Involvement of Epigenetic Modifications of GABAergic Interneurons in Basolateral Amygdala in Anxiety-like Phenotype of Prenatally Stressed Mice

Involvement of Epigenetic Modifications of GABAergic Interneurons in Basolateral Amygdala in... International Journal of Neuropsychopharmacology (2018) 21(6): 570–581 doi:10.1093/ijnp/pyy006 Advance Access Publication: February 20, 2018 Regular Research Article regular research article Involvement of Epigenetic Modifications of GABAergic Interneurons in Basolateral Amygdala in Anxiety-like Phenotype of Prenatally Stressed Mice Chunting Zhu, Min Liang, Yingchun Li, Xuejiao Feng, Juan Hong, Rong Zhou Department of Physiology, Nanjing Medical University, Jiangsu, China. Correspondence: Rong Zhou, PhD, Department of Physiology, Nanjing Medical University, Longmian Avenue 101, Jiangning District, Nanjing City, Jiangsu Province, China 211166 (zhourong@njmu.edu.cn). ABSTRACT Background: Prenatal stress is considered a risk factor for anxiety disorder. Downregulation in the expression of GABAergic gene, that is, glutamic acid decarboxylase 67, associated with DNA methyltransferase overexpression in GABAergic neurons has been regarded as a characteristic component of anxiety disorder. Prenatal stress has an adverse effect on the development of the basolateral amygdala, which is a key region in anxiety regulation. The aim of this study is to analyze the possibility of epigenetic alterations of GABAergic neurons in the basolateral amygdala participating in prenatal stress-induced anxiety. Methods: Behavioral tests were used to explore the prenatal stress-induced anxiety behaviors of female adult mice. Real-time RT-PCR, western blot, chromatin immunoprecipitation, and electrophysiological analysis were employed to detect epigenetic changes of GABAergic system in the basolateral amygdala. Results: Prenatal stress mice developed an anxiety-like phenotype accompanied by a significant increase of DNA methyltransferase 1 and a reduced expression of glutamic acid decarboxylase 67 in the basolateral amygdala. Prenatal stress mice also showed the increased binding of DNA methyltransferase 1 and methyl CpG binding protein 2 to glutamic acid decarboxylase 67 promoter region. The decrease of glutamic acid decarboxylase 67 transcript was paralleled by an enrichment of 5-methylcytosine in glutamic acid decarboxylase 67 promoter regions. Electrophysiological study revealed the increase of postsynaptic neuronal excitability in the cortical-basolateral amygdala synaptic transmission of prenatal stress mice. 5-Aza-deoxycytidine treatment restored the increased synaptic transmission and anxiety-like behaviors in prenatal stress mice via improving GABAergic system. Conclusion: The above results suggest that DNA epigenetic modifications of GABAergic interneurons in the basolateral amygdala participate in the etiology of anxiety-like phenotype in prenatal stress mice. Keywords: anxiety, DNMT1, epigenetic, GABAergic dysinhibition, GAD67, prenatal stress effect of early-life stress on brain development. For example, epi- Introduction demiologic studies have indicated that children exposed to early Brain development is an intricate and subtle process and greatly adverse experiences are at increased risk for the development sensitive to stress and environmental factors. Clinical and pre- of depression and anxiety disorders in the adulthood (Heim clinical studies have indicated that early-life stress including and Nemeroff, 2001; Cartwright-Hatton, 2006). Consistently, prenatal stress (PRS) has an adverse effect on the neurodevel- animal studies have indicated that prenatally stressed rats or opment leading to the permanent abnormality of brain struc- mice exhibit excessive anxiety-like behaviors in the elevated ture and function. Anxiety disorder in childhood or adulthood plus maze (EPM) and the open field test (OFT) (Vallee et al., 1997; is regarded as the common long-term outcome of the disrupted Received: September 27, 2017; Revised: January 8, 2018 © The Author(s) 2018. Published by Oxford University Press on behalf of CINP. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons. org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is 570 properly cited. Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 Zhu et al. | 571 Significance Statement The present study provides new insight into investigating the mechanisms underlying the influence of prenatal stress (PRS) on adult behaviors. Since PRS mice shows a similar epigenetic signature to patients with anxiety disorder, PRS mice can be a valid animal model to study the epigenetic mechanisms underlying anxiety disorder and validate the novel antianxietic drugs. Furthermore, our study reveals the validity of DNA methyltransferase 1 (DNMT1) inhibitor in improving a variety of PRS-induced anxiety alterations. DNMT1 may represent a potential new molecular target to treat patients with anxiety disorder. Thus far, epigenetic drugs have been used in cancer treatment, because they often selectively reactivate tumor suppressor genes that are silenced by CpG island promoter methylation. Mairesse et al., 2007; Zuena et al., 2008; Papale et al., 2017) and the NIH Guide for the Care and Use of Laboratory Animals. All an increased reactivity of hypothalamo-pituitary-adrenal (HPA) efforts were made to minimize the number of animals and their axis to stress indicative of a typical anxious phenotype that is suffering. observed in anxiety patients (Darnaudery and Maccari, 2008; Weinstock, 2008). Animal Model Preparation Abundant data have demonstrated that “persistency” is the Pregnant C57BL/6J mice (Oriental Bio Service Inc) were individu- most obvious characteristic of the effects of early-life stress. ally housed and food and water ad libitum. Control dams were Although the mechanisms underlying the relationship between left undisturbed throughout gestation with a 12-h-light/-dark adverse developmental experiences and life-long phenotypic cycle (lights on at 7:00 am and off at 7:00 pm), whereas stressed consequences are unclear, the epigenetic role of early-life dams were subjected to the restraint stress as described pre- stress in the pathogenesis of anxiety disorder was suggested viously (Zheng et  al., 2016) with slight modification. From the in epidemiological studies (Murgatroyd et al., 2009 Meane ; y and tenth day of pregnancy until delivery, the pregnant dams were Ferguson-Smith, 2010; Papale et al., 2017). An early-life stressor restrained in a transparent tube (12  cm × 3  cm) for 45  min 3 has been reported to increase the expression of DNA methyl- times/d and exposed to 24-h constant light. The day of birth was transferase (DNMT1 and 3a) in the postnatal brain (Matrisciano referred to as postnatal day 0 (PND 0). Weaning occurred at PND et al., 2013; Dong et al., 2015). DNMT1 and DNMT3a are mainte- 21 to 22, after which the offspring of control and stressed dams nance enzymes that selectively localize in GABAergic neurons, (control and PRS mice) were group-housed by litter and sex. To and the overexpression of these enzymes has been reported minimize the effect of parent-to-offspring interaction per litter, in GABAergic neurons of cortical or striatal brain areas in psy- one female offspring was randomly selected from each litter as chotic patients (Veldic et al., 2005 V ; eldic et al., 2007; Zhou et al., object of study. Male offspring were not taken into experiments, 2013). The promoter of glutamic acid decarboxylase (GAD) 67, because the anxiogenic effects of PRS were mainly observed in which is one of GABAergic neuronal markers, has been proved females but not males (Papale et al., 2017). Then, the following to be embedded in large CpG islands and express methylation experiments were performed at PNDs 60 to 70. consensuses (Grayson et al., 2005; Costa et al., 2007). Decreased GAD67 expression and increased DNMTs expression, as well an increase in the methylation of GAD67 promoter, have recently Behavior Analysis been reported in the brain of adult mice prenatally exposed to stress (Matrisciano et al., 2012, 2013). To avoid the influence of the fluctuation of gonadal hormones The GABAergic inhibitory circuit in the basolateral amyg- in estrous cycle on anxious behaviors (Koonce et al., 2012), the dala (BLA) has been identified as a key regulator of anxiety- behavioral experiments were performed at diestrus of female like behaviors in both preclinical and clinical settings (Sanders mice. According to the types of vaginal epithelium cells (leuko- and Shekhar, 1995; Allison and Pratt, 2003Bueno et  ; al., 2005; cyte cells, nucleated cells, and cornified cells), diestrus, proes- Ackermann et al., 2008). The deficit in GABAergic system in the trus, and estrus were determined. Mice were used to examine BLA is implicated in the pathophysiology of neurodevelopmen- anxiety-like behaviors on 3 mornings following OFT (on the first tal psychiatric disorders (Quirk and Gehlert, 2003 Benes, ; 2010; morning)→EPM (on the second morning)→light/dark box test Felix-Ortiz et al., 2013). Several studies have identified effects of (DLT on the third morning) sequence. The room was dimly lit PRS on the developing amygdala (Kraszpulski et al., 2006Charil ; during the tests. The detailed methods of the behavioral tests et  al., 2010) and adult amygdala function (Weinstock, 2008; have been described previously (Chiba et  al., 2012). Animals’ Sadler et al., 2011). behaviors were videotaped and quantified via Ethovision 3.0 Considering that PRS has adverse effects on DNA methylation software (Noldus Information Technology Inc.). and the development of amygdala, we investigated whether PRS results in the increase of anxiety-related behaviors through an OFT epigenetic GABAergic dysfunction in the BLA. The aim of the pre- The novel environment was a 35  cm × 35  cm × 25  cm white sent study is to increase the understanding of epigenetic mecha- Plexiglas arena. Mice were placed in a corner and were allowed nisms underlying anxiety disorder by analyzing the interactions to freely explore the field for 10 min. Both total traveled distance between genes and the environment in an animal model. and time spent in the center area were recorded. EPM Materials and Methods The elevated plus maze consisted of 2 open and 2 closed arms The present studies were approved by the Animal Care and with each arm projecting 50  cm from the center (a 10× 10  cm area). The whole apparatus was placed 50  cm above the floor. Use Committee of Nanjing Medical University. The protocols used here were in accordance with the guidelines published in Control and PRS mice were placed in the center of the EPM, Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 572 | International Journal of Neuropsychopharmacology, 2018 facing a closed arm, and were allowed to freely explore the maze Western-Blot Analysis for 10 min. The number of 4-paw entries and the time spent in For protein quantification, we conducted measurements as the 2 open arms were blindly analyzed. described in detail elsewhere (Matrisciano et  al., 2012). The BLA was dissected on ice and the protein was extracted using DLT a total protein extraction kit (KGP250KGP2100; KeyGEN Biotech). The DLT test was performed in a rectangular box divided in Anti-DNMT1 monoclonal antibodies (NB100-264; Imagenex) and 2 compartments (light and dark). A  removable dark Plexiglas anti-GAD67 polyclonal antibody (MAB5406; Millipore) were used partition was used to divide the box into light and dark sides. to detect DNMT1 and GAD67 protein. Anti-β-actin monoclonal Each animal was placed into the light side of the box, facing antibody (04-1116; Millipore) was used an internal antibody. The away from the dark side and allowed to explore both chambers IMAGEQUANT analysis software was used to perform the densi- of the apparatus for 10  min. The time spent in the light side tometric analysis of interest bands. The values were presented and the number of entries into the dark compartment were as an optical density ratio with respect to β-actin. scored. Chromatin Immunoprecipitation Assays Hormones Assay Chromatin immunoprecipitation (ChIP) assays were used to Two batches of mice were killed, one between 7:30 and 8:00 am detect DNMT1 or MeCP2 binding to CpG-rich regions of GAD67 and the other between 5:30 and 6:00 pm. Plasma was separated promoter. The Chip procedure was carried out using a ChIP kit and stored at -20°C for hormones assay. The concentrations of (17–295; Upstate). Briefly, approximate 10  mg of the BLA was plasma corticosterone and adrenocorticotropin (ACTH) were 125 used for this procedure. Tissue was incubated at 37°C for 10 min assayed by a I double-antibody radioimmunoassay kit (07- with 500 mL of PBS containing 1% formaldehyde and a cocktail 189105; MP Biomedicals) according to the instructions of the of protease inhibitors (P8340; Sigma). Tissue was homogenized manufacturer. The ACTH assay has a sensitivity of 2 pg/mL and in 300 mL of SDS lysis buffer (supplied by ChIP kit, Upstate), and intra-assay and interassay CVs of <8%. The corticosterone assay the lysate was sonicated for 15 min on ice. Immunoprecipitation has a sensitivity of 1 ng/mL and intra-assay and interassay CVs was performed overnight at 4 °C by the addition of 10  μg of ChIP of <10%. grade DNMT1 (ab87656; Abcam) or