater than 100 μM. (B) Long-term exposure (48, 72, and 96 h) to low-dose BPA (10 nM, 1 μM) did not significantly reduce cell viability. *P < 0.05 compared to BPA untreated control. Cell viability assay Cell viability was measured using an MTT assay. Reductions of MTT tetrazolium salts were used to detect enzyme activity in the mitochondria, which only takes place in living cells. Thiazolyl Blue Tetrazolium Bromide (MTT) (M5655; Sigma-Aldrich) was prepared in phosphate-buffered saline (PBS), and then diluted in serum-free DMEM at a final concentration 1 mg/ml before use. JEG3 cells were seeded in plates and maintained overnight before BPA treatment at the indicated concentrations (0–200 μM) for the indicated time (0–96 h). Medium was removed and 200 μl of MTT solution/well was added, followed by incubation for 2 h at 37°C. Then, dimethyl sulfoxide (200 μl/well) was added to dissolve crystals. A microplate reader was used for detection at a wavelength of 450 nm. Plasmids and reporter assay Plasmids for CYP11a1-Luc 2.3 kb and CYP19-Luc (–951 to +84) containing the human gene promoters were described previously [25]. JEG-3 cells were transfected using Lipofectamine 2000 (#11668; Invitrogen, Carlsbad, CA, USA) according to manufacturer's suggested procedures. Cells were harvested at 24–48 h after transfection in lysis buffer (100 mM K3PO4, pH 7.8, 0.2% Triton X-100, 0.5 mM DTT, 0.2 mM PMSF) and subjected to luciferase assays using the Dual-Luciferase Reporter Assay System (E1910; Promega, Madison, WI, USA). Methanol and empty vector were added to control groups. Quantitative real-time PCR Real-time PCR was performed using the Rotor-Gene Q Real Time PCR system (Qiagen) with KAP SYBR® FAST qPCR Kit Master Mix (KAPA Biosystems Woburn, MA) according to the instruction manual. The PCR parameters used for CYP11A1, CYP19, and HPRT were as follows: 95°C for 3 min, 95°C for 3 s and 60°C for 20 s (40 cycles). The cycle threshold (Ct) values and related data were analyzed by using the Rotor-Gene Q Real Time PCR System Software (Qiagen). The expression level of CYP19 was normalized with that of HPRT. The relative expression levels (in fold) were determined by using the 2-(▵▵Ct) method. The sequence for the forward primer of CYP11A1 is 5΄- GAGGGAGACGGGCACACA -3΄ and that for the reverse primer is 5΄- GCCCTCGGACTTAAAGAG -3΄. The sequence for the forward primer of CYP19 is 5΄- GGAATTATGAGGGCACAT -3΄ and that for the reverse primer is: 5΄- AGACTCGCATGAATTCTC -3΄. For the HPRT gene (used as an internal control), the sequence for the forward primer is 5΄- GAACCAGGTTATGACCTTGAT -3΄ and that for the reverse primer is 5΄- CCTGTTGACTGGTCATTACAA -3΄. Western blotting and antibodies JEG-3 cells were cultured in 1 × 105/well of 6-well plate, and primary cultures were seeded in 2.5 × 104/well of 24-well plate. Whole cell extracts were harvested in lysis buffer (100 mM potassium phosphate, pH 7.8, 0.2% Triton X-100, 0.5 mM DTT, 0.2 mM PMSF) or SDS gel loading buffer for 24 h after treatment. An equal amount of cell extract (10 μg/l) was separated by SDS-PAGE and transferred to a PVDF membrane (Millipore, Billerica, MA, USA). Membranes were incubated with anti-CYP11A1 (ab75497; Abcam, Cambridge, UK), anti-CYP19 (ab124776; Abcam), anti-ERK (#4695; Cell Signaling Technology, Inc., Danvers, MA, USA), anti-phospho-ERK (#4376; Cell Signaling Technology, Inc.), anti- Cytokeratin-7 (MAB 3226; Millipore), or anti-tubulin (GTX628802; GeneTex, Inc., Irvine, CA, USA) antibodies overnight at 4°C (see Supplementary Table S1 for antibody information). They were then incubated with a horseradish peroxidase-conjugated secondary antibody for 1 h at 25°C. Signals were developed using the ECL detection reagent and revealed in the Smart Chemi chemiluminescence image detection system (ChampChemi, SageCreation). The quantitative level of signal determined by densitometric analysis using Image J and normalized with the internal controls. Enzyme-linked immunosorbent assay for hormones JEG-3 cells were cultured in 1 × 105/well of 6-well plate, and primary cultures were seeded in 2.5 × 104/well of 24-well plate. Samples of cell culture medium were collected and maintained in tubes at –80°C until detection. Samples were determined using an enzyme-linked immunosorbent assay (ELISA)-based direct sandwich technique. Specific hormone kits were used, including the Progesterone EIA Kit obtained from the Cayman Chemical Company (Item Number 582601; Ann Arbor, MI, USA) and the Estradiol ELISA Kit from Calbiotech (ES180S-100; Spring Valley, CA, USA). A standard curve was generated using the reference standard set supplied in the kit. The samples were measured according to the instructions accompanying the kit. All results were