Inositol trisphosphate receptor-mediated Ca2+ signalling stimulates mitochondrial function and gene expression in core myopathy patients

Matteo Suman; Jenny A Sharpe; Robert B Bentham; Vassilios N Kotiadis; Michela Menegollo; Viviana Pignataro; Jordi Molgó; Francesco Muntoni; Michael R Duchen; Elena Pegoraro; Gyorgy Szabadkai

doi:10.1093/hmg/ddy149

Inositol trisphosphate receptor-mediated Ca2+ signalling stimulates mitochondrial function and gene expression in core myopathy patients

Suman, Matteo; Sharpe, Jenny A; Bentham, Robert B; Kotiadis, Vassilios N; Menegollo, Michela; Pignataro, Viviana; Molgó, Jordi; Muntoni, Francesco; Duchen, Michael R; Pegoraro, Elena; Szabadkai, Gyorgy 2018-07-01 00:00:00 2þ Core myopathies are a group of childhood muscle disorders caused by mutations of the ryanodine receptor (RyR1), the Ca release channel of the sarcoplasmic reticulum. These mutations have previously been associated with elevated inositol trisphosphate receptor (IP3R) levels in skeletal muscle myotubes derived from patients. However, the functional relevance and 2þ the relationship of IP3R mediated Ca signalling with the pathophysiology of the disease is unclear. It has also been suggested that mitochondrial dysfunction underlies the development of central and diffuse multi-mini-cores, devoid of mitochondrial ac- tivity, which is a key pathological consequence of RyR1 mutations. Here we used muscle biopsies of central core and multi- minicore disease patients with RyR1 mutations, as well as cellular and in vivo mouse models of the disease to characterize global 2þ cellular and mitochondrial Ca signalling, mitochondrial function and gene expression associated with the disease. We show that RyR1 mutations that lead to the depletion of the channel are associated with increased IP -mediated nuclear and mito- 2þ chondrial Ca signals and increased mitochondrial activity. Moreover, western blot and microarray analysis indicated en- hanced mitochondrial biogenesis at the transcriptional and protein levels and was reﬂected in increased mitochondrial DNA content. The phenotype was recapitulated by RYR1 silencing in mouse cellular myotube models. Altogether, these data indicate 2þ that remodelling of skeletal muscle Ca signalling following loss of functional RyR1 mediates bioenergetic adaptation. Received: October 1, 2017. Revised: April 14, 2018. Accepted: April 16, 2018 V C The Author(s) 2018. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. 2367 Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2368 | Human Molecular Genetics, 2018, Vol. 27, No. 13 myotubes and human cell lines with hypomorphic RyR1 muta- Introduction tions disrupting EC coupling (17,18). This might represent an Mutations of the type 1 ryanodine receptor (RyR1), a key sarco- 2þ adaptative rearrangement of Ca signal-related gene expres- 2þ plasmic reticulum (SR) Ca release channel almost exclusively sion patterns (19), altering cytoplasmic or nuclear signalling, expressed in skeletal muscle, are one of the most common similarly as described in cardiomyocytes, where IP3Rs play a causes of non-dystrophic congenital myopathies. Different 2þ privileged role to directly trigger nuclear Ca signals (20). Thus mode of inheritance of mutations in the RYR1 gene and either directly, or indirectly, altered RyR1 and IP3R expression associated distinct clinico-pathological phenotypes are 2þ can be part of feedback loops of an altered Ca -dependent tran- recognized: the dominantly inherited central core disease (CCD, scriptional network, which has been shown to affect mitochon- MIM#11700); autosomal recessive multi-minicore disease drial gene expression, biogenesis and function in muscle (21,22). (MmD, MIM #255320), RYR1-related centronuclear myopathy On the other hand, increased IP3R expression might also lead to (CNM) (1) and congenital ﬁbre-type disproportion (CFTD, MIM 2þ increased direct transfer of Ca between the SR-localized IP3Rs #255310) (2). In addition, association of malignant hyperthermia and mitochondria (23). Localization of a mitochondrial popula- susceptibility (MHS, MIM# 145600) and exertional rhabdomyoly- tion (24) and IP3R/F F -ATP synthase immunoﬂuorescence to 1 o sis (3) traits are also associated with dominant RYR1 mutations. the ‘intercisternal’ (25) might favour this signalling, promoting The underlying mutations and the heterogeneity in clinical 2þ direct mitochondrial Ca transfer from the SR. While mito- symptoms, characterized primarily by the varying severity and 2þ chondrial Ca uptake contributes to metabolic signalling and extent of muscle weakness, suggest a complex underlying path- adaptation through altering NAD(P)H redox state and increasing ophysiology (4,5). In spite of the broad clinical features of 2þ ATP production, long-term Ca overload can lead to mitochon- RyR1-related myopathies, the pathology is dominated by ultra- drial permeability transition (26–28), an established pathome- structural derangement of myoﬁbres resulting in the focal loss chanism in muscle disease (29). Alternatively to IP3Rs, of mitochondria in either a single longitudinal central core or hyperactive RyR1 itself, even if almost exclusively localized to multiple smaller cores (multi-minicores) (6). Accordingly, a cen- 2þ the triads, may also be associated with mitochondrial Ca tral question of the pathophysiology of RyR1-related myopa- overload (30). thies is the identiﬁcation of pathways linking RyR1 mutations Here we have tested the hypothesis that IP3R-mediated mi- to mitochondrial dysfunction and loss. 2þ tochondrial Ca signalling and accompanying alterations of 2þ Given the central role of RyR1 in Ca -mediated excitation- mitochondrial gene expression patterns underlie the functional contraction (EC) coupling in skeletal muscle, signiﬁcant re- phenotype of core myopathies. In order to ﬁnd potential associ- search has focussed on the consequences of mutations on this ations between speciﬁc RyR1 mutations, gene expression pat- process. The emerging picture divides the functional outcome terns and signalling phenotypes, we have used patient biopsy into (i) defects in mechanical coupling in the triad structure material with a range of RyR1 mutations and mouse cellular 2þ and increased Ca leak through RyR1 channels, mostly and in vivo models with altered RyR1 expression and RyR1 characterizing dominant mutations, and (ii) loss of RyR1 func- mutations. Our ﬁndings reveal a complex relationship between tion, often associated with recessive mutations leading to re- loss of RyR1, increased IP3R-mediated cytoplasmic-nuclear and duced expression of RyR1 (7,8). Mapping of mutations on the 2þ mitochondrial Ca signalling, and altered mitochondrial gene complex structure of the RyR1 channel also revealed a charac- expression and function and indicates an adaptive phenotype, teristic pattern. Dominant (gain-of-function) mutations tend 2þ presumably driven by altered Ca signalling. to affect three domains: 1 (N-terminal), 2 (central) and 3 (C-ter- minal), and associated with CCD and/or the MHS and exer- tional rhabdomyolysis traits. On the other hand, recessive Results mutations are distributed along the whole length of the RyR1 Selected patient material sequence, leading to loss of function, reduced expression or truncated proteins, clinically often resulting in MmD (9). How In order to understand the consequences of RyR1 mutations in these heterogeneous mutations lead to this range, develop- primary patient-derived tissues and differentiated myotubes, ment and interconversion of pathologies is not known (10–12). we have selected biopsies collected from patients with CCD and As a direct consequence of RyR1 mutations on muscle ﬁbre MmD with RYR1 mutations established at the molecular level. 2þ Ca signalling, a wide range of effects have been described. For functional analysis on primary myotubes differentiated 2þ 2þ Increased Ca leak can lead to reduced SR Ca content or from patient-derived myoblasts, we have selected material from 2þ consequent increased cytoplasmic Ca levels. On the other two affected children and controls matched for age and gender: hand, reduced RyR1 function can also result in reduced cyto- (i) patient p7322 exhibiting CCD pathology due to a dominant 2þ 2þ plasmic Ca levels, making it difﬁcult to ﬁnd a common Ca mutation in the MH/CCD hotspot 3 (c.13724 A> C; p.N4575T) and signal-related pathomechanism that results in the develop- (ii) patient p3369 with MmD pathology with compound hetero- ment of cores. zygous mutations in regions outside of MH/CCD hotspots pre- Crucially, core formation has been linked to mitochondrial sumably resulting in truncated non-functional RyR1 protein dysfunction, and has been observed in both core myopathy pa- (c.A4711G/p.I1571Vþ c.9407delT/p.L3136Rfs). For gene expres- tient samples and experimental models of the disease (13–16). sion studies, in addition to these prototypic MmD and CCD However, whether mitochondrial dysfunction is primary to core patients, a further affected child and two adult CCD patients development or the consequence of the molecular derangement were used with dominant mutations in MH/CCD hotspots 1 and of the subtle molecular architecture of muscle ﬁbres still 3 (p4449: c.487C> T/p.R163C, adult; p2638: c.14693T> C/p.I4898T, remains unanswered. The relationship between mitochondrial child; and p7379: c.14510delA/p.Q4837RfsX3, adult). The local- 2þ dysfunction and altered Ca signalling in RyR1 mutant ization of the mutations and the summary of the patient mate- myoﬁbres can be envisaged in different ways. On the one hand, rial is shown in Figure 1, for clinical and pathological data, see it has been shown that increased IP3R expression occurs in Supplementary Material, Table S1. Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2369 Figure 1. Patient material used in the study. Positions (A) and characteristics (B) of RyR1 mutations detected in patients with CCD and MmD. Muscle biopsies for micro- array analysis were used from all patients, while primary myotubes were generated from two patient biopsies (shown in blue). (C) Representative histopathologic changes in speciﬁc RYR1-related myopathies included in the study. Wide-ﬁeld light microscopy images of cytochrome c oxidase staining are shown. In p3369, absolute prevalence of type 1 ﬁbres and areas of varying size devoid of oxidative enzyme stain; in the rest of the sections numerous cores of varying size and number are ob- served. In p7322 and p7379 cores are centrally, in p2638 peripherally and in p4449 both centrally and peripherally located. 2þ EGTA) (Fig. 2A–C) or in the presence of EC Ca (1 mM) IP3-mediated cytoplasmic, nuclear and mitochondrial 2þ (Supplementary Material, Fig. S1A and B) to discriminate be- Ca signalling is up-regulated in myotubes of patients 2þ 2þ tween Ca signals generated by SR Ca release and by the sum with RyR1 mutations 2þ of Ca inﬂux and SR release pathways, respectively. Since myo- 2þ 2þ tubes are not fully differentiated muscle ﬁbres, Ca inﬂux in- To characterize RyR1- and IP3R-mediated Ca ﬂuxes in patient cells carrying RyR1 mutations that underlie CCD and MmD pa- duced by CCh contributes signiﬁcantly to the response in the 2þ 2þ presence of EC Ca , similarly to the ATP-mediated response, thologies, we ﬁrst evaluated nuclear and cytosolic Ca signals in primary differentiated myotubes obtained from muscle which can be mediated not only by IP3-coupled P2Y but also by 2þ the ligand-activated P2X channels (19). Thus, in order to speciﬁ- biopsies. Cells were loaded with the Ca -sensitive ﬂuorescent 2þ 2þ ratiometric dye fura-2-AM. RyR1-mediated Ca signals were cally address Ca release from intracellular stores, we have pri- marily evaluated the contribution of RyR1 and IP3Rs in the induced by the nicotinic acetylcholine (ACh) receptor agonist 2þ carbachol (CCh, 0.5 lM) in the presence of the muscarinic ACh absence of EC Ca (Fig. 2). In myotubes derived from patients with MmD and with CCD, receptor blocker atropine (Atr, 10 lM) which activates the dihy- 2þ dropyridine receptor (DHPR, CaV1.1)-RyR1 axis. IP3R-mediated we found signiﬁcant down-regulation of CCh-induced SR Ca 2þ release in the cytosol which was reﬂected by a similar down- Ca release was triggered by the G-protein coupled receptor 2þ agonist ATP (100 lM). Myotubes were stimulated in the absence regulation when Ca signals were quantiﬁed over the nuclear 2þ regions of interest (ROIs) (Fig. 2A), indicating impaired RyR1 of extracellular (EC) Ca (medium supplemented with 200 lM Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2370 | Human Molecular Genetics, 2018, Vol. 27, No. 13 2þ Figure 2. Up-regulation of IP3R-mediated Ca signalling in CCD and MmD patient myotubes. Primary myotubes were generated from biopsies of CCD (p7322) and 2þ MmD (p3369) patients and age-matched controls (p7875, p6578, pooled data). Differentiated myotubes were loaded with the Ca -sensitive ratiometric dye fura-2 and ﬂuorescent intensity ratios (ex: 340/380 nm, em: 505 nm) were measured using a wide-ﬁeld ﬂuorescent imaging system (see Materials and Methods section). 2þ 2þ (A) Response to CCh (0.5 mM) in the presence of atropine (10 mM) in Ca -free EC medium (supplemented with 200 mM EGTA) shows Ca release mediated by RyR1. 2þ 2þ (B) Response to ATP (100 mM) in Ca -free EC medium (supplemented with 200 mM EGTA) shows Ca release mediated by IP3Rs. Representative traces of ratios mea- sured in cytosolic (left panels) and nuclear (middle panels) regions of interest, and statistics of quantiﬁed signals (peak—basal ratios, right panels, means6 S.E.M. of>20 cells from at least three separate experiments) are shown. Data were analysed using one-way ANOVA with Bonferoni post-hoc tests for multiple comparisons 2þ (*P < 0.05). (C) Quantiﬁcation of basal fura-2 ratios, representing basal [Ca ] in control and patient myotubes. (D) Western blot analysis of patient and control myotube protein extracts as described in the Materials and Methods section. Duplicates of 20 ug protein extracts are shown. (E) Quantiﬁcation of signals from western blot analysis. Signals from the IP3R and RyR1 bands were normalized to b-tubulin, means6 S.E.M. of>3 replicates are shown. Data were analysed using two-way ANOVA Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2371 2þ function. Basal cytosolic [Ca ], measured by basal fura-2 ratio Altogether we found that in mouse C2C12 myotubes, the values, also showed a small, but signiﬁcant decrease in cells loss of RyR1 following its knockdown with siRNA RYR1 led to 2þ from both patients (Fig. 2C). The reduction of RyR1-mediated signiﬁcantly enhanced IP3-mediated Ca release, in both the 2þ Ca release correlated with signiﬁcant decrease in RyR1 ex- cytosolic and nuclear compartments (see Fig. 3A and B), con- 2þ pression, quantiﬁed by western blotting of protein extracts from ﬁrming the role of RyR1 loss in the Ca signalling pattern ob- 2þ patient derived myotubes (Fig. 2D). While RyR1-mediated Ca served in patient myotubes. Moreover, quantiﬁcation of RyR1 signals were reduced in both the MmD and CCD patient myo- and IP3R protein expression levels by western blotting revealed tubes, interestingly, IP3-mediated responses showed an oppo- similar inverse correlation between siRNA-mediated down-reg- site trend. While no signiﬁcant alterations were observed in the ulation of RyR1 and increased IP3R protein expression levels 2þ overall cytosolic Ca signals induced by ATP, the myotubes (Fig. 3C), pointing to a conserved mechanism of gene regulation from the patient with MmD (p3369) showed signiﬁcantly in- patterns following RyR1 loss in mouse and human muscle and 2þ creased nuclear Ca signals compared to controls (Fig. 2B). The myotubes. Finally, in this model system, speciﬁc blockade of myotubes from the patient with CCD (p7322) also showed ele- IP3Rs using Xestospongin-B (XeB) (32), conﬁrmed that IP3Rs ex- 2þ 2þ 2þ vated nuclear Ca signals in the presence of EC Ca clusively contribute to ATP but not to CCh-mediated Ca sig- (Supplementary Material, Fig. S1B). To address the origin of the nals (Supplementary Material, Fig. S1G). 