MeCP2 (ab2828; Upstate) to the sonicated solution. An aliquot of the sonicated lysate with- Real-time RT-PCR out antibody was used as input to quantify the total amount Mice were killed (2  h after lights on) and whole brains were of DNA in sample extracts. Protein-free DNA was extracted and extracted and immediately stored at -80°C until assayed. Brains used for detection and quantification of CpG-rich regions of sections (50 μm thick) were cut in the coronal plane using a GAD67 promoter by quantitative PCR. The primers of CpG-rich cryostat. The BLA subfield was dissected from the frozen slices GAD67 promoter were decided by the reports of Matrisciano on dry ice. Total RNA was extracted using TRIzol (15596–026; et al., (2013) and shown in Table 1. The level of immunoprecipi- Invitrogen) following the manufacturer’s instructions. Possible tated GAD67 promoter by the DNMT1 or MeCP2 antibody was contamination with genenomic DNA was removed by an on- expressed as a percentage of the input DNA using the following column DNase I  (15200, Qiagen) treatment. mRNA was reverse equation: % (DNA-IP/total input) = 2 [(Ct(10%input) – 3.32) – Ct transcribed using the high-capacity cDNA Reverse Transcription (DNA-IP)] × 100%. kit (4368814; Applied Biosystems) following the manufactur - er’s instructions. The primer sequences of DNMT1, DNMT3a, Methylated/Hydroxymethylated DNA DNMT3b, methyl CpG binding protein 2 (MeCP2), ten-eleven Immunoprecipitation translocation 1 (TET1), GAD67, and GAPDH are shown in Table 1. Methylated (5MC) and hydroxymethylated DNA (5HMC) on These primer sequences were decided upon according to the pre- vious reports (La Salle et al., 2004 Matrisciano et  ; al., 2013Dong ; GAD67 promoter were assessed using MeDIP (C02010011; Diagenode) and hMeDIP kits (C02010034; Diagenode) followed et al., 2015). RT-PCR was performed using a LightCycler FastStart DNA Master SYBR Green I  kit (3515869001; Roche) and an ABI by quantitative PCR. The procedures for sample treatment and immunoprecipitation are described in the kit instruction manu- Prism 7300 Sequence Detection System (Applied Biosystems). To improve the accuracy of the real-time PCR for quantification, als. The following quantitative PCR, the primers of GAD67 pro- moter, and the calculation of the level of immunoprecipitated amplifications were performed intriplicate for each RNA sample. -ΔΔCt The relative expression of genes was determined using the 2 GAD67 promoter by the 5MC or 5HMC antibody were the same as those in ChIP assays. method with normalization to GAPDH expression. Table 1. Primers for the Reference and Target Genes Gene Forward Primer (5’ to 3’) Reverse Primer (5’ to 3’) DNMT1 TGACAGTGGTGCTGAAGAAGCCAT AGAATGGAGCCTCGAATTCTGAGA DNMT3a AACAACAACTGCTGCAGGTGCTTT ACTCCTGGATATGCTTCTGTGTGA DNMT3b TTCAGTGACCAGTCCTCAGACACGAA TCAGAAGGCTGGAGACCTCCCTCTT MeCP2 GGTTGTCTCCACTGCTACTTAC GCTAACTTGGGTGCTGATCT TET1 ACGCTGGAACAAGTGGTAGCCATA TGAACGTTTGGGTCTTGGAGGTCT GAD67 CTTTGGAGCTCTTCCTGATTGA TTGTTTGAGGGCTGTCTCTG GAPDH ACCAGGGAGGGCTGCAGTCC TCAGTTCGGAGCCCACACGC CpG-rich GAD67 promoter GAGGAGAGCGGGCCAAGA GTGCCGCTCCACACGCC Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 Zhu et al. | 573 brain in stereotaxic coordinates (Paxinos and Franklin, 2001). Electrophysiological Analysis After a 7-day recovery period, animals received bilateral injec- Slice Preparation tion of the drugs with 0.3 μL/side through the infusion cannula Mice were killed by decapitation and prepared for slices elec- (Nasehi et  al., 2017). 5-Aza-deoxycytidine (5-aza-CdR; A3656; trophysiology as described previously (Zhou et  al., 2011). Their Sigma-Aldrich) was dissolved in 0.8% acetate and diluted to a brains were quickly removed and placed in ice-cold oxygen- concentration of 200  ng/μL in saline. 5-aza-CdR or vehicle was ated artificial cerebrospinal fluid (ACSF) consisting of (in mM) delivered through the cannula once a day for 7 consecutive days 124 NaCl, 2 CaCl, 4.5 KCl, 1.0 MgCl, 26 NaHCO , 1.2 NaH PO , 2 2 3 2 4 before the experiments. and 10 D-glucose and adjusted to pH 7.4 by bubbling with 95% O /5% CO mixture. Coronal brain slices (400  μm thick) were cut 2 2 Data Analysis/Statistics using a vibrating microtome (Microslicer DTK 1500) in ice-cold oxygenated (95% O /5% CO ) ACSF. The slices containing the BLA 2 2 Data were retrieved and processed with the Origin 6.1 software and external capsule (EC) were stored for a minimum of 1 h in (Micro-Cal Software Inc.). The group data were expressed as the oxygenated ACSF maintained at RT. means ±SEM. Two-tailed Student’s t test was used for compari- sons between 2 groups. ANOVAs followed by Fisher’s protected Field Potential Recording least significant difference (PLSD) posthoc test was employed For recording, the BLA slices were transferred to a chamber con- if more than 2 groups were compared. Statistical analysis tinuously perfused with oxygenated ACSF (2 mL/min) maintained was performed using Stata 7 software (Stata Corp). P < .05 was at 30°C. Biphasic square wave pulses were applied at EC through considered statistically significant. For statistical purposes, a stainless-steel stimulation electrode (Figure  6A). Stimulation- only one slice was studied per mouse in electrophysiological evoked population spikes (PS) were recorded from the BLA by a analysis. glass micropipettes filled with 2 M NaCl (4–5 MΩ) connected to an Axoclamp2B amplifier (Axon Instruments). PS response was sam- pled using pCLAMP software (Axon Instruments). The PS ampli- RESULTS tude was defined as the mean amplitude of the peak negativity, measured from the peak of the early and the late negativity. Paired- PRS Mice Express the Increase of Anxiety-like pulse inhibition (PPI) of the PS was evoked by double-pulse stimu- Behaviors in Behavioral Experiments lation to EC at 50% of maximal stimulus strength and expressed as the ratio of the second PS amplitude to the first one. The inter - OFT val between double pulses (20, 50, 75, 100 ms) was adopted to fall PRS mice showed a decrease in time spent in the central area within the time course of the intracellularly recorded IPSP attrib- of the open field in comparison with age-matched controls uted to activation of GABAergic interneurons (Rainnie et al., 1991). (t = 2.41, P < .05; Figure 2A). To exclude the influence of locomo- (26) tion abnormality in this test, we also measured the locomotor Drug Administration activity of those mice. No significant difference in total traveled Cannulae were implanted with bilateral 27-gauge stainless steel distance between control and PRS groups was observed in the present study (t = 0.27, P > 0.05; Figure 2B). cannulas into the bilateral BLA (Figure 1) according to the mouse (26) Figure 1. Illustration of the locations of the injection cannula tips in the basolateral amygdala (BLA) in all animals used in the study. Numbers show distances from bregma. Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 574 | International Journal of Neuropsychopharmacology, 2018 Figure  3. The basal activity of hypothalamo-pituitary-adrenal (HPA)-axis is Figure 2. Prenatal stress (PRS) mice exhibit the increased anxiety-like behaviors. potentiated in prenatal stress (PRS) mice. CON and PRS represent control and CON and PRS represent control and PRS mice, respectively. (A and B) In the open PRS mice, respectively. (A and B) PRS mice showed a significant increase in basal field test (OFT), PRS mice spent less time in the center area compared with control corticosterone (A) and adrenocorticotropin (ACTH) (B) concentrations. Sample mice. (C and D) In the elevated plus maze (EPM), PRS mice showed a decreased collection was performed in the morning (8:00 am) and in the afternoon (6:00 pm). percentage of time spent in the open arms compared with control mice. (E and All bars represent means ± SEM; 2-tailed Student’s t test; *P < .05 between the data F) In the light/dark box test (DLT), PRS mice spent less time in the light-box com- of control (n = 10) and PRS mice (n = 12) at the same time. pared with control mice. All bars represent means ± SEM; 2-tailed Student’s test; t *P < .05 and **P < .01 between the data of control (n = 14) and PRS mice (n = 14). from control and PRS mice at circadian nadir (8:00 am) and EPM peak (6:00 pm). As shown in Figure  3A–B, PRS mice exhibited The percentage of time spent in the open arms was decreased a significant increase in both basal and peak corticosterone in PRS offspring as compared with controls (t = 3.08, P < .01; release compared with controls (basal: t = 2.51, P < .05; peak: (26) (20) Figure 2C). However, the number of 4-paw entries in the test area t = 2.74, P < .05). Similarly, PRS mice had increased basal plasma (20) was not affected by PRS (t = 0.48, P > 0.05; Figure 2D). ACTH and exhibited significantly increased peak ACTH (basal: (26) t = 2.32, P < .05; peak: t = 2.21, P < .05). (20) (20) DLT PRS mice spent less time in the light-box of the DLT than con- DNMT1 Excess Is Accompanied by the Decreased trols (t = 2.26, P < .05; Figure 2E). No statistically significant dif- (26) GAD67 Expression in the BLA of PRS Mice ferences were found in terms of the total number of transitions Earlier reports suggest that an increase in DNMT levels is asso- between the 2 groups (t = 0.146, P > 0.05; Figure 2F). (26) ciated with a downregulation of GAD67 in postmortem brain tissue from patients with schizophrenia or bipolar disorders PRS Results in the Potentiation of Circadian HPA- (Guidotti et  al., 2011) and in brain of early postnatal stressed Axis Activity rats (Zhang et al., 2010). The results of real-time RT-PCR showed To test whether PRS affects HPA-axis regulation leading to the that in several detected enzymes associated with DNA meth- change of anxiety-related behaviors, plasma was collected ylation modification, only the expression of DNMT1 mRNA Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 Zhu et al. | 575 was significantly higher in the BLA of PRS mice compared with in PRS mice was significantly greater than that for the control control mice (t = 3.16, P < .01; Figure 4A). The result of western group (t   =  4.21, P < .01). Based on the previous studies (Wang (14) (18) blot indicated that associated with an increased level of DNMT1 et al., 2001, 2002), the appearance of PSs suggests the possibility (t = 4.29, P < .01), PRS mice showed a marked decrease in GAD67 that the inhibitory mechanisms that normally restrict repetitive (14) protein level in the BLA (t = 2.41, P < .05; Figure  4B) compared firing in the BLA are impaired in PRS mice. PPI with inter-pulse (14) with control mice. intervals (IPIs) ranging from 20 to 100 ms were then introduced to determine the inhibitory activity of GABAergic interneuron in the BLA (Isoardi et  al., 2004). As shown in Figure  6C, 2-way DNMT1-Induced Hypermethylation of GAD67 repeated ANOVA indicated statistically significant effects with Promoter Results in the Downregulation of GAD67 in PRS (F = 58.024; P < .001), IPIs (F = 5.373; P < .05), and PRS by (1,20) (1,20) the BLA of PRS Mice IPI interaction (F = 7.916; P < .05). PPI was mainly observed (1,20) To test whether the overexpression of DNMT1 in PRS mice cor - with IPIs at 20 to 75  ms in the control mice, whereas paired- relates with an increased binding of DNMT1 to specific GAD67 pulse facilitation (PPF) instead of PPI was evoked by 20 to 75 ms CpG-rich promoter sequences, we measured the binding of IPIs in PRS mice (P < .01). The PPI-reversed to PPF in PRS mice DNMT1 to GAD67 promoter by ChIP assay. The results showed proves the fact that the decrease of GABAergic inhibitory mech- that the binding of DNMT1 to GAD67 promoter region was anism results in the increase of the BLA neuronal excitability. increased in PRS mice (t = 3.24, P < .01; Figure 5A). Moreover, the Two-way ANOVA displayed main effects of PRS and 5-aza-CdR (10) binding of MeCP2 to GAD67 was also significantly higher in PRS treatment and their interaction on the number of PSs (PRS: mice (t = 2.68, P < .05; Figure  5B) in the absence of the expres- F = 28.62; P < .001; 5-aza-CdR: F = 34.35; P < .001; PRS×5-aza- (10) (1,42) (1,42) sion change of MeCP2 mRNA. CdR: F = 38.01; P < .001; Figure 6D) and PS2/PS1 (PRS: F = 5.54; (1,42) (1,42) To investigate whether the decreased expression of GAD67 P < .05; 5-aza-CdR: F = 4.72; P < .05; PRS×5-aza-CdR: F = 4.384; (1,42) (1,42) in PRS mice are the consequence of epigenetic modification on P < .05; Figure  6E). The followed PLSD posthoc test further indi- the corresponding DNA regulatory regions, we measured the cated that treatment with 5-aza-CdR abolished the repetitive enrichment of the 2 most important epigenetic marks: 5MC response (P < .01) and recovered PPI (P < .01) in the slices from and 5HMC at the GAD67 promoter. As shown in Figure  5C, PRS offspring, suggesting the involvement of DNMT1 in the BLA 5MC was enriched at GAD67 promoter in PRS mice compared GABAergic deficiency. with control mice (t = 2.66, P < .05). The 5HMC level in PRS (10) mice was higher than control mice, but did not reach the sig- The Intra-BLA Injection of 5-aza-CdR Corrects nificant level (t = 1.04, P  >  0.05; Figure  5D). These findings (10) Anxiety-like Behavior in PRS Mice suggest that PRS leads to CpG hypermethylation on GAD67 promoters. The enrichment of 5MC at GAD67 promoter was To test whether the behavioral