read using a microplate reader (Luminescence Scanner; Thermo, Waltham, MA, USA) at wavelengths of 450/415 nm. The hormone concentration was calculated based on the standard curve. Primary culture of trophoblasts Placentas were obtained from women with normal pregnancies between 38 and 40 weeks of gestation by caesarean section or vaginal deliveries at the Tri-Service General Hospital, National Defense Medical Center (NDMC), Taipei, Taiwan. A total of seven placentas were collected and five primary cultures were generated and used in this study. All experiments were performed using three individual placenta samples and repeated at least twice. All procedures were consistent with those of previous studies [26, 27] and were approved by the Institutional Review Board (IRB) at NDMC (permission number 2–104-05–149). Term placentas were maintained in cold saline, and 10–15 pieces of tissue (3 cm3) were collected at random. Placental tissues were stored in ice-cold PBS containing 1% penicillin/streptomycin and brought to the laboratory within 1 h of delivery. The tissue was washed with PBS three to five times to remove blood to the greatest extent possible. Then, the placental tissue was cut into small pieces and any blood vessels or clots were removed. This tissue was rewashed several times with cold PBS and dissolved in 0.1% collagenase containing medium for 30 min. The undecomposed tissue was removed using a filter, and RBC lysis buffer was added for 1–2 min. The dispersed placental cells were purified using a 5%–65% Percoll gradient (17–0891; GE Healthcare, Chicago, IL, USA). The cell suspension was centrifuged at 650 × g for 10 min and the supernatants were removed, followed by resuspension in DMEM/F12 medium containing 10% bovine serum albumin and 1% penicillin/streptomycin. The final cell suspension was seeded in 2.5 × 104/well of 24-well plate and cultured a 37°C and 5% CO2 in an incubator. Isolated human cytotrophoblasts were spontaneously aggregate and syncytialization, and we characterized using a spontaneous differentiation marker, syncytin, and hCG production, similar to previous studies [28, 29]. Immunocytochemistryof trophoblast marker cytokeratin-7 (MAB 3226; Millipore) was performed as previous study [28] and detected using flow cytometry (BD; Flowcytometer FACS Verse) or confocal microscope (Zeiss; Confocal Microscopy LSM510). BPA stimulates for 24 h at 9–12 days after seeding. The cultured medium was collected for ELISA analysis, and whole cell extracts were recovered for immune blot. Results JEG3 cell viability after BPA treatment BPA induces apoptosis in many cells [30, 31], but the aim of this study was to use concentrations that are not expected to affect cell viability. Therefore, JEG-3 cell viability after low-dose BPA treatment was detected. Cell viability was determined using the MTT assay after BPA treatment at various concentrations and durations. The results showed that the viabilities of JEG-3 cells were similar to those of untreated controls at 1, 50, and 75 μM BPA, and decreased for BPA concentrations of greater than 100 μM (Figure 1A). For long-term exposure to a low dose of BPA (10 nM, 1 μM), cell viability was not significantly reduced or only slightly reduced (10 nM, 72 h) compared with that of control cells (Figure 1B). These results indicated that JEG-3 placental cells survived when treated with human-detectable BPA concentrations (1–1000 nM). BPA effects of steroidogenic gene expressions and hormone secretions After confirming that JEG-3 placental cells survived using BPA concentrations detectable in the human body, we examined changes in steroidogenesis-related gene expression in JEG-3 cells after exposure to BPA. A luciferase reporter assay was performed and a group treated with 8-Br-cAMP was used as a positive control. CYP11A1, CYP19, and StAR genes were examined. Based on this analysis, the relative expression levels of both CYP11A1 and CYP19 decreased significantly after BPA treatment (Figure 2A and C). Furthermore, quantitative real-time PCR were performed to detect the endogenous gene expression of CYP11A1 and CYP19. The results showed that BPA downregulated CYP11A1 (Figure 2B) and CYP19 (Figure 2D) mRNA levels which were consistent with reporter assay. The protein levels of CYP11A1 and CYP19 were also attenuated (Figure 2E). However, the StAR gene, which controls cholesterol transport, was not affected (Supplementary Figure S1). Downstream hormonal changes were also detected. We examined the concentrations of progesterone and estradiol in the JEG-3 cell culture medium. When JEG-3 cells were exposed to low-dose BPA in the culture medium, the levels of steroidogenesis downstream products, such as progesterone and estradiol, decreased (Figure 3A and B) compared to the levels observed for cells in untreated culture medium. According to these results, we found that JEG-3 cells survived when treated with a low dose of BPA, but the expression levels of steroidogenic genes and final hormone secretion levels were altered. Figure 2. View largeDownload slide Examination of the changes in steroidogenesis-related gene expression in JEG-3 cells after exposure to BPA for 24 h. A luciferase reporter assay was performed and the group treated with 8-Br-cAMP was used as a positive control. CYP11A1 (A) and CYP19 (B) were examined. *P < 0.05 compared to reporter transfection alone (lane 2). Quantitative real-time PCR of CYP11A1 (B) and CYP19 (D) was shown in relative value which was normalized against the internal control, HPRT gene. *P < 0.05 compared with the level of untreated control (lane 1). The relative expression levels of CYP11A1 and CYP19 decreased significantly after BPA treatment. The protein levels of CYP11A1 and CYP19 were detected by western blotting (C). α-Tubulin was used as an internal control. Each number below the gel is the signal density quantification of each land which normalized with the internal control. Figure 2. View largeDownload slide Examination of the changes in steroidogenesis-related gene expression in JEG-3 cells after exposure to BPA for 24 h. A luciferase reporter assay was performed and the group treated with 8-Br-cAMP was used as a positive control. CYP11A1 (A) and CYP19 (B) were examined. *P < 0.05 compared to reporter transfection alone (lane 2). Quantitative real-time PCR of CYP11A1 (B) and CYP19 (D) was shown in relative value which was normalized against the internal control, HPRT gene. *P < 0.05 compared with the level of untreated control (lane 1). The relative expression levels of CYP11A1 and CYP19 decreased significantly after BPA treatment. The protein levels of CYP11A1 and CYP19 were detected by western blotting (C). α-Tubulin was used as an internal control. Each number below the gel is the signal density quantification of each land which normalized with the internal control. Figure 3. View largeDownload slide Changes in hormones regulated by CYP genes were detected. The concentrations of progesterone (A) and estradiol (B) in the JEG-3 cell culture medium after 24 h of BPA treatment were examined. The levels of steroidogenesis final products, such as progesterone and estradiol, decreased. The group treated with 8-Br-cAMP was used as a positive control. *P < 0.05 compared to BPA untreated control. Figure 3. View largeDownload slide Changes in hormones regulated by CYP genes were detected. The concentrations of progesterone (A) and estradiol (B) in the JEG-3 cell culture medium after 24 h of BPA treatment were examined. The levels of steroidogenesis final products, such as progesterone and estradiol, decreased. The group treated with 8-Br-cAMP was used as a positive control. *P < 0.05 compared to BPA untreated control. ERK signaling pathway participated in BPA influences to steriodogenesis In addition, we explored the signaling pathway through which BPA influenced the expression of CYP genes and consequently affected hormone levels. Based on a literature search and our preliminary study, we decided to examine the correlation between JNK/c-Jun or ERK signaling pathway and BPA exposure. We found that the addition of BPA increased phosphorylated ERK (Figure 4A), but c-Jun phosphorylation had no significantly difference (data not shown). After the addition of U0126, a specific inhibitor of ERK1/2, to the culture medium, the attenuation of CYP gene activity was recovered, and this was statistically significant compared to BPA treated alone (Figure 4B and C). When we performed a western blotting analysis, we found that BPA exposure decreased the expression of CYP proteins, and this expression was recovered using U0126 (Figure 5A). Consequent hormonal changes (i.e. the concentrations of progesterone and estradiol) also declined. Hormonal changes also recovered after treatment with U0126 (Figure 5B and C). Figure 4. View largeDownload slide To explore the ERK signaling pathway and its relationship to the addition of BPA for 24 h, protein levels of phosphorylated ERK and total ERK were measured by western blotting (A). BPA led to an increase in phosphorylated ERK. Each number below the gel represents the signal density quantification of each land which normalized with total ERK. With the addition of U0126, a specific inhibitor of ERK1/2, the attenuation of steroidogenic genes, CYP11A1 (B) and CYP19 (C), was recovered, with a statistically significant difference. *P < 0.05 compared to BPA untreated control. #P < 0.05 for comparisons between indicated groups. Figure 