2þ reciprocal regulation of RyR1- and IP3R-mediated Ca signals, Consequently, the similar behaviour of the C2C12 mouse we quantiﬁed the expression of IP3Rs by western blotting using and patient-derived human myotube models allowed us to use a pan-IP3R antibody (Fig. 2D–F). Importantly, IP3R expression in- the mouse cell line to test the hypothesis that, following RyR1 2þ creased in negative correlation with reduction of RyR1 protein loss, the increased IP3-mediated Ca release is transferred to 2þ levels, showing the highest expression in the MmD (p3369) pa- mitochondria. In order to measure mitochondrial Ca in both 2þ tient muscle biopsy tissue. low and high [Ca ] ranges, we used two different recombinant 2þ 2þ To test whether increased IP3R-mediated Ca signalling ﬂuorescent Ca probes, speciﬁcally targeted to mitochondria, 2þ results in increased mitochondrial Ca uptake in myotubes 2mtGCaMP6m (see Fig. 2G and H), and Cepia3mt (33), which from the patient with MmD (p3369), we transfected cells with were suitable to measure the range of ATP- and CCh-induced 2þ 2þ 2mtGCaMP6m, a recombinant ﬂuorescent Ca probe speciﬁ- mitochondrial Ca signals, respectively. Responses from myo- 2þ cally targeted to mitochondria (31). The high dynamic range of tubes stimulated in the absence of EC Ca (medium supple- this ratiometric probe allows the measurement of both basal mented with 200 lM EGTA) are shown in Figure 3D and E, while 2þ 2þ and stimulated Ca levels in the mitochondrial compartment. responses in the presence of EC Ca are shown in As shown in Figure 2G, p3369 patient myotubes had signiﬁ- Supplementary Material, Figure S1E and F. Overall, mitochon- 2þ 2þ cantly increased basal mitochondrial [Ca ], indicating en- drial Ca uptake followed the changes seen in nuclear and cy- 2þ 2þ hanced Ca transfer into the organelle. Moreover, enhanced tosolic Ca signals. In RYR1 siRNA-transfected mouse 2þ 2þ 2þ Ca transfer was due to IP3R-mediated Ca release, since myotubes, ATP-induced, IP3R-mediated mitochondrial Ca up- stimulation of the p3369 patient myotubes with CCh resulted in take was signiﬁcantly increased compared with control cells, 2þ signiﬁcantly reduced mitochondrial Ca transients as com- while the RyR1-mediated, CCh-induced signals were signiﬁ- pared with controls, but ATP stimulation led to signiﬁcantly in- cantly reduced (Fig. 3D). Importantly, the IP3R-mediated mito- 2þ 2þ creased mitochondrial Ca uptake (Fig. 2H). chondrial Ca uptake increased more than twofold, while 2þ 2þ These results suggest that remodelling of Ca signalling in RyR1-mediated mitochondrial Ca signals were reduced only patient-derived myotubes involves up-regulation of IP3Rs in re- by 10%, indicating a stronger coupling of mitochondria to sponse to loss of RyR1, which drives increased IP3-mediated sig- IP3Rs in this cellular model. The coupling to the increased levels 2þ nalling in both the nuclear compartment and mitochondria. of IP3Rs led also to an increase in basal mitochondrial [Ca ], 2þ conﬁrmed using both mitochondria-targeted recombinant Ca probes (Fig. 3E). Altogether, these results demonstrated large- RyR1 knock-down in C2C12 mouse myotubes mimics scale remodelling of global and compartmentalized cellular 2þ 2þ remodelling of Ca signalling in patient myotubes and Ca signalling following loss of RyR1, which thus can be a com- 2þ increases IP3-mediated mitochondrial Ca uptake mon phenotype linking recessive MmD and a subset of domi- nant mutations associated with CCD patients. Since we have observed loss of RyR1 in both MmD and CCD patient-derived myotubes, in order to directly address the role of 2þ RyR1 in remodelling myotube Ca signalling, we used the C2C12 2þ Bioenergetic consequences of altered Ca signalling in mouse myotube model where RyR1 levels were directly reduced myotubes with loss of RyR1 using siRNA mediated silencing. Following RyR1 knock-down after 2þ transfection with RYR1 siRNA, RyR1- and IP3R-mediated Ca In order to understand the functional consequences of the 2þ signals were measured using the protocols described above for remodelled compartmental Ca signalling in RyR1-deﬁcient patient myotubes. Results from myotubes stimulated in the human and mouse models, we evaluated mitochondrial func- 2þ absence of EC Ca (medium supplemented with 200 lMEGTA) are tion and gene expression. First, since material available 2þ shown in Figure 3A and B, while results in the presence of EC Ca from patient biopsies was insufﬁcient to carry out measure- are shown in Supplementary Material, Figure S1C–G. ments of oxygen consumption measurements, we used live cell with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). (F) Correlation plot of RyR1 and IP3R intensities from the same samples. (G, H) For analysis of 2þ 2þ mitochondrial Ca signals, myotubes were infected with the adenoviral recombinant mitochondria-targeted Ca probe 4mtGCaMP6 expression construct, and ratios (ex: 475/410, em: 520 nm) were imaged as described in the Materials and Methods section. (G) shows basal ratios in controls and the p3369 MmD patient. (H) Response 2þ 2þ to CCh (0.5 mM) in the presence of atropine (10 mM) in Ca -free EC medium (supplemented with 200 mM EGTA) shows Ca release mediated by RyR1 (left panel) and 2þ response to ATP (100 mM) in shows Ca release mediated by IP3Rs (middle panel). Quantiﬁed peak-basal values are shown in the right panel. Data were analysed using two-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2372 | Human Molecular Genetics, 2018, Vol. 27, No. 13 2þ Figure 3. RyR1 silencing in C2C12 mouse myotubes stimulates IP3R-mediated Ca signals in the cytosol, nucleus and mitochondria. Myotubes were differentiated from C2C12 cells transfected with scrambled (siRNA scr) or RyR1-speciﬁc (siRNA RYR1) siRNAs, or left untransfected. Differentiated myotubes were loaded with the 2þ Ca -sensitive ratiometric dye fura-2 and ﬂuorescent intesity ratios (ex: 340/380 nm, em: 505 nm) were measured using a wide-ﬁeld ﬂuorescent imaging system (see 2þ Materials and Methods section). (A) Response to CCh (0.5 mM) in the presence of atropine (10 mM) in Ca -free EC medium (supplemented with 200 mM EGTA) shows Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2373 confocal imaging to measure mitochondrial membrane poten- suggesting that a shared feature, such as the loss of RyR1 is the tial (Dw ) in the CCD and MmD patient-derived myotube mod- underlying cause. els. For these measurements, we used the membrane To verify that increased oxidative phosphorylation follow- permeable cationic dye tetramethyl rhodamine methyl-ester at ing RyR1 loss is a result of IP3R-mediated stimulation of respi- low concentration (TMRM, 5 nM), and quantiﬁed average inten- ratory chain activity, we measured oxygen consumption rate sities in two distinct subcellular mitochondrial populations, in (OCR) in C2C12 mouse myotubes using the Seahorse technol- the perinuclear and sub-plasmalemmal (SP) regions, since in ogy. We have compared OCR in control and RyR1 siRNA-trans- differentiated myoﬁbres the proteomic composition and func- fected myotubes in the absence or presence of XeB, a speciﬁc 2þ tion of SP mitochondria differs from the interﬁbrillar population inhibitor of IP3R-mediated Ca release. As shown in Figure 4D (24). In addition to quantifying steady-state TMRM intensities, and E, silencing of RyR1 led to signiﬁcantly increased basal res- which reﬂect steady state Dw , to evaluate the contribution of piration, which was prevented by treating cells with XeB. the electron transport chain and the forward and reverse mode Increased respiration was speciﬁc differentiated myotubes of the F F -ATPase in generating and maintaining Dw , we per- (Fig. 4F), and was not due to uncoupling (Fig. 4G). No signiﬁcant 1 o m formed time-lapse measurement of single cells following the changes in ECAR were observed. These data demonstrated that 2þ addition of oligomycin and rotenone to inhibit the F F -ATPase the up-regulation of IP3R-mediated Ca release following the 1 o and respiratory complex I, respectively. In addition, in order to loss of RyR1 protein results in enhanced mitochondrial 2þ evaluate the effect of Ca load on Dw , we have performed bioenergetics. these experiments in both resting conditions and following stimulation of myotubes with elevated EC [K ], which by 2þ Consequences of altered Ca signalling on depolarizing the plasmamembrane, activates the EC coupling 2þ 2þ mitochondrial and Ca homeostasis-related gene mechanism to release SR Ca via RyR1 receptors. Figure 4A expression shows representative images of TMRM-loaded control and CCD/ MmD patient-derived myotubes. Measurement of average Increased mitochondrial oxidative function can be associated 2þ TMRM intensities showed reduced steady-state Dw in both pa- with enhanced IP3R-mediated Ca signalling in at least two dif- 2þ tient groups, which difference, however, was almost completely ferent ways. Direct IP3R-mediated Ca transfer to mitochondria abolished in the MmD patient (p3369) following K stimulation has been previously shown to contribute to maintenance and ac- (Fig. 4B). Lower steady-state Dw might indicate decreased re- m tivation of the TCA cycle, respiratory activity and ATP production spiratory chain activity or increased dissipation of the H gradi- under both basal and stress conditions (34,35). Given the results 2þ ent through the F F -ATPase or uncoupling related to 1 o shown in the sections on Ca signalling (see Figs 2 and 3), this mitochondrial damage. To differentiate between these possibili- mechanism certainly plays an important role in the bioenergetic ties we used the above described time-lapse protocol (Fig. 4C). changes observed here. However, in both patient and mouse 2þ Interestingly, unstimulated control myotubes showed slow loss myotubes we found speciﬁc up-regulation of nuclear Ca sig- 2þ of potential following inhibition of the F F -ATPase by oligomy- 1 o nals, which suggests that Ca -mediated changes in gene expres- cin, indicating that glycolytic ATP was used to maintain Dw in sion proﬁles might also take place. To address this hypothesis, these cells. However, oligomycin treatment caused a small but we have applied two different approaches. First, we used immu- signiﬁcant hyperpolarization of the mitochondria in patient noblots to assess the expression of respiratory chain components cells, indicating an intact respiratory chain and use of the F F - 1 o using the MitoProﬁle antibody set detecting single subunits of ATPase in the forward mode, producing mitochondrial ATP. each complex, as well as PGC-1a, the best known nuclear co- These differences between control and patient myotubes were regulator controlling mitochondrial biogenesis by co-activating a more pronounced in the SP population of mitochondria, but be- large set of nuclear-encoded mitochondrial genes (36,37). came clear following K stimulation also in the perinuclear re- Importantly, we found signiﬁcant up-regulation of respiratory gion. Similar results were obtained in the CCD (p7322) patient complex subunits in the CCD (p7322) patient myotubes (com- myotubes (data not shown). Altogether these data indicate that plexes II–III), along with signiﬁcant increase in PGC-1a content, the rate of mitochondrial ATP synthesis is higher and make a and we have observed a similar trend in the MmD (p3369) patient greater contribution to cellular ATP demand in patient myo- cells, where the F F -ATPase a subunit was strongly induced 1 o tubes. Importantly, no differences between the recessive MmD (Fig. 5A and B). These results indicated activation of mitochon- and dominant CCD patient-derived myotubes were observed, drial biogenesis in both patient myotubes. Similarly, respiratory 2þ 2þ 2þ Ca release mediated by RyR1. (B) Response to ATP (100 mM) in Ca -free EC medium (supplemented with 200 mM EGTA) shows Ca release mediated by IP3Rs. Representative traces of ratios measured in cytosolic (left panels) and nuclear (middle panels) regions of interest, and statistics of quantiﬁed signals (peak—basal ra- tios, right panels, means6 S.E.M. of>20 cells from at least three separate experiments, are shown. Data were analysed using one-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P< 0.05). (C) Western blot analysis of protein extracts from siRNA scr and siRNA RYR1-transfected cells. About 20 ug protein extracts were analysed as described in the Materials and Methods section (left panel). Quantiﬁcation of signals from western blot analysis is shown in the middle panel. Signals from the IP3R and RyR1 bands were normalized to b-tubulin, means6 S.E.M. of>3 replicates are shown. Data were analysed using two-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). Correlation plot of RyR1 and IP3R intensities from the same samples is shown on the right panel. (D) For analysis of 2þ 2þ mitochondrial Ca signals, C2C12 cells were co-transfected with siRNA scr or RyR1 and the recombinant mitochondria-targeted Ca probes 4mtGCaMP6 or Cepia3mt, and ratios (excitation 475/410, emission 520 nm) were imaged as described in the Materials and Methods section. Response to CCh (0.5 mM) in the presence of atropine 2þ 2þ (10 mM) in Ca -free EC medium (supplemented with 200 mM EGTA) shows Ca release mediated by RyR1 (left panel, Cepia3mt probe) and response to ATP (100 mM) in 2þ 2þ Ca -free EC medium (supplemented with 200 mM EGTA) shows Ca release mediated by IP3Rs (middle panel, 4mtGCaMP6 probe). Statistics of quantiﬁed signals (peak—basal ratios, right panels, means6 S.E.M. of>20 cells from at least three separate experiments) are shown on the right panel. Data were analysed using one- way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). (E) Quantiﬁcation of basal ratios of 4mtGCaMP6 or Cepia3mt, representing basal 2þ mitochondrial [Ca ] in siRNA scr and RYR1-transfected myotubes. Data were analysed using one-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2374 | Human Molecular Genetics, 2018, Vol. 27, No. 13 Figure 4. Mitochondrial bioenergetics in CCD and MmD patient derived and in C2C12 myotubes following RYR1 silencing. Primary myotubes, generated from biopsies of CCD (p7322) and MmD (p3369) patients and age-matched controls (p7875, p6578, pooled data) were imaged in the presence of 4 nM TMRM and 0.8 mM cyclosporin-H, þ þ þ following 30 min incubation to reach steady-state