Leptin/leptin receptor system in the regulation of reproductive functions and stress response in the European beaver

Leptin/leptin receptor system in the regulation of reproductive functions and stress response in... The European beaver (Castor fiber L.) is the largest free-living rodent in Eurasia. The present work aimed to determine sex- and season-related changes in leptin receptor (Ob-R) expression in the hypothalamic–pituitary–gonadal/adrenal axes and uterus of beavers during breeding- (April), post- breeding- (July), and pre-breeding- (November) periods. The expression of Ob-R gene and protein was found in all analyzed tissues. The expression of Ob-R mRNA remained constant in the hypo- thalamus of both sexes during the analyzed stages. Sex- and season-related changes were found in the pituitary gland; the greatest level was observed in July in both sexes. The same expression pattern was noted in the testis, whereas in the ovary a lack of seasonal changes was found. In uter- ine tissues, the greatest expression occurred in November. The impact of season was also demon- strated in the adrenal cortex. In females, a higher Ob-R transcript level was noted in April, while in males, an increased mRNA abundance was noted in November than July. Our study suggests that in the beaver, leptin acting via the Ob-R can be an important endocrine factor engaged in the regulation of reproductive functions and stress response. Key words: leptin receptor (Ob-R), beaver, seasonal breeding, hypothalamic–pituitary–gonadal axis (HPG), hypothalamic–pituit- ary–adrenal axis (HPA) The European beaver (Castor fiber L.) is the largest free-living ro- accumulate subcutaneous fat deposits, but they do not hibernate dent in Eurasia. In the past, this species was formerly widely distrib- (Zurowski 1992). uted across forested areas from western borders of Europe to eastern Although ecological aspects of beaver life have been broadly Siberia. Beavers are often referred as an ecosystem engineers due to described, their physiology remains poorly understood. Our recent their ability to form or change existing habitats. They enlarge bio- findings indicate season- and sex-related changes in beaver plasma diversity and prepare the ecosystem for the emergence of various sex steroids, glucocorticoids, and leptin concentration (Chojnowska species of plants and animals. The animals exhibit a seasonal pattern et al. 2015; Czerwinska et al. 2015). The results also present of reproduction and they are referred as a long-day breeders with changes in leptin mRNA abundance in the tissues of the hypothal- the peak reproductive activity occurring at the end of winter. amic–pituitary–gonadal/adrenal axes (HPG/HPA) and uterus, de- Mating takes place in January and February (they mate under ice) pending on season and sex of beavers (Chojnowska et al. 2017). and pregnancy lasts 105–107 days until May and June. During sum- Studies performed on rodents and domestic animals revealed mer, beavers take care of pups and store food reserves. They that leptin receptors are widely localized in several regions of the V C The Author(s) (2018). Published by Oxford University Press. 1 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018 2 Current Zoology, 2018, Vol. 0, No. 0 brain that are involved in regulation of both energy balance and re- actin (ACTB) and glyceraldehyde-3-phosphate dehydrogenase production. Their presence has been also reported in various periph- (GAPDH) genes (Chojnowska et al. 2017) were used as internal con- eral tissues, including reproductive tissues and the adrenal gland (for trols. In no-template controls, the cDNA was replaced by RNase- review see Spicer 2001; Malendowicz et al. 2007). A number of free water. The specificity of amplification was tested at the end of studies indicate leptin as a factor linking energy homeostasis, feeding the reaction by analyzing the melting curve. The relative expression behavior, and reproductive functions (for review see Zieba et al. of leptin receptor was calculated with the use of the comparative 2008). cycle threshold method (DDCt) as described previously We hypothesize that gene expression of leptin receptor varies in (Chojnowska et al. 2017). the tissues of both regulatory axes (HPG and HPA) as well in the uterus, depending on season and sex of beavers. Thus, the present Immunohistochemistry study aimed to investigate Ob-R mRNA abundance (determined by Immunohistochemical analysis was performed as described previ- quantitative real-time PCR) and protein localization (determined by ously (Chojnowska et al. 2017). The collected frozen tissues were immunohistochemistry) in the structures of both axes and the ute- cut using a cryostat CM3050 (Leica, USA) and mounted onto rus, depending on sex and reproductive stage. poly-L-lysine-coated glass microscope slides (Menzel-Glaser, Braunschweig, Germany). The sections were incubated with primary V R rabbit polyclonal antibodies against leptin receptor (1:50, Abcam Materials and Methods UK) and with secondary anti-mouse/rabbit antibodies (ImmPRESS Universal Reagent Anti-Mouse/Rabbit Ig, Vector Laboratories, Animals USA). To visualize the immunoreactivity, the sections were The study was performed on 34 European beavers during 3 different immersed in 3,3-diaminobenzidine tetrahydrochloride (DAB, Dako, stages of their reproductive activity: April—“breeding period,” preg- USA), and then counterstained with hematoxylin (Aqua-Med, nancy in females (8 males, 5 pregnant females); July—“post- Poland). The labeled tissues were photographed using a C-5060 breeding,” the end of lactation and raising of offspring (4 males, 6 Camera (Olympus, Japan) mounted on a light microscope (CH30/ females); and November—“pre-breeding,” sexual silence (6 males, 5 CH40, Olympus, Japan). For negative controls, the tissue slices females). were incubated in 0.01 M PBS instead of primary and/or secondary Beavers were anesthetized with 2 anesthetic drug intramuscular- antibodies. ly with injections of xylazine (3 mg/kg of BW; Sedazin , Biovet Puławy, Poland) and ketamine (15 mg/kg of BW; Bioketan, Vetoquinol Biowet, Poland), and scarified. The pregnancy of Statistical analysis females was confirmed by postmortem, by the presence of fetuses in Statistical analysis for leptin receptor mRNA abundance in the tis- the uterus. Tissue samples [the medio-basal hypothalamus (MBH), sues that were assessed within each experimental group (males or whole pituitary gland, testes, ovaries, the middle part of the uterine females in different reproductive stages) was performed using horn divided into endometrium and myometrium, adrenal glands Statistica software (Statoft Inc., Tulsa, USA). Compatibility with the from which adrenal cortex was separated, and subcutaneous white normal distribution of each variable was tested with the Shapiro– adipose tissue (WAT)] were collected. The experimental material Wilk’s test. The data were analyzed by one-way ANOVA followed was immediately frozen in liquid nitrogen and stored at 80 C until by the Tukey’s post hoc test and are presented as means6 SEM. To further analysis. establish the impact of sex and/or season on leptin transcript expres- sion, a two-way ANOVA analysis was performed. The relation be- tween levels of Ob-R mRNA and Ob mRNA as well as Ob-mRNA Sequencing of Ob-R and quantitative real-time PCR and plasma leptin was described by Pearson’s correlations coeffi- For the analysis of Ob-R gene expression, total RNA was extracted cient. Values P< 0.05 were considered as statistically