alterations of PRS mice were negatively correlated with the level of corresponding GAD67 mediated by epigenetic mechanisms including an increase in transcript (r = 0.352, P = .03; Figure 5E), suggesting an epigenetic DNMT1, an increase of GABAergic promoter methylation, and mechanism by which promoter methylation may be respon- a downregulation of the GABAergic gene expression, the behav- sible for the downregulation of GAD67 in PRS mice (t = 3.83, (10) ior of PRS mice was evaluated following the repeated microin- P < .01; Figure  5F), and this possibility was therefore tested via jection of 5-aza-CdR into the BLA. Two-way ANOVA revealed a detecting the effect of repeated intra-BLA injection of 5-aza- main effect of PRS (center time: F = 4.83, P < .05; time in the (1,60) CdR, DNMT1 inhibitor on 5MC at GAD67 promoter, and GAD67 open arm: F = 5.15, P < .05; time in light: F = 4.32, P < .05) and (1,60) (1,60) transcript. Two-way ANOVA displayed main effects of PRS and 5-aza-CdR treatment (center time: F = 5.36, P < .05; time in (1,60) 5-aza-CdR treatment and their interaction on 5MC at GAD67 the open arm: F = 5.56, P < .05; time in light: F = 5.73, P < .05) (1,60) (1,60) promoter (PRS: F = 6.28; P < .05; 5-aza-CdR: F = 4.89; P < .05; (1,24) (1,24) and a PRS×5-aza-CdR treatment interaction effect (center time: PRS×5-aza-CdR: F = 4.71; P < .05; Figure  5G) and GAD67 tran- (1,24) F = 4.95, P < .05; time in the open arm: F = 8.64, P < .05; time (1,60) (1,60) script (PRS: F = 5.77; P < .05; 5-aza-CdR: F = 5.01; P < .05; (1,24) (1,24) in light: F = 3.02, P < .05). The results of the followed PLSD post- (1,60) PRS×5-aza-CdR: F = 8.53; P < .01; Figure  5H). The treatment (1,24) hoc test further showed that 5-aza-CdR rectified the changed with 5-aza-CdR abolished both the alterations of 5MC level at center time in the OFT (P < .05; Figure 7A), time spent in the open GAD67 promoter (P < .05) and GAD67 transcript (P < .01) in PRS arm of the EPM (P < .05; Figure 7B), and time in the light of the DLT mice. (P < .05; Figure 7C), but had no effect in control mice (P > 0.05). DNMT1-Mediated GABAergic Dysfunction Discussion Participates in the Enhancement of Cortical-BLA This study represents the first demonstration that PRS facili- Transmission in PRS Mice tates anxiety-like behaviors and attenuates GABAergic inhibi- GABAergic system in the BLA plays a key role in inhibiting the tion in the BLA of female mice offspring, which is at least partly excitation of the pyramidal cells that receive cortical glutamater - via DNMT1-related epigenetic reprogramming of GABAergic sys- gic inputs (Stell et  al., 2003Ma ; guire et  al., 2005). Therefore, to tem. In addition, the present data also suggest the long-term evaluate the possibility that epigenetic modification of DNMT1 neurobehavioral effects of PRS are reversible in the adult period. further changes GABAergic function in the BLA of PRS mice, It has been widely proved that early life stress causes long- cortical-BLA glutamate synaptic transmission was detected lasting changes in neuroplasticity that result in an increased (Figure  6A). As shown in Figure  6B, in slices from control off- vulnerability to stress-related disorders in later life (Meaney spring, a moderate single pulse evoked a PS generated by the et al., 2007; Darnaudery and Maccari, 2008; Lupien et al., 2009). synchronous firing of basolateral projecting neurons. By con- The present data that PRS resulted in anxiety-like behaviors trast, in slices from PRS mice, the same manner of stimulation and associated endocrinological alterations of adult female evoked the appearance of several additional responses follow- mice give further support to the above notion. Female mice ing the main PS in the BLA neurons. The average number of PSs exposed to stress in utero represent a new behavioral model of Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 576 | International Journal of Neuropsychopharmacology, 2018 Figure 4. Elevated DNA methyltransferase 1 (DNMT1) levels are accompanied by the decrease of glutamic acid decarboxylase 67 (GAD67) expression in the basolateral amygdala (BLA) of prenatal stress (PRS) mice. CON and PRS represent control and PRS mice, respectively. (A) Quantitative RT-PCR results of DNMT1, DNMT3a, DNMT3b, MeCP2, and TET1 mRNA in the BLA of control and PRS mice. (B) Immunoblot data of DNMT1 and GAD67 normalized by β-actin protein levels. All bars represent means ± SEM; 2-tailed Student’s t test; *P < .05 and **P < .01 between the data of control (n = 8) and PRS mice (n = 8). Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 Zhu et al. | 577 an anxiety-like phenotype, because it recapitulates the potential link between early-life adversity and the pathogenesis of stress- related disorders. The early development period is crucial for establishing and maintaining epigenetic marks (Reik et al., 2001; Reik, 2007). Epigenetic mechanisms are consequently regarded as the most plausible targets through which early life stress could exert their long-lasting effects. Indeed, accumulating evidence has proved the DNA epigenetic alterations induced by prenatal restrained stress contribute to the complex phenotypes of neuropsy- chiatric disorders (Matrisciano et  al., 2012 Zheng et  ; al., 2016; Papale et  al., 2017). DNMTs are important components of the DNA-methylation that dynamically regulates the expression of key molecules involved in brain function. Here, we focused on DNMTs, because these enzymes have been proved to participate in the physiopathology of several neurodevelopmental disor - ders including anxiety disorder (Ruzicka et al., 2007 V; eldic et al., 2007; Guidotti et  al., 2011). Our results showed that in these detected enzymes, only the expression of DNMT1 was found to be elevated in the BLA of adult female PRS offspring. To establish in detail whether the altered expression of DNMT1 is expected to result in enrichment of CpG methylation at GAD67 promot- ers, we then measured levels of 5mC, a CpG methylation marker. As expected, there was significant methylation (high levels of 5mC) found on GAD67 promoters in female PRS mice, and the increased promoter methylation of GAD67 was inversely cor - related with the corresponding transcripts. These data suggest PRS results in DNMT1-regulated hypermethylation of GAD67 promotor, thereby inhibiting GAD67 transcription in the BLA. However, we cannot exclude the possibility that histone modi- fications, another epigenetic regulation of gene transcription, could contribute to the epigenetic modifications detected in female PRS mice. The GABAergic system in the BLA participates in the regula- tion of emotional behaviors via inhibiting the excitation of the pyramidal cells that receive cortical glutamatergic inputs (Stell et al., 2003; Maguire et al., 2005). Research in our laboratory and others have established the appearance of multiple PSs in cor - tical-BLA transmission due to the decreased GABAergic inhibi- tory effect on the pyramidal neurons (Rodriguez Manzanares et al., 2005). In the present study, the electrophysiological find- ing that multiple PSs instead of single PS were measured in the BLA slices of female PRS mice strongly suggests that PRS results in the BLA GABAergic deficits. This inference also is supported by the fact that PPI reversed into PPF in the slices of female PRS mice. Guidotti et al. (2005) have found that there is an obvious decrease of GAD67 and other markers of GABAergic interneu- rons but not neuronal loss in the postmortem brains of patients with neurodevelopmental psychiatric disorders. The present study shows that the overexpression of DNMT1 is responsible for the decrease of GAD67. Hence,it is plausible that DNMT1- Figure  5. The hypermethylation of glutamic acid decarboxylase 67 (GAD67) induced epigenetic alterations of GABAergic neurons could be promoter results in the downregulation of GAD67 in the basolateral amygdala the basis for the disturbance of GABA-glutamate neuron inter - (BLA) of prenatal stress (PRS) mice. CON and PRS represent control and PRS mice, actions in the BLA of female PRS mice. respectively. (A and B) Data of DNA methyltransferase 1 (DNMT1) (A) or MeCP2 (B) binding to specific promoter regions of GAD67 in control and PRS groups. (C Traditionally, DNA methylation is thought to be a static pro- and D) The levels of 5MC (C) and 5HMC (D) on GAD67 promoter region in con- cess after cellular differentiation. In support of this DNMT stasis trol and PRS groups. (E) The enrichment of 5MC on GAD67 promoter region is hypothesis, the activity and expression of DNMT significantly negatively correlated with the corresponding transcripts by Pearson correlation decreases in differentiated cells and is positively correlated with analysis. (F) Quantitative RT-PCR results of GAD67 mRNA in the BLA of control the proliferative state of cells (Singer-Sam et al., 1990 Yen et  ; al., and PRS mice. (G and H) Effects of 5-aza-CdR on 5MC at GAD67 promoter and 1992; Goto et al., 1994). Our present study and others have found GAD67 transcript. All bars represent means ± SEM; 2-tailed Student’ s t test for A, B, C, D and F; 2-way ANOVA followed by protected least significant difference that the high level of DNMT1 mRNA is detected in the BLA or (PLSD) posthoc test for G and H; *P < .05 and **P < .01 between the data of control hippocampus region of adult mice brain (Levenson et al., 2006; (n = 6) and PRS mice (n = 6) or between the data of vehicle-treated control (n = 6) Kadriu et al., 2012). These results suggest a possibility that DNMT and vehicle-treated PRS mice (n= 6); #P < .05 and ##P < .01 between the data of stasis is absent in the mature brain. Due to the high expression vehicle-treated PRS mice (n= 6) and 5-aza-CdR-treated PRS mice (n= 6). Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 578 | International Journal of Neuropsychopharmacology, 2018 Figure  6. DNA methyltransferase 1 (DNMT1)-mediated GABAergic deficit leads to the potentiation of cortical-basolateral amygdala (BLA) transmission in postnatal stress (PRS) mice. CON and PRS represent control and PRS mice, respectively. (A) Schematic diagram illustrating the placement of stimulating electrode (Stim) and recording electrode (Rec) at cotical-BLA pathway. (B) Left: Basal evoked synaptic response in the BLA of control and PRS mice. PS wave is marked with arrows. Right: The comparison of population spike (PS) number between control and PRS mice. (C) Left: The original results of paired-pulse stimulation with the interval at 50 ms. Right: The comparison of PS2/PS1 with the stimulus interval from 20 to 100 ms between control and PRS mice. Dotted line indicates 100%. ↑ and ↓ represent paired-pulse facilitation (PPF) and paired-pulse inhibition (PPI), respectively. (D and E) Effects of 5-aza-CdR on the number of PSs or the PPI induction in control and PRS mice. All bars represent means ± SEM; 2-tailed Student’s t test for B and 2-way ANOVA followed by PLSD posthoc test for C, D, and E; **P < .01 between the data of contr =ol (n 10) and PRS mice (n = 10) or between the data of vehicle-treated control (n = 12) and v ehicle-treated PRS mice (n= 10). ##P < .01 between the data of vehicle-treated PRS mice (n = 10) and 5-aza-CdR-treated PRS mice (n= 10). of DNMT1 in the BLA, it is possible to analyze the role of DNMT1 female PRS mice. Our study indicates PRS leads to the increase of in long-lasting anxiety using pharmacological methods. In fact, anxiety level in female offspring through epigenetic GABAergic we have found that the local blockade of DNMT1 with 5-aza-CdR dysfunction. However, another report by Matrisciano et  al. in the BLA significantly ameliorated anxiety-like symptoms in (2013) has pointed out the involvement of PRS-induced epigen- PRS mice. It is noteworthy that the same dosage of 5-aza-CdR etic modifications of GABAergic interneurons in schizophrenia as that used in PRS mice fails to change anxiety-related behav- in male mice. These data suggest that PRS-induced epigenetic iors of control mice, suggesting a specificity of action on the epi- DNA alternations have a sexual dimorphic effect on behavioral genetic mechanisms that underlie the behavioral pathology in outcome. A review by Charil et al. (2010) has pointed out that the Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 Zhu et al. | 579 pups (Pardon et  al., 2000). Previous studies suggest that the variations of maternal care have a stable effect on anxiety- mediated behaviors through epigenetic mechanisms (Weaver et  al., 2006). Therefore, the change of maternal care could be another factor involved in DNMT1 upregulation in female PRS mice. In conclusion, these preclinical studies in mice support the concept that the PRS model has construct face validity and pharmacological utility as an experimental epigenetic model of anxiety disorders. We propose that the upregulation of DNMT1 leads to the hypermethylation and increased binding of DNMT1 to GAD67 promoters in PRS model. Furthermore, we propose that drugs that induce promoter hypomethylation and/or DNMT1 downregulation might be useful in correcting anxious behaviors. This means that DNMT1 may represent possible new molecular targets to treat with the long-term neurobehavioral effects of developmental stress exposure. Acknowledgments This work was supported by the