distribution of the dye. Cells were pre-incubated and imaged in control ([Na ] ¼ 140 mM) or K containing ([Na ] ¼ 70 mM, [K ] ¼ 70 mM) depolarizing recording medium, using a confocal system (ex: 535 nm, em: >560 nm) as described in the Materials and Methods section. (A) Representative images of control and patient cells, showing examples of perinuclear (PN) and SP regions of interests where average TMRM intensities were quanti- ﬁed. (B) Steady-state TMRM intensities in p3369 MmD (upper panel) and p7322 CCD (lower panel) patient myotubes. Means6 S.E.M. of>20 cells from at least three separate experiments are shown. (C) Sensitivity of mitochondrial membrane potential to inhibition of the F F ATP synthase with oligomycin (10 mM) and complex I of 1 o the respiratory chain with rotenone (2 mM) was measured in time-lapse imaging of TMRM-loaded cells as in (A). Values from PN and SP regions of interests were nor- malized to the average of the initial 5 time points. Means6 S.E.M. of>20 cells from at least three separate experiments are shown under control (Na , upper panels) and K stimulated (lower panels) conditions. Data were analysed using one-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). (D–G) OCR was measured in C2C12 mouse myoblasts (F) and differentiated myotubes (D, E, G) in a Seahorse XF-24 EC ﬂux analyser. Cells were transfected with siRNA scr or RYR1, and treated with XeB (2 lM) 30 min prior to measurements. (D) Basal OCR (pMoles/min/20 K seeded cells) were recorded followed by injection of 2 lM oligomycin to measure coupled respiration, 0.8 lM FCCP to induce maximal oxygen consumption. Rotenone and antimycin A (1 lM each) were injected to assess non-mitochondrial OCR at the end of the experiment. Data are normalized to these values in each run. (E) Quantiﬁcation of basal respiration. (F) As controls, non-differentiated myoblasts were treated and measured in the same way. Values were corrected to non-mitochondrial respiration, i.e. by subtracting OCR values after rotenone/antimycin-A addition. (G) Coupling ratios of respiration in myotubes, calculated as the ratio of basal and oligomycin-treated OCR. Data were analysed using one-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2375 Figure 5. Increased mitochondrial biogenesis in CCD and MmD patient myotubes. Western blot analysis of subunits of respiratory chain complexes I–IV and the F F 1 o ATP synthase (A) and PGC-1A (B) from differentiated human patient myotubes or C2C12 mouse myotubes following transfection with siRNA scr or siRNA RYR1 (C). About 20 ug protein extracts from differentiated myotubes were immunoblotted as described in the Materials and Methods section (left panel). Quantiﬁcation of signals from western blot analysis are shown on the right panels. Signals from the respective bands were normalized to b-tubulin, means6 S.E.M. of>3 replicates are shown. Data were analysed using two-way ANOVA with Bonferoni post-hoc test. Asterisks denote signiﬁcane between control and patient (A, B) or siRNA scr and siRNA RYR1- transfected cells (*P < 0.05, **P < 0.01, ***P < 0.001). subunits were signiﬁcantly up-regulated in C2C12 mouse myo- the male child MmD (p3369) patient, we found 690 transcripts tubes following silencing of RyR1 expression (Fig. 5C), indicating which were differentially regulated (277 up, 413 down), while in that loss of RyR1 results in increased mitochondrial biogenesis, the CCD female child (p7322 and p2638) patients 883 transcripts underlying improved oxidative phosphorylation (see Fig. 4). (504 up, 379 down) and in the CCD female adult (p4449 and In order to verify and expand these ﬁndings in muscle tissue p7379) patients 54 transcripts (23 up, 31 down) were signiﬁ- of human patient biopsies and in a mouse model of CCD/MmD, cantly altered, indicating a large-scale remodelling of gene ex- we performed microarray analysis. To represent patients at dif- pression, in particular at a young age (see the full list of the ferent ages and gender, we separately compared the transcrip- differentially regulated genes in Supplementary Material, Data tomes of male child (MmD, p3369), female child (CCDs, p7322 Set S1). Gene ontology analysis identiﬁed metabolism (in partic- and p2638) and adult female (CCDs, p4449 and p7379) patient bi- ular amino acid metabolism and oxidoreductase activity), oxy- opsies to age- and sex-matched controls (p7875, p6578 and gen transport and regulation of programmed cell death as key p8463, respectively). First, we identiﬁed differentially expressed up-regulated biological processes, while glycolysis and myoﬁbril gene sets (see Materials and Methods and Supplementary assembly pathways were down-regulated. Importantly, signiﬁ- Material sections), which were further analysed for enrichments cant enrichment of genes in the mitochondrial, SR and cytosolic of speciﬁc cellular compartments and biological function (by compartments were equally present. Interestingly, remarkably gene ontology analysis using gProﬁler (38) and for the presence less variations in gene expression and associated signiﬁcant 2þ of transcripts representing genes of Ca signalling (http:// gene ontology terms were found in adult patient samples. www.ebi.ac.uk/QuickGO/term/GO: 0006874; date last accessed Details of the gene ontology analysis are shown in May 2, 2018) or mitochondrial pathways [MitoCarta 2.0 (39)]. In Supplementary Material, Data Set S2. No alterations in IP3R and Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2376 | Human Molecular Genetics, 2018, Vol. 27, No. 13 RYR1 gene transcripts were found in the patients indicating degradation (ERAD) system has been recently established (40), that RyR1 loss and the parallel increase in IP3Rs is the result of and down-regulation of this pathways might provide explana- post-transcriptional mechanisms, most likely alterations of pro- tion for increased IP3R levels following loss of RyR1 function. tein stability and degradation (40). However, highly signiﬁcant Indeed, we have observed signiﬁcant down-regulation of sev- 2þ alterations of other Ca signaling-related genes were found eral ubiquitin E3 ligases in human muscle samples and the (Fig. 6A), including almost complete down-regulation of ATP2A1 overall ubiquitin-dependent protein catabolic process term (GO: 2þ I4859T/wt (SR Ca -ATPase 1, SERCA1), the SERCA isoform speciﬁc for fast 0006511) in the RyR mouse model (Supplementary ﬁbres (21), most likely reﬂecting type 1 (slow) ﬁbre predomi- Material, Data Set S3). 2þ nance (11). Importantly, components of the mitochondrial Ca Previously, one study by Zhou et al. (17) has shown up-regu- 2þ uniporter (MCU and MCUR1), mediating Ca uptake in the or- lation of IP3Rs both at the transcriptional and proteins levels in ganelle, were up-regulated in both MmD (p3369) and CCD (p7322 patient-derived myotubes with recessive RyR1 mutations. Here, 2þ and p2638) patients. Induction of mitochondrial Ca transport using microarrays from muscle biopsies we could not detect proteins was accompanied by an overall increase in nuclear- alterations of any of the ITPR1–3 genes, probably due to the low encoded mitochondrial genes, as shown by the analysis of sig- sensitivity of the method, compared with the quantitative PCR niﬁcantly altered genes intersecting with the human MitoCarta approach used in the previous study. Alternatively, up-regula- 2.0 list (Fig. 6B). The majority of these genes showed more than tion of IP3Rs might be present only in in vitro differentiated twofold increase in transcript abundance (Fig. 6C), and were myotubes, which might represent an early stage of muscle ﬁbre enriched in genes coding for components of the respiratory chain development. Importantly however, from functional point of in both the MmD and CCD child patient cohorts (p3369, p7322 and view, here we demonstrated the ﬁrst time that increased IP3R 2þ p2638, Fig. 6D). To test whether the elevated mitochondrial pro- levels lead to elevated IP3-mediated Ca signalling in both hu- tein expression levels reﬂect increased mitochondrial content, we man and mouse myotubes, which affects the mitochondrial have assessed the relative mitochondrial DNA (mtDNA) content and nuclear compartments. in patient biopsies. As shown in Figure 6E,boththe MmDand Although the general trend in all the models studied was up- 2þ CCD child patient cohorts (p3369, p7322 and p2638) also showed regulation of IP3R-mediated Ca signalling, the compartment elevated mtDNA copy number, conﬁrming that mitochondrial speciﬁcity varied between different mutations and the C2C12 biogenesis I increased in the early stages of the disease. mouse myoblast models (see Figs 2 and 3) Moreover, when we 2þ 2þ In order to evaluate the hypothesis that gene expression measured Ca signals in the presence of EC Ca , i.e. when ei- 2þ changes are induced by RyR1 mutations, we performed microar- ther ATP- or CCh-induced Ca inﬂux was allowed in the sys- ray analysis in an established mouse model of RYR1-linked core tem, the overall picture was more complex. In the patient cells, 2þ myopathies, carrying the I4859T mutation in the RyR1 gene (16). we observed signiﬁcant down-regulation of CCh-induced Ca We used muscle tissue extracts from two types of muscles of signals in the cytosol of both patients and signiﬁcant reduction I4859T/wt 2þ the heterozygous RyR mice with high and low mitochon- of nuclear Ca signals in myotubes from patient p3369 but not drial content (m. soleus, type 1 and m. extensor digitorum longus, from patient p7322. On the other hand, we noted a signiﬁcant 2þ EDL, type 2A/2X, respectively). Similarly to the human core my- up-regulation of ATP-induced nuclear Ca signals in patient opathy patient biopsies, we found alterations in a large gene set p7322, an effect which was missing in patient p3369, while cyto- 2þ in both muscle types (soleus: 1039 transcripts differentially reg- solic Ca was not affected in any patients (see Supplementary ulated, 579 up, 460 down; EDL: 974 transcripts differentially reg- Material, Fig. S1). However, a more homogenous up-regulation ulated, 502 up, 471 down, Supplementary Material, Data Set S1), in all compartments was observed in C2C12 myotubes following 2þ which had a marked intersection with mouse MitoCarta gene RYR1 silencing. These differences in the remodelling of Ca sig- set (Supplementary Material, Fig. S2A). Moreover, these nuclear- nals might reﬂect different levels of the loss of RyR1 protein and encoded mitochondrial gene transcripts also showed overall function, as well as the different distribution of IP3R expression 2þ up-regulation with enrichment of respiratory chain compo- in the various cellular models. Whether remodelling of Ca sig- nents (Supplementary Material, Fig. S1B and C). nalling pathways in fully differentiated myoﬁbres have similar Altogether these results show that RyR1 dysfunction, silenc- pattern, remains to be determined. ing or loss, apart from direct consequences of RyR1-mediated Apart from demonstrating the functional role of IP3Rs in 2þ 2þ Ca signalling, leads to large-scale rearrangement of muscle remodelling compartmentalized Ca signalling and increased 2þ 2þ gene expression, which involves both Ca signalling and mito- mitochondrial Ca uptake, our study provides the ﬁrst evi- chondrial biogenesis pathways in human and murine samples. dence for altered mitochondrial gene expression and function Further analysis of promoters of de-regulated genes also indi- as the consequence of RyR1 mutations associated with loss of 2þ cated a set of key transcription factors (TFs) responsible for the the Ca release channel. Mitochondrial damage due to domi- altered gene expression proﬁle in human patients and animal nant RyR1 mutations (41), disruption of mitochondrial distribu- models of RyR1-related core myopathies (see Supplementary tion (13) has been previously shown in mouse models, zebraﬁsh Material, Data Set S3). (15) and well documented in human muscle biopsies (6,5,11,42), but whether these alterations are the primary cause of core de- velopment and muscle pathology is not known. While direct Discussion 2þ damage of mitochondria due to excess Ca leak has been previ- The RyR1 mutations analysed in this study were associated ously proposed (30), our results indicate a different role for IP3R- 2þ 2þ with loss of expression and function of the SR Ca release mediated Ca signals. Up-regulation of IP3R and concomitant 2þ channel. We have shown that loss of RyR1 leads to signiﬁcant increase in mitochondrial Ca load appear to increase the met- 2þ remodelling of skeletal muscle Ca signalling, driven by up- abolic competence of mitochondria in the myotube models of regulation of the IP3R at post-translational level and a set of both CCD and MmD patients. Of note, muscle biopsies also 2þ 2þ Ca homeostasis-related proteins at the transcriptional level in showed up-regulation of members of the mitochondrial Ca both human and mouse myotubes. Dynamic regulation of IP3R uptake machinery (MCU, MCUR1), indicating that increased mi- 2þ levels by ubiquitination and degradation by the ER-associated tochondrial Ca uptake might also happen in vivo, as part of Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2377 2þ Figure 6. Transcriptome analysis of patient biopsies reveal remodelling of gene expression in Ca signalling pathways and mitochondria. Total RNA extracts from male child (MmD, p3369), female child (CCDs, p7322 and p2638) and adult female (CCDs, p4449 and p7379) patient biopsies and age and sex-matched controls (p7875, 2þ p6578 and p8463, respectively), were used for microarray analysis as described in the Materials and Methods section. (A) Differentially expressed genes related to Ca signalling pathways (GO: 0006874) identiﬁed by gene ontology analysis. Log 2 values of gene expression differences between p3369 MmD (left panel) and p7322 CCD (right panel) and respective controls are plotted. Consensus gene names are listed at the left. (B) Genes with signiﬁcantly altered expression are shown in Venn dia- grams in the human dataset. Overlaps between patients and with mitochondrial genes listed in the MitoCarta 2.0 database are shown. All differentially expressed genes and the Venn diagram intersections are listed in Supplementary Material, Data Set S1. (C) Differential expression values of mitochondrial genes in human patients. Log 2 values of up-regulated genes are shown in red, down-regulated genes are in green. (D) Differentially expressed mitochondrial genes coding for proteins of the respiratory chain and energy metabolism in human patient transcriptomes. Log 2 values of gene expression differences between p3369 MmD (left panel) and p7322 CCD (right panel) and respective controls are plotted. (E) Relative mtDNA copy number data from biopsies of all patients and age/sex-matched controls. Means 6 S.E.M. of three replicates are shown. Data were analysed using two-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2378 | Human Molecular Genetics, 2018, Vol. 27, No. 13 the pathological process in core myopathies. However, whether transfection, the medium was replaced with DMEM supple- the localization of IP3Rs (25) and the (43) with respect to mito- mented with 10% FBS; 12 h later the medium was replaced with chondria in fully differentiated muscle ﬁbres would allow this differentiation medium. Transfection efﬁciencies were tested by direct activation of mitochondrial metabolism remains to be co-transfecting cells with GFP, and were typically> 80%. 