significant. from each tissue using an A&A Mini-column Kit (A&A Biotechnology, USA) including the DNase treatment step. The concentration and quali- fication of isolated RNA were determined spectrophotometrically Results (Infinite M200 PRO, Tecan, Switzerland) and integrity was verified on 1.5% agarose gel. The obtained RNA was reverse-transcribed into The obtained PCR product contained 318 bp. The sequence exhib- cDNA using a QuantiTect Reverse Transcription Kit (Qiagen, USA). ited homology with the European rabbit (Oryctolagus cuniculus, The partial sequence of leptin receptor cDNA was determined XM_008265114.1; 92% identity), rat/mouse (NM_012596.1/ based on rat (NM_012596.1), mouse (NM_146146.2), pig NM_146146.2; 85%/86% identity), pig (NM_001024587.1; 88% (NM_001024587.1), and human (NM_002303.5) leptin receptor identity), and with human (NM_001198689.1; 91% identity) leptin sequences. For analysis, the most conservative sequence regions receptor sequences (Figure 1). were chosen in the extracellular domain of the receptor by using the The presence of Ob-R mRNA and protein was noted in all tested Basic Local Alignment Search Tool (BLAST). The final primer se- beaver tissues (the MBH, pituitary gland, ovary, testis, uterus, ad- quence set is presented in Table 1A. The PCR amplification was per- renal gland, and WAT) during the analyzed reproductive periods. TM formed using JumpStart (Sigma, USA). PCR-amplified DNA was Two-way ANOVA analysis revealed no impact of sex, season, or determined by electrophoresis on 1.5% agarose gel. After extraction the interaction between sex and season in the MBH (Figure 2A,B). TM from the gel (GenElute Gen Extraction Kit, Sigma, USA), DNA The presence of Ob-R protein was confirmed in the MBH during the was sequenced (Genomed S.A., Warsaw, Poland) in both directions. tested stages (the representative data are presented in Figure 3A). Quantitative real-time PCR analysis was carried out using a PCR In the pituitary gland, the impact of sex (F ¼ 12.08; 1,24 System 7300 and Power SYBR Green Master Mix (Applied P< 0.05), season (F ¼ 28.11; P< 0.05), and their interaction 2,24 Biosystems, USA), and specific primer pairs (Table 1B) used to amp- (F ¼ 6.51; P< 0.05) on Ob-R mRNA expression was assessed. In 2,24 lify parts of Ob-R were designed after sequencing results. The b- both males (Figure 2C) and females (Figure 2D), the highest Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018 Chojnowska et al.  Leptin/leptin receptor system in the European beaver 3 Table 1. The sequences of primers used for identification of leptin receptor (Ob-R) cDNA in PCR (A) or leptin receptor and reference genes: b-actin (ACTB) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression in quantitative real-time PCR (B) (A) PCR 0 0 Gene name Primer sequences (5 –3 ) T ( C) Product length (bp) Ob-R F: CAAGCATACAGCATCAGTGACATG 60 318 R: TGCTAGAGAAGCACTTGGTGACTG (B) Real-time PCR 0 0 Gene name Primer sequences (5 –3 ) T ( C) Product length (bp) ACTB F: ATCGCCGACAGGATGCA 60 102 R: CGTACTCCTGCTTGCTGATCC GAPDH F: CCTTCATTGACCTCCACTAC 59 123 R: CCACAACATACGTAGCACCA Ob-R F: CAGATGGTCAGCCAATACAATCC 60 112 R: CTCAGATATGGTTTGAACAGATGGTC Figure 1. The sequence of leptin receptor in beavers and its homology with the European rabbit (XM_008265114.1), rat (NM_012596.1), mouse (NM_146146.2), pig (NM_001024587.1), and with human (NM_001198689.1) Ob-R sequences. Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018 4 Current Zoology, 2018, Vol. 0, No. 0 (P< 0.05) abundance of Ob-R mRNA was noted in July (post- breeding) compared with April (breeding) or November (pre-breed- ing). The Ob-R protein presence was observed in the pituitary gland collected from all analyzed reproductive stages (the representative data are presented in Figure 3B). In the testis (Figure 2E), a greater relative abundance of Ob-R was demonstrated in July in comparison with November. In turn, in the ovaries (Figure 2F), no seasonal changes in the expression of Ob- R mRNA were noted. The Ob-R protein was localized in the testis in smooth muscle layer, Sertoli-, Leydig-, and myoid cells. In ova- ries, Ob-R protein was observed in cells forming stroma and primor- dial and primary follicles (the representative data are presented in Figure 3C,D, respectively). In the uterus, a similar pattern of Ob-R mRNA content was observed in both myometrium (Figure 2G) and endometrium (Figure 2H). The greatest content of Ob-R transcript was found in November (pre-breeding). The Ob-R protein was localized in both the endometrium (uterine glands and luminal epithelium layer) and myometrium (circular and longitudinal muscle layers); the represen- tative data are presented in Figure 3E. In the adrenal cortex, the impact of season (F ¼ 18.11; 2,23 P< 0.05) and interaction between sex and season (F ¼ 19.08; 2,23 P< 0.05) were found. In females (Figure 2J), a higher Ob-R tran- script level was noted in April (pregnancy) when compared with the remaining periods. In males (Figure 2I), an increased mRNA abun- dance was noted in November (pre-breeding) in comparison with July (post-breeding). The Ob-R protein was detected in both the cor- tex (glomerulosa, fasciculata, and reticularis layers) and medulla (the representative picture is presented in Figure 3F). A lack of changes in Ob-R mRNA abundance in subcutaneous WAT was observed, regardless of either sex or season impact (Figure 2K,L). Generally, we did not found many important correlations be- tween the analyzed parameters. The most significant correlation was noted between levels of mRNA for OB-R and OB in the male MBH in April (r ¼ 0.97; P< 0.01). Discussion The beaver has been frequently studied as model for behavioral ecol- ogy and ecosystem engineer for many years. Despite considerable interest in a strong influence on the environment and reintroduction programs, little is known about physiology of the beaver. Beaver tis- sues/organs remain insufficiently studied with respect to their func- tions and in comparison with other wild species with seasonal breeding. The present study demonstrates, for the first time, the ex- pression of gene and protein of leptin receptor in the structures of the HPA and HPG axes as well as in the uterus of the European bea- ver. This is also the first report indicating sex- and season-related changes in Ob-R mRNA expression in the above structures. The ex- pression of Ob-R mRNA remained constant in the hypothalamus of both sexes during the analyzed stages. Sex- and season-related changes were found in the pituitary gland; the greatest level was observed in July in both sexes. The same expression pattern was Figure 2. The expression of leptin receptor gene in the medio-basal hypothal- amus (MBH; A, B), pituitary gland (C, D), gonads (E, F), uterus (G, H), adrenal noted in the testis, whereas in the ovary a lack of seasonal changes cortex (I, J), and white adipose tissue (WAT; K, L) in males of the European was found. In uterine tissues, the greatest expression occurred in beaver during different seasons of the reproductive activity (April—breeding, November. The impact of season was also demonstrated in the July—post-breeding, and November—pre-breeding). Different letters indicate adrenal cortex. In females, a higher Ob-R transcript level was noted significant differences (P< 0.05) between the columns representing various in April, while in males, an increased mRNA abundance was noted groups of animals, whereas the same letters indicate a lack of differences be- in November than July tween columns. Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018 Chojnowska et al.  Leptin/leptin receptor system in the European beaver 5 A B 1 1 2 3 4 3 4 CD 1 1 2 3 4 3 4 EF 1 2 1 2 3 4 3 4 Figure 3. The leptin receptor protein localization in the representative tissue sections of MBH (A), pituitary (B), gonads (C, D), uterus (E), and adrenal gland (F). The leptin receptor protein is marked in brown color (DAB). Hematoxylin (violet color) was applied for nuclei staining. The pictures (a1–f1) indicate negative con- trols (the procedure without the primary antibody). The pictures (A2–F2) indicate leptin receptor protein localization in the tested tissues of female and male (D2) captured in April (breeding). The pictures (A3–F3) indicate leptin receptor protein localization in the tested tissues of female and male (d3) captured in July (post- breeding). The pictures (A4–F4) indicate leptin receptor protein localization in the tested tissues of female and male (d4) captured in November (pre-breeding). The study regarding distribution and physiological role of leptin/ hypothalamus of both sexes of juvenile Siberian hamsters whereas a leptin receptor system in various animal species was widely dis- short day exerts an opposite effect (Adam et al. 2000; Mercer et al. cussed, although in protected free-living animals, including the bea- 2000). Unfortunately, such a tendency was not confirmed in our ver, it is often problematic and limited due to difficulties in study, since Ob-R expression did not alter in the hypothalamus of obtaining adequate samples representing all reproductive stages. females during the analyzed reproductive stages. In male hypothal- While the presence of Ob-R mRNA/protein in various levels of the amus, Ob-R mRNA abundance in November (pre-breeding; short HPG/HPA axes has been described in laboratory rodents or domes- day) remained constant when compared with July (post-breeding; tic animals, there have been few studies conducted on wild rodents long day). In turn, a higher level was noted in April (breeding) than such as Syrian Mesocricetus auratus and Siberian hamsters in July (post-breeding). In the male MBH in April the correlation Phodopus sungorus (Mercer et al. 2000), Brandt vole Lasiopodomys was noted between levels of mRNA for OB-R and OB. brandtii (Zhang et al. 2011), and Daurian ground squirrel Interestingly, the above findings can be associated with the Spermophilus dauricus (Xing et al. 2015). results regarding to leptin serum concentration obtained from the There is evidence that the photoperiod in wild living animals same group of beavers (Chojnowska et al. 2017). Although the affects the expression of Ob-R. It has also been shown that a long plasma leptin concentration remained stable during the analyzed day augments the expression of long form of Ob-R mRNA in the stages in females, changes were noted in males. We may assume Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018 6 Current Zoology, 2018, Vol. 0, No. 0 that, in males, a low peripheral leptin concentration in April (breed- The Ob-R protein, detected by immunocytochemistry, was strong- ing) up-regulates (whereas a high plasma leptin content in July— ly expressed in human cortical cells, whereas the adrenal medulla post-breeding down-regulates) the expression of Ob-R in the MBH. showed only a weak expression in cortical cell islets (Glasow et al. Additionally, our previous findings reported seasonal differences in 1998). It should be pointed out that leptin itself is not expressed in the leptin gene expression that may suggest possible local regulatory im- human adrenals (Glasow et al. 1998). Our findings indicate the pres- pact of leptin on the receptor mRNA abundance in the MBH of bea- ence of Ob-R (this study) and leptin (Chojnowska et al. 2017) mRNAs vers (Chojnowska et al. 2017). The changes in Ob-R expression and proteins in the beaver adrenals of both sexes. Interestingly, ele- may imply a different leptin availability in the brain. vated abundance of Ob-R and leptin mRNAs was observed in females Sex- and season-related changes in Ob-R mRNA abundance in April (pregnancy) than in July (post-breeding). In turn, in males, were found in the pituitary gland of beavers. Interestingly, the pat- higher Ob-R and leptin mRNA levels were noted in November (pre- tern of the expression was similar in both females and males—the breeding) than in July (post-breeding). It can be assumed that the lower greatest mRNA abundance was found during the post-breeding mRNA abundance of leptin and Ob-R in the adrenal gland of males in season (July) when compared with breeding (April) or sexual si- July could be related to a higher plasma cortisol concentration during lence (November) periods. It is also worth mentioning that the pre- this stage (Czerwinska et al. 2015). This observation could support a sent results and our previous findings show similar expression negative relationship between leptin and cortisol plasma concentration, pattern of Ob-R mRNA and leptin mRNA (Chojnowska et al. as discussed above. It is worth mentioning that plasma cortisol concen- 2017) in the pituitary gland as well as FSH plasma concentration tration in females remained constant during the analyzed reproductive (Chojnowska et al. 2015) in females in July and April. However, stages (Czerwinska et al. 2015). The above findings suggest that leptin such relation cannot be observed in males. Despite similarity in can participate in the regulation of the HPA axis on a sex-specific basis Ob-R mRNA expression in the pituitary gland with females, we and the exact role of leptin in functioning of the HPA axis in both did not find any relation with plasma gonadotropins concentration sexes needs to be explored. or leptin synthesis in this tissue (Chojnowska et al. 2017). In In conclusion, this study indicates the presence of Ob-R gene and addition, we did not observe any consistency with plasma testos- protein expression as well as sex- and/or season-related changes in terone concentration during the analyzed reproductive stages Ob-R mRNA abundance in all structures of the HPG/HPA axes and (Chojnowska et al. 2015) although a very similar profile of Ob-R uterus of the European beaver. The observed circannual changes in mRNA expression was also noted in the testis when compared leptin receptor mRNA abundance can be associated with the differ- with the pituitary. ential activity of the HPG/HPA axes during different reproductive The Ob-R mRNA abundance in the ovary was relatively con- stages. A lack of common pattern in leptin receptor gene expression stant through the tested reproductive periods, whereas both the in male and female beavers suggests a gender-specific biological role endometrium and myometrium showed season-dependent of leptin which can be an important link connecting metabolism, re- changes—the greatest level was in November (pre-breeding). Our productive processes, and stress response. results concerning the ovary are, to some degree, surprising because experiments conducted on the ovary of the human, pig, or dog revealed that Ob-R mRNA expression varied depending on the stage Ethics Statement of the menstrual/estrous cycle or pregnancy (Cervero et al. 2004; All experimental procedures were conducted in accordance with Smolinska et al. 2013; Balogh et al. 2015). The Ob-R protein has ethical standards of the institutional Animal Ethical Committees been identified in beaver ovarian structures, i.e., corpora albicantia [ministerial approval: RDOS-28-OOP-6631-0007-638/09/10/pj and