National Natural Science Foundation of China (81471385) and the Natural Science Foundation of Jiangsu Province of China (BK20151552). Statement of Interest None. References Ackermann TF, Hörtnagl H, Wolfer DP, Colacicco G, Sohr R, Lang F, Hellweg R, Lang UE (2008) Phosphatidylinositide dependent kinase deficiency increases anxiety and decreases GABA and serotonin abundance in the amygdala. Cell Physiol Biochem 22:735–744. Allison C, Pratt JA (2003) Neuroadaptive processes in GABAergic and glutamatergic systems in benzodiazepine dependence. Pharmacol Ther 98:171–195. Benes FM (2010) Amygdalocortical circuitry in schizophre- nia: from circuits to molecules. Neuropsychopharmacology 35:239–257. Bueno CH, Zangrossi H Jr, Viana MB (2005) The inactivation of the basolateral nucleus of the rat amygdala has an anxiolytic Figure 7. The anxiety-like behaviors in postnatal stress (PRS) mice are corrected effect in the elevated T-maze and light/dark transition tests. by 5-aza-CdR. 5-aza-CdR recovered the shortened center time in the open field test (OFT) (A), improved the decrease in the percentage of time spent in the open Braz J Med Biol Res 38:1697–1701. arms of the elevated plus maze (EPM) (B), and increased the time in the light box Cartwright-Hatton S (2006) Anxiety of childhood and adolescence: (C) in PRS mice. All values are means± SEM; 2-way ANOVA followed by protected challenges and opportunities. Clin Psychol Rev 26:813–816. least significant difference (PLSD) posthoc test; *P < .05 and **P < .01 between the Charil A, Laplante DP, Vaillancourt C, King S (2010) Prenatal data of vehicle-treated control mice (n = 14) and v ehicle-treated PRS mice (n = 14); stress and brain development. Brain Res Rev 65:56–79. #P < .05 between the data of vehicle-treated PRS mice (n = 14) and 5-aza-CdR- Chiba S, Numakawa T, Ninomiya M, Richards MC, Wakabayashi treated PRS mice (n= 16). C, Kunugi H (2012) Chronic restraint stress causes anxiety- sexual dimorphic effect of PRS is related with the sex-difference and depression-like behaviors, downregulates glucocortic- oid receptor expression, and attenuates glutamate release in brain development. It is therefore inferred that the sex-differ - ence in brain development may be a key factor responsible for induced by brain-derived neurotrophic factor in the pre- frontal cortex. Prog Neuropsychopharmacol Biol Psychiatry sex dimorphisms in neuropsychiatric disorders associated with PRS-induced epigenetic DNA alternations and this possibility 39:112–119. Costa E, Dong E, Grayson DR, Guidotti A, Ruzicka W, Veldic M requires further investigation. It has been found that there is a persistent overexpression (2007) Reviewing the role of DNA (cytosine-5) methyltrans- ferase overexpression in the cortical GABAergic dysfunction of DNMT in the brain of PRS mice ranging from birth to adult- hood (Matrisciano et al., 2013). We can infer that in female PRS associated with psychosis vulnerability. Epigenetics 2:29–36. Darnaudéry M, Maccari S (2008) Epigenetic programming of the mice, the increase of DNMT1 is probably the result of changes occurring during embryonic life. Further, stress exposure dur - stress response in male and female rats by prenatal restraint stress. Brain Res Rev 57:571–585. ing pregnancy results in the decrease of maternal cares on Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 580 | International Journal of Neuropsychopharmacology, 2018 Dong E, Dzitoyeva SG, Matrisciano F, Tueting P, Grayson DR, by prenatal stress in mice. Neuropsychopharmacology Guidotti A (2015) Brain-derived neurotrophic factor epigen- 37:929–938. etic modifications associated with schizophrenia-like pheno- Matrisciano F, Tueting P, Dalal I, Kadriu B, Grayson DR, Davis type induced by prenatal stress in mice. Biol Psychiatry JM, Nicoletti F, Guidotti A (2013) Epigenetic modifications 77:589–596. of GABAergic interneurons are associated with the schizo- Felix-Ortiz AC, Beyeler A, Seo C, Leppla CA, Wildes CP, Tye KM phrenia-like phenotype induced by prenatal stress in mice. (2013) BLA to VHPC inputs modulate anxiety-related behav- Neuropharmacology 68:184–194. iors. Neuron 79:658–664. Meaney MJ, Szyf M, Seckl JR (2007) Epigenetic mechanisms of Goto K, Numata M, Komura JI, Ono T, Bestor TH, Kondo H (1994) perinatal programming of hypothalamic-pituitary-adrenal Expression of DNA methyltransferase gene in mature and function and health. Trends Mol Med 13:269–277. immature neurons as well as proliferating cells in mice. Meaney MJ, Ferguson-Smith AC (2010) Epigenetic regulation of Differentiation 56:39–44. the neural transcriptome: the meaning of the marks. Nat Grayson DR, Jia X, Chen Y, Sharma RP, Mitchell CP, Guidotti A, Neurosci 13:1313–1318. Costa E (2005) Reelin promoter hypermethylation in schizo- Murgatroyd C, Patchev AV, Wu Y, Micale V, Bockmühl Y, Fischer D, phrenia. Proc Natl Acad Sci U S A 102:9341–9346. Holsboer F, Wotjak CT, Almeida OF, Spengler D (2009) Dynamic Guidotti A, Auta J, Davis JM, Dong E, Grayson DR, Veldic M, Zhang DNA methylation programs persistent adverse effects of X, Costa E (2005) GABAergic dysfunction in schizophrenia: new early-life stress. Nat Neurosci 12:1559–1566. treatment strategies on the horizon. Psychopharmacology Nasehi M, Roghani F, Ebrahimi-Ghiri M, Zarrindast MR (2017) Role (Berl) 180:191–205. of the amygdala GABA-A receptors in ACPA-induced deficits Guidotti A, Auta J, Chen Y, Davis JM, Dong E, Gavin DP, Grayson during conditioned fear learning. Brain Res Bull 131:85–92. DR, Matrisciano F, Pinna G, Satta R, Sharma RP, Tremolizzo L, Papale LA, Madrid A, Li S, Alisch RS (2017) Early-life stress links Tueting P (2011) Epigenetic GABAergic targets in schizophre- 5-hydroxymethylcytosine to anxiety-related behaviors. nia and bipolar disorder. Neuropharmacology 60:1007–1016. Epigenetics 12:264–276. Heim C, Nemeroff CB (2001) The role of childhood trauma in the Pardon M, Gérardin P, Joubert C, Pérez-Diaz F, Cohen-Salmon C neurobiology of mood and anxiety disorders: preclinical and (2000) Influence of prepartum chronic ultramild stress on clinical studies. Biol Psychiatry 49:1023–1039. maternal pup care behavior in mice. Biol Psychiatry 47:858–863. Isoardi NA, Martijena ID, Carrer HF, Molina VA (2004) Increased Paxinos G, Franklin KBJ (2001) The mouse brain in stereotaxic fear learning coincides with neuronal dysinhibition and coordinates. San Diego: Academic Press. facilitated LTP in the basolateral amygdala following benzo- Quirk GJ, Gehlert DR (2003) Inhibition of the amygdala: key to diazepine withdrawal in rats. Neuropsychopharmacology pathological states? Ann N Y Acad Sci 985:263–272. 29:1852–1864. Rainnie DG, Asprodini EK, Shinnick-Gallagher P (1991) Inhibitory Kadriu B, Guidotti A, Chen Y, Grayson DR (2012) DNA methyl- transmission in the basolateral amygdala. J Neurophysiol transferases1 (DNMT1) and 3a (DNMT3A) colocalize with 66:999–1009. GAD67-positive neurons in the GAD67-GFP mouse brain. J Reik W (2007) Stability and flexibility of epigenetic gene regula- Comp Neurol 520:1951–1964. tion in mammalian development. Nature 447:425–432. Koonce CJ, Walf AA, Frye CA (2012) Type 1 5α-reductase may be Reik W, Dean W, Walter J (2001) Epigenetic reprogramming in required for estrous cycle changes in affective behaviors of mammalian development. Science 293:1089–1093. female mice. Behav Brain Res 226:376–380. Rodríguez Manzanares PA, Isoardi NA, Carrer HF, Molina VA Kraszpulski M, Dickerson PA, Salm AK (2006) Prenatal stress (2005) Previous stress facilitates fear memory, attenuates affects the developmental trajectory of the rat amygdala. GABAergic inhibition, and increases synaptic plasticity in the Stress 9:85–95. rat basolateral amygdala. J Neurosci 25:8725–8734. La Salle S, Mertineit C, Taketo T, Moens PB, Bestor TH, Trasler JM Ruzicka WB, Zhubi A, Veldic M, Grayson DR, Costa E, Guidotti A (2004) Windows for sex-specific methylation marked by DNA (2007) Selective epigenetic alteration of layer I  gabaergic neu- methyltransferase expression profiles in mouse germ cells. rons isolated from prefrontal cortex of schizophrenia patients Dev Biol 268:403–415. using laser-assisted microdissection. Mol Psychiatry 12:385–397. Levenson JM, Roth TL, Lubin FD, Miller CA, Huang IC, Desai P, Sadler TR, Nguyen PT, Yang J, Givrad TK, Mayer EA, Maarek JM, Malone LM, Sweatt JD (2006) Evidence that DNA (cytosine-5) Hinton DR, Holschneider DP (2011) Antenatal maternal stress methyltransferase regulates synaptic plasticity in the hippo- alters functional brain responses in adult offspring during campus. J Biol Chem 281:15763–15773. conditioned fear. Brain Res 1385:163–174. Lupien SJ, McEwen BS, Gunnar MR, Heim C (2009) Effects of Sanders SK, Shekhar A (1995) Anxiolytic effects of chlordiaz- stress throughout the lifespan on the brain, behaviour and epoxide blocked by injection of GABAA and benzodiazepine cognition. Nat Rev Neurosci 10:434–445. receptor antagonists in the region of the anterior basolateral Maguire JL, Stell BM, Rafizadeh M, Mody I (2005) Ovarian cycle- amygdala of rats. Biol Psychiatry 37:473–476. linked changes in GABA(A) receptors mediating tonic inhibition Singer-Sam J, Robinson MO, Bellvé AR, Simon MI, Riggs AD (1990) alter seizure susceptibility and anxiety. Nat Neurosci 8:797–804. Measurement by quantitative PCR of changes in HPRT, PGK-1, Mairesse J, Viltart O, Salomé N, Giuliani A, Catalani A, Casolini PGK-2, APRT, MTase, and Zfy gene transcripts during mouse P, Morley-Fletcher S, Nicoletti F, Maccari S (2007) Prenatal spermatogenesis. Nucleic Acids Res 18:1255–1259. stress alters the negative correlation between neuronal Stell BM, Brickley SG, Tang CY, Farrant M, Mody I (2003) activation in limbic regions and behavioral responses in Neuroactive steroids reduce neuronal excitability by select- rats exposed to high and low anxiogenic environments. ively enhancing tonic inhibition mediated by delta subu- Psychoneuroendocrinology 32:765–776. nit-containing GABAA receptors. Proc Natl Acad Sci U S A Matrisciano F, Tueting P, Maccari S, Nicoletti F, Guidotti A (2012) 100:14439–14444. Pharmacological activation of group-II metabotropic glutam- Vallée M, Mayo W, Dellu F, Le Moal M, Simon H, Maccari S ate receptors corrects a schizophrenia-like phenotype induced (1997) Prenatal stress induces high anxiety and postnatal Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 Zhu et al. | 581 handling induces low anxiety in adult offspring: correlation and characterization of the cdna encoding human DNA with stress-induced corticosterone secretion. J Neurosci methyltransferase. Nucleic Acids Res 20:2287–2291. 17:2626–2636. Zhang TY, Hellstrom IC, Bagot RC, Wen X, Diorio J, Meaney MJ Veldic M, Guidotti A, Maloku E, Davis JM, Costa E (2005) (2010) Maternal care and DNA methylation of a glutamic acid In psychosis, cortical interneurons overexpress DNA- decarboxylase 1 promoter in rat hippocampus. J Neurosci methyltransferase 1. Proc Natl Acad Sci U S A 102:2152–2157. 30:13130–13137. Veldic M, Kadriu B, Maloku E, Agis-Balboa RC, Guidotti A, Davis Zheng Y, Fan W, Zhang X, Dong E (2016) Gestational stress induces JM, Costa E (2007) Epigenetic mechanisms expressed in basal depressive-like and anxiety-like phenotypes through epigen- ganglia GABAergic neurons differentiate schizophrenia from etic regulation of BDNF expression in offspring hippocampus. bipolar disorder. Schizophr Res 91:51–61. Epigenetics 11:150–162. Wang C, Wilson WA, Moore SD (2001) Role of NMDA, non-NMDA, Zhou R, Bai Y, Yang R, Zhu Y, Chi X, Li L, Chen L, Sokabe M, Chen and GABA receptors in signal propagation in the amygdala L (2011) Abnormal synaptic plasticity in basolateral amyg- formation. J Neurophysiol 86:1422–1429. dala may account for hyperactivity and attention-deficit Wang C, Kang-Park MH, Wilson WA, Moore SD (2002) Properties of in male rat exposed perinatally to low-dose bisphenol-A. the pathways from the lateral amygdal nucleus to basolateral Neuropharmacology 60:789–798. nucleus and amygdalostriatal transition area. J Neurophysiol Zhou R, Chen F, Chang F, Bai Y, Chen L (2013) Persistent overex- 87:2593–2601. pression of DNA methyltransferase 1 attenuating GABAergic Weaver IC, Meaney MJ, Szyf M (2006) Maternal care effects on the inhibition in basolateral amygdala accounts for anxiety in hippocampal transcriptome and anxiety-mediated behaviors rat offspring exposed perinatally to low-dose bisphenol A. J in the offspring that are reversible in adulthood. Proc Natl Psychiatr Res 47:1535–1544. Acad Sci U S A 103:3480–3485. Zuena AR, Mairesse J, Casolini P, Cinque C, Alemà GS, Morley- Weinstock M (2008) The long-term behavioural consequences of Fletcher S, Chiodi V, Spagnoli LG, Gradini R, Catalani A, prenatal stress. Neurosci Biobehav Rev 32:1073–1086. Nicoletti F, Maccari S (2008) Prenatal restraint stress gener - Yen RW, Vertino PM, Nelkin BD, Yu JJ, el-Deiry W, Cumaraswamy ates two distinct behavioral and neurochemical profiles in A, Lennon GG, Trask BJ, Celano P, Baylin SB (1992) Isolation male and female rats. Plos One 3:e2170. Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png International Journal of Neuropsychopharmacology Oxford University Press

Involvement of Epigenetic Modifications of GABAergic Interneurons in Basolateral Amygdala in Anxiety-like Phenotype of Prenatally Stressed Mice

Free
12 pages

Loading next page...