2þ shown. The direct, Ca -mediated activation of mitochondria in Myoblasts differentiate in mature myotubes after 5 days in differ- our models is also accompanied by increased mitochondrial entiation medium. Cell passage numbers were all less than 15. biogenesis. Although no apparent adaptive proliferation of mi- tochondria has been previously described in CCD and MmD, se- Patient samples lective up-regulation of genes involved in the respiratory chain 2þ and energy production by activation of Ca -dependent TFs or Patient’s samples were selected by screening archived muscle epigenetic changes (8) might provide adaptation to the overall biopsies hosted at the Neuromuscular Bank of Tissues and DNA loss of mitochondria in the core areas. samples of the University of Padova. Selection criteria were his- Our patient material comprised autosomal dominant cases, topathological diagnosis of core myopathy, characterized RYR1 such as p4449/p7379, cases with dominant de novo mutations gene mutations, the availability of clinical data and availability (p7322/p2638) and the autosomal recessive case p3369. The lat- of cultured myoblast cell lines. Muscle biopsies were obtained ter resulted in MmD while all other cases in CCD. Importantly, at the time of diagnosis after signing of an informed consent. in both functionally studied cases (p3369/p7322) mutations led The study was carried out in accordance with the ethical rules to loss of RyR1, which thus can accompany both AD- and AR- and guidelines issued by the Ethical committee of the partici- inherited disease, and both MMD and CCD histology. Moreover, pating centres and with the declaration of Helsinki. Five biop- since our study was limited to cases where RyR1 loss of protein sies were selected for the study. and function dominated the pathomechanism, and thus partial silencing of the mouse RyR1 in C2C12 myotubes provided an ap- 2þ propriate model to study compartmentalized Ca signalling. Mouse model Interestingly, results from microarray studies of the AD patients RyR1 I4895T knock-in mice on a 129S2/SvPasCrl background were showed partial overlap with the AR case, indicating that the ob- kindly provided by the S. Hamilton laboratory, Texas, USA. These served mitochondrial phenotype is independent of the mode of founder mice were rederived using C57BL/6J for breeding. This inheritance. However, the consequences of mutations on RyR1 resulted in a new sub-line with a mixed genetic background (ap- expression and function vary wildly in speciﬁc cases (10,17), proximately 50% 129S2/SvPasCrl and 50% C57BL/6J after rederiva- 2þ thus whether IP3R-mediated Ca signals operate as an overall tion). Since homozygotes have a perinatal lethal phenotype (44), adaptive mechanism in core myopathies remains to be studied. heterozygotes (HET) were crossed with wild-type (WT) littermates However, our study corroborated previous results showing neg- 2þ or C57BL/6J mice (Charles River) to maintain the colony. At least ative correlation between the two main SR Ca release chan- ﬁve such crosses had occurred before the experiments. Ear snips nels, RyR1 and the IP3R. Moreover, by rendering an overall from adult mice and tail snips from sacriﬁced neonates were adaptive function most likely for the up-regulation of IP3Rs, the 2þ retained for genotyping. DNA was extracted from tissue samples hypothesis of IP3-mediated Ca overload as a ruling pathome- using the Extract-N-Amp kit (Sigma) and PCR was used to amplify chanism in RyR1-related myopathies is implausible. the fragment covering the mutation site. Forward and reverse pri- 0 0 mers were 5 -GGTCTTCCTGTCTCAATAACCCGATCTAGAAAC-3 0 0 and 5 -GATGGAGAAACCAAAGCTCAGAGAGACCAC-3,respec- Materials and Methods tively. Since the inserted mutation site also contains an Age I tar- Cell culture and transfection get sequence, only samples containing the mutated allele undergo Age I digestion. Primary cultures of myoblasts from human quadriceps biopsies were obtained after collagenase A (Roche) digestion in 1% gelatin pre-coated dishes. Human myoblasts were grown in 2þ Ca imaging HAMF12 w/o glutamine medium (Euroclone), supplemented with 20% heat inactivated fetal bovine serum (FBS, Invitrogen), Cells for imaging were seeded on 1% gelatin pre-coated 24 mm coverslips placed in six-well plates. Human-derived primary 100 mg/ml penicillin and streptomycin, 25 ng/ml ﬁbroblast growth factor 2 (FGF2) (lowered to 5 nM for cell maintenance af- myoblasts were plated at a concentration of 2 10 while C2C12 myoblasts were plated at a concentration of 1, 5 10 . To mea- ter second cell passage). Cells were incubated at 37 C under 5% 2þ CO and passaged 1: 5 or 1: 10 at 70% conﬂuence. Myoblasts sure cytosolic and nuclear Ca dynamics, differentiated cells were loaded with 2 mM Fura-2/AM (Life Technologies) for 20 min were differentiated into myotubes at 80% conﬂuence in a me- dium containing Dulbecco’s modiﬁed Eagle medium (DMEM, at 37 in modiﬁed Krebs-Ringer buffer (KRB) (135 mM NaCl, 5 mM KCl, 1 mM MgCl ,20mM HEPES,1mM MgSO , 0.4 mM KH PO ,1 Invitrogen) supplemented with 2% horse serum (HS, Invitrogen), 2 4 2 4 100 mg/ml penicillin and streptomycin, 30 mg/ml insulin; mM CaCl , 5.5 mM glucose, pH 7.4). Images were acquired at 1/s (with exposure time set to 400 ms for all experiments) using alter- myoblasts differentiate into mature myotubes after 5 days in dif- ferentiation medium. nate excitation at 380 and 340 nm and collecting emitted light 2þ with a 505/20 emission ﬁlter. To measure mitochondrial [Ca ]in C2C12 mouse myoblasts were grown in DMEM (Invitrogen), supplemented with 10% heat inactivated FBS (Invitrogen), C2C12 myotubes we co-transfected myoblast with 3 mM of the mi- tochondrial targeted probes 2mtGCaMP6m or Cepia3mt and 1 mM 100 mg/ml penicillin and streptomycin. Cells were cultured and myoblasts were differentiated using the same protocol as for hu- siRNA-RYR1 (with exposure time set to 200 ms for all experi- ments). Images acquisition rate was 1/s. Images were generated man cells. Transfection of C2C12 myoblasts with siRNAs or with cDNAs was carried out with Lipofectamine 2000 (Invitrogen) using a 475–415 excitation ﬁlter with exposure time set to 200 ms for 475 nm and 100 ms for 415 nm, emitted light was collected according to the manufacturer’s instructions. After 6 h of Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2379 was collected through a 515/30 nm band-pass ﬁlter (Semrock). respectively) for 1 h at RT. Proteins were visualized by the 2þ To measure mitochondrial Ca levels in patient-derived differ- chemiluminescent reagent ‘super signal west pico chemiolumi- entiated myotubes we infected cells with an adenoviral nescent substrate’ (Thermo, 34080). Densitometric analyses 2mtGCaMP6m construct (1 ug/well in six-well plates) by adding were performed by using ImageJ analysis software. We analysed the virus directly to the culture medium 36 h before performing by means of densitometric measurements of at least three inde- the experiments. Imaging was performed using an Zeiss Axiovert pendent experiments, normalized to b-tubulin. 200 microscope equipped with a 63/1.4 N.A. Plan Apochromat objective. Excitation was performed with a DeltaRAM V high- Mitochondrial membrane potential measurements speed monochromator (Photon Technology International) equipped with a 75 W xenon arc lamp. Images were captured Human myoblasts were seeded at a density of 1.8 10 on 1% gel- with a high-sensitivity Evolve 512 Delta EMCCD (Photometrics). atin pre-coated 24 mm coverslips.After 5daysindifferentiation The system was controlled by MetaMorph 7.5 (Molecular Devices) medium, mitochondrial membrane potential (Dw ) was measured and was assembled by Crisel Instruments. by confocal imaging. Cells were loaded with 4 nM tetramethyl- rhodamine-methyl-ester (TMRM, Life Technologies) for 30 min at 37 C in KRB (supplemented with 2 mM CaCl )tomeasure Dw at 2 m 2þ [Ca ] measurements with aequorin resting conditions (steady state) or loaded in a modiﬁed KRB with C2C12 myoblasts were seeded on 1% gelatin pre-coated 13 mm [NaCl] lowered to 70 mM and supplemented with 2 mM CaCl and 70 mM KCl. About 0.8 lM cyclosporine-H was also used in coverslips placed in 24-well plates plated at a concentration of 4 10 . 4 days after addition of differentiation medium, cells these experiments to reduce active TMRM extrusion. Z-stack were infected with 1 mM adenoviral cytosolic-targeted aequorin images were acquired with a Leica Confocal SP5 microscope using (cytAEQ). The following day (5th day in differentiation medium) a100 immersion oil objective (Zeiss). TMRM was excited at coverslips with infected cells were incubated with 2 lMcoelen- 535 nm and emission was measured with a 560 nm LP ﬁlter. Eight terazine for 2 h in KRB supplemented with 1 mM CaCl , and then bit images were taken every 20 s for 4 min with a ﬁxed 1 s transferred to the perfusion chamber. All luminometer measure- exposure time; laser power was set to 8%. Pinhole was set to ments were carried out in KRB and agonists were added to the 1.5 airy units and pixel size was set as 1024 1024 nm. ImageJ same medium. Experiments were terminated by lysing the cells was used to quantify TMRM intensity on background-corrected 2þ with 100 lM digitonin in a hypotonic high [Ca ] solution (10 mM images applying a constant threshold and quantifying the ﬂuores- cence intensity mean values in selected region of interests CaCl in water), to discharge the remaining aequorin pool. The 2þ light signal was collected and calibrated into [Ca ]values byan (see Fig. 5A). 2þ algorithm based on the Ca response curve of aequorin at physi- 2þ ological conditions of pH, [Mg ]and ionicstrength(45). Oxygen consumption rate (OCR) measurements in C2C12 mouse myotubes and myoblasts Western blot analysis Low-passage C2C12 myoblast were seeded 20.000/well in a V7 C2C12 siRNA RYR1-transfected and human-derived differenti- XF 24-well cell culture microplate (XF24 EC ﬂux assay kit, ated myotubes were harvested with ice-cold PBS and centri- Seahorse, Bioscience) in culture medium. Cells were transfected fuged 10 min at 4000 rpm at 4 C. Cellular extracts were prepared (as reported in the previous section) with 0.1 ug/well siRNA by solubilizing cells for 30 min in ice-cold lysis buffer (RIPA RyR1 (Sigma) and 0.5 ul lipofectamine 2000 (Invitrogen) per well buffer 80%, 9% complete protease inhibitor cocktail tablets, and the following day culture medium was replaced with differ- Roche, 04693159001), 0.9% PMSF, 0.1% DTT, 9% phosphostop entiation medium. After 5 days in differentiation medium, ma- phosphatase inhibitor cocktail tablets, Roche 04906845001) sup- ture myotubes were gently rinsed in measurement buffer (MB) plemented with a cocktail of protease inhibitors (1%) (Sigma). consisting of DMEM (Sigma, D5030) 8.3 g/l, sodium pyruvate Supernatants were collected after 25 min centrifugation at 1 mM (1.1 g/l), glucose 25 mM (4.5 g/l), NaCl 33 mM (1.85 g/l), 12 000 rpm at 4 C. The total protein content was determined us- phenol red (15 mg/l), L-Glut 10 ml/l, pH 7.4, and placed in a 37 ing the BCA protein assay (Thermo, 23209). A total of 20 mg pro- humidiﬁed un-buffered incubator for 2 h to allow temperature teins were loaded on a Nu-page 3–8% tris-acetate precast gel and pH equilibration. Myotubes were visually inspected prior to (Lifetechnologies) immersed in tris-acetate SDS running buffer and after MB addition then loaded onto the instrument. Bio- (Lifetechnologies). Running was set up as follows: for IP3R and energetic analysis was performed utilizing an XF24–3 Seahorse RyR1 30 min at 50 V and 2 h at 70 V; for mitochondrial respira- Extracellular Flux Analyzer (Seahorse Bio-Science). After an tory complexes and PGC1-a 1 h 30 min at 130 V. Wet transfer equilibration step, basal OCR(pMoles/min) were recorded using was performed 2 h onto nitrocellulose (IP3R and RyR1) or meth- 3 min mix, 2 min wait and 3 min measure (looped three times) anol pre-activated PVDF membrane (Biorad) (mitochondrial re- cycles prior to the injection of 2 uM oligomycin to inhibit the spiratory complexes and PGC1-a). Membranes were blocked ATP synthase. Three more measurement loops were recorded with 5% milk in TBS-Tween 1% for 1 h and incubated with pri- prior to injection of substrate plus 0.8 uM FCCP to induce maxi- mary antibodies overnight at 4 C in 1% milk in TBS-Tween 1%. mal oxygen consumption. Following recording of three more We used the following antibodies: rabbit-IP3R (Santa Cruz, H- measurement loops, rotenone 1 uM and 1 uM antimycin A 300, sc-28613), mouse RyR1 (Thermo, 34C, MA3–925), mouse (inhibitors of mitochondrial respiration) were injected to assess mitoproﬁle (Mitosciences, MS604/H3941) rabbit PGC1-a (Santa non-mitochondrial OCR. Stimuli prepared in MB (70 ll volumes) Cruz, H-300, sc-13067), rabbit b-tubulin (Santa Cruz, H-235, sc- were pre-loaded and sequentially injected as indicated through 9104). Detection was carried out by incubation with secondary ports in the XF24 calibration cartridge to ﬁnal concentrations of horseradish peroxidase-conjugated goat anti-rabbit or goat 1 lg/ml oligomycin, 800 nM FCCP and 1 lM rotenone and anti-mouse IgG antibodies (Biorad, 170–6515 and 170–6516, antimycin-A. XeB (2 lM) was added to siRNA scr and siRNA Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2380 | Human Molecular Genetics, 2018, Vol. 27, No. 13 RYR1-transfected cells 30 min prior to measurements, and was algorithm (http://biit.cs.ut.ee/gproﬁler/help.cgi? help_id¼21). included in ports in the XF24 calibration cartridge to maintain ﬁ- Signiﬁcant TFs were further analysed by listing all the genes or- nal concentrations of 2 lM when injected. Since the number of dered by how many TFs target them in the human patient and differentiated cells in the culture was not feasible to determine, mouse model samples. In addition, we created heatmap plots of OCR values are expressed as pMoles/min/20 K seeded cells. As the genes ordered by this ranking and the TFs ordered by hierar- controls, non-differentiated myoblasts were treated and mea- chical clustering (see Supplementary Material, Data Set S3). In sured in the same way. Values were corrected to non- the heatmaps, blue signiﬁes that the gene is regulated by the TF mitochondrial respiration, i.e. by subtracting OCR values after and white signiﬁes that it is not. TFs belonging to the individual rotenone/antimycin-A addition. clusters were ranked according to signiﬁcance values. Statistical analysis Quantiﬁcation of mtDNA Data are reported as mean6 S.E.M. Statistical differences were Total DNA for mtDNA copy number estimation was extracted evaluated by ANOVA and post-hoc tests for multiple compari- from muscle biopsies with Qiagen DNeasy Blood & Tissue kit sons, or Student’s t-tests. according to the manufacturer’s protocol. The quantitative real- time PCR measurement of mtDNA copy number was conducted according to the protocol in Rooney et al. (46), by utilizing hu- Supplementary