primordial and primary follicles. Similarly, the Ob-R protein and local approvals: SGGW/11/2010 and UWM/87/2012/DTN]. was localized in ovaries of the rat and mouse (Ruiz-Cortez et al. 2000; Ryan et al. 2002). In turn, the finding regarding the presence of Ob-R protein in beaver uterine tissues including structures, such Acknowledgments as uterine glands and luminal epithelium layers as well as circular The authors would like to thank Jan Gozdziewski from the Polish Hunting and longitudinal muscle layers, is supported by immunohistochemi- Association in Suwalki for capturing and delivery of animals; Grzegorz Belzecki, cal Ob-R staining in uteri of the mouse (Kawamura et al. 2002), rat Ph.D., from The Kielanowski Institute of Animal Physiology and Nutrition of (Plastow and Waddell 2002), dog (Balogh et al. 2015), as well as in Polish Academy of Sciences in Jabłonna, Zygmunt Gizejewski, Prof., from Japanese black bear (Nakamura et al. 2009). Research Station of Ecological Agriculture and Preservation Animal Breeding of Season-associated changes in Ob-R expression were observed in the Polish Academy of Sciences in Popielno for cooperation and sharing of mate- the beaver’s adrenal cortex. Elevated abundance of Ob-R and leptin rials to research; and Prof. Jacek Nowakowski from Department of Ecology and mRNAs (Chojnowska et al. 2017) was noted in females in April Environmental Protection, Faulty of Biology and Biotechnology of University of (pregnancy) than in July (post-breeding). In turn, in males, higher Warmia and Mazury in Olsztyn for assistance with statistical analysis. Ob-R and leptin mRNA levels were noted in November (pre-breed- ing) than in July (post-breeding). The presence of Ob-R gene and protein in all branches of the HPA axis suggests that leptin can Funding modulate the stress response in this species. It is known that leptin This study was supported by the National Science Centre [Project No. 2012/ suppresses glucocorticoid secretion by the adrenal cortex through 07/B/NZ9/01335] and the Ministry of Higher Education [Project No. 528/ the direct/indirect effect on hypothalamic CRF and pituitary ACTH 0206/882]. release (for review see Roubos et al. 2012). There are also reports describing the direct inhibitory effect of leptin on cortisol secretion References from bovine (Bornstein et al. 1997), rat, and human (Pralong et al. 1998) adrenocortical cells although leptin itself is not expressed in Adam CL, Moar KM, Logie TJ, Ross AW, Barrett P et al., 2000. Photoperiod the human adrenals (Glasow et al. 1998). regulates growth, puberty and hypothalamic neuropeptide and receptor Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018 Chojnowska et al.  Leptin/leptin receptor system in the European beaver 7 gene expression in female Siberian hamsters. Endocrinology 141: Nakamura S, Nishii N, Yamanaka A, Kitagawa H, Asano M et al., 2009. 4349–4356. Leptin receptor (Ob-R) expression in the ovary and uterus of the wild Balogh O, Staub LP, Gram A, Boos A, Kowalewski MP et al., 2015. Leptin in Japanese black bear Ursus thibetanus japonicus. J Reprod Dev 55:110–115. the canine uterus and placenta: possible implications in pregnancy. Reprod Plastow KP, Waddell B, 2002. Leptin receptor expression in the rat uterus: vari- Biol Endocrinol 13:13. ation across the estrous cycle and with decidualization. In: Henson MC, Bornstein S, Uhlmann R, Haidan K, Ehrhart-Bornstein A, Scherbaum WA, 1997. Castracane VD, editors. Leptin and reproduction. Berlin: Springer Evidence for a novel peripheral action of leptin as a metabolic signal to the ad- Science+business Media, LLC, 352 renal gland: leptin inhibits cortisol release directly. Diabetes 46:1235–1238. Pralong FP, Roduit R, Waeber G, Castillo E, Mosimann F et al., 1998. Leptin Cervero A, Horcajadas JA, Martin J, Pellicer A, Simon C, 2004. The leptin sys- inhibits directly glucocorticoid secretion by normal human and rat adrenal tem during human endometrial receptivity and preimplantation develop- gland. Endocrinology 139:4264–4268. ment. J Clin Endocrinol Metab 89:2442–2451. Roubos EW, Dahmen M, Kozicz T, Xu L, 2012. Leptin and the Chojnowska K, Czerwinska J, Kaminski T, Kaminska B, Kurzynska A et al., hypothalamo–pituitary–adrenal stress axis. Gen Comp Endocrinol 177: 2017. Leptin plasma concentrations, leptin gene expression and protein lo- 28–36. calisation in the hypothalamic–pituitary–gonadal/adrenal axes of the Ruiz-Cortez ZT, Men T, Palin MF, Downey BR, Lacroix DA et al., 2000. European beaver Castor fiber. Theriogenology 87:266–275. Porcine leptin receptor: molecular structure and expression in the ovary. Chojnowska K, Czerwinska J, Kaminski T, Kaminska B, Panasiewicz G et al., Mol Reprod Dev 56:465–474. 2015. Sex- and seasonally related changes in plasma gonadotropins and sex Ryan NK, Woodhouse CM, Van Der Hoek KH, Gilchrist RB, Armstrong DT steroids concentration in the European beaver Castor fiber. Eur J Wildl Res et al., 2002. Expression of leptin and its receptor in the murine ovary: pos- 6:807–811. sible role in the regulation of oocyte maturation. Biol Reprod 66: Czerwinska J, Chojnowska K, Kaminski T, Bogacka I, Panasiewicz G et al., 2015. 1548–1554. Plasma glucocorticoids and ACTH levels during different periods of activity in Smolinska N, Kaminski T, Siawrys G, Przala J, 2013. Expression of leptin and the European beavers (Castor fiber L.). Folia Biol (Krako´w) 63:229–233. its receptor genes in the ovarian follicles of cycling and early pregnant pigs. Glasow A, Haidan A, Hilbers U, Breidert M, Gillespie J et al., 1998. Animal 7:109–117. Expression of Ob receptor in normal human adrenals: differential regulation Spicer LJ, 2001. Leptin: a possible metabolic signal affecting reproduction. of adrenocortical and adrenomedullary function by leptin. J Clin Dom Anim Endocrinol 21:251–270. Endocrinol Metab 83:4459–4466. Xing Y, Liu J, Xu J, Yin L, Wang L et al., 2015. Association between plasma Kawamura K, Sato N, Fukuda J, Kodama H, Kumagai J et al., 2002. Leptin leptin and estrogen in female patients of amnestic mild cognitive impair- promotes the development of mouse preimplantation embryos in vitro. ment. Dis Markers 11:1–5. Endocrinology 143:1922–1931. Zhang Y, Kerman IA, Laque A, Nguyen P, Faouzi M et al., 2011. Malendowicz LK, Rucinski M, Belloni AS, Ziolkowska A, Nussdorfer GG, Leptin-receptor-expressing neurons in the dorsomedial hypothalamus and 2007. Leptin and the regulation of the hypothalamic–pituitary–adrenal median preoptic area regulate sympathetic brown adipose tissue circuits. J axis. Int Rev Cytol 263:63–102. Neurosci 31:1873–1884. Mercer JG, Moar KM, Ross AW, Morgan PJ, 2000. Regulation of leptin re- Zieba DA, Szczesna M, Klocek-Gorka B, Williams GL, 2008. Leptin as a nu- ceptor, POMC and AGRP gene expression by photoperiod and food depriv- tritional signal regulating appetiteand reproductive processes in ation in the hypothalamic arcuate nucleus of the male Siberian hamster seasonally-breeding ruminants. J Physiol Pharmacol 59:7–18. Phodopus sungorus. Appetite 34:109–111. Zurowski W, 1992. Building activity of beavers. Acta Theriol 37:403–411. Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Current Zoology Oxford University Press

Leptin/leptin receptor system in the regulation of reproductive functions and stress response in the European beaver

Free
7 pages

Loading next page...
 
/lp/ou_press/leptin-leptin-receptor-system-in-the-regulation-of-reproductive-9jEr6LqhwP
Publisher
Editorial Office
Copyright
© The Author(s) (2018). Published by Oxford University Press.