4. View largeDownload slide To explore the ERK signaling pathway and its relationship to the addition of BPA for 24 h, protein levels of phosphorylated ERK and total ERK were measured by western blotting (A). BPA led to an increase in phosphorylated ERK. Each number below the gel represents the signal density quantification of each land which normalized with total ERK. With the addition of U0126, a specific inhibitor of ERK1/2, the attenuation of steroidogenic genes, CYP11A1 (B) and CYP19 (C), was recovered, with a statistically significant difference. *P < 0.05 compared to BPA untreated control. #P < 0.05 for comparisons between indicated groups. Figure 5. View largeDownload slide (A) Western blotting showed that BPA exposure for 24 h decreased the expression of CYP proteins, and expression levels were recovered using U0126. Each number below the gel is the signal density quantification of each land which normalized with internal control or total ERK. Consequent hormonal changes in progesterone (B) and estradiol (C) were also declined. Recovery of hormone reductions was also detected after treatment with U0126. *P < 0.05 compared to BPA untreated control. #P < 0.05 for comparisons between the same dose of BPA with or without U0126. Figure 5. View largeDownload slide (A) Western blotting showed that BPA exposure for 24 h decreased the expression of CYP proteins, and expression levels were recovered using U0126. Each number below the gel is the signal density quantification of each land which normalized with internal control or total ERK. Consequent hormonal changes in progesterone (B) and estradiol (C) were also declined. Recovery of hormone reductions was also detected after treatment with U0126. *P < 0.05 compared to BPA untreated control. #P < 0.05 for comparisons between the same dose of BPA with or without U0126. Identical response to BPA in human primary trophoblast culture Next, the primary trophoblast culture from the human placenta was used to confirm previous findings using the JEG3 cell line. The primary cultures of term placenta were generated following previous reports [26, 28], and the details of experimental procure were described in ‘Primary culture of trophoblasts’ under Materials and Methods section. The cell purity of trophopblast in our system was over than 70% of total collected placental cells according to cytokeratin-7 expression (Supplementary Figure S2). The isolated trophoblast cells would spontaneously aggregate and fuse to form multinucleated cells, and differentiate to syncytiotrophoblast according to previous study [26, 28]. The cell morphology was observed at day 7 after seeding (Figure 6A). The cells attached the plate and become multinucleated (Figure 6A, arrow pointed). The syncytiotrophoblast properties were characterized based on hCG secretion (Figure 6B) and expression of the marker protein syncytin (Figure 6C), which were not affected by BPA. After 5 days of culture, primary trophoblasts were treated with BPA and the expression levels of CYP11A1, CYP19, and phosphorylated ERK were measured. ERK phosphorylation was activated and CYP genes were downregulated (Figure 6C), consistent with previous data in JEG3 cells. Reductions in progesterone and estradiol production were also observed in primary cultures with BPA treatment (Figure 6D). Figure 6. View largeDownload slide (A) Cell morphology of placental primary culture at day 7 was observed using confocal microscope. The trophoblast was stained with cytokeratin-7 (red) and DAPI (blue). The arrows indicated multinucleated cells. Two panels were shown from individual placentas. (B) Detection of hCG secretion by ELISA in culture medium from day 1 to day 5 after collection. Secretion increased as culture time increased. BPA stimulate for 24 h at 9–12 days after seeding. The cultured medium was collected for ELISA analysis, and whole cell extracts were recovered for protein detection. (C) Western blotting was performed to detect protein expression levels of the syncytiotrophoblast marker, syncytin, CYP proteins, and ERK phosphorylation with or without BPA treatment. Number 1–3 in the top of the gel indicated three individual samples. Each number below the gel represents the signal density quantification of each land which normalized with internal control or total ERK. (D) The steroid hormone, progesterone, and estradiol were also measured in primary culture medium with BPA treatment. Relative hormone level were shown, and BPA untreated control was set as 100. *P < 0.05 compared to BPA untreated control. Figure 6. View largeDownload slide (A) Cell morphology of placental primary culture at day 7 was observed using confocal microscope. The trophoblast was stained with cytokeratin-7 (red) and DAPI (blue). The arrows indicated multinucleated cells. Two panels were shown from individual placentas. (B) Detection of hCG secretion by ELISA in culture medium from day 1 to day 5 after collection. Secretion increased as culture time increased. BPA stimulate for 24 h at 9–12 days after seeding. The cultured medium was collected for ELISA analysis, and whole cell extracts were recovered for protein detection. (C) Western blotting was performed to detect protein expression levels of the syncytiotrophoblast marker, syncytin, CYP proteins, and ERK phosphorylation with or without BPA treatment. Number 1–3 in the top of the gel indicated three individual samples. Each number below the gel represents the signal density quantification of each land which normalized with internal control or total ERK. (D) The steroid hormone, progesterone, and estradiol were also measured in primary culture medium with BPA treatment. Relative hormone level were shown, and BPA untreated control was set as 100. *P < 0.05 compared to BPA untreated control. Discussion According to our results, a low dose of BPA (1–1000 nM), which does not affect cell viability, affects some signaling molecules, such as phosphorylated ERK. The activation of ERK phosphorylation reduced CYP11A1 and CYP19 expression and resulted in decreased estradiol and progesterone production. The disruption of hormone secretion might cause placental insufficiency and contribute to pregnancy failure. These findings suggest a potential mechanism by which BPA causes reproductive toxicity. Although this is not the first study of the effects of BPA on CYP19 in the placenta, the concentrations examined and findings are absolutely different. In a previous study, Huang showed that CYP19 mRNA expression was significantly reduced in response to approximately 20 μM BPA [20]; however, the apoptosis rate of JEG3 cells was elevated for this dosage [18]. Therefore, a decreased expression level of CYP19 using a high dose of BPA may be explained by proapoptotic activity. On the other hand, treatment with BPA at less than 1 μM does not cause cell death; according to our results and those of a previous study [18], CYP19 expression still decreased. However, the effects of BPA at low concentrations are probably mediated by the regulation of signaling pathways rather than cell toxicity. It is well known that BPA activates different signaling pathways and results in different outcomes depending on its concentration [32]. In addition to concentration-dependent differences, BPA has multiple functions in different tissues. In human osteoblastic (SV-HFO) and ovarian granulosa-like (KGN) cell lines, BPA suppresses CYP19 activity [33], similar to our results. However, in 2010, Kim indicated that BPA induces aromatase (CYP19) activity and enhances estrogen production in Leydig cells of the testis [34]. The differences in observed effects may be explained by the tissue specificity of the CYP19 promoter, as demonstrated previously [35]. For example, the placenta-specific promoter is I.1 and promoter I.4 can be induced in preadipocytes; thus, the same gene shows different responses to a chemical owing to promoter differences. Furthermore, in studies of another key enzyme, CYP11A1, BPA also exhibited multiple effects. In a mouse adrenocortical cell line, BPA induces CYP11a1 expression and activates steroidogenesis [24], but BPA downregulates Cyp11a1 to inhibit steroidogenesis in cultured mouse antral follicles [36]. Therefore, the effects of BPA uniquely depend on cell type and dosage, and we found that steroidogenic genes are downregulated in human placental JEG3 cells. In an investigation of signal transduction of steroidogenic genes, we determined that the ERK pathway may participate in BPA function. The ERK signaling pathway is important for cell proliferation, but it downregulates hormone production in response to treatment with various drugs. Metformin, which is used to treat polycystic ovary syndrome, inhibits aromatase via ERK signaling [37]. Bufalin and cinobufagin inhibit steroidogenesis in adrenocortical cells via ERK [38]. In granulosa cells, ERK signaling inhibits gonadotropin-stimulated steroidogenesis [39]. In our study, BPA inhibited steroidogenic genes and reduced hormone production via the ERK signaling pathway. A previous study also showed that BPA induces ERK phosphorylation, which is involved in apoptosis [31] and cancer cell proliferation [23, 40]. Although BPA activation of ERK signaling is not a novel finding, this is the first paper to examine the role of the ERK signaling pathway in placenta cells under BPA stimulation. Interestingly, we found that ERK inhibitor (U0126) alone could activate steroidogenesis in placental