Material man sequence-speciﬁc primers targeting the mtDNA region Supplementary Material is available at HMG online. coding for the tRNALeu (UUR) gene (F: CACCCAAGAACA GGGTTTGT; R: TGGCCATGGGTATGTTGTTA) and the nuclear re- gion coding for the B2-microglobulin gene (F: TGCTGTCTC Acknowledgements CATGTTTGATGTATCT; R: TCTCTGCTCCCCACCTCTAAGT). RT- We thank for the helpful discussions and technical assistance PCR reaction parameters were set according to protocol in to the members of the laboratory of Rosario Rizzuto, Anna V C Rooney et al. (46), using SYBR Green JumpstartTM TaqTM Raffaello, Diego De Stefani and Cristina Mammucari. The person- ReadyMixTM (Sigma) on a Biorad CFX96 Thermocycler. Ct analy- nel of the MicroCribi Microarray Service (http://array9.wix.com/ sis was conducted through the Biorad CFX manager software. microcribi), Beniamina Pacchioni and Caterina Millino are kindly For the determination of relative mtDNA copy number the fol- acknowledged for help in array production and data analysis. lowing equations were used: Conﬂict of Interest statement. None declared. a. DCt ¼ Nuclear Ct – Mitochondrial Ct b. Relative mtDNA content ¼ 2 2DCt Funding This work was supported by the following grants: Telethon Microarray analysis (GEP12066 and GGP16026), University College London COMPLeX/ Total mRNA was extracted from 40 mg of frozen human or British Heart Foundation Fund (SP/08/004), the Biotechnology mouse muscle tissues using 1 ml trizol per sample using a tissue and Biological Sciences Research Council (BB/L020874/1 and BB/ lyser (Tissue lyser II, Qiagen). Gene expression studies were per- P018726/1) to G.S. and M.R.D.; Ricerca Finalizzata, Italian formed using Agilent technology with one-color (quick amp la- Ministry of Health (RF-2013–02359065) to G.S. and E.P. The sup- belling) kit following the manufacturer’s instructions. port of the Medical Research Council to the Neuromuscular Quantitative and qualitative analysis of total RNA were per- Centre Biobank is gratefully acknowledged. We greatly appreci- formed with NanoDrop spectrophotometers (Thermo Scientiﬁc) ate support from the Telethon BioBank (GTB12001D), and the and Nanochip BioAnalyzer (Agilent). Human samples were EuroBioBank network. F.M. was supported by the National analysed using the Human 4x44K V2 platform (Agilent) and data Institute of Health Research Biomedical Research Centre at were normalized with the intra-array (Multiplicatively Great Ormond Street Hospital for Children NHS Foundation Detrended) and the inter-array (Quantile) methods. To evaluate Trust. The support of MDUK to the Dubowitz Neuromuscular the differences in transcript expression levels we used Centre and of NHSE to the NSCT Diagnostic Service for signiﬁcance analysis of microarray (SAM) and we performed Congenital Myopathies is also acknowledged. V.N.K. was sup- cluster analysis only on altered transcripts with false discovery ported by an Action Medical Research grant (GN2158). Funding to rate (FDR) analysis of 0% using the complete linkage Euclidean pay the Open Access publication charges for this article was pro- method. EDL and soleus mouse samples were analysed using the vided by Biotechnology and Biological Sciences Research Council. Mus musculus 4x44K platform and data were normalized with the intra-array (Multiplicatively Detrended) and the inter-array References (Quantile) methods. Differentially expressed transcripts were found using permutations of t-test with Bonferroni method 1. Jungbluth, H. and Gautel, M. (2014) Pathogenic mechanisms (P-value < 0.05). Enrichment analyses were performed using g: in centronuclear myopathies. Front. Aging Neurosci., 6, 339. Proﬁler (38). To identify altered mitochondrial transcripts, we 2. Amburgey, K., Bailey, A., Hwang, J.H., Tarnopolsky, M.A., compared our results with The Human and Mouse MitoCarta 2.0 Bonnemann, C.G., Medne, L., Mathews, K.D., Collins, J., list (Broad Institute, Cambridge, MA, USA, https://www.broadinsti Daube, J.R., Wellman, G.P. et al. (2013) Genotype-phenotype tute.org/scientiﬁc-community/science/programs/metabolic-dis correlations in recessive RYR1-related myopathies. Orph. ease-program/publications/mitocarta/mitocarta-in-0) (39), using J. Rare Dis., 8, 117. Venn diagrams (http://bioinfogp.cnb.csic.es/tools/venny/index. 3. Snoeck, M., Treves, S., Molenaar, J.P., Kamsteeg, E.J., html). Microarray data have been deposited in GEO (GSE103855). Jungbluth, H. and Voermans, N.C. (2016) “Human stress Putative TF-binding sites were determined using the syndrome” and the expanding spectrum of RYR1-related TRANSFAC database (2015.3) (47) by a custom g: Proﬁler myopathies. Cell Biochem. Biophys., 74, 85–87. Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2381 4. Klein, A., Lillis, S., Munteanu, I., Scoto, M., Zhou, H., 19. Arias-Caldero ´ n, M., Almarza, G., Dı ´az-Vegas, A., Contreras- Quinlivan, R., Straub, V., Manzur, A.Y., Roper, H., Jeannet, Ferrat, A., Valladares, D., Casas, M., Toledo, H., Jaimovich, E. P.Y. et al. (2012) Clinical and genetic ﬁndings in a large cohort and Buvinic, S. (2016) Characterization of a multiprotein of patients with ryanodine receptor 1 gene-associated my- complex involved in excitation-transcription coupling of opathies. Hum. Mutat., 33, 981–988. skeletal muscle. Skelet. Muscle, 6, 15. 5. Jungbluth, H., Sewry, C.A. and Muntoni, F. (2011) Core myop- 20. Ibarra, C., Vicencio, J.M., Estrada, M., Lin, Y., Rocco, P., athies. Semin. Pediatr. Neurol., 18, 239–249. Rebellato, P., Munoz, J.P., Garcia-Prieto, J., Quest, A.F., 6. Sewry, C.A. and Wallgren-Pettersson, C. (2017) Chiong, M. et al. (2013) Local control of nuclear calcium sig- Myopathology in congenital myopathies. Neuropathol. Appl. naling in cardiac myocytes by perinuclear microdomains of Neurobiol., 43, 5–23. sarcolemmal insulin-like growth factor 1 receptors. Circ. 7. Hwang, J.H., Zorzato, F., Clarke, N.F. and Treves, S. (2012) Res., 112, 236–245. Mapping domains and mutations on the skeletal muscle 21. Schiafﬁno, S. and Reggiani, C. (2011) Fiber types in mamma- ryanodine receptor channel. Trends Mol. Med., 18, 644–657. lian skeletal muscles. Physiol. Rev., 91, 1447–1531. 8. Rokach, O., Sekulic-Jablanovic, M., Voermans, N., 22. Freyssenet, D., Irrcher, I., Connor, M.K., Di Carlo, M. and Wilmshurst, J., Pillay, K., Heytens, L., Zhou, H., Muntoni, F., Hood, D.A. (2004) Calcium-regulated changes in mitochon- Gautel, M., Nevo, Y. et al. (2015) Epigenetic changes as a com- drial phenotype in skeletal muscle cells. Am. J. Physiol. Cell mon trigger of muscle weakness in congenital myopathies. Physiol., 286, C1053–C1061. Hum. Mol. Genet., 24, 4636–4647. 23. Yi, M., Weaver, D., Eisner, V., Va ´ rnai, P., Hunyady, L., Ma, J., 9. Jungbluth, H. (2007) Multi-minicore disease. Orph. J. Rare Dis., Csorda ´ s, G. and Hajno ´ czky, G. (2012) Switch from 2, 31. ER-mitochondrial to SR-mitochondrial calcium coupling 10. Zhou, H., Jungbluth, H., Sewry, C.A., Feng, L., Bertini, E., during muscle differentiation. Cell Calcium, 52, 355–365. Bushby, K., Straub, V., Roper, H., Rose, M.R., Brockington, M. 24. Glancy, B., Hartnell, L.M., Malide, D., Yu, Z.-X., Combs, C.A., et al. (2007) Molecular mechanisms and phenotypic variation Connelly, P.S., Subramaniam, S. and Balaban, R.S. (2015) in RYR1-related congenital myopathies. Brain, 130, 2024–2036. Mitochondrial reticulum for cellular energy distribution in 11. North, K.N., Wang, C.H., Clarke, N., Jungbluth, H., Vainzof, muscle. Nature, 523, 617–620. M., Dowling, J.J., Amburgey, K., Quijano-Roy, S., Beggs, A.H., 25. Vassilopoulos, S., Thevenon, D., Rezgui, S.S., Brocard, J., Sewry, C. et al. (2014) Approach to the diagnosis of congenital Chapel, A., Lacampagne, A., Lunardi, J., DeWaard, M. and myopathies. Neuromusc. Disord., 24, 97–116. Marty, I. (2005) Triadins are not triad-speciﬁc proteins. J. Biol. 12. Ravenscroft, G., Laing, N.G. and Bo ¨ nnemann, C.G. (2015) Chem., 280, 28601–28609. Pathophysiological concepts in the congenital myopathies: 26. Szabadkai, G., Pitter, J.G. and Spa ¨ t, A. (2001) Cytoplasmic blurring the boundaries, sharpening the focus. Brain, 138, Ca2þ at low submicromolar concentration stimulates mito- 246–268. chondrial metabolism in rat luteal cells. Pﬂugers Archiv., 441, 13. Boncompagni, S., Loy, R.E., Dirksen, R.T. and Franzini- 678–685. Armstrong, C. (2010) The I4895T mutation in the type 1 rya- 27. Szabadkai, G. and Duchen, M.R. (2008) Mitochondria: the hub nodine receptor induces ﬁber-type speciﬁc alterations in of cellular Ca2þ signaling. Physiology, 23, 84–94. skeletal muscle that mimic premature aging. Aging Cell, 9, 28. Giorgio, V., Guo, L., Bassot, C., Petronilli, V., and Bernardi, P. 958–970. (2018) Calcium and regulation of the mitochondrial perme- 14. Loy, R.E., Orynbayev, M., Xu, L., Andronache, Z., Apostol, S., ability transition. Cell Calcium, 70, 56–63. Zvaritch, E., MacLennan, D.H., Meissner, G., Melzer, W., 29. Irwin, W.A., Bergamin, N., Sabatelli, P., Reggiani, C., Dirksen, R.T. et al. (2011) Muscle weakness in Ryr1I4895T/WT Megighian, A., Merlini, L., Braghetta, P., Columbaro, M., knock-in mice as a result of reduced ryanodine receptor Volpin, D., Bressan, G.M. et al. (2003) Mitochondrial dysfunc- Ca2þ ion permeation and release from the sarcoplasmic re- tion and apoptosis in myopathic mice with collagen VI deﬁ- ticulum. J. Gen. Physiol., 137, 43–57. ciency. Nat. Genet., 35, 367–371. 15. Dowling, J.J., Arbogast, S., Hur, J., Nelson, D.D., McEvoy, A., 30. Rossi, A.E., Boncompagni, S., Wei, L., Protasi, F. and Dirksen, Waugh, T., Marty, I., Lunardi, J., Brooks, S.V., Kuwada, J.Y. et al. R.T. (2011) Differential impact of mitochondrial positioning (2012) Oxidative stress and successful antioxidant treatment on mitochondrial Ca2 uptake and Ca2 spark suppression in in models of RYR1-related myopathy. Brain, 135, 1115–1127. skeletal muscle. AJP Cell Physiol., 301, C1128–C1139. 16. Zvaritch, E., Kraeva, N., Bombardier, E., McCloy, R.A., 31. Hill, J.M., De Stefani, D., Jones, A.W., Ruiz, A., Rizzuto, R. and Depreux, F., Holmyard, D., Kraev, A., Seidman, C.E., Szabadkai, G. (2014) Measuring baseline Ca(2þ) levels in sub- Seidman, J.G., Tupling, A.R. et al. (2009) Ca2þ dysregulation cellular compartments using genetically engineered ﬂuores- in Ryr1(I4895T/wt) mice causes congenital myopathy with cent indicators. Methods Enzymol., 543, 47–72. progressive formation of minicores, cores, and nemaline 32. Jaimovich, E., Mattei, C., Liberona, J.L., Cardenas, C., Estrada, rods. Proc. Natl. Acad. Sci. U.S.A., 106, 21813–21818. M., Barbier, J., Debitus, C., Laurent, D. and Molgo ´ , J. (2005) 17. Zhou, H., Rokach, O., Feng, L., Munteanu, I., Mamchaoui, K., Xestospongin B, a competitive inhibitor of IP3-mediated Wilmshurst, J.M., Sewry, C., Manzur, A.Y., Pillay, K., Mouly, Ca2þ signalling in cultured rat myotubes, isolated myonu- V. et al. (2013) RyR1 deﬁciency in congenital myopathies dis- clei, and neuroblastoma (NG108-15) cells. FEBS Lett., 579, rupts excitation-contraction coupling. Hum. Mutat., 34, 2051–2057. 986–996. 33. Suzuki, J., Kanemaru, K., Ishii, K., Ohkura, M., Okubo, Y. and 18. Zhou, H., Feng, L., Munteanu, I., Duchen, M., Treves, S., Iino, M. (2014) Imaging intraorganellar Ca2 at subcellular res- Jungbluth, H. and Muntoni, F. (2012) P91 RyR1 deﬁciency in olution using CEPIA. Nat. Commun., 5, 4153. congenital myopathies disrupts excitation-contraction cou- 34. Ca ´ rdenas, C., Miller, R.A., Smith, I., Bui, T., Molgo ´ , J., Mu ¨ ller, pling and induces the second calcium release system via M., Vais, H., Cheung, K.-H., Yang, J., Parker, I. et al. (2010) IP3R. Neuromusc. Disord., 22, S32. Essential regulation of cell bioenergetics by constitutive Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2382 | Human Molecular Genetics, 2018, Vol. 27, No. 13 InsP3 receptor Ca2þ transfer to mitochondria. Cell, 142, mouse model of malignant hyperthermia. Proc. Natl. Acad. 270–283. Sci. U.S.A., 106, 21996–22001. 35. Bravo, R. Vicencio, J.M., Parra, V., Troncoso, R., Munoz, J.P., 42. Sato, I., Wu, S., Ibarra, M.C.A., Hayashi, Y.K., Fujita, H., Tojo, Bui, M., Quiroga, C., Rodriguez, A.E., Verdejo, H.E., Ferreira, J. M., Oh, S.J., Nonaka, I., Noguchi, S., Nishino, I. et al. (2008) et al. (2011) Increased ER-mitochondrial coupling promotes Congenital neuromuscular disease with uniform type 1 ﬁber mitochondrial respiration and bioenergetics during early and RYR1 mutation. Neurology, 70, 114–122. phases of ER stress. J. Cell Sci., 124, 2143–2152. 43. Boncompagni, S., Rossi, A.E., Micaroni, M., Beznoussenko, 36. Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G.V., Polishchuk, R.S., Dirksen, R.T. and Protasi, F. (2008) G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R.C. Mitochondria are linked to calcium stores in striated muscle et al. (1999) Mechanisms controlling mitochondrial biogene- by developmentally regulated tethering structures. Mol. Biol. sis and respiration through the thermogenic coactivator Cell, 20, 1058–1067. PGC-1. Cell, 98, 115–124. 44. Zvaritch, E., Depreux, F.,Kraeva, N.,Loy,R.E., 37. Jones, A.W.E., Yao, Z., Vicencio, J.M., Karkucinska- Goonasekera, S.A., Boncompagni, S., Kraev, A., Gramolini, Wieckowska, A. and Szabadkai, G. (2012) PGC-1 family coac- A.O., Dirksen, R.T., Franzini-Armstrong, C. et al. (2007) An tivators and cell fate: roles in cancer, neurodegeneration, Ryr1I4895T mutation abolishes Ca2þ release channel cardiovascular disease and retrograde mitochondria– function and delays development in homozygous off- nucleus signalling. Mitochondrion, 12, 86–99. spring of a mutant mouse line. Proc. Natl. Acad. Sci. U.S.A., 38. Reimand, J., Arak, T., Adler, P., Kolberg, L., Reisberg, S., 104, 18537–18542. Peterson, H. and Vilo, J. (2016) g: proﬁler-a web server for 45. Chiesa, A., Rapizzi, E., Tosello, V., Pinton, P., De Virgilio, M., functional interpretation of gene lists (2016 update). Nucleic Fogarty, K.E. and Rizzuto, R. (2001) Recombinant aequorin Acids Res., 44, W83–W89. and green ﬂuorescent protein as valuable tools in the study 39. Calvo, S.E., Clauser, K.R. and Mootha, V.K. (2016) of cell signalling. Biochem. J., 355, 1–12. MitoCarta2.0: an updated inventory of mammalian mito- 46. Rooney, J.P., Ryde, I.T., Sanders, L.H., Howlett, E.H., Colton, chondrial proteins. Nucleic Acids Res., 44, D1251–D1257. M.D., Germ, K.E., Mayer, G.D., Greenamyre, J.T. and Meyer, 40. Wright, F.A. and Wojcikiewicz, R.J.H. (2016) Chapter 4 - J.N. (2015) PCR based determination of mitochondrial DNA Inositol 1, 4, 5-Trisphosphate Receptor Ubiquitination. Prog. copy number in multiple species. Methods Mol. Biol., 1241, Mol. Biol. Transl. Sci., 141, 141–159. 23–38. 41. Boncompagni, S., Rossi, A.E., Micaroni, M., Hamilton, S.L., 47. Wingender, E. (2008) The TRANSFAC project as an example Dirksen, R.T., Franzini-Armstrong, C. and Protasi, F. (2009) of framework technology that supports the analysis of geno- Characterization and temporal development of cores in a mic regulation. Brief. Bioinform., 9, 326–332. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Human Molecular Genetics Oxford University Press http://www.deepdyve.com/lp/oxford-university-press/inositol-trisphosphate-receptor-mediated-ca2-signalling-stimulates-vHWQW22ojs

Loading next page...