ISSN
1674-5507
eISSN
2396-9814
D.O.I.
10.1093/cz/zoy030
Publisher site
See Article on Publisher Site

Abstract

The European beaver (Castor fiber L.) is the largest free-living rodent in Eurasia. The present work aimed to determine sex- and season-related changes in leptin receptor (Ob-R) expression in the hypothalamic–pituitary–gonadal/adrenal axes and uterus of beavers during breeding- (April), post- breeding- (July), and pre-breeding- (November) periods. The expression of Ob-R gene and protein was found in all analyzed tissues. The expression of Ob-R mRNA remained constant in the hypo- thalamus of both sexes during the analyzed stages. Sex- and season-related changes were found in the pituitary gland; the greatest level was observed in July in both sexes. The same expression pattern was noted in the testis, whereas in the ovary a lack of seasonal changes was found. In uter- ine tissues, the greatest expression occurred in November. The impact of season was also demon- strated in the adrenal cortex. In females, a higher Ob-R transcript level was noted in April, while in males, an increased mRNA abundance was noted in November than July. Our study suggests that in the beaver, leptin acting via the Ob-R can be an important endocrine factor engaged in the regulation of reproductive functions and stress response. Key words: leptin receptor (Ob-R), beaver, seasonal breeding, hypothalamic–pituitary–gonadal axis (HPG), hypothalamic–pituit- ary–adrenal axis (HPA) The European beaver (Castor fiber L.) is the largest free-living ro- accumulate subcutaneous fat deposits, but they do not hibernate dent in Eurasia. In the past, this species was formerly widely distrib- (Zurowski 1992). uted across forested areas from western borders of Europe to eastern Although ecological aspects of beaver life have been broadly Siberia. Beavers are often referred as an ecosystem engineers due to described, their physiology remains poorly understood. Our recent their ability to form or change existing habitats. They enlarge bio- findings indicate season- and sex-related changes in beaver plasma diversity and prepare the ecosystem for the emergence of various sex steroids, glucocorticoids, and leptin concentration (Chojnowska species of plants and animals. The animals exhibit a seasonal pattern et al. 2015; Czerwinska et al. 2015). The results also present of reproduction and they are referred as a long-day breeders with changes in leptin mRNA abundance in the tissues of the hypothal- the peak reproductive activity occurring at the end of winter. amic–pituitary–gonadal/adrenal axes (HPG/HPA) and uterus, de- Mating takes place in January and February (they mate under ice) pending on season and sex of beavers (Chojnowska et al. 2017). and pregnancy lasts 105–107 days until May and June. During sum- Studies performed on rodents and domestic animals revealed mer, beavers take care of pups and store food reserves. They that leptin receptors are widely localized in several regions of the V C The Author(s) (2018). Published by Oxford University Press. 1 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018 2 Current Zoology, 2018, Vol. 0, No. 0 brain that are involved in regulation of both energy balance and re- actin (ACTB) and glyceraldehyde-3-phosphate dehydrogenase production. Their presence has been also reported in various periph- (GAPDH) genes (Chojnowska et al. 2017) were used as internal con- eral tissues, including reproductive tissues and the adrenal gland (for trols. In no-template controls, the cDNA was replaced by RNase- review see Spicer 2001; Malendowicz et al. 2007). A number of free water. The specificity of amplification was tested at the end of studies indicate leptin as a factor linking energy homeostasis, feeding the reaction by analyzing the melting curve. The relative expression behavior, and reproductive functions (for review see Zieba et al. of leptin receptor was calculated with the use of the comparative 2008). cycle threshold method (DDCt) as described previously We hypothesize that gene expression of leptin receptor varies in (Chojnowska et al. 2017). the tissues of both regulatory axes (HPG and HPA) as well in the uterus, depending on season and sex of beavers. Thus, the present Immunohistochemistry study aimed to investigate Ob-R mRNA abundance (determined by Immunohistochemical analysis was performed as described previ- quantitative real-time PCR) and protein localization (determined by ously (Chojnowska et al. 2017). The collected frozen tissues were immunohistochemistry) in the structures of both axes and the ute- cut using a cryostat CM3050 (Leica, USA) and mounted onto rus, depending on sex and reproductive stage. poly-L-lysine-coated glass microscope slides (Menzel-Glaser, Braunschweig, Germany). The sections were incubated with primary V R rabbit polyclonal antibodies against leptin receptor (1:50, Abcam Materials and Methods UK) and with secondary anti-mouse/rabbit antibodies (ImmPRESS Universal Reagent Anti-Mouse/Rabbit Ig, Vector Laboratories, Animals USA). To visualize the immunoreactivity, the sections were The study was performed on 34 European beavers during 3 different immersed in 3,3-diaminobenzidine tetrahydrochloride (DAB, Dako, stages of their reproductive activity: April—“breeding period,” preg- USA), and then counterstained with hematoxylin (Aqua-Med, nancy in females (8 males, 5 pregnant females); July—“post- Poland). The labeled tissues were photographed using a C-5060 breeding,” the end of lactation and raising of offspring (4 males, 6 Camera (Olympus, Japan) mounted on a light microscope (CH30/ females); and November—“pre-breeding,” sexual silence (6 males, 5 CH40, Olympus, Japan). For negative controls, the tissue slices females). were incubated in 0.01 M PBS instead of primary and/or secondary Beavers were anesthetized with 2 anesthetic drug intramuscular- antibodies. ly with injections of xylazine (3 mg/kg of BW; Sedazin , Biovet Puławy, Poland) and ketamine (15 mg/kg of BW; Bioketan, Vetoquinol Biowet, Poland), and scarified. The pregnancy of Statistical analysis females was confirmed by postmortem, by the presence of fetuses in Statistical analysis for leptin receptor mRNA abundance in the tis- the uterus. Tissue samples [the medio-basal hypothalamus (MBH), sues that were assessed within each experimental group (males or whole pituitary gland, testes, ovaries, the middle part of the uterine females in different reproductive stages) was performed using horn divided into endometrium and myometrium, adrenal glands Statistica software (Statoft Inc., Tulsa, USA). Compatibility with the from which adrenal cortex was separated, and subcutaneous white normal distribution of each variable was tested with the Shapiro– adipose tissue (WAT)] were collected. The experimental material Wilk’s test. The data were analyzed by one-way ANOVA followed was immediately frozen in liquid nitrogen and stored at 80 C until by the Tukey’s post hoc test and are presented as means6 SEM. To further analysis. establish the impact of sex and/or season on leptin transcript expres- sion, a two-way ANOVA analysis was performed. The relation be- tween levels of Ob-R mRNA and Ob mRNA as well as Ob-mRNA Sequencing of Ob-R and quantitative real-time PCR and plasma leptin was described by Pearson’s correlations coeffi- For the analysis of Ob-R gene expression, total RNA was extracted cient. Values P< 0.05 were considered as statistically significant. from each tissue