cells (Figures 4B, C and 5) without BPA. It implied there are some endogenous ERK signaling that inhibit steroidogenic genes in background and could be blocked by U0126. We think the endogenous ERK signaling may come from the 10% serum in cultured medium because previous study also revealed the ERK1/2 signaling in placenta cells under 10% serum cultured without drug treatment [41]. In addition to ERK, many signaling molecules could be activated by BPA, such as CREB, and p53 [30, 34], and the roles of these molecules cannot be ruled out in our system. Other signaling pathways involved in BPA effects on placental cells need to be further studied. The inhibition of steroidogenic gene expression resulted in a decrease in hormone secretion. According to our results, after treatment with 1 μM BPA, progesterone levels were 30% and estradiol levels were 50% of the levels observed in control treatments (Figure 3). It is well known that hormone insufficiency causes pregnancy failure, which is also observed in BPA-exposed animals [15]. Estrogen and progesterone are two major steroid hormones secreted in the placenta [8]. Estrogen is important to stimulate myometrium growth of the uterus and mammary gland development. Major functions of progesterone are the maintenance of the endometrium and providing an environment for embryonic development. In addition, progesterone also regulates contractility in uterine smooth muscle tissues and inhibits the secretion of gonadotropins of the pituitary. Blocking progesterone action by an antagonist, RU-486, causes abortion [42]. The abortion rate and recurrent miscarriage in humans are associated with BPA concentrations in the body [1, 10]. We suggest that these defects related to BPA may be due to the suppression of steroidogenic gene expression and consequent reductions in hormone production. However, the precise physiological effects of BPA in maternal tissues and the fetus require further study, and future studies should examine whether hormone supplementation rescues pregnancy defects caused by BPA. Conclusion In human placental cells, the steroidogenic genes CYP11A1 and CYP19 were downregulated via the ERK signaling pathway for BPA doses detectable in human tissues (1–1000 nM). The final hormone production levels of estrogen and progesterone by placental cells were significantly reduced after BPA treatment. These findings may explain the association between the abortion rate and recurrent miscarriage in humans with BPA exposure. Supplementary data Supplementary data are available at BIOLRE online. Supplementary Table S1. Primary antibodies used in the study. Supplementary Figure S1. (A) A StAR reporter construct was used to test the transcriptional activities of steroidogenic genes. After 24 h of BPA treatment using a low dose (1 nM to 1 μM), the transcriptional activity of StAR, which controls cholesterol transport, was not affected. (B) Protein expression of StAR was not changed by BPA based on western blotting. Each number below the gel represents the signal density quantification of each land which normalized with internal control. Supplementary Figure S2. To reveal the cell purity of primary culture, expression of cytokeratin-7 was analyzed using flow cytometry. Unstaining control (A) was performed without first antibody, and JEG-3 cell (B) was stained as the positive control. (C) Human placental primary culture showed over 70% of positive staining. (D) The statistic results of trophoblast staining were shown from 3 independent experiments. Acknowledgments We thank Dr Meng-Chun Hu of the Institute of Physiology, National Taiwan University College of Medicine, Taipei, for providing the CYP19-Luc construct, and Dr Ying Chen of Institute of Biology and Anatomy, National Defense Medical Center, Taipei, for providing E-cadherin antibody. Conflict of interest: The authors have no conflicts of interest to declare. Footnotes † Grant Support: This work was supported by the Ministry of Science and Technology (Grant number MOST 104–2320-B-016–015 and MOST 105–2320-B-016–013) and the Ministry of National Defense in Taiwan (Grant number MAB-104–090 and MAB-105–060). References 1. Tsai WT. Human health risk on environmental exposure to Bisphenol-A: a review. J Environ Sci Health C Environ Carcinog Ecotoxicol Rev  2006; 24( 2): 225– 255. Google Scholar CrossRef Search ADS PubMed  2. Flint S, Markle T, Thompson S, Wallace E. Bisphenol A exposure, effects, and policy: a wildlife perspective. J Environ Manage  2012; 104: 19– 34. Google Scholar CrossRef Search ADS PubMed  3. Ahmadkhaniha R, Mansouri M, Yunesian M, Omidfar K, Jeddi MZ, Larijani B, Mesdaghinia A, Rastkari N. Association of urinary bisphenol a concentration with type-2 diabetes