References (49)

B. Glancy, L. Hartnell, D. Malide, Zu-Xi Yu, C. Combs, P. Connelly, S. Subramaniam, R. Balaban (2015)
Mitochondrial reticulum for cellular energy distribution in muscle
Nature, 523
Cé Sar, Cá Rdenas, Russell Miller, Ian Smith, Thi Bui, J. Molgó, Marioly Mü, H. Vais, K. Cheung, Jun Yang, I. Parker, C. Thompson, M. Birnbaum, K. Hallows, J. Foskett (2010)
Essential Regulation of Cell Bioenergetics by Constitutive InsP3 Receptor Ca2+ Transfer to Mitochondria
Cell, 142
Julia Hill, Diego Stefani, A. Jones, A. Ruiz, R. Rizzuto, G. Szabadkai (2014)
Measuring baseline Ca(2+) levels in subcellular compartments using genetically engineered fluorescent indicators.
Methods in enzymology, 543
J. Reimand, Tambet Arak, P. Adler, Liis Kolberg, S. Reisberg, Hedi Peterson, J. Vilo (2016)
g:Profiler—a web server for functional interpretation of gene lists (2016 update)
Nucleic Acids Research, 44
I. Sato, Shiwen Wu, M. Ibarra, Y. Hayashi, H. Fujita, M. Tōjō, Shin Oh, Ikuya Nonaka, Satoru Noguchi, I. Nishino (2008)
Congenital neuromuscular disease with uniform type 1 fiber and RYR1 mutation
Neurology, 70
V. Giorgio, Lishu Guo, Claudio Bassot, V. Petronilli, P. Bernardi (2017)
Calcium and regulation of the mitochondrial permeability transition.
Cell calcium, 70
K. Amburgey, A. Bailey, J. Hwang, M. Tarnopolsky, C. Bonnemann, L. Medne, K. Mathews, J. Collins, J. Daube, G. Wellman, B. Callaghan, N. Clarke, J. Dowling (2013)
Genotype-phenotype correlations in recessive RYR1-related myopathies
Orphanet Journal of Rare Diseases, 8
D. Freyssenet, I. Irrcher, M. Connor, M. Carlo, D. Hood (2004)
Calcium-regulated changes in mitochondrial phenotype in skeletal muscle cells.
American journal of physiology. Cell physiology, 286 5
K. North, Ching Wang, N. Clarke, H. Jungbluth, M. Vainzof, J. Dowling, K. Amburgey, S. Quijano-roy, A. Beggs, C. Sewry, N. Laing, C. Bönnemann (2014)
Approach to the diagnosis of congenital myopathies
Neuromuscular Disorders, 24
S. Boncompagni, A. Rossi, M. Micaroni, G. Beznoussenko, R. Polishchuk, R. Dirksen, F. Protasi (2008)
Mitochondria are linked to calcium stores in striated muscle by developmentally regulated tethering structures.
Molecular biology of the cell, 20 3
H. Zhou, L. Feng, I. Munteanu, M. Duchen, S. Treves, H. Jungbluth, F. Muntoni (2012)
P91 RyR1 deficiency in congenital myopathies disrupts excitation-contraction coupling and induces the second calcium release system via IP3R
Neuromuscular Disorders, 22
M. Snoeck, Susan Treves, J. Molenaar, E. Kamsteeg, H. Jungbluth, N. Voermans (2015)
“Human Stress Syndrome” and the Expanding Spectrum of RYR1-Related Myopathies
Cell Biochemistry and Biophysics, 74
Haiyan Zhou, H. Jungbluth, C. Sewry, Lucy Feng, E. Bertini, K. Bushby, V. Straub, H. Roper, M. Rose, M. Brockington, M. Kinali, A. Manzur, S. Robb, R. Appleton, S. Messina, A. D’Amico, R. Quinlivan, M. Swash, C. Müller, Susan Brown, S. Treves, F. Muntoni (2007)
Molecular mechanisms and phenotypic variation in RYR1-related congenital myopathies.
Brain : a journal of neurology, 130 Pt 8
Zhidan Wu, P. Puigserver, U. Andersson, Chenyu Zhang, G. Adelmant, V. Mootha, A. Troy, S. Cinti, B. Lowell, R. Scarpulla, B. Spiegelman (1999)
Mechanisms Controlling Mitochondrial Biogenesis and Respiration through the Thermogenic Coactivator PGC-1
Cell, 98
S. Boncompagni, Ryan Loy, R. Dirksen, C. Franzini-armstrong (2010)
The I4895T mutation in the type 1 ryanodine receptor induces fiber‐type specific alterations in skeletal muscle that mimic premature aging
Aging Cell, 9
Roberto Bravo, J. Vicencio, V. Parra, Rodrigo Troncoso, J. Muñoz, Michael Bui, Clara Quiroga, Andrea Rodríguez, H. Verdejo, Jorge Ferreira, Myriam Iglewski, M. Chiong, T. Simmen, A. Zorzano, Joseph Hill, B. Rothermel, G. Szabadkai, S. Lavandero (2011)
Increased ER–mitochondrial coupling promotes mitochondrial respiration and bioenergetics during early phases of ER stress
Journal of Cell Science, 124
H. Jungbluth, C. Sewry, F. Muntoni (2011)
Core myopathies.
Seminars in pediatric neurology, 18 4
Manuel Arias-Calderón, G. Almarza, A. Díaz-Vegas, A. Contreras-Ferrat, D. Valladares, M. Casas, H. Toledo, E. Jaimovich, S. Buvinic (2016)
Characterization of a multiprotein complex involved in excitation-transcription coupling of skeletal muscle
Skeletal Muscle, 6
S. Calvo, K. Clauser, V. Mootha (2015)
MitoCarta2.0: an updated inventory of mammalian mitochondrial proteins
Nucleic Acids Research, 44
J. Hwang, F. Zorzato, N. Clarke, S. Treves (2012)
Mapping domains and mutations on the skeletal muscle ryanodine receptor channel.
Trends in molecular medicine, 18 11
Muqing Yi, D. Weaver, V. Eisner, P. Várnai, L. Hunyady, Jianjie Ma, G. Csordás, G. Hajnóczky (2012)
Switch from ER-mitochondrial to SR-mitochondrial calcium coupling during muscle differentiation.
Cell calcium, 52 5
A. Klein, S. Lillis, I. Munteanu, M. Scoto, Haiyan Zhou, R. Quinlivan, V. Straub, A. Manzur, H. Roper, P. Jeannet, W. Rakowicz, David Jones, U. Jensen, E. Wraige, N. Trump, U. Schara, H. Lochmuller, A. Sarkozy, H. Kingston, F. Norwood, M. Damian, J. Kirschner, C. Longman, M. Roberts, M. Auer-Grumbach, I. Hughes, K. Bushby, C. Sewry, S. Robb, S. Abbs, H. Jungbluth, F. Muntoni (2012)
Clinical and genetic findings in a large cohort of patients with ryanodine receptor 1 gene‐associated myopathies
Human Mutation, 33
S. Schiaffino, C. Reggiani (2011)
Fiber types in mammalian skeletal muscles.
Physiological reviews, 91 4
C. Sewry, C. Wallgren‐Pettersson (2017)
Myopathology in congenital myopathies
Neuropathology and Applied Neurobiology, 43
S. Boncompagni, A. Rossi, M. Micaroni, S. Hamilton, R. Dirksen, C. Franzini-armstrong, F. Protasi (2009)
Characterization and temporal development of cores in a mouse model of malignant hyperthermia
Proceedings of the National Academy of Sciences, 106
G. Szabadkai, J. Pitter, A. Spät (2001)
Cytoplasmic Ca2+ at low submicromolar concentration stimulates mitochondrial metabolism in rat luteal cells
Pflügers Archiv, 441
E. Jaimovich, C. Mattei, J. Liberona, C. Cárdenas, M. Estrada, J. Barbier, C. Debitus, D. Laurent, J. Molgó (2005)
Xestospongin B, a competitive inhibitor of IP3‐mediated Ca2+ signalling in cultured rat myotubes, isolated myonuclei, and neuroblastoma (NG108‐15) cells
FEBS Letters, 579
C. Ibarra, J. Vicencio, M. Estrada, Yingbo Lin, Paola Rocco, Paola Rebellato, J. Muñoz, J. García‐Prieto, A. Quest, M. Chiong, S. Davidson, Iva Bulatovic, K. Grinnemo, O. Larsson, G. Szabadkai, P. Uhlén, E. Jaimovich, S. Lavandero (2013)
Local Control of Nuclear Calcium Signaling in Cardiac Myocytes by Perinuclear Microdomains of Sarcolemmal Insulin-Like Growth Factor 1 Receptors
Circulation Research, 112
F. Wright, R. Wojcikiewicz (2016)
Chapter 4 - Inositol 1,4,5-Trisphosphate Receptor Ubiquitination.
Progress in molecular biology and translational science, 141
Junji Suzuki, Kazunori Kanemaru, K. Ishii, Masamichi Ohkura, Y. Okubo, M. Iino (2014)
Imaging intraorganellar Ca2+ at subcellular resolution using CEPIA
Nature Communications, 5
E. Zvaritch, N. Kraeva, É. Bombardier, Robert McCloy, Frederic Depreux, D. Holmyard, A. Kraev, C. Seidman, J. Seidman, A. Tupling, D. Maclennan (2009)
Ca2+ dysregulation in Ryr1I4895T/wt mice causes congenital myopathy with progressive formation of minicores, cores, and nemaline rods
Proceedings of the National Academy of Sciences, 106
A. Jones, Z. Yao, J. Vicencio, A. Karkucińska-Więckowska, G. Szabadkai (2012)
PGC-1 family coactivators and cell fate: roles in cancer, neurodegeneration, cardiovascular disease and retrograde mitochondria-nucleus signalling.
Mitochondrion, 12 1
G. Ravenscroft, N. Laing, C. Bönnemann (2015)
Pathophysiological concepts in the congenital myopathies: blurring the boundaries, sharpening the focus.
Brain : a journal of neurology, 138 Pt 2
Ori Rokach, M. Sekulic-Jablanovic, N. Voermans, J. Wilmshurst, K. Pillay, L. Heytens, Haiyan Zhou, F. Muntoni, M. Gautel, Y. Nevo, S. Mitrani-Rosenbaum, Ruben Attali, A. Finotti, R. Gambari, Barbara Mosca, H. Jungbluth, F. Zorzato, S. Treves (2015)
Epigenetic changes as a common trigger of muscle weakness in congenital myopathies.
Human molecular genetics, 24 16
William Irwin, N. Bergamin, P. Sabatelli, C. Reggiani, A. Megighian, L. Merlini, P. Braghetta, M. Columbaro, D. Volpin, G. Bressan, P. Bernardi, P. Bonaldo (2003)
Mitochondrial dysfunction and apoptosis in myopathic mice with collagen VI deficiency
Nature Genetics, 35
(2007)
Orphanet Journal of Rare Diseases BioMed Central Review Multi-minicore Disease
E. Wingender (2008)
The TRANSFAC project as an example of framework technology that supports the analysis of genomic regulation
Briefings in bioinformatics, 9 4
S. Vassilopoulos, D. Thevenon, Sophia Rezgui, J. Brocard, A. Chapel, A. Lacampagne, J. Lunardi, M. Dewaard, I. Marty (2005)
Triadins Are Not Triad-specific Proteins
Journal of Biological Chemistry, 280
E. Zvaritch, Frederic Depreux, N. Kraeva, Ryan Loy, Sanjeewa Goonasekera, S. Boncompagni, A. Kraev, A. Gramolini, R. Dirksen, C. Franzini-armstrong, C. Seidman, J. Seidman, D. Maclennan (2007)
An Ryr1I4895T mutation abolishes Ca2+ release channel function and delays development in homozygous offspring of a mutant mouse line
Proceedings of the National Academy of Sciences, 104
Haiyan Zhou, Ori Rokach, Lucy Feng, I. Munteanu, K. Mamchaoui, J. Wilmshurst, C. Sewry, A. Manzur, K. Pillay, V. Mouly, M. Duchen, H. Jungbluth, S. Treves, F. Muntoni (2013)
RyR1 Deficiency in Congenital Myopathies Disrupts Excitation–Contraction Coupling
Human Mutation, 34
Jungbluth (2007)
Multi-minicore disease
Orph. J. Rare Dis, 2
A. Rossi, S. Boncompagni, Lan Wei, F. Protasi, R. Dirksen (2011)
Differential impact of mitochondrial positioning on mitochondrial Ca(2+) uptake and Ca(2+) spark suppression in skeletal muscle.