using an A&A Mini-column Kit (A&A Biotechnology, USA) including the DNase treatment step. The concentration and quali- fication of isolated RNA were determined spectrophotometrically Results (Infinite M200 PRO, Tecan, Switzerland) and integrity was verified on 1.5% agarose gel. The obtained RNA was reverse-transcribed into The obtained PCR product contained 318 bp. The sequence exhib- cDNA using a QuantiTect Reverse Transcription Kit (Qiagen, USA). ited homology with the European rabbit (Oryctolagus cuniculus, The partial sequence of leptin receptor cDNA was determined XM_008265114.1; 92% identity), rat/mouse (NM_012596.1/ based on rat (NM_012596.1), mouse (NM_146146.2), pig NM_146146.2; 85%/86% identity), pig (NM_001024587.1; 88% (NM_001024587.1), and human (NM_002303.5) leptin receptor identity), and with human (NM_001198689.1; 91% identity) leptin sequences. For analysis, the most conservative sequence regions receptor sequences (Figure 1). were chosen in the extracellular domain of the receptor by using the The presence of Ob-R mRNA and protein was noted in all tested Basic Local Alignment Search Tool (BLAST). The final primer se- beaver tissues (the MBH, pituitary gland, ovary, testis, uterus, ad- quence set is presented in Table 1A. The PCR amplification was per- renal gland, and WAT) during the analyzed reproductive periods. TM formed using JumpStart (Sigma, USA). PCR-amplified DNA was Two-way ANOVA analysis revealed no impact of sex, season, or determined by electrophoresis on 1.5% agarose gel. After extraction the interaction between sex and season in the MBH (Figure 2A,B). TM from the gel (GenElute Gen Extraction Kit, Sigma, USA), DNA The presence of Ob-R protein was confirmed in the MBH during the was sequenced (Genomed S.A., Warsaw, Poland) in both directions. tested stages (the representative data are presented in Figure 3A). Quantitative real-time PCR analysis was carried out using a PCR In the pituitary gland, the impact of sex (F ¼ 12.08; 1,24 System 7300 and Power SYBR Green Master Mix (Applied P< 0.05), season (F ¼ 28.11; P< 0.05), and their interaction 2,24 Biosystems, USA), and specific primer pairs (Table 1B) used to amp- (F ¼ 6.51; P< 0.05) on Ob-R mRNA expression was assessed. In 2,24 lify parts of Ob-R were designed after sequencing results. The b- both males (Figure 2C) and females (Figure 2D), the highest Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018 Chojnowska et al.  Leptin/leptin receptor system in the European beaver 3 Table 1. The sequences of primers used for identification of leptin receptor (Ob-R) cDNA in PCR (A) or leptin receptor and reference genes: b-actin (ACTB) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression in quantitative real-time PCR (B) (A) PCR 0 0 Gene name Primer sequences (5 –3 ) T ( C) Product length (bp) Ob-R F: CAAGCATACAGCATCAGTGACATG 60 318 R: TGCTAGAGAAGCACTTGGTGACTG (B) Real-time PCR 0 0 Gene name Primer sequences (5 –3 ) T ( C) Product length (bp) ACTB F: ATCGCCGACAGGATGCA 60 102 R: CGTACTCCTGCTTGCTGATCC GAPDH F: CCTTCATTGACCTCCACTAC 59 123 R: CCACAACATACGTAGCACCA Ob-R F: CAGATGGTCAGCCAATACAATCC 60 112 R: CTCAGATATGGTTTGAACAGATGGTC Figure 1. The sequence of leptin receptor in beavers and its homology with the European rabbit (XM_008265114.1), rat (NM_012596.1), mouse (NM_146146.2), pig (NM_001024587.1), and with human (NM_001198689.1) Ob-R sequences. Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018 4 Current Zoology, 2018, Vol. 0, No. 0 (P< 0.05) abundance of Ob-R mRNA was noted in July (post- breeding) compared with April (breeding) or November (pre-breed- ing). The Ob-R protein presence was observed in the pituitary gland collected from all analyzed reproductive stages (the representative data are presented in Figure 3B). In the testis (Figure 2E), a greater relative abundance of Ob-R was demonstrated in July in comparison with November. In turn, in the ovaries (Figure 2F), no seasonal changes in the expression of Ob- R mRNA were noted. The Ob-R protein was localized in the testis in smooth muscle layer, Sertoli-, Leydig-, and myoid cells. In ova- ries, Ob-R protein was observed in cells forming stroma and primor- dial and primary follicles (the representative data are presented in Figure 3C,D, respectively). In the uterus, a similar pattern of Ob-R mRNA content was observed in both myometrium (Figure 2G) and endometrium (Figure 2H). The greatest content of Ob-R transcript was found in November (pre-breeding). The Ob-R protein was localized in both the endometrium (uterine glands and luminal epithelium layer) and myometrium (circular and longitudinal muscle layers); the represen- tative data are presented in Figure 3E. In the adrenal cortex, the impact of season (F ¼ 18.11; 2,23 P< 0.05) and interaction between sex and season (F ¼ 19.08; 2,23 P< 0.05) were found. In females (Figure 2J), a higher Ob-R tran- script level was noted in April (pregnancy) when compared with the remaining periods. In males (Figure 2I), an increased mRNA abun- dance was noted in November (pre-breeding) in comparison with July (post-breeding). The Ob-R protein was detected in both the cor- tex (glomerulosa, fasciculata, and reticularis layers) and medulla (the representative picture is presented in Figure 3F). A lack of changes in Ob-R mRNA abundance in subcutaneous WAT was observed, regardless of either sex or season impact (Figure 2K,L). Generally, we did not found many important correlations be- tween the analyzed parameters. The most significant correlation was noted between levels of mRNA for OB-R and OB in the male MBH in April (r ¼ 0.97; P< 0.01). Discussion The beaver has been frequently studied as model for behavioral ecol- ogy and ecosystem engineer for many years. Despite considerable interest in a strong influence on the environment and reintroduction programs, little is known about physiology of the beaver. Beaver tis- sues/organs remain insufficiently studied with respect to their func- tions and in comparison with other wild species with seasonal breeding. The present study demonstrates, for the first time, the ex- pression of gene and protein of leptin receptor in the structures of the HPA and HPG axes as well as in the uterus of the European bea- ver. This is also the first report indicating sex- and season-related changes in Ob-R mRNA expression in the above structures. The ex- pression of Ob-R mRNA remained constant in the hypothalamus of both sexes during the analyzed stages. Sex- and season-related changes were found in the pituitary gland; the greatest level was observed in July in both sexes. The same expression pattern was Figure 2. The expression of leptin receptor gene in the medio-basal hypothal- amus (MBH; A, B), pituitary gland (C, D), gonads (E, F), uterus (G, H), adrenal noted in the testis, whereas in the ovary a lack of seasonal changes cortex (I, J), and white adipose tissue (WAT; K, L) in males of the European was found. In uterine tissues, the greatest expression occurred in beaver during different seasons of the reproductive activity (April—breeding, November. The impact of season was also demonstrated in the July—post-breeding, and November—pre-breeding). Different letters indicate adrenal cortex. In females, a higher Ob-R transcript level was noted significant differences (P< 0.05) between the columns representing various in April, while in males, an increased mRNA abundance was noted groups of animals, whereas the same letters indicate a lack of differences be- in November than July tween columns. Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018 Chojnowska et al.  Leptin/leptin receptor system in the European beaver 5 A B 1 1 2 3 4 3 4 CD 1 1 2 3 4 3 4 EF 1 2 1 2 3 4 3 4 Figure 3. The leptin receptor protein localization in the representative tissue sections of MBH (A), pituitary (B), gonads (C, D), uterus (E), and adrenal gland (F). The leptin receptor protein is marked in brown color (DAB). Hematoxylin (violet color) was applied for nuclei staining. The pictures (a1–f1) indicate negative con- trols (the procedure without the primary antibody). The pictures (A2–F2) indicate leptin receptor protein localization in the tested tissues of female and male (D2) captured in April (breeding). The pictures (A3–F3) indicate leptin receptor protein localization in the tested tissues of female and male (d3) captured in July (post- breeding). The pictures (A4–F4) indicate leptin receptor protein localization in the tested tissues of female and male (d4) captured in November (pre-breeding). The study regarding distribution and physiological role of leptin/ hypothalamus of both sexes of juvenile Siberian hamsters whereas a leptin receptor system in various animal species was widely dis- short day exerts an opposite effect (Adam et al. 2000; Mercer et al. cussed, although in protected free-living animals, including the bea- 2000). Unfortunately, such a tendency was not confirmed in our ver, it is often problematic and limited due to difficulties in study, since Ob-R expression did not alter in the hypothalamus of obtaining adequate samples representing all reproductive stages. females during the analyzed reproductive stages. In male hypothal- While the presence of Ob-R mRNA/protein in various levels of the amus, Ob-R mRNA abundance in November (pre-breeding; short HPG/HPA axes has been described in laboratory rodents or domes- day) remained constant when compared with July (post-breeding; tic animals, there have been few studies conducted on wild rodents long day). In turn, a higher level was noted in April (breeding) than such as Syrian Mesocricetus auratus and Siberian hamsters in July (post-breeding). In the male MBH in April the correlation Phodopus sungorus (Mercer et al. 2000), Brandt vole Lasiopodomys was noted between levels of mRNA for OB-R and OB. brandtii (Zhang et al. 2011), and Daurian ground squirrel Interestingly, the above findings can be associated with the Spermophilus dauricus (Xing et al. 2015). results regarding to leptin serum concentration obtained from the There is evidence that the photoperiod in wild living animals same group of beavers (Chojnowska et al. 2017). Although the affects the expression of Ob-R. It has also been shown that a long plasma leptin concentration remained stable during the analyzed day augments the expression of long form of Ob-R mRNA in the stages in females, changes were noted in males. We may assume Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018 6 Current Zoology, 2018, Vol. 0, No. 0 that, in males, a low peripheral leptin concentration in April (breed- The Ob-R protein, detected by immunocytochemistry, was strong- ing) up-regulates (whereas a high plasma leptin content in July— ly expressed in human cortical cells, whereas the adrenal medulla post-breeding down-regulates) the expression of Ob-R in the MBH. showed only a weak expression in cortical cell islets (Glasow et al. Additionally, our previous findings reported seasonal differences in 1998). It should be pointed out that leptin itself is not expressed in the leptin gene expression that may suggest possible local regulatory im- human adrenals (Glasow et al. 1998). Our findings indicate the pres- pact of leptin on the receptor mRNA abundance in the MBH of bea- ence of Ob-R (this study) and leptin (Chojnowska et al. 2017) mRNAs vers (Chojnowska et al. 2017). The changes in Ob-R expression and proteins in the beaver adrenals of both sexes. Interestingly, ele- may imply a different leptin availability in the brain. vated abundance of Ob-R and leptin mRNAs was observed in females Sex- and season-related changes in Ob-R mRNA abundance in April (pregnancy) than in July (post-breeding). In turn, in males, were found in the pituitary gland of beavers. Interestingly, the pat- higher Ob-R and leptin mRNA levels were noted in November (pre- tern of the expression was similar in both females and males—the breeding) than in July (post-breeding). It can be assumed that the lower greatest mRNA abundance was found during the post-breeding mRNA abundance of leptin and Ob-R in the adrenal gland of males in season (July) when compared with breeding (April) or sexual si- July could be related to a higher plasma cortisol concentration during lence (November) periods. It is also worth mentioning that the pre- this stage (Czerwinska et al. 2015). This observation could support a sent results and our previous findings show similar expression negative relationship between leptin and cortisol plasma concentration, pattern of Ob-R mRNA and leptin mRNA (Chojnowska et al. as discussed above. It is worth mentioning that plasma cortisol concen- 2017) in the pituitary gland as well as FSH plasma concentration tration in females remained constant during the analyzed reproductive (Chojnowska et al. 2015) in females in July and April. However, stages (Czerwinska et al. 2015). The above findings suggest that leptin such relation cannot be observed in males. Despite similarity in can participate in the regulation of the HPA axis on a sex-specific basis Ob-R mRNA expression in the pituitary gland with females, we and the exact role of leptin in functioning of the HPA axis in both did not find any relation with plasma gonadotropins concentration sexes needs to be explored. or leptin synthesis in this tissue (Chojnowska et al. 2017). In In conclusion, this study indicates the presence of Ob-R gene and addition, we did not observe any consistency with plasma testos- protein expression as well as sex- and/or season-related changes in terone concentration during the analyzed reproductive stages Ob-R mRNA abundance in all structures of the HPG/HPA axes and (Chojnowska et al. 2015) although a very similar profile of Ob-R uterus of the European beaver. The observed circannual changes in mRNA expression was also noted in the testis when compared leptin receptor mRNA abundance can be associated with the differ- with the pituitary. ential activity of the HPG/HPA axes during different reproductive The Ob-R mRNA abundance in the ovary was relatively con- stages. A lack of common pattern in leptin receptor gene expression stant through the tested reproductive periods, whereas both the in male and female beavers suggests a gender-specific biological role endometrium and myometrium showed season-dependent of leptin which can be an important link connecting metabolism, re- changes—the greatest level was in November (pre-breeding). Our productive processes, and stress response. results concerning the ovary are, to some degree, surprising because experiments conducted on the ovary of the human, pig, or dog revealed that Ob-R mRNA expression varied depending on the stage Ethics Statement of the menstrual/estrous cycle or pregnancy (Cervero et al. 2004; All experimental procedures were conducted in accordance with Smolinska et al. 2013; Balogh et al. 2015). The Ob-R protein has ethical standards of the institutional Animal Ethical Committees been identified in