 
/lp/ou_press/involvement-of-epigenetic-modifications-of-gabaergic-interneurons-in-O1pjf4MDfH
Publisher
Collegium Internationale Neuro-Psychopharmacologicum
Copyright
© The Author(s) 2018. Published by Oxford University Press on behalf of CINP.
ISSN
1461-1457
eISSN
1469-5111
D.O.I.
10.1093/ijnp/pyy006
Publisher site
See Article on Publisher Site

Abstract

International Journal of Neuropsychopharmacology (2018) 21(6): 570–581 doi:10.1093/ijnp/pyy006 Advance Access Publication: February 20, 2018 Regular Research Article regular research article Involvement of Epigenetic Modifications of GABAergic Interneurons in Basolateral Amygdala in Anxiety-like Phenotype of Prenatally Stressed Mice Chunting Zhu, Min Liang, Yingchun Li, Xuejiao Feng, Juan Hong, Rong Zhou Department of Physiology, Nanjing Medical University, Jiangsu, China. Correspondence: Rong Zhou, PhD, Department of Physiology, Nanjing Medical University, Longmian Avenue 101, Jiangning District, Nanjing City, Jiangsu Province, China 211166 (zhourong@njmu.edu.cn). ABSTRACT Background: Prenatal stress is considered a risk factor for anxiety disorder. Downregulation in the expression of GABAergic gene, that is, glutamic acid decarboxylase 67, associated with DNA methyltransferase overexpression in GABAergic neurons has been regarded as a characteristic component of anxiety disorder. Prenatal stress has an adverse effect on the development of the basolateral amygdala, which is a key region in anxiety regulation. The aim of this study is to analyze the possibility of epigenetic alterations of GABAergic neurons in the basolateral amygdala participating in prenatal stress-induced anxiety. Methods: Behavioral tests were used to explore the prenatal stress-induced anxiety behaviors of female adult mice. Real-time RT-PCR, western blot, chromatin immunoprecipitation, and electrophysiological analysis were employed to detect epigenetic changes of GABAergic system in the basolateral amygdala. Results: Prenatal stress mice developed an anxiety-like phenotype accompanied by a significant increase of DNA methyltransferase 1 and a reduced expression of glutamic acid decarboxylase 67 in the basolateral amygdala. Prenatal stress mice also showed the increased binding of DNA methyltransferase 1 and methyl CpG binding protein 2 to glutamic acid decarboxylase 67 promoter region. The decrease of glutamic acid decarboxylase 67 transcript was paralleled by an enrichment of 5-methylcytosine in glutamic acid decarboxylase 67 promoter regions. Electrophysiological study revealed the increase of postsynaptic neuronal excitability in the cortical-basolateral amygdala synaptic transmission of prenatal stress mice. 5-Aza-deoxycytidine treatment restored the increased synaptic transmission and anxiety-like behaviors in prenatal stress mice via improving GABAergic system. Conclusion: The above results suggest that DNA epigenetic modifications of GABAergic interneurons in the basolateral amygdala participate in the etiology of anxiety-like phenotype in prenatal stress mice. Keywords: anxiety, DNMT1, epigenetic, GABAergic dysinhibition, GAD67, prenatal stress effect of early-life stress on brain development. For example, epi- Introduction demiologic studies have indicated that children exposed to early Brain development is an intricate and subtle process and greatly adverse experiences are at increased risk for the development sensitive to stress and environmental factors. Clinical and pre- of depression and anxiety disorders in the adulthood (Heim clinical studies have indicated that early-life stress including and Nemeroff, 2001; Cartwright-Hatton, 2006). Consistently, prenatal stress (PRS) has an adverse effect on the neurodevel- animal studies have indicated that prenatally stressed rats or opment leading to the permanent abnormality of brain struc- mice exhibit excessive anxiety-like behaviors in the elevated ture and function. Anxiety disorder in childhood or adulthood plus maze (EPM) and the open field test (OFT) (Vallee et al., 1997; is regarded as the common long-term outcome of the disrupted Received: September 27, 2017; Revised: January 8, 2018 © The Author(s) 2018. Published by Oxford University Press on behalf of CINP. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons. org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is 570 properly cited. Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 Zhu et al. | 571 Significance Statement The present study provides new insight into investigating the mechanisms underlying the influence of prenatal stress (PRS) on adult behaviors. Since PRS mice shows a similar epigenetic signature to patients with anxiety disorder, PRS mice can be a valid animal model to study the epigenetic mechanisms underlying anxiety disorder and validate the novel antianxietic drugs. Furthermore, our study reveals the validity of DNA methyltransferase 1 (DNMT1) inhibitor in improving a variety of PRS-induced anxiety alterations. DNMT1 may represent a potential new molecular target to treat patients with anxiety disorder. Thus far, epigenetic drugs have been used in cancer treatment, because they often selectively reactivate tumor suppressor genes that are silenced by CpG island promoter methylation. Mairesse et al., 2007; Zuena et al., 2008; Papale et al., 2017) and the NIH Guide for the Care and Use of Laboratory Animals. All an increased reactivity of hypothalamo-pituitary-adrenal (HPA) efforts were made to minimize the number of animals and their axis to stress indicative of a typical anxious phenotype that is suffering. observed in anxiety patients (Darnaudery and Maccari, 2008; Weinstock, 2008). Animal Model Preparation Abundant data have demonstrated that “persistency” is the Pregnant C57BL/6J mice (Oriental Bio Service Inc) were individu- most obvious characteristic of the effects of early-life stress. ally housed and food and water ad libitum. Control dams were Although the mechanisms underlying the relationship between left undisturbed throughout gestation with a 12-h-light/-dark adverse developmental experiences and life-long phenotypic cycle (lights on at 7:00 am and off at 7:00 pm), whereas stressed consequences are unclear, the epigenetic role of early-life dams were subjected to the restraint stress as described pre- stress in the pathogenesis of anxiety disorder was suggested viously (Zheng et  al., 2016) with slight modification. From the in epidemiological studies (Murgatroyd et al., 2009 Meane ; y and tenth day of pregnancy until delivery, the pregnant dams were Ferguson-Smith, 2010; Papale et al., 2017). An early-life stressor restrained in a transparent tube (12  cm × 3  cm) for 45  min 3 has been reported to increase the expression of DNA methyl- times/d and exposed to 24-h constant light. The day of birth was transferase (DNMT1 and 3a) in the postnatal brain (Matrisciano referred to as postnatal day 0 (PND 0). Weaning occurred at PND et al., 2013; Dong et al., 2015). DNMT1 and DNMT3a are mainte- 21 to 22, after which the offspring of control and stressed dams nance enzymes that selectively localize in GABAergic neurons, (control and PRS mice) were group-housed by litter and sex. To and the overexpression of these enzymes has been reported minimize the effect of parent-to-offspring interaction per litter, in GABAergic neurons of cortical or striatal brain areas in psy- one female offspring was randomly selected from each litter as chotic patients (Veldic et al., 2005 V ; eldic et al., 2007; Zhou et al., object of study. Male offspring were not taken into experiments, 2013). The promoter of glutamic acid decarboxylase (GAD) 67, because the anxiogenic effects of PRS were mainly observed in which is one of GABAergic neuronal markers, has been proved females but not males (Papale et al., 2017). Then, the following to be embedded in large CpG islands and express methylation experiments were performed at PNDs 60 to 70. consensuses (Grayson et al., 2005; Costa et al., 2007). Decreased GAD67 expression and increased DNMTs expression, as well an increase in the methylation of GAD67 promoter, have recently Behavior Analysis been reported in the brain of adult mice prenatally exposed to stress (Matrisciano et al., 2012, 2013). To avoid the influence of the fluctuation of gonadal hormones The GABAergic inhibitory circuit in the basolateral amyg- in estrous cycle on anxious behaviors (Koonce et al., 2012), the dala (BLA) has been identified as a key regulator of anxiety- behavioral experiments were performed at diestrus of female like behaviors in both preclinical and clinical settings (Sanders mice. According to the types of vaginal epithelium cells (leuko- and Shekhar, 1995; Allison and Pratt, 2003Bueno et  ; al., 2005; cyte cells, nucleated cells, and cornified cells), diestrus, proes- Ackermann et al., 2008). The deficit in GABAergic system in the trus, and estrus were determined. Mice were used to examine BLA is implicated in the pathophysiology of neurodevelopmen- anxiety-like behaviors on 3 mornings following OFT (on the first tal psychiatric disorders (Quirk and Gehlert, 2003 Benes, ; 2010; morning)→EPM (on the second morning)→light/dark box test Felix-Ortiz et al., 2013). Several studies have identified effects of (DLT on the third morning) sequence. The room was dimly lit PRS on the developing amygdala (Kraszpulski et al., 2006Charil ; during the tests. The detailed methods of the behavioral tests et  al., 2010) and adult amygdala function (Weinstock, 2008; have been described previously (Chiba et  al., 2012). Animals’ Sadler et al., 2011). behaviors were videotaped and quantified via Ethovision 3.0 Considering that PRS has adverse effects on DNA methylation software (Noldus Information Technology Inc.). and the development of amygdala, we investigated whether PRS results in the increase of anxiety-related behaviors through an OFT epigenetic GABAergic dysfunction in the BLA. The aim of the pre- The novel environment was a 35  cm × 35  cm × 25  cm white sent study is to increase the understanding of epigenetic mecha- Plexiglas arena. Mice were placed in a corner and were allowed nisms underlying anxiety disorder by analyzing the interactions to freely explore the field for 10 min. Both total traveled distance between genes and the environment in an animal model. and time spent in the center area were recorded. EPM Materials and Methods The elevated plus maze consisted of 2 open and 2 closed arms The present studies were approved by the Animal Care and with each arm projecting 50  cm from the center (a 10× 10  cm area). The whole apparatus was placed 50  cm above the floor. Use Committee of Nanjing Medical University. The protocols used here were in accordance with the guidelines published in Control and PRS mice were placed in the center of the EPM, Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 572 | International Journal of Neuropsychopharmacology, 2018 facing a closed arm, and were allowed to freely explore the maze Western-Blot Analysis for 10 min. The number of 4-paw entries and the time spent in For protein quantification, we conducted measurements as the 2 open arms were blindly analyzed. described in detail elsewhere (Matrisciano et  al., 2012). The BLA was dissected on ice and the protein was extracted using DLT a total protein extraction kit (KGP250KGP2100; KeyGEN Biotech). The DLT test was performed in a rectangular box divided in Anti-DNMT1 monoclonal antibodies (NB100-264; Imagenex) and 2 compartments (light and dark). A  removable dark Plexiglas anti-GAD67 polyclonal antibody (MAB5406; Millipore) were used partition was used to divide the box into light and dark sides. to detect DNMT1 and GAD67 protein. Anti-β-actin monoclonal Each animal was placed into the light side of the box, facing antibody (04-1116; Millipore) was used an internal antibody. The away from the dark side and allowed to explore both chambers IMAGEQUANT analysis software was used to perform the densi- of the apparatus for 10  min. The time spent in the light side tometric analysis of interest bands. The values were presented and the number of entries into the dark compartment were as an optical density ratio with respect to β-actin. scored. Chromatin Immunoprecipitation Assays Hormones Assay Chromatin immunoprecipitation (ChIP) assays were used to Two batches of mice were killed, one between 7:30 and 8:00 am detect DNMT1 or MeCP2 binding to CpG-rich regions of GAD67 and the other between 5:30 and 6:00 pm. Plasma was separated promoter. The Chip procedure was carried out using a ChIP kit and stored at -20°C for hormones assay. The concentrations of (17–295; Upstate). Briefly, approximate 10  mg of the BLA was plasma corticosterone and adrenocorticotropin (ACTH) were 125 used for this procedure. Tissue was incubated at 37°C for 10 min assayed by a I double-antibody radioimmunoassay kit (07- with 500 mL of PBS containing 1% formaldehyde and a cocktail 189105; MP Biomedicals) according to the instructions of the of protease inhibitors (P8340; Sigma). Tissue was homogenized manufacturer. The ACTH assay has a sensitivity of 2 pg/mL and in 300 mL of SDS lysis buffer (supplied by ChIP kit, Upstate), and intra-assay and interassay CVs of <8%. The corticosterone assay the lysate was sonicated for 15 min on ice. Immunoprecipitation has a sensitivity of 1 ng/mL and intra-assay and interassay CVs was performed