American journal of physiology. Cell physiology, 301 5
H. Jungbluth, M. Gautel (2014)
Pathogenic Mechanisms in Centronuclear Myopathies
Frontiers in Aging Neuroscience, 6
John Rooney, Ian Ryde, Laurie Sanders, Evan Howlett, Meryl Colton, Kaylyn Germ, Greg Mayer, J. Greenamyre, Joel Meyer (2015)
PCR based determination of mitochondrial DNA copy number in multiple species.
Methods in molecular biology, 1241
G. Szabadkai, M. Duchen (2008)
Mitochondria: the hub of cellular Ca2+ signaling.
Physiology, 23
J. Dowling, S. Arbogast, J. Hur, D. Nelson, A. McEvoy, Trent Waugh, I. Marty, J. Lunardi, S. Brooks, J. Kuwada, A. Ferreiro (2012)
Oxidative stress and successful antioxidant treatment in models of RYR1-related myopathy.
Brain : a journal of neurology, 135 Pt 4
Chiesa (2001)
Recombinant aequorin and green fluorescent protein as valuable tools in the study of cell signalling
Biochem. J, 355
Ryan Loy, Murat Orynbayev, Le Xu, Zoita Andronache, Simona Apostol, E. Zvaritch, D. Maclennan, G. Meissner, W. Melzer, R. Dirksen (2011)
Muscle weakness in Ryr1I4895T/WT knock-in mice as a result of reduced ryanodine receptor Ca2+ ion permeation and release from the sarcoplasmic reticulum
The Journal of General Physiology, 137
A. Chiesa, E. Rapizzi, V. Tosello, P. Pinton, M. Virgilio, K. Fogarty, R. Rizzuto (2001)
Recombinant aequorin and green fluorescent protein as valuable tools in the study of cell signalling.
The Biochemical journal, 355 Pt 1

Publisher: Oxford University Press
Copyright: Copyright © 2022 Oxford University Press
ISSN: 0964-6906
eISSN: 1460-2083
DOI: 10.1093/hmg/ddy149
Publisher site: See Article on Publisher Site

Abstract

2þ Core myopathies are a group of childhood muscle disorders caused by mutations of the ryanodine receptor (RyR1), the Ca release channel of the sarcoplasmic reticulum. These mutations have previously been associated with elevated inositol trisphosphate receptor (IP3R) levels in skeletal muscle myotubes derived from patients. However, the functional relevance and 2þ the relationship of IP3R mediated Ca signalling with the pathophysiology of the disease is unclear. It has also been suggested that mitochondrial dysfunction underlies the development of central and diffuse multi-mini-cores, devoid of mitochondrial ac- tivity, which is a key pathological consequence of RyR1 mutations. Here we used muscle biopsies of central core and multi- minicore disease patients with RyR1 mutations, as well as cellular and in vivo mouse models of the disease to characterize global 2þ cellular and mitochondrial Ca signalling, mitochondrial function and gene expression associated with the disease. We show that RyR1 mutations that lead to the depletion of the channel are associated with increased IP -mediated nuclear and mito- 2þ chondrial Ca signals and increased mitochondrial activity. Moreover, western blot and microarray analysis indicated en- hanced mitochondrial biogenesis at the transcriptional and protein levels and was reﬂected in increased mitochondrial DNA content. The phenotype was recapitulated by RYR1 silencing in mouse cellular myotube models. Altogether, these data indicate 2þ that remodelling of skeletal muscle Ca signalling following loss of functional RyR1 mediates bioenergetic adaptation. Received: October 1, 2017. Revised: April 14, 2018. Accepted: April 16, 2018 V C The Author(s) 2018. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. 2367 Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2368 | Human Molecular Genetics, 2018, Vol. 27, No. 13 myotubes and human cell lines with hypomorphic RyR1 muta- Introduction tions disrupting EC coupling (17,18). This might represent an Mutations of the type 1 ryanodine receptor (RyR1), a key sarco- 2þ adaptative rearrangement of Ca signal-related gene expres- 2þ plasmic reticulum (SR) Ca release channel almost exclusively sion patterns (19), altering cytoplasmic or nuclear signalling, expressed in skeletal muscle, are one of the most common similarly as described in cardiomyocytes, where IP3Rs play a causes of non-dystrophic congenital myopathies. Different 2þ privileged role to directly trigger nuclear Ca signals (20). Thus mode of inheritance of mutations in the RYR1 gene and either directly, or indirectly, altered RyR1 and IP3R expression associated distinct clinico-pathological phenotypes are 2þ can be part of feedback loops of an altered Ca -dependent tran- recognized: the dominantly inherited central core disease (CCD, scriptional network, which has been shown to affect mitochon- MIM#11700); autosomal recessive multi-minicore disease drial gene expression, biogenesis and function in muscle (21,22). (MmD, MIM #255320), RYR1-related centronuclear myopathy On the other hand, increased IP3R expression might also lead to (CNM) (1) and congenital ﬁbre-type disproportion (CFTD, MIM 2þ increased direct transfer of Ca between the SR-localized IP3Rs #255310) (2). In addition, association of malignant hyperthermia and mitochondria (23). Localization of a mitochondrial popula- susceptibility (MHS, MIM# 145600) and exertional rhabdomyoly- tion (24) and IP3R/F F -ATP synthase immunoﬂuorescence to 1 o sis (3) traits are also associated with dominant RYR1 mutations. the ‘intercisternal’ (25) might favour this signalling, promoting The underlying mutations and the heterogeneity in clinical 2þ direct mitochondrial Ca transfer from the SR. While mito- symptoms, characterized primarily by the varying severity and 2þ chondrial Ca uptake contributes to metabolic signalling and extent of muscle weakness, suggest a complex underlying path- adaptation through altering NAD(P)H redox state and increasing ophysiology (4,5). In spite of the broad clinical features of 2þ ATP production, long-term Ca overload can lead to mitochon- RyR1-related myopathies, the pathology is dominated by ultra- drial permeability transition (26–28), an established pathome- structural derangement of myoﬁbres resulting in the focal loss chanism in muscle disease (29). Alternatively to IP3Rs, of mitochondria in either a single longitudinal central core or hyperactive RyR1 itself, even if almost exclusively localized to multiple smaller cores (multi-minicores) (6). Accordingly, a cen- 2þ the triads, may also be associated with mitochondrial Ca tral question of the pathophysiology of RyR1-related myopa- overload (30). thies is the identiﬁcation of pathways linking RyR1 mutations Here we have tested the hypothesis that IP3R-mediated mi- to mitochondrial dysfunction and loss. 2þ tochondrial Ca signalling and accompanying alterations of 2þ Given the central role of RyR1 in Ca -mediated excitation- mitochondrial gene expression patterns underlie the functional contraction (EC) coupling in skeletal muscle, signiﬁcant re- phenotype of core myopathies. In order to ﬁnd potential associ- search has focussed on the consequences of mutations on this ations between speciﬁc RyR1 mutations, gene expression pat- process. The emerging picture divides the functional outcome terns and signalling phenotypes, we have used patient biopsy into (i) defects in mechanical coupling in the triad structure material with a range of RyR1 mutations and mouse cellular 2þ and increased Ca leak through RyR1 channels, mostly and in vivo models with altered RyR1 expression and RyR1 characterizing dominant mutations, and (ii) loss of RyR1 func- mutations. Our ﬁndings reveal a complex relationship between tion, often associated with recessive mutations leading to re- loss of RyR1, increased IP3R-mediated cytoplasmic-nuclear and duced expression of RyR1 (7,8). Mapping of mutations on the 2þ mitochondrial Ca signalling, and altered mitochondrial gene complex structure of the RyR1 channel also revealed a charac- expression and function and indicates an adaptive phenotype, teristic pattern. Dominant (gain-of-function) mutations tend 2þ presumably driven by altered Ca signalling. to affect three domains: 1 (N-terminal), 2 (central) and 3 (C-ter- minal), and associated with CCD and/or the MHS and exer- tional rhabdomyolysis traits. On the other hand, recessive Results mutations are distributed along the whole length of the RyR1 Selected patient material sequence, leading to loss of function, reduced expression or truncated proteins, clinically often resulting in MmD (9). How In order to understand the consequences of RyR1 mutations in these heterogeneous mutations lead to this range, develop- primary patient-derived tissues and differentiated myotubes, ment and interconversion of pathologies is not known (10–12). we have selected biopsies collected from patients with CCD and As a direct consequence of RyR1 mutations on muscle ﬁbre MmD with RYR1 mutations established at the molecular level. 2þ Ca signalling, a wide range of effects have been described. For functional analysis on primary myotubes differentiated 2þ 2þ Increased Ca leak can lead to reduced SR Ca content or from patient-derived myoblasts, we have selected material from 2þ consequent increased cytoplasmic Ca levels. On the other two affected children and controls matched for age and gender: hand, reduced RyR1 function can also result in reduced cyto- (i) patient p7322 exhibiting CCD pathology due to a dominant 2þ 2þ plasmic Ca levels, making it difﬁcult to ﬁnd a common Ca mutation in the MH/CCD hotspot 3 (c.13724 A> C; p.N4575T) and signal-related pathomechanism that results in the develop- (ii) patient p3369 with MmD pathology with compound hetero- ment of cores. zygous mutations in regions outside of MH/CCD hotspots pre- Crucially, core formation has been linked to mitochondrial sumably resulting in truncated non-functional RyR1 protein dysfunction, and has been observed in both core myopathy pa- (c.A4711G/p.I1571Vþ c.9407delT/p.L3136Rfs). For gene expres- tient samples and experimental models of the disease (13–16). sion studies, in addition to these prototypic MmD and CCD However, whether mitochondrial dysfunction is primary to core patients, a further affected child and two adult CCD patients development or the consequence of the molecular derangement were used with dominant mutations in MH/CCD hotspots 1 and of the subtle molecular architecture of muscle ﬁbres still 3 (p4449: c.487C> T/p.R163C, adult; p2638: c.14693T> C/p.I4898T, remains unanswered. The relationship between mitochondrial child; and p7379: c.14510delA/p.Q4837RfsX3, adult). The local- 2þ dysfunction and altered Ca signalling in RyR1 mutant ization of the mutations and the summary of the patient mate- myoﬁbres can be envisaged in different ways. On the one hand, rial is shown in Figure 1, for clinical and pathological data, see it has been shown that increased IP3R expression occurs in Supplementary Material, Table S1. Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2369 Figure 1. Patient material used in the study. Positions (A) and characteristics (B) of RyR1 mutations detected in patients with CCD and MmD. Muscle biopsies for micro- array analysis were used from all patients, while primary myotubes were generated from two patient biopsies (shown in blue). (C) Representative histopathologic changes in speciﬁc RYR1-related myopathies included in the study. Wide-ﬁeld light microscopy images of cytochrome c oxidase staining are shown. In p3369, absolute prevalence of type 1 ﬁbres and areas of varying size devoid of oxidative enzyme stain; in the rest of the sections numerous cores of varying size and number are ob- served. In p7322 and p7379 cores are centrally, in p2638 peripherally and in p4449 both centrally and peripherally located. 2þ EGTA) (Fig. 2A–C) or in the presence of EC Ca (1 mM) IP3-mediated cytoplasmic, nuclear and mitochondrial 2þ (Supplementary Material, Fig. S1A and B) to discriminate be- Ca signalling is up-regulated in myotubes of patients 2þ 2þ tween Ca signals generated by SR Ca release and by the sum with RyR1 mutations 2þ of Ca inﬂux and SR release pathways, respectively. Since myo- 2þ 2þ tubes are not fully differentiated muscle ﬁbres, Ca inﬂux in- To characterize RyR1- and IP3R-mediated Ca ﬂuxes in patient cells carrying RyR1 mutations that underlie CCD and MmD pa- duced by CCh contributes signiﬁcantly to the response in the 2þ 2þ presence of EC Ca , similarly to the ATP-mediated response, thologies, we ﬁrst evaluated nuclear and cytosolic Ca signals in primary differentiated myotubes obtained from muscle which can be mediated not only by IP3-coupled P2Y but also by 2þ the ligand-activated P2X channels (19). Thus, in order to speciﬁ- biopsies. Cells were loaded with the Ca -sensitive ﬂuorescent 2þ 2þ ratiometric dye fura-2-AM. RyR1-mediated Ca signals were cally address Ca release from intracellular stores, we have pri- marily evaluated the contribution of RyR1 and IP3Rs in the induced by the nicotinic acetylcholine (ACh) receptor agonist 2þ carbachol (CCh, 0.5 lM) in the presence of the muscarinic ACh absence of EC Ca (Fig. 2). In myotubes derived from patients with MmD and with CCD, receptor blocker atropine (Atr, 10 lM) which activates the dihy- 2þ dropyridine receptor (DHPR, CaV1.1)-RyR1 axis. IP3R-mediated we found signiﬁcant down-regulation of CCh-induced SR Ca 2þ release in the cytosol which was reﬂected by a similar down- Ca release was triggered by the G-protein coupled receptor 2þ agonist ATP (100 lM). Myotubes were stimulated in the absence regulation when Ca signals were quantiﬁed over the nuclear 2þ regions of interest (ROIs) (Fig. 2A), indicating impaired RyR1 of extracellular (EC) Ca (medium supplemented with 200 lM Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2370 | Human Molecular Genetics, 2018, Vol. 27, No. 13 2þ Figure 2. Up-regulation of IP3R-mediated Ca signalling in CCD and MmD patient myotubes. Primary myotubes were generated from biopsies of CCD (p7322) and 2þ MmD (p3369) patients and age-matched controls (p7875, p6578, pooled data). Differentiated myotubes were loaded with the Ca -sensitive ratiometric dye fura-2 and ﬂuorescent intensity ratios (ex: 340/380 nm, em: 505 nm) were measured using a wide-ﬁeld ﬂuorescent imaging system (see Materials and Methods section). 2þ 2þ (A) Response to CCh (0.5 mM) in the presence of atropine (10 mM) in Ca -free EC medium (supplemented with 200 mM EGTA) shows Ca release mediated by RyR1. 