beaver ovarian structures, i.e., corpora albicantia [ministerial approval: RDOS-28-OOP-6631-0007-638/09/10/pj and primordial and primary follicles. Similarly, the Ob-R protein and local approvals: SGGW/11/2010 and UWM/87/2012/DTN]. was localized in ovaries of the rat and mouse (Ruiz-Cortez et al. 2000; Ryan et al. 2002). In turn, the finding regarding the presence of Ob-R protein in beaver uterine tissues including structures, such Acknowledgments as uterine glands and luminal epithelium layers as well as circular The authors would like to thank Jan Gozdziewski from the Polish Hunting and longitudinal muscle layers, is supported by immunohistochemi- Association in Suwalki for capturing and delivery of animals; Grzegorz Belzecki, cal Ob-R staining in uteri of the mouse (Kawamura et al. 2002), rat Ph.D., from The Kielanowski Institute of Animal Physiology and Nutrition of (Plastow and Waddell 2002), dog (Balogh et al. 2015), as well as in Polish Academy of Sciences in Jabłonna, Zygmunt Gizejewski, Prof., from Japanese black bear (Nakamura et al. 2009). Research Station of Ecological Agriculture and Preservation Animal Breeding of Season-associated changes in Ob-R expression were observed in the Polish Academy of Sciences in Popielno for cooperation and sharing of mate- the beaver’s adrenal cortex. Elevated abundance of Ob-R and leptin rials to research; and Prof. Jacek Nowakowski from Department of Ecology and mRNAs (Chojnowska et al. 2017) was noted in females in April Environmental Protection, Faulty of Biology and Biotechnology of University of (pregnancy) than in July (post-breeding). In turn, in males, higher Warmia and Mazury in Olsztyn for assistance with statistical analysis. Ob-R and leptin mRNA levels were noted in November (pre-breed- ing) than in July (post-breeding). The presence of Ob-R gene and protein in all branches of the HPA axis suggests that leptin can Funding modulate the stress response in this species. It is known that leptin This study was supported by the National Science Centre [Project No. 2012/ suppresses glucocorticoid secretion by the adrenal cortex through 07/B/NZ9/01335] and the Ministry of Higher Education [Project No. 528/ the direct/indirect effect on hypothalamic CRF and pituitary ACTH 0206/882]. release (for review see Roubos et al. 2012). There are also reports describing the direct inhibitory effect of leptin on cortisol secretion References from bovine (Bornstein et al. 1997), rat, and human (Pralong et al. 1998) adrenocortical cells although leptin itself is not expressed in Adam CL, Moar KM, Logie TJ, Ross AW, Barrett P et al., 2000. Photoperiod the human adrenals (Glasow et al. 1998). regulates growth, puberty and hypothalamic neuropeptide and receptor Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018 Chojnowska et al.  Leptin/leptin receptor system in the European beaver 7 gene expression in female Siberian hamsters. Endocrinology 141: Nakamura S, Nishii N, Yamanaka A, Kitagawa H, Asano M et al., 2009. 4349–4356. Leptin receptor (Ob-R) expression in the ovary and uterus of the wild Balogh O, Staub LP, Gram A, Boos A, Kowalewski MP et al., 2015. Leptin in Japanese black bear Ursus thibetanus japonicus. J Reprod Dev 55:110–115. the canine uterus and placenta: possible implications in pregnancy. Reprod Plastow KP, Waddell B, 2002. Leptin receptor expression in the rat uterus: vari- Biol Endocrinol 13:13. ation across the estrous cycle and with decidualization. In: Henson MC, Bornstein S, Uhlmann R, Haidan K, Ehrhart-Bornstein A, Scherbaum WA, 1997. Castracane VD, editors. Leptin and reproduction. Berlin: Springer Evidence for a novel peripheral action of leptin as a metabolic signal to the ad- Science+business Media, LLC, 352 renal gland: leptin inhibits cortisol release directly. Diabetes 46:1235–1238. Pralong FP, Roduit R, Waeber G, Castillo E, Mosimann F et al., 1998. Leptin Cervero A, Horcajadas JA, Martin J, Pellicer A, Simon C, 2004. The leptin sys- inhibits directly glucocorticoid secretion by normal human and rat adrenal tem during human endometrial receptivity and preimplantation develop- gland. Endocrinology 139:4264–4268. ment. J Clin Endocrinol Metab 89:2442–2451. Roubos EW, Dahmen M, Kozicz T, Xu L, 2012. Leptin and the Chojnowska K, Czerwinska J, Kaminski T, Kaminska B, Kurzynska A et al., hypothalamo–pituitary–adrenal stress axis. Gen Comp Endocrinol 177: 2017. Leptin plasma concentrations, leptin gene expression and protein lo- 28–36. calisation in the hypothalamic–pituitary–gonadal/adrenal axes of the Ruiz-Cortez ZT, Men T, Palin MF, Downey BR, Lacroix DA et al., 2000. European beaver Castor fiber. Theriogenology 87:266–275. Porcine leptin receptor: molecular structure and expression in the ovary. Chojnowska K, Czerwinska J, Kaminski T, Kaminska B, Panasiewicz G et al., Mol Reprod Dev 56:465–474. 2015. Sex- and seasonally related changes in plasma gonadotropins and sex Ryan NK, Woodhouse CM, Van Der Hoek KH, Gilchrist RB, Armstrong DT steroids concentration in the European beaver Castor fiber. Eur J Wildl Res et al., 2002. Expression of leptin and its receptor in the murine ovary: pos- 6:807–811. sible role in the regulation of oocyte maturation. Biol Reprod 66: Czerwinska J, Chojnowska K, Kaminski T, Bogacka I, Panasiewicz G et al., 2015. 1548–1554. Plasma glucocorticoids and ACTH levels during different periods of activity in Smolinska N, Kaminski T, Siawrys G, Przala J, 2013. Expression of leptin and the European beavers (Castor fiber L.). Folia Biol (Krako´w) 63:229–233. its receptor genes in the ovarian follicles of cycling and early pregnant pigs. Glasow A, Haidan A, Hilbers U, Breidert M, Gillespie J et al., 1998. Animal 7:109–117. Expression of Ob receptor in normal human adrenals: differential regulation Spicer LJ, 2001. Leptin: a possible metabolic signal affecting reproduction. of adrenocortical and adrenomedullary function by leptin. J Clin Dom Anim Endocrinol 21:251–270. Endocrinol Metab 83:4459–4466. Xing Y, Liu J, Xu J, Yin L, Wang L et al., 2015. Association between plasma Kawamura K, Sato N, Fukuda J, Kodama H, Kumagai J et al., 2002. Leptin leptin and estrogen in female patients of amnestic mild cognitive impair- promotes the development of mouse preimplantation embryos in vitro. ment. Dis Markers 11:1–5. Endocrinology 143:1922–1931. Zhang Y, Kerman IA, Laque A, Nguyen P, Faouzi M et al., 2011. Malendowicz LK, Rucinski M, Belloni AS, Ziolkowska A, Nussdorfer GG, Leptin-receptor-expressing neurons in the dorsomedial hypothalamus and 2007. Leptin and the regulation of the hypothalamic–pituitary–adrenal median preoptic area regulate sympathetic brown adipose tissue circuits. J axis. Int Rev Cytol 263:63–102. Neurosci 31:1873–1884. Mercer JG, Moar KM, Ross AW, Morgan PJ, 2000. Regulation of leptin re- Zieba DA, Szczesna M, Klocek-Gorka B, Williams GL, 2008. Leptin as a nu- ceptor, POMC and AGRP gene expression by photoperiod and food depriv- tritional signal regulating appetiteand reproductive processes in ation in the hypothalamic arcuate nucleus of the male Siberian hamster seasonally-breeding ruminants. J Physiol Pharmacol 59:7–18. Phodopus sungorus. Appetite 34:109–111. Zurowski W, 1992. Building activity of beavers. Acta Theriol 37:403–411. Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zoy030/4969521 by Ed 'DeepDyve' Gillespie user on 13 July 2018

Journal

Current ZoologyOxford University Press

Published: Apr 12, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off