overnight at 4 °C by the addition of 10  μg of ChIP of <10%. grade DNMT1 (ab87656; Abcam) or MeCP2 (ab2828; Upstate) to the sonicated solution. An aliquot of the sonicated lysate with- Real-time RT-PCR out antibody was used as input to quantify the total amount Mice were killed (2  h after lights on) and whole brains were of DNA in sample extracts. Protein-free DNA was extracted and extracted and immediately stored at -80°C until assayed. Brains used for detection and quantification of CpG-rich regions of sections (50 μm thick) were cut in the coronal plane using a GAD67 promoter by quantitative PCR. The primers of CpG-rich cryostat. The BLA subfield was dissected from the frozen slices GAD67 promoter were decided by the reports of Matrisciano on dry ice. Total RNA was extracted using TRIzol (15596–026; et al., (2013) and shown in Table 1. The level of immunoprecipi- Invitrogen) following the manufacturer’s instructions. Possible tated GAD67 promoter by the DNMT1 or MeCP2 antibody was contamination with genenomic DNA was removed by an on- expressed as a percentage of the input DNA using the following column DNase I  (15200, Qiagen) treatment. mRNA was reverse equation: % (DNA-IP/total input) = 2 [(Ct(10%input) – 3.32) – Ct transcribed using the high-capacity cDNA Reverse Transcription (DNA-IP)] × 100%. kit (4368814; Applied Biosystems) following the manufactur - er’s instructions. The primer sequences of DNMT1, DNMT3a, Methylated/Hydroxymethylated DNA DNMT3b, methyl CpG binding protein 2 (MeCP2), ten-eleven Immunoprecipitation translocation 1 (TET1), GAD67, and GAPDH are shown in Table 1. Methylated (5MC) and hydroxymethylated DNA (5HMC) on These primer sequences were decided upon according to the pre- vious reports (La Salle et al., 2004 Matrisciano et  ; al., 2013Dong ; GAD67 promoter were assessed using MeDIP (C02010011; Diagenode) and hMeDIP kits (C02010034; Diagenode) followed et al., 2015). RT-PCR was performed using a LightCycler FastStart DNA Master SYBR Green I  kit (3515869001; Roche) and an ABI by quantitative PCR. The procedures for sample treatment and immunoprecipitation are described in the kit instruction manu- Prism 7300 Sequence Detection System (Applied Biosystems). To improve the accuracy of the real-time PCR for quantification, als. The following quantitative PCR, the primers of GAD67 pro- moter, and the calculation of the level of immunoprecipitated amplifications were performed intriplicate for each RNA sample. -ΔΔCt The relative expression of genes was determined using the 2 GAD67 promoter by the 5MC or 5HMC antibody were the same as those in ChIP assays. method with normalization to GAPDH expression. Table 1. Primers for the Reference and Target Genes Gene Forward Primer (5’ to 3’) Reverse Primer (5’ to 3’) DNMT1 TGACAGTGGTGCTGAAGAAGCCAT AGAATGGAGCCTCGAATTCTGAGA DNMT3a AACAACAACTGCTGCAGGTGCTTT ACTCCTGGATATGCTTCTGTGTGA DNMT3b TTCAGTGACCAGTCCTCAGACACGAA TCAGAAGGCTGGAGACCTCCCTCTT MeCP2 GGTTGTCTCCACTGCTACTTAC GCTAACTTGGGTGCTGATCT TET1 ACGCTGGAACAAGTGGTAGCCATA TGAACGTTTGGGTCTTGGAGGTCT GAD67 CTTTGGAGCTCTTCCTGATTGA TTGTTTGAGGGCTGTCTCTG GAPDH ACCAGGGAGGGCTGCAGTCC TCAGTTCGGAGCCCACACGC CpG-rich GAD67 promoter GAGGAGAGCGGGCCAAGA GTGCCGCTCCACACGCC Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 Zhu et al. | 573 brain in stereotaxic coordinates (Paxinos and Franklin, 2001). Electrophysiological Analysis After a 7-day recovery period, animals received bilateral injec- Slice Preparation tion of the drugs with 0.3 μL/side through the infusion cannula Mice were killed by decapitation and prepared for slices elec- (Nasehi et  al., 2017). 5-Aza-deoxycytidine (5-aza-CdR; A3656; trophysiology as described previously (Zhou et  al., 2011). Their Sigma-Aldrich) was dissolved in 0.8% acetate and diluted to a brains were quickly removed and placed in ice-cold oxygen- concentration of 200  ng/μL in saline. 5-aza-CdR or vehicle was ated artificial cerebrospinal fluid (ACSF) consisting of (in mM) delivered through the cannula once a day for 7 consecutive days 124 NaCl, 2 CaCl, 4.5 KCl, 1.0 MgCl, 26 NaHCO , 1.2 NaH PO , 2 2 3 2 4 before the experiments. and 10 D-glucose and adjusted to pH 7.4 by bubbling with 95% O /5% CO mixture. Coronal brain slices (400  μm thick) were cut 2 2 Data Analysis/Statistics using a vibrating microtome (Microslicer DTK 1500) in ice-cold oxygenated (95% O /5% CO ) ACSF. The slices containing the BLA 2 2 Data were retrieved and processed with the Origin 6.1 software and external capsule (EC) were stored for a minimum of 1 h in (Micro-Cal Software Inc.). The group data were expressed as the oxygenated ACSF maintained at RT. means ±SEM. Two-tailed Student’s t test was used for compari- sons between 2 groups. ANOVAs followed by Fisher’s protected Field Potential Recording least significant difference (PLSD) posthoc test was employed For recording, the BLA slices were transferred to a chamber con- if more than 2 groups were compared. Statistical analysis tinuously perfused with oxygenated ACSF (2 mL/min) maintained was performed using Stata 7 software (Stata Corp). P < .05 was at 30°C. Biphasic square wave pulses were applied at EC through considered statistically significant. For statistical purposes, a stainless-steel stimulation electrode (Figure  6A). Stimulation- only one slice was studied per mouse in electrophysiological evoked population spikes (PS) were recorded from the BLA by a analysis. glass micropipettes filled with 2 M NaCl (4–5 MΩ) connected to an Axoclamp2B amplifier (Axon Instruments). PS response was sam- pled using pCLAMP software (Axon Instruments). The PS ampli- RESULTS tude was defined as the mean amplitude of the peak negativity, measured from the peak of the early and the late negativity. Paired- PRS Mice Express the Increase of Anxiety-like pulse inhibition (PPI) of the PS was evoked by double-pulse stimu- Behaviors in Behavioral Experiments lation to EC at 50% of maximal stimulus strength and expressed as the ratio of the second PS amplitude to the first one. The inter - OFT val between double pulses (20, 50, 75, 100 ms) was adopted to fall PRS mice showed a decrease in time spent in the central area within the time course of the intracellularly recorded IPSP attrib- of the open field in comparison with age-matched controls uted to activation of GABAergic interneurons (Rainnie et al., 1991). (t = 2.41, P < .05; Figure 2A). To exclude the influence of locomo- (26) tion abnormality in this test, we also measured the locomotor Drug Administration activity of those mice. No significant difference in total traveled Cannulae were implanted with bilateral 27-gauge stainless steel distance between control and PRS groups was observed in the present study (t = 0.27, P > 0.05; Figure 2B). cannulas into the bilateral BLA (Figure 1) according to the mouse (26) Figure 1. Illustration of the locations of the injection cannula tips in the basolateral amygdala (BLA) in all animals used in the study. Numbers show distances from bregma. Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 574 | International Journal of Neuropsychopharmacology, 2018 Figure  3. The basal activity of hypothalamo-pituitary-adrenal (HPA)-axis is Figure 2. Prenatal stress (PRS) mice exhibit the increased anxiety-like behaviors. potentiated in prenatal stress (PRS) mice. CON and PRS represent control and CON and PRS represent control and PRS mice, respectively. (A and B) In the open PRS mice, respectively. (A and B) PRS mice showed a significant increase in basal field test (OFT), PRS mice spent less time in the center area compared with control corticosterone (A) and adrenocorticotropin (ACTH) (B) concentrations. Sample mice. (C and D) In the elevated plus maze (EPM), PRS mice showed a decreased collection was performed in the morning (8:00 am) and in the afternoon (6:00 pm). percentage of time spent in the open arms compared with control mice. (E and All bars represent means ± SEM; 2-tailed Student’s t test; *P < .05 between the data F) In the light/dark box test (DLT), PRS mice spent less time in the light-box com- of control (n = 10) and PRS mice (n = 12) at the same time. pared with control mice. All bars represent means ± SEM; 2-tailed Student’s test; t *P < .05 and **P < .01 between the data of control (n = 14) and PRS mice (n = 14). from control and PRS mice at circadian nadir (8:00 am) and EPM peak (6:00 pm). As shown in Figure  3A–B, PRS mice exhibited The percentage of time spent in the open arms was decreased a significant increase in both basal and peak corticosterone in PRS offspring as compared with controls (t = 3.08, P < .01; release compared with controls (basal: t = 2.51, P < .05; peak: (26) (20) Figure 2C). However, the number of 4-paw entries in the test area t = 2.74, P < .05). Similarly, PRS mice had increased basal plasma (20) was not affected by PRS (t = 0.48, P > 0.05; Figure 2D). ACTH and exhibited significantly increased peak ACTH (basal: (26) t = 2.32, P < .05; peak: t = 2.21, P < .05). (20) (20) DLT PRS mice spent less time in the light-box of the DLT than con- DNMT1 Excess Is Accompanied by the Decreased trols (t = 2.26, P < .05; Figure 2E). No statistically significant dif- (26) GAD67 Expression in the BLA of PRS Mice ferences were found in terms of the total number of transitions Earlier reports suggest that an increase in DNMT levels is asso- between the 2 groups (t = 0.146, P > 0.05; Figure 2F). (26) ciated with a downregulation of GAD67 in postmortem brain tissue from patients with schizophrenia or bipolar disorders PRS Results in the Potentiation of Circadian HPA- (Guidotti et  al., 2011) and in brain of early postnatal stressed Axis Activity rats (Zhang et al., 2010). The results of real-time RT-PCR showed To test whether PRS affects HPA-axis regulation leading to the that in several detected enzymes associated with DNA meth- change of anxiety-related behaviors, plasma was collected ylation modification, only the expression of DNMT1 mRNA Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 Zhu et al. | 575 was significantly higher in the BLA of PRS mice compared with in PRS mice was significantly greater than that for the control control mice (t = 3.16, P < .01; Figure 4A). The result of western group (t   =  4.21, P < .01). Based on the previous studies (Wang (14) (18) blot indicated that associated with an increased level of DNMT1 et al., 2001, 2002), the appearance of PSs suggests the possibility (t = 4.29, P < .01), PRS mice showed a marked decrease in GAD67 that the inhibitory mechanisms that normally restrict repetitive (14) protein level in the BLA (t = 2.41, P < .05; Figure  4B) compared firing in the BLA are impaired in PRS mice. PPI with inter-pulse (14) with control mice. intervals (IPIs) ranging from 20 to 100 ms were then introduced to determine the inhibitory activity of GABAergic interneuron in the BLA (Isoardi et  al., 2004). As shown in Figure  6C, 2-way DNMT1-Induced Hypermethylation of GAD67 repeated ANOVA indicated statistically significant effects with Promoter Results in the Downregulation of GAD67 in PRS (F = 58.024; P < .001), IPIs (F = 5.373; P < .05), and PRS by (1,20) (1,20) the BLA of PRS Mice IPI interaction (F = 7.916; P < .05). PPI was mainly observed (1,20) To test whether the overexpression of DNMT1 in PRS mice cor - with IPIs at 20 to 75  ms in the control mice, whereas paired- relates with an increased binding of DNMT1 to specific GAD67 pulse facilitation (PPF) instead of PPI was evoked by 20 to 75 ms CpG-rich promoter sequences, we measured the binding of IPIs in PRS mice (P < .01). The PPI-reversed to PPF in PRS mice DNMT1 to GAD67 promoter by ChIP assay. The results showed proves the fact that the decrease of GABAergic inhibitory mech- that the binding of DNMT1 to GAD67 promoter region was anism results in the increase of the BLA neuronal excitability. increased in PRS mice (t = 3.24, P < .01; Figure 5A). Moreover, the Two-way ANOVA displayed main effects of PRS and 5-aza-CdR (10) binding of MeCP2 to GAD67 was also significantly higher in PRS treatment and their interaction on the number of PSs (PRS: mice (t = 2.68, P < .05; Figure  5B) in the absence of the expres- F = 28.62; P < .001; 5-aza-CdR: F = 34.35; P < .001; PRS×5-aza- (10) (1,42) (1,42) sion change of MeCP2 mRNA. CdR: F = 38.01; P < .001; Figure 6D) and PS2/PS1 (PRS: F = 5.54; (1,42) (1,42) To investigate whether the decreased expression of GAD67 P < .05; 5-aza-CdR: F = 4.72; P < .05; PRS×5-aza-CdR: F = 4.384; (1,42) (1,42) in PRS mice are the consequence of epigenetic modification on P < .05; Figure  6E). The followed PLSD posthoc test further indi- the corresponding DNA regulatory regions, we measured the cated that treatment with 5-aza-CdR abolished the repetitive enrichment of the 2 most important epigenetic marks: 5MC response (P < .01) and recovered PPI (P < .01) in the slices from and 5HMC at the GAD67 promoter. As shown in Figure  5C, PRS offspring, suggesting the involvement of DNMT1 in the BLA 5MC was enriched at GAD67 promoter in PRS mice compared GABAergic deficiency. with control mice (t = 2.66, P < .05). The 5HMC level in PRS (10) mice was higher than control mice, but did not reach the sig- The Intra-BLA Injection of 5-aza-CdR Corrects nificant level (t = 1.04, P  >  0.05; Figure  5D). These findings (10) Anxiety-like Behavior in PRS Mice suggest that PRS leads to CpG hypermethylation on GAD67 promoters. The