mellitus. J Environ Health Sci Eng  2014; 12( 1): 64. Google Scholar CrossRef Search ADS PubMed  4. Soto AM, Sonnenschein C. Environmental causes of cancer: endocrine disruptors as carcinogens. Nat Rev Endocrinol  2010; 6( 7): 363– 370. Google Scholar CrossRef Search ADS PubMed  5. Hajszan T, Leranth C. Bisphenol A interferes with synaptic remodeling. Front Neuroendocrinol  2010; 31( 4): 519– 530. Google Scholar CrossRef Search ADS PubMed  6. Maffini MV, Rubin BS, Sonnenschein C, Soto AM. Endocrine disruptors and reproductive health: the case of bisphenol-A. Mol Cell Endocrinol  2006; 254–255: 179– 186. Google Scholar CrossRef Search ADS PubMed  7. Hobson BM. Production of gonadotrophin, oestrogens and progesterone by the primate placenta. Adv Reprod Physiol  1971; 5: 67– 102. Google Scholar PubMed  8. Pepe GJ, Albrecht ED. Actions of placental and fetal adrenal steroid hormones in primate pregnancy. Endocr Rev  1995; 16: 608– 648. Google Scholar PubMed  9. Miller WL. Molecular biology of steroid hormone synthesis. Endocrine Rev  1988; 9( 3): 295– 318. Google Scholar CrossRef Search ADS   10. Sugiura-Ogasawara M, Ozaki Y, Sonta S, Makino T, Suzumori K. Exposure to bisphenol A is associated with recurrent miscarriage. Hum Reprod  2005; 20( 8): 2325– 2329. Google Scholar CrossRef Search ADS PubMed  11. Pinney SE, Mesaros CA, Snyder NW, Busch CM, Xiao R, Aijaz S, Ijaz N, Blair IA, Manson JM. Second trimester amniotic fluid bisphenol A concentration is associated with decreased birth weight in term infants. Reprod Toxicol  2017; 67: 1– 9. Google Scholar CrossRef Search ADS PubMed  12. Shen Y, Zheng Y, Jiang J, Liu Y, Luo X, Shen Z, Chen X, Wang Y, Dai Y, Zhao J, Liang H, Chen A et al.   Higher urinary bisphenol A concentration is associated with unexplained recurrent miscarriage risk: evidence from a case-control study in eastern China. PLoS One  2015; 10( 5): e0127886. Google Scholar CrossRef Search ADS PubMed  13. Balakrishnan B, Henare K, Thorstensen EB, Ponnampalam AP, Mitchell MD. Transfer of bisphenol A across the human placenta. Am J Obstet Gynecol  2010; 202( 393): e391– e397. 14. Schonfelder G, Wittfoht W, Hopp H, Talsness CE, Paul M, Chahoud I. Parent bisphenol A accumulation in the human maternal-fetal-placental unit. Environ Health Perspect  2002; 110: a703– a707. Google Scholar CrossRef Search ADS PubMed  15. Tachibana T, Wakimoto Y, Nakamuta N, Phichitraslip T, Wakitani S, Kusakabe K, Hondo E, Kiso Y. Effects of bisphenol A (BPA) on placentation and survival of the neonates in mice. J Reprod Dev  2007; 53: 509– 514. Google Scholar CrossRef Search ADS PubMed  16. Ranjit N, Siefert K, Padmanabhan V. Bisphenol-A and disparities in birth outcomes: a review and directions for future research. J Perinatol  2010; 30: 2– 9. Google Scholar CrossRef Search ADS PubMed  17. Yamada H, Furuta I, Kato EH, Kataoka S, Usuki Y, Kobashi G, Sata F, Kishi R, Fujimoto S. Maternal serum and amniotic fluid bisphenol A concentrations in the early second trimester. Reprod Toxicol  2002; 16: 735– 739. Google Scholar CrossRef Search ADS PubMed  18. Morice L, Benaitreau D, Dieudonne MN, Morvan C, Serazin V, de Mazancourt P, Pecquery R, Dos Santos E. Antiproliferative and proapoptotic effects of bisphenol A on human trophoblastic JEG-3 cells. Reprod Toxicol  2011; 32: 69– 76. Google Scholar CrossRef Search ADS PubMed  19. Tait S, Tassinari R, Maranghi F, Mantovani A. Bisphenol A affects placental layers morphology and angiogenesis during early pregnancy phase in mice. J Appl Toxicol  2015; 35: 1278– 1291. Google Scholar CrossRef Search ADS PubMed  20. Huang H, Leung LK. Bisphenol A downregulates CYP19 transcription in JEG-3 cells. Toxicol Lett  2009; 189: 248– 252. Google Scholar CrossRef Search ADS PubMed  21. Vandenberg LN, Chahoud I, Heindel JJ, Padmanabhan V, Paumgartten FJ, Schoenfelder G. Urinary, circulating, and tissue biomonitoring studies indicate widespread exposure to bisphenol A. Environ Health Perspect  2010; 118: 1055– 1070. Google Scholar CrossRef Search ADS PubMed  22. Vandenberg LN, Hauser R, Marcus M, Olea N, Welshons WV. Human exposure to bisphenol A (BPA). Reprod Toxicol  2007; 24: 139– 177. Google Scholar CrossRef Search ADS PubMed  23. Dong S, Terasaka S, Kiyama R. Bisphenol A induces a rapid activation of Erk1/2 through GPR30 in human breast cancer cells. Environ Pollut  2011; 159: 212– 218. Google Scholar CrossRef Search ADS PubMed  24. Lan HC, Lin IW, Yang ZJ, Lin JH. Low-dose bisphenol A activates Cyp11a1 gene expression and corticosterone secretion in adrenal gland via the JNK signaling pathway. Toxicol Sci  2015; 148: 26– 34. Google Scholar CrossRef Search ADS PubMed  25. Hu MC, Chou SJ, Huang YY, Hsu NC, Li H, Chung BC. Tissue-specific, hormonal, and