enrichment of 5MC at GAD67 promoter was To test whether the behavioral alterations of PRS mice were negatively correlated with the level of corresponding GAD67 mediated by epigenetic mechanisms including an increase in transcript (r = 0.352, P = .03; Figure 5E), suggesting an epigenetic DNMT1, an increase of GABAergic promoter methylation, and mechanism by which promoter methylation may be respon- a downregulation of the GABAergic gene expression, the behav- sible for the downregulation of GAD67 in PRS mice (t = 3.83, (10) ior of PRS mice was evaluated following the repeated microin- P < .01; Figure  5F), and this possibility was therefore tested via jection of 5-aza-CdR into the BLA. Two-way ANOVA revealed a detecting the effect of repeated intra-BLA injection of 5-aza- main effect of PRS (center time: F = 4.83, P < .05; time in the (1,60) CdR, DNMT1 inhibitor on 5MC at GAD67 promoter, and GAD67 open arm: F = 5.15, P < .05; time in light: F = 4.32, P < .05) and (1,60) (1,60) transcript. Two-way ANOVA displayed main effects of PRS and 5-aza-CdR treatment (center time: F = 5.36, P < .05; time in (1,60) 5-aza-CdR treatment and their interaction on 5MC at GAD67 the open arm: F = 5.56, P < .05; time in light: F = 5.73, P < .05) (1,60) (1,60) promoter (PRS: F = 6.28; P < .05; 5-aza-CdR: F = 4.89; P < .05; (1,24) (1,24) and a PRS×5-aza-CdR treatment interaction effect (center time: PRS×5-aza-CdR: F = 4.71; P < .05; Figure  5G) and GAD67 tran- (1,24) F = 4.95, P < .05; time in the open arm: F = 8.64, P < .05; time (1,60) (1,60) script (PRS: F = 5.77; P < .05; 5-aza-CdR: F = 5.01; P < .05; (1,24) (1,24) in light: F = 3.02, P < .05). The results of the followed PLSD post- (1,60) PRS×5-aza-CdR: F = 8.53; P < .01; Figure  5H). The treatment (1,24) hoc test further showed that 5-aza-CdR rectified the changed with 5-aza-CdR abolished both the alterations of 5MC level at center time in the OFT (P < .05; Figure 7A), time spent in the open GAD67 promoter (P < .05) and GAD67 transcript (P < .01) in PRS arm of the EPM (P < .05; Figure 7B), and time in the light of the DLT mice. (P < .05; Figure 7C), but had no effect in control mice (P > 0.05). DNMT1-Mediated GABAergic Dysfunction Discussion Participates in the Enhancement of Cortical-BLA This study represents the first demonstration that PRS facili- Transmission in PRS Mice tates anxiety-like behaviors and attenuates GABAergic inhibi- GABAergic system in the BLA plays a key role in inhibiting the tion in the BLA of female mice offspring, which is at least partly excitation of the pyramidal cells that receive cortical glutamater - via DNMT1-related epigenetic reprogramming of GABAergic sys- gic inputs (Stell et  al., 2003Ma ; guire et  al., 2005). Therefore, to tem. In addition, the present data also suggest the long-term evaluate the possibility that epigenetic modification of DNMT1 neurobehavioral effects of PRS are reversible in the adult period. further changes GABAergic function in the BLA of PRS mice, It has been widely proved that early life stress causes long- cortical-BLA glutamate synaptic transmission was detected lasting changes in neuroplasticity that result in an increased (Figure  6A). As shown in Figure  6B, in slices from control off- vulnerability to stress-related disorders in later life (Meaney spring, a moderate single pulse evoked a PS generated by the et al., 2007; Darnaudery and Maccari, 2008; Lupien et al., 2009). synchronous firing of basolateral projecting neurons. By con- The present data that PRS resulted in anxiety-like behaviors trast, in slices from PRS mice, the same manner of stimulation and associated endocrinological alterations of adult female evoked the appearance of several additional responses follow- mice give further support to the above notion. Female mice ing the main PS in the BLA neurons. The average number of PSs exposed to stress in utero represent a new behavioral model of Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 576 | International Journal of Neuropsychopharmacology, 2018 Figure 4. Elevated DNA methyltransferase 1 (DNMT1) levels are accompanied by the decrease of glutamic acid decarboxylase 67 (GAD67) expression in the basolateral amygdala (BLA) of prenatal stress (PRS) mice. CON and PRS represent control and PRS mice, respectively. (A) Quantitative RT-PCR results of DNMT1, DNMT3a, DNMT3b, MeCP2, and TET1 mRNA in the BLA of control and PRS mice. (B) Immunoblot data of DNMT1 and GAD67 normalized by β-actin protein levels. All bars represent means ± SEM; 2-tailed Student’s t test; *P < .05 and **P < .01 between the data of control (n = 8) and PRS mice (n = 8). Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 Zhu et al. | 577 an anxiety-like phenotype, because it recapitulates the potential link between early-life adversity and the pathogenesis of stress- related disorders. The early development period is crucial for establishing and maintaining epigenetic marks (Reik et al., 2001; Reik, 2007). Epigenetic mechanisms are consequently regarded as the most plausible targets through which early life stress could exert their long-lasting effects. Indeed, accumulating evidence has proved the DNA epigenetic alterations induced by prenatal restrained stress contribute to the complex phenotypes of neuropsy- chiatric disorders (Matrisciano et  al., 2012 Zheng et  ; al., 2016; Papale et  al., 2017). DNMTs are important components of the DNA-methylation that dynamically regulates the expression of key molecules involved in brain function. Here, we focused on DNMTs, because these enzymes have been proved to participate in the physiopathology of several neurodevelopmental disor - ders including anxiety disorder (Ruzicka et al., 2007 V; eldic et al., 2007; Guidotti et  al., 2011). Our results showed that in these detected enzymes, only the expression of DNMT1 was found to be elevated in the BLA of adult female PRS offspring. To establish in detail whether the altered expression of DNMT1 is expected to result in enrichment of CpG methylation at GAD67 promot- ers, we then measured levels of 5mC, a CpG methylation marker. As expected, there was significant methylation (high levels of 5mC) found on GAD67 promoters in female PRS mice, and the increased promoter methylation of GAD67 was inversely cor - related with the corresponding transcripts. These data suggest PRS results in DNMT1-regulated hypermethylation of GAD67 promotor, thereby inhibiting GAD67 transcription in the BLA. However, we cannot exclude the possibility that histone modi- fications, another epigenetic regulation of gene transcription, could contribute to the epigenetic modifications detected in female PRS mice. The GABAergic system in the BLA participates in the regula- tion of emotional behaviors via inhibiting the excitation of the pyramidal cells that receive cortical glutamatergic inputs (Stell et al., 2003; Maguire et al., 2005). Research in our laboratory and others have established the appearance of multiple PSs in cor - tical-BLA transmission due to the decreased GABAergic inhibi- tory effect on the pyramidal neurons (Rodriguez Manzanares et al., 2005). In the present study, the electrophysiological find- ing that multiple PSs instead of single PS were measured in the BLA slices of female PRS mice strongly suggests that PRS results in the BLA GABAergic deficits. This inference also is supported by the fact that PPI reversed into PPF in the slices of female PRS mice. Guidotti et al. (2005) have found that there is an obvious decrease of GAD67 and other markers of GABAergic interneu- rons but not neuronal loss in the postmortem brains of patients with neurodevelopmental psychiatric disorders. The present study shows that the overexpression of DNMT1 is responsible for the decrease of GAD67. Hence,it is plausible that DNMT1- Figure  5. The hypermethylation of glutamic acid decarboxylase 67 (GAD67) induced epigenetic alterations of GABAergic neurons could be promoter results in the downregulation of GAD67 in the basolateral amygdala the basis for the disturbance of GABA-glutamate neuron inter - (BLA) of prenatal stress (PRS) mice. CON and PRS represent control and PRS mice, actions in the BLA of female PRS mice. respectively. (A and B) Data of DNA methyltransferase 1 (DNMT1) (A) or MeCP2 (B) binding to specific promoter regions of GAD67 in control and PRS groups. (C Traditionally, DNA methylation is thought to be a static pro- and D) The levels of 5MC (C) and 5HMC (D) on GAD67 promoter region in con- cess after cellular differentiation. In support of this DNMT stasis trol and PRS groups. (E) The enrichment of 5MC on GAD67 promoter region is hypothesis, the activity and expression of DNMT significantly negatively correlated with the corresponding transcripts by Pearson correlation decreases in differentiated cells and is positively correlated with analysis. (F) Quantitative RT-PCR results of GAD67 mRNA in the BLA of control the proliferative state of cells (Singer-Sam et al., 1990 Yen et  ; al., and PRS mice. (G and H) Effects of 5-aza-CdR on 5MC at GAD67 promoter and 1992; Goto et al., 1994). Our present study and others have found GAD67 transcript. All bars represent means ± SEM; 2-tailed Student’ s t test for A, B, C, D and F; 2-way ANOVA followed by protected least significant difference that the high level of DNMT1 mRNA is detected in the BLA or (PLSD) posthoc test for G and H; *P < .05 and **P < .01 between the data of control hippocampus region of adult mice brain (Levenson et al., 2006; (n = 6) and PRS mice (n = 6) or between the data of vehicle-treated control (n = 6) Kadriu et al., 2012). These results suggest a possibility that DNMT and vehicle-treated PRS mice (n= 6); #P < .05 and ##P < .01 between the data of stasis is absent in the mature brain. Due to the high expression vehicle-treated PRS mice (n= 6) and 5-aza-CdR-treated PRS mice (n= 6). Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 578 | International Journal of Neuropsychopharmacology, 2018 Figure  6. DNA methyltransferase 1 (DNMT1)-mediated GABAergic deficit leads to the potentiation of cortical-basolateral amygdala (BLA) transmission in postnatal stress (PRS) mice. CON and PRS represent control and PRS mice, respectively. (A) Schematic diagram illustrating the placement of stimulating electrode (Stim) and recording electrode (Rec) at cotical-BLA pathway. (B) Left: Basal evoked synaptic response in the BLA of control and PRS mice. PS wave is marked with arrows. Right: The comparison of population spike (PS) number between control and PRS mice. (C) Left: The original results of paired-pulse stimulation with the interval at 50 ms. Right: The comparison of PS2/PS1 with the stimulus interval from 20 to 100 ms between control and PRS mice. Dotted line indicates 100%. ↑ and ↓ represent paired-pulse facilitation (PPF) and paired-pulse inhibition (PPI), respectively. (D and E) Effects of 5-aza-CdR on the number of PSs or the PPI induction in control and PRS mice. All bars represent means ± SEM; 2-tailed Student’s t test for B and 2-way ANOVA followed by PLSD posthoc test for C, D, and E; **P < .01 between the data of contr =ol (n 10) and PRS mice (n = 10) or between the data of vehicle-treated control (n = 12) and v ehicle-treated PRS mice (n= 10). ##P < .01 between the data of vehicle-treated PRS mice (n = 10) and 5-aza-CdR-treated PRS mice (n= 10). of DNMT1 in the BLA, it is possible to analyze the role of DNMT1 female PRS mice. Our study indicates PRS leads to the increase of in long-lasting anxiety using pharmacological methods. In fact, anxiety level in female offspring through epigenetic GABAergic we have found that the local blockade of DNMT1 with 5-aza-CdR dysfunction. However, another report by Matrisciano et  al. in the BLA significantly ameliorated anxiety-like symptoms in (2013) has pointed out the involvement of PRS-induced epigen- PRS mice. It is noteworthy that the same dosage of 5-aza-CdR etic modifications of GABAergic interneurons in schizophrenia as that used in PRS mice fails to change anxiety-related behav- in male mice. These data suggest that PRS-induced epigenetic iors of control mice, suggesting a specificity of action on the epi- DNA alternations have a sexual dimorphic effect on behavioral genetic mechanisms that underlie the behavioral pathology in outcome. A review by Charil et al. (2010) has pointed out that the Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 Zhu et al. | 579 pups (Pardon et  al., 2000). Previous studies suggest that the variations of maternal care have a stable effect on anxiety- mediated behaviors through epigenetic mechanisms (Weaver et  al., 2006). Therefore, the change of maternal care could be another factor involved in DNMT1 upregulation in female PRS mice. In conclusion, these preclinical studies in mice support the concept that the PRS model has construct face validity and pharmacological utility as an experimental epigenetic model of anxiety disorders. We propose that the upregulation of DNMT1 leads to the hypermethylation and increased binding of DNMT1 to GAD67 promoters in PRS model. Furthermore, we propose that drugs that induce promoter hypomethylation and/or DNMT1 downregulation might be useful in correcting anxious behaviors. This means that DNMT1 may represent possible new molecular targets to treat with the long-term neurobehavioral effects of developmental stress exposure. Acknowledgments This work was supported by the National Natural Science Foundation of China (81471385) and the Natural Science Foundation of Jiangsu Province of China (BK20151552). Statement of Interest None. References Ackermann TF, Hörtnagl H, Wolfer DP, Colacicco G, Sohr R, Lang F, Hellweg R, Lang UE (2008) Phosphatidylinositide dependent kinase deficiency increases anxiety and decreases GABA and serotonin abundance in the amygdala. Cell Physiol Biochem 22:735–744. Allison C, Pratt JA (2003) Neuroadaptive processes in GABAergic and glutamatergic systems in benzodiazepine dependence. Pharmacol Ther 98:171–195. Benes FM (2010) Amygdalocortical circuitry in schizophre- nia: from circuits to molecules. Neuropsychopharmacology 35:239–257. Bueno CH, Zangrossi H Jr, Viana MB (2005) The inactivation of the basolateral nucleus of the rat amygdala has an anxiolytic Figure 7. The anxiety-like behaviors in postnatal stress (PRS) mice are corrected effect in the elevated T-maze and light/dark transition tests. by 5-aza-CdR. 5-aza-CdR recovered the shortened center time in the open field test (OFT) (A), improved the decrease in the percentage of time spent in the open Braz J Med Biol Res 38:1697–1701. arms of the elevated plus maze (EPM) (B), and increased the time in the light box Cartwright-Hatton S (2006) Anxiety of childhood and adolescence: (C) in PRS mice. All values are means± SEM; 2-way ANOVA followed by protected challenges and opportunities. Clin Psychol Rev 26:813–816. least significant difference (PLSD) posthoc test; *P < .05 and **P < .01 between the Charil A, Laplante DP, Vaillancourt C, King S (2010) Prenatal data of vehicle-treated control mice (n = 14) and v ehicle-treated PRS mice (n = 14); stress and brain development. Brain Res Rev 65:56–79. #P < .05 between the data of vehicle-treated PRS mice (n = 14) and 5-aza-CdR- Chiba S, Numakawa T, Ninomiya M, Richards MC, Wakabayashi treated PRS mice (n= 16). C, Kunugi H (2012) Chronic restraint stress causes anxiety- sexual dimorphic effect of PRS is related with the sex-difference and depression-like behaviors, downregulates glucocortic- oid receptor expression, and attenuates glutamate release in brain development. It is therefore inferred that the sex-differ - ence in brain development may be a key factor responsible for induced by brain-derived neurotrophic factor in the pre- frontal cortex. Prog Neuropsychopharmacol Biol Psychiatry sex dimorphisms in neuropsychiatric disorders associated with PRS-induced epigenetic DNA alternations and this possibility 39:112–119. Costa E, Dong E, Grayson DR, Guidotti A, Ruzicka W, Veldic M requires further investigation. It has been found that there is a persistent overexpression (2007) Reviewing the role of DNA (cytosine-5) methyltrans- ferase overexpression in the cortical GABAergic dysfunction of DNMT in the brain of PRS mice ranging from birth to adult- hood (Matrisciano et al., 2013). We can infer that in female PRS associated with psychosis vulnerability. Epigenetics 2:29–36. Darnaudéry M, Maccari S (2008) Epigenetic programming of the mice, the increase of DNMT1 is probably the result of changes occurring during embryonic life. Further, stress exposure dur - stress response in male and female rats by prenatal restraint stress. Brain Res Rev 57:571–585. ing pregnancy results in the decrease of maternal cares on Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 580 | International Journal of Neuropsychopharmacology, 2018 Dong E, Dzitoyeva SG, Matrisciano F, Tueting P, Grayson DR, by prenatal stress in mice. Neuropsychopharmacology Guidotti A (2015) Brain-derived neurotrophic factor epigen- 37:929–938. etic modifications associated with schizophrenia-like pheno- Matrisciano F, Tueting P, Dalal I, Kadriu B, Grayson DR, Davis type induced by prenatal stress in mice. Biol Psychiatry JM, Nicoletti F, Guidotti A (2013) Epigenetic modifications 77:589–596. of GABAergic interneurons are associated with the schizo- Felix-Ortiz AC, Beyeler A, Seo C, Leppla CA, Wildes CP, Tye KM phrenia-like phenotype induced by prenatal stress in mice. (2013) BLA to VHPC inputs modulate anxiety-related behav- Neuropharmacology 68:184–194. iors. Neuron 79:658–664. Meaney MJ, Szyf M, Seckl JR (2007) Epigenetic mechanisms of Goto K, Numata M, Komura JI, Ono T, Bestor TH, Kondo H (1994) perinatal programming of hypothalamic-pituitary-adrenal Expression of DNA methyltransferase gene in mature and function and health. Trends Mol Med 13:269–277. immature neurons as well as proliferating cells in mice. Meaney MJ, Ferguson-Smith AC (2010) Epigenetic regulation of Differentiation 56:39–44. the neural transcriptome: the meaning of the marks. Nat Grayson DR, Jia X, Chen Y, Sharma RP, Mitchell CP, Guidotti A, Neurosci 13:1313–1318. Costa E (2005) Reelin promoter hypermethylation in schizo- Murgatroyd C, Patchev AV, Wu Y, Micale V, Bockmühl Y, Fischer D, phrenia. Proc Natl Acad Sci U S A 102:9341–9346. Holsboer F, Wotjak CT, Almeida OF, Spengler D (2009) Dynamic Guidotti A, Auta J, Davis JM, Dong E, Grayson DR, Veldic M, Zhang DNA methylation programs persistent adverse effects of X, Costa E (2005) GABAergic dysfunction in schizophrenia: new early-life stress. Nat Neurosci 12:1559–1566. treatment strategies on the horizon. Psychopharmacology Nasehi M, Roghani F, Ebrahimi-Ghiri M, Zarrindast MR (2017) Role (Berl) 180:191–205. of the amygdala GABA-A receptors in ACPA-induced deficits Guidotti A, Auta J, Chen Y, Davis JM, Dong E, Gavin DP, Grayson during conditioned fear learning. Brain Res Bull 131:85–92. DR, Matrisciano F, Pinna G, Satta R, Sharma RP, Tremolizzo L, Papale LA, Madrid A, Li S, Alisch RS (2017) Early-life stress links Tueting P (2011) Epigenetic GABAergic targets in schizophre- 5-hydroxymethylcytosine to anxiety-related behaviors. nia and bipolar disorder. Neuropharmacology 60:1007–1016. Epigenetics 12:264–276. Heim C, Nemeroff CB (2001) The role of childhood trauma in the Pardon M, Gérardin P, Joubert C, Pérez-Diaz F, Cohen-Salmon C neurobiology of mood and anxiety disorders: preclinical and (2000) Influence of prepartum chronic ultramild stress on clinical studies. Biol Psychiatry 49:1023–1039. maternal pup care behavior in mice. Biol Psychiatry 47:858–863. Isoardi NA, Martijena ID, Carrer HF, Molina VA (2004) Increased Paxinos G, Franklin KBJ (2001) The mouse brain in stereotaxic fear learning coincides with neuronal dysinhibition and coordinates. San Diego: Academic Press. facilitated LTP in the basolateral amygdala following benzo- Quirk GJ, Gehlert DR (2003) Inhibition of the amygdala: key to diazepine withdrawal in rats. Neuropsychopharmacology pathological states? Ann N Y Acad Sci 985:263–272. 29:1852–1864. Rainnie DG, Asprodini EK, Shinnick-Gallagher P (1991) Inhibitory Kadriu B, Guidotti A, Chen Y, Grayson DR (2012) DNA methyl- transmission in the basolateral amygdala. J Neurophysiol transferases1 (DNMT1) and 3a (DNMT3A) colocalize with 66:999–1009. GAD67-positive neurons in the GAD67-GFP mouse brain. J Reik W (2007) Stability and flexibility of epigenetic gene regula- Comp Neurol 520:1951–1964. tion in mammalian development. Nature 447:425–432. Koonce CJ, Walf AA, Frye CA (2012) Type 1 5α-reductase may be Reik W, Dean W, Walter J (2001) Epigenetic reprogramming in required for estrous cycle changes in affective behaviors of mammalian development. Science 293:1089–1093. female mice. Behav Brain Res 226:376–380. Rodríguez Manzanares PA, Isoardi NA, Carrer HF, Molina VA Kraszpulski M, Dickerson PA, Salm AK (2006) Prenatal stress (2005) Previous stress facilitates fear memory, attenuates affects the developmental trajectory of the rat amygdala. GABAergic inhibition, and increases synaptic plasticity in the Stress 9:85–95. rat basolateral amygdala. J Neurosci 25:8725–8734. La Salle S, Mertineit C, Taketo T, Moens PB, Bestor TH, Trasler JM Ruzicka WB, Zhubi A, Veldic M, Grayson DR, Costa E, Guidotti A (2004) Windows for sex-specific methylation marked by DNA (2007) Selective epigenetic alteration of layer I  gabaergic neu- methyltransferase expression profiles in mouse germ cells. rons isolated from prefrontal cortex of schizophrenia patients Dev Biol 268:403–415. using laser-assisted microdissection. Mol Psychiatry 12:385–397. Levenson JM, Roth TL, Lubin FD, Miller CA, Huang IC, Desai P, Sadler TR, Nguyen PT, Yang J, Givrad TK, Mayer EA, Maarek JM, Malone LM, Sweatt JD (2006) Evidence that DNA (cytosine-5) Hinton DR, Holschneider DP (2011) Antenatal maternal stress methyltransferase regulates synaptic plasticity in the hippo- alters functional brain responses in adult offspring during campus. J Biol Chem 281:15763–15773. conditioned fear. Brain Res 1385:163–174. Lupien SJ, McEwen BS, Gunnar MR, Heim C (2009) Effects of Sanders SK, Shekhar A (1995) Anxiolytic effects of chlordiaz- stress throughout the lifespan on the brain, behaviour and epoxide blocked by injection of GABAA and benzodiazepine cognition. Nat Rev Neurosci 10:434–445. receptor antagonists in the region of the anterior basolateral Maguire JL, Stell BM, Rafizadeh M, Mody I (2005) Ovarian cycle- amygdala of rats. Biol Psychiatry 37:473–476. linked changes in GABA(A) receptors mediating tonic inhibition Singer-Sam J, Robinson MO, Bellvé AR, Simon MI, Riggs AD (1990) alter seizure susceptibility and anxiety. Nat Neurosci 8:797–804. Measurement by quantitative PCR of changes in HPRT, PGK-1, Mairesse J, Viltart O, Salomé N, Giuliani A, Catalani A, Casolini PGK-2, APRT, MTase, and Zfy gene transcripts during mouse P, Morley-Fletcher S, Nicoletti F, Maccari S (2007) Prenatal spermatogenesis. Nucleic Acids Res 18:1255–1259. stress alters the negative correlation between neuronal Stell BM, Brickley SG, Tang CY, Farrant M, Mody I (2003) activation in limbic regions and behavioral responses in Neuroactive steroids reduce neuronal excitability by select- rats exposed to high and low anxiogenic environments. ively enhancing tonic inhibition mediated by delta subu- Psychoneuroendocrinology 32:765–776. nit-containing GABAA receptors. Proc Natl Acad Sci U S A Matrisciano F, Tueting P, Maccari S, Nicoletti F, Guidotti A (2012) 100:14439–14444. Pharmacological activation of group-II metabotropic glutam- Vallée M, Mayo W, Dellu F, Le Moal M, Simon H, Maccari S ate receptors corrects a schizophrenia-like phenotype induced (1997) Prenatal stress induces high anxiety and postnatal Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018 Zhu et al. | 581 handling induces low anxiety in adult offspring: correlation and characterization of the cdna encoding human DNA with stress-induced corticosterone secretion. J Neurosci methyltransferase. Nucleic Acids Res 20:2287–2291. 17:2626–2636. Zhang TY, Hellstrom IC, Bagot RC, Wen X, Diorio J, Meaney MJ Veldic M, Guidotti A, Maloku E, Davis JM, Costa E (2005) (2010) Maternal care and DNA methylation of a glutamic acid In psychosis, cortical interneurons overexpress DNA- decarboxylase 1 promoter in rat hippocampus. J Neurosci methyltransferase 1. Proc Natl Acad Sci U S A 102:2152–2157. 30:13130–13137. Veldic M, Kadriu B, Maloku E, Agis-Balboa RC, Guidotti A, Davis Zheng Y, Fan W, Zhang X, Dong E (2016) Gestational stress induces JM, Costa E (2007) Epigenetic mechanisms expressed in basal depressive-like and anxiety-like phenotypes through epigen- ganglia GABAergic neurons differentiate schizophrenia from etic regulation of BDNF expression in offspring hippocampus. bipolar disorder. Schizophr Res 91:51–61. Epigenetics 11:150–162. Wang C, Wilson WA, Moore SD (2001) Role of NMDA, non-NMDA, Zhou R, Bai Y, Yang R, Zhu Y, Chi X, Li L, Chen L, Sokabe M, Chen and GABA receptors in signal propagation in the amygdala L (2011) Abnormal synaptic plasticity in basolateral amyg- formation. J Neurophysiol 86:1422–1429. dala may account for hyperactivity and attention-deficit Wang C, Kang-Park MH, Wilson WA, Moore SD (2002) Properties of in male rat exposed perinatally to low-dose bisphenol-A. the pathways from the lateral amygdal nucleus to basolateral Neuropharmacology 60:789–798. nucleus and amygdalostriatal transition area. J Neurophysiol Zhou R, Chen F, Chang F, Bai Y, Chen L (2013) Persistent overex- 87:2593–2601. pression of DNA methyltransferase 1 attenuating GABAergic Weaver IC, Meaney MJ, Szyf M (2006) Maternal care effects on the inhibition in basolateral amygdala accounts for anxiety in hippocampal transcriptome and anxiety-mediated behaviors rat offspring exposed perinatally to low-dose bisphenol A. J in the offspring that are reversible in adulthood. Proc Natl Psychiatr Res 47:1535–1544. Acad Sci U S A 103:3480–3485. Zuena AR, Mairesse J, Casolini P, Cinque C, Alemà GS, Morley- Weinstock M (2008) The long-term behavioural consequences of Fletcher S, Chiodi V, Spagnoli LG, Gradini R, Catalani A, prenatal stress. Neurosci Biobehav Rev 32:1073–1086. Nicoletti F, Maccari S (2008) Prenatal restraint stress gener - Yen RW, Vertino PM, Nelkin BD, Yu JJ, el-Deiry W, Cumaraswamy ates two distinct behavioral and neurochemical profiles in A, Lennon GG, Trask BJ, Celano P, Baylin SB (1992) Isolation male and female rats. Plos One 3:e2170. Downloaded from https://academic.oup.com/ijnp/article-abstract/21/6/570/4881839 by Ed 'DeepDyve' Gillespie user on 17 June 2018

Journal

International Journal of NeuropsychopharmacologyOxford University Press

Published: Feb 20, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off