developmental regulation of SCC-LacZ expression in transgenic mice leads to adrenocortical zone characterization. Endocrinology  1999; 140: 5609– 5618. Google Scholar CrossRef Search ADS PubMed  26. Morrish DW, Dakour J, Li H, Xiao J, Miller R, Sherburne R, Berdan RC, Guilbert LJ. In vitro cultured human term cytotrophoblast: a model for normal primary epithelial cells demonstrating a spontaneous differentiation programme that requires EGF for extensive development of syncytium. Placenta  1997; 18: 577– 585. Google Scholar CrossRef Search ADS PubMed  27. Sooranna SR, Oteng-Ntim E, Meah R, Ryder TA, Bajoria R. Characterization of human placental explants: morphological, biochemical and physiological studies using first and third trimester placenta. Human Reprod  1999; 14: 536– 541. Google Scholar CrossRef Search ADS   28. Li L, Schust DJ. Isolation, purification and in vitro differentiation of cytotrophoblast cells from human term placenta. Reprod Biol Endocrinol  2015; 13: 71. Google Scholar CrossRef Search ADS PubMed  29. Zhang N, Wang WS, Li WJ, Liu C, Wang Y, Sun K. Reduction of progesterone, estradiol and hCG secretion by perfluorooctane sulfonate via induction of apoptosis in human placental syncytiotrophoblasts. Placenta  2015; 36: 575– 580. Google Scholar CrossRef Search ADS PubMed  30. Liu R, Xing L, Kong D, Jiang J, Shang L, Hao W. Bisphenol A inhibits proliferation and induces apoptosis in micromass cultures of rat embryonic midbrain cells through the JNK, CREB and p53 signaling pathways. Food Chem Toxicol  2013; 52: 76– 82. Google Scholar CrossRef Search ADS PubMed  31. Qian W, Zhu J, Mao C, Liu J, Wang Y, Wang Q, Liu Y, Gao R, Xiao H, Wang J. Involvement of CaM-CaMKII-ERK in bisphenol A-induced Sertoli cell apoptosis. Toxicology  2014; 324: 27– 34. Google Scholar CrossRef Search ADS PubMed  32. Vandenberg LN, Colborn T, Hayes TB, Heindel JJ, Jacobs DR Jr, Lee DH, Shioda T, Soto AM, vom Saal FS, Welshons WV, Zoeller RT, Myers JP. Hormones and endocrine-disrupting chemicals: low-dose effects and nonmonotonic dose responses. Endocrine Rev  2012; 33: 378– 455. Google Scholar CrossRef Search ADS   33. Watanabe M, Ohno S, Nakajin S. Effects of bisphenol A on the expression of cytochrome P450 aromatase (CYP19) in human fetal osteoblastic and granulosa cell-like cell lines. Toxicol Lett  2012; 210: 95– 99. Google Scholar CrossRef Search ADS PubMed  34. Kim JY, Han EH, Kim HG, Oh KN, Kim SK, Lee KY, Jeong HG. Bisphenol A-induced aromatase activation is mediated by cyclooxygenase-2 up-regulation in rat testicular Leydig cells. Toxicol Lett  2010; 193: 200– 208. Google Scholar CrossRef Search ADS PubMed  35. Harada N, Utsumi T, Takagi Y. Tissue-specific expression of the human aromatase cytochrome P-450 gene by alternative use of multiple exons 1 and promoters, and switching of tissue-specific exons 1 in carcinogenesis. Proc Natl Acad Sci  1993; 90: 11312– 11316. Google Scholar CrossRef Search ADS PubMed  36. Peretz J, Flaws JA. Bisphenol A down-regulates rate-limiting Cyp11a1 to acutely inhibit steroidogenesis in cultured mouse antral follicles. Toxicol Appl Pharmacol  2013; 271: 249– 256. Google Scholar CrossRef Search ADS PubMed  37. Rice S, Pellatt L, Ramanathan K, Whitehead SA, Mason HD. Metformin inhibits aromatase via an extracellular signal-regulated kinase-mediated pathway. Endocrinology  2009; 150: 4794– 4801. Google Scholar CrossRef Search ADS PubMed  38. Kau MM, Wang JR, Tsai SC, Yu CH, Wang PS. Inhibitory effect of bufalin and cinobufagin on steroidogenesis via the activation of ERK in human adrenocortical cells. Br J Pharmacol  2012; 165: 1868– 1876. Google Scholar CrossRef Search ADS PubMed  39. Seger R, Hanoch T, Rosenberg R, Dantes A, Merz WE, Strauss JF 3rd, Amsterdam A. The ERK signaling cascade inhibits gonadotropin-stimulated steroidogenesis. J Biol Chem  2001; 276: 13957– 13964. Google Scholar CrossRef Search ADS PubMed  40. Bouskine A, Nebout M, Brucker-Davis F, Benahmed M, Fenichel P. Low doses of bisphenol A promote human seminoma cell proliferation by activating PKA and PKG via a membrane G-protein– coupled estrogen receptor. Environ Health Perspect  2009; 117: 1053– 1058. Google Scholar CrossRef Search ADS PubMed  41. Daoud G, Amyot M, Rassart E, Masse A, Simoneau L, Lafond J. ERK1/2 and p38 regulate trophoblasts differentiation in human term placenta. J Physiol  2005; 566: 409– 423. Google Scholar CrossRef Search ADS PubMed  42. Cadepond F, Ulmann A, Baulieu EE. RU486 (mifepristone): mechanisms of action and clinical uses. Annu Rev Med  1997; 48: 129– 156. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Journal

Biology of ReproductionOxford University Press

Published: Feb 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off