2þ 2þ (B) Response to ATP (100 mM) in Ca -free EC medium (supplemented with 200 mM EGTA) shows Ca release mediated by IP3Rs. Representative traces of ratios mea- sured in cytosolic (left panels) and nuclear (middle panels) regions of interest, and statistics of quantiﬁed signals (peak—basal ratios, right panels, means6 S.E.M. of>20 cells from at least three separate experiments) are shown. Data were analysed using one-way ANOVA with Bonferoni post-hoc tests for multiple comparisons 2þ (*P < 0.05). (C) Quantiﬁcation of basal fura-2 ratios, representing basal [Ca ] in control and patient myotubes. (D) Western blot analysis of patient and control myotube protein extracts as described in the Materials and Methods section. Duplicates of 20 ug protein extracts are shown. (E) Quantiﬁcation of signals from western blot analysis. Signals from the IP3R and RyR1 bands were normalized to b-tubulin, means6 S.E.M. of>3 replicates are shown. Data were analysed using two-way ANOVA Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2371 2þ function. Basal cytosolic [Ca ], measured by basal fura-2 ratio Altogether we found that in mouse C2C12 myotubes, the values, also showed a small, but signiﬁcant decrease in cells loss of RyR1 following its knockdown with siRNA RYR1 led to 2þ from both patients (Fig. 2C). The reduction of RyR1-mediated signiﬁcantly enhanced IP3-mediated Ca release, in both the 2þ Ca release correlated with signiﬁcant decrease in RyR1 ex- cytosolic and nuclear compartments (see Fig. 3A and B), con- 2þ pression, quantiﬁed by western blotting of protein extracts from ﬁrming the role of RyR1 loss in the Ca signalling pattern ob- 2þ patient derived myotubes (Fig. 2D). While RyR1-mediated Ca served in patient myotubes. Moreover, quantiﬁcation of RyR1 signals were reduced in both the MmD and CCD patient myo- and IP3R protein expression levels by western blotting revealed tubes, interestingly, IP3-mediated responses showed an oppo- similar inverse correlation between siRNA-mediated down-reg- site trend. While no signiﬁcant alterations were observed in the ulation of RyR1 and increased IP3R protein expression levels 2þ overall cytosolic Ca signals induced by ATP, the myotubes (Fig. 3C), pointing to a conserved mechanism of gene regulation from the patient with MmD (p3369) showed signiﬁcantly in- patterns following RyR1 loss in mouse and human muscle and 2þ creased nuclear Ca signals compared to controls (Fig. 2B). The myotubes. Finally, in this model system, speciﬁc blockade of myotubes from the patient with CCD (p7322) also showed ele- IP3Rs using Xestospongin-B (XeB) (32), conﬁrmed that IP3Rs ex- 2þ 2þ 2þ vated nuclear Ca signals in the presence of EC Ca clusively contribute to ATP but not to CCh-mediated Ca sig- (Supplementary Material, Fig. S1B). To address the origin of the nals (Supplementary Material, Fig. S1G). 2þ reciprocal regulation of RyR1- and IP3R-mediated Ca signals, Consequently, the similar behaviour of the C2C12 mouse we quantiﬁed the expression of IP3Rs by western blotting using and patient-derived human myotube models allowed us to use a pan-IP3R antibody (Fig. 2D–F). Importantly, IP3R expression in- the mouse cell line to test the hypothesis that, following RyR1 2þ creased in negative correlation with reduction of RyR1 protein loss, the increased IP3-mediated Ca release is transferred to 2þ levels, showing the highest expression in the MmD (p3369) pa- mitochondria. In order to measure mitochondrial Ca in both 2þ tient muscle biopsy tissue. low and high [Ca ] ranges, we used two different recombinant 2þ 2þ To test whether increased IP3R-mediated Ca signalling ﬂuorescent Ca probes, speciﬁcally targeted to mitochondria, 2þ results in increased mitochondrial Ca uptake in myotubes 2mtGCaMP6m (see Fig. 2G and H), and Cepia3mt (33), which from the patient with MmD (p3369), we transfected cells with were suitable to measure the range of ATP- and CCh-induced 2þ 2þ 2mtGCaMP6m, a recombinant ﬂuorescent Ca probe speciﬁ- mitochondrial Ca signals, respectively. Responses from myo- 2þ cally targeted to mitochondria (31). The high dynamic range of tubes stimulated in the absence of EC Ca (medium supple- this ratiometric probe allows the measurement of both basal mented with 200 lM EGTA) are shown in Figure 3D and E, while 2þ 2þ and stimulated Ca levels in the mitochondrial compartment. responses in the presence of EC Ca are shown in As shown in Figure 2G, p3369 patient myotubes had signiﬁ- Supplementary Material, Figure S1E and F. Overall, mitochon- 2þ 2þ cantly increased basal mitochondrial [Ca ], indicating en- drial Ca uptake followed the changes seen in nuclear and cy- 2þ 2þ hanced Ca transfer into the organelle. Moreover, enhanced tosolic Ca signals. In RYR1 siRNA-transfected mouse 2þ 2þ 2þ Ca transfer was due to IP3R-mediated Ca release, since myotubes, ATP-induced, IP3R-mediated mitochondrial Ca up- stimulation of the p3369 patient myotubes with CCh resulted in take was signiﬁcantly increased compared with control cells, 2þ signiﬁcantly reduced mitochondrial Ca transients as com- while the RyR1-mediated, CCh-induced signals were signiﬁ- pared with controls, but ATP stimulation led to signiﬁcantly in- cantly reduced (Fig. 3D). Importantly, the IP3R-mediated mito- 2þ 2þ creased mitochondrial Ca uptake (Fig. 2H). chondrial Ca uptake increased more than twofold, while 2þ 2þ These results suggest that remodelling of Ca signalling in RyR1-mediated mitochondrial Ca signals were reduced only patient-derived myotubes involves up-regulation of IP3Rs in re- by 10%, indicating a stronger coupling of mitochondria to sponse to loss of RyR1, which drives increased IP3-mediated sig- IP3Rs in this cellular model. The coupling to the increased levels 2þ nalling in both the nuclear compartment and mitochondria. of IP3Rs led also to an increase in basal mitochondrial [Ca ], 2þ conﬁrmed using both mitochondria-targeted recombinant Ca probes (Fig. 3E). Altogether, these results demonstrated large- RyR1 knock-down in C2C12 mouse myotubes mimics scale remodelling of global and compartmentalized cellular 2þ 2þ remodelling of Ca signalling in patient myotubes and Ca signalling following loss of RyR1, which thus can be a com- 2þ increases IP3-mediated mitochondrial Ca uptake mon phenotype linking recessive MmD and a subset of domi- nant mutations associated with CCD patients. Since we have observed loss of RyR1 in both MmD and CCD patient-derived myotubes, in order to directly address the role of 2þ RyR1 in remodelling myotube Ca signalling, we used the C2C12 2þ Bioenergetic consequences of altered Ca signalling in mouse myotube model where RyR1 levels were directly reduced myotubes with loss of RyR1 using siRNA mediated silencing. Following RyR1 knock-down after 2þ transfection with RYR1 siRNA, RyR1- and IP3R-mediated Ca In order to understand the functional consequences of the 2þ signals were measured using the protocols described above for remodelled compartmental Ca signalling in RyR1-deﬁcient patient myotubes. Results from myotubes stimulated in the human and mouse models, we evaluated mitochondrial func- 2þ absence of EC Ca (medium supplemented with 200 lMEGTA) are tion and gene expression. First, since material available 2þ shown in Figure 3A and B, while results in the presence of EC Ca from patient biopsies was insufﬁcient to carry out measure- are shown in Supplementary Material, Figure S1C–G. ments of oxygen consumption measurements, we used live cell with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). (F) Correlation plot of RyR1 and IP3R intensities from the same samples. (G, H) For analysis of 2þ 2þ mitochondrial Ca signals, myotubes were infected with the adenoviral recombinant mitochondria-targeted Ca probe 4mtGCaMP6 expression construct, and ratios (ex: 475/410, em: 520 nm) were imaged as described in the Materials and Methods section. (G) shows basal ratios in controls and the p3369 MmD patient. (H) Response 2þ 2þ to CCh (0.5 mM) in the presence of atropine (10 mM) in Ca -free EC medium (supplemented with 200 mM EGTA) shows Ca release mediated by RyR1 (left panel) and 2þ response to ATP (100 mM) in shows Ca release mediated by IP3Rs (middle panel). Quantiﬁed peak-basal values are shown in the right panel. Data were analysed using two-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2372 | Human Molecular Genetics, 2018, Vol. 27, No. 13 2þ Figure 3. RyR1 silencing in C2C12 mouse myotubes stimulates IP3R-mediated Ca signals in the cytosol, nucleus and mitochondria. Myotubes were differentiated from C2C12 cells transfected with scrambled (siRNA scr) or RyR1-speciﬁc (siRNA RYR1) siRNAs, or left untransfected. Differentiated myotubes were loaded with the 2þ Ca -sensitive ratiometric dye fura-2 and ﬂuorescent intesity ratios (ex: 340/380 nm, em: 505 nm) were measured using a wide-ﬁeld ﬂuorescent imaging system (see 2þ Materials and Methods section). (A) Response to CCh (0.5 mM) in the presence of atropine (10 mM) in Ca -free EC medium (supplemented with 200 mM EGTA) shows Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2373 confocal imaging to measure mitochondrial membrane poten- suggesting that a shared feature, such as the loss of RyR1 is the tial (Dw ) in the CCD and MmD patient-derived myotube mod- underlying cause. els. For these measurements, we used the membrane To verify that increased oxidative phosphorylation follow- permeable cationic dye tetramethyl rhodamine methyl-ester at ing RyR1 loss is a result of IP3R-mediated stimulation of respi- low concentration (TMRM, 5 nM), and quantiﬁed average inten- ratory chain activity, we measured oxygen consumption rate sities in two distinct subcellular mitochondrial populations, in (OCR) in C2C12 mouse myotubes using the Seahorse technol- the perinuclear and sub-plasmalemmal (SP) regions, since in ogy. We have compared OCR in control and RyR1 siRNA-trans- differentiated myoﬁbres the proteomic composition and func- fected myotubes in the absence or presence of XeB, a speciﬁc 2þ tion of SP mitochondria differs from the interﬁbrillar population inhibitor of IP3R-mediated Ca release. As shown in Figure 4D (24). In addition to quantifying steady-state TMRM intensities, and E, silencing of RyR1 led to signiﬁcantly increased basal res- which reﬂect steady state Dw , to evaluate the contribution of piration, which was prevented by treating cells with XeB. the electron transport chain and the forward and reverse mode Increased respiration was speciﬁc differentiated myotubes of the F F -ATPase in generating and maintaining Dw , we per- (Fig. 4F), and was not due to uncoupling (Fig. 4G). No signiﬁcant 1 o m formed time-lapse measurement of single cells following the changes in ECAR were observed. These data demonstrated that 2þ addition of oligomycin and rotenone to inhibit the F F -ATPase the up-regulation of IP3R-mediated Ca release following the 1 o and respiratory complex I, respectively. In addition, in order to loss of RyR1 protein results in enhanced mitochondrial 2þ evaluate the effect of Ca load on Dw , we have performed bioenergetics. these experiments in both resting conditions and following stimulation of myotubes with elevated EC [K ], which by 2þ Consequences of altered Ca signalling on depolarizing the plasmamembrane, activates the EC coupling 2þ 2þ mitochondrial and Ca homeostasis-related gene mechanism to release SR Ca via RyR1 receptors. Figure 4A expression shows representative images of TMRM-loaded control and CCD/ MmD patient-derived myotubes. Measurement of average Increased mitochondrial oxidative function can be associated 2þ TMRM intensities showed reduced steady-state Dw in both pa- with enhanced IP3R-mediated Ca signalling in at least two dif- 2þ tient groups, which difference, however, was almost completely ferent ways. Direct IP3R-mediated Ca transfer to mitochondria abolished in the MmD patient (p3369) following K stimulation has been previously shown to contribute to maintenance and ac- (Fig. 4B). Lower steady-state Dw might indicate decreased re- m tivation of the TCA cycle, respiratory activity and ATP production spiratory chain activity or increased dissipation of the H gradi- under both basal and stress conditions (34,35). Given the results 2þ ent through the F F -ATPase or uncoupling related to 1 o shown in the sections on Ca signalling (see Figs 2 and 3), this mitochondrial damage. To differentiate between these possibili- mechanism certainly plays an important role in the bioenergetic ties we used the above described time-lapse protocol (Fig. 4C). changes observed here. However, in both patient and mouse 2þ Interestingly, unstimulated control myotubes showed slow loss myotubes we found speciﬁc up-regulation of nuclear Ca sig- 2þ of potential following inhibition of the F F -ATPase by oligomy- 1 o nals, which suggests that Ca -mediated changes in gene expres- cin, indicating that glycolytic ATP was used to maintain Dw in sion proﬁles might also take place. To address this hypothesis, these cells. However, oligomycin treatment caused a small but we have applied two different approaches. First, we used immu- signiﬁcant hyperpolarization of the mitochondria in patient noblots to assess the expression of respiratory chain components cells, indicating an intact respiratory chain and use of the F F - 1 o using the MitoProﬁle antibody set detecting single subunits of ATPase in the forward mode, producing mitochondrial ATP. each complex, as well as PGC-1a, the best known nuclear co- These differences between control and patient myotubes were regulator controlling mitochondrial biogenesis by co-activating a more pronounced in the SP population of mitochondria, but be- large set of nuclear-encoded mitochondrial genes (36,37). came clear following K stimulation also in the perinuclear re- Importantly, we found signiﬁcant up-regulation of respiratory gion. Similar results were obtained in the CCD (p7322) patient complex subunits in the CCD (p7322) patient myotubes (com- myotubes (data not shown). Altogether these data indicate that plexes II–III), along with signiﬁcant increase in PGC-1a content, the rate of mitochondrial ATP synthesis is higher and make a and we have observed a similar trend in the MmD (p3369) patient greater contribution to cellular ATP demand in patient myo- cells, where the F F -ATPase a subunit was strongly induced 1 o tubes. Importantly, no differences between the recessive MmD (Fig. 5A and B). These results indicated activation of mitochon- and dominant CCD patient-derived myotubes were observed, drial biogenesis in both patient myotubes. Similarly, respiratory 2þ 2þ 2þ Ca release mediated by RyR1. (B) Response to ATP (100 mM) in Ca -free EC medium (supplemented with 200 mM EGTA) shows Ca release mediated by IP3Rs. Representative traces of ratios measured in cytosolic (left panels) and nuclear (middle panels) regions of interest, and statistics of quantiﬁed signals (peak—basal ra- tios, right panels, means6 S.E.M. of>20 cells from at least three separate experiments, are shown. Data were analysed using one-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P< 0.05). (C) Western blot analysis of protein extracts from siRNA scr and siRNA RYR1-transfected cells. About 20 ug protein extracts were analysed as described in the Materials and Methods section (left panel). Quantiﬁcation of signals from western blot analysis is shown in the middle panel. Signals from the IP3R and RyR1 bands were normalized to b-tubulin, means6 S.E.M. of>3 replicates are shown. Data were analysed using two-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). Correlation plot of RyR1 and IP3R intensities from the same samples is shown on the right panel. (D) For analysis of 2þ 2þ mitochondrial Ca signals, C2C12 cells were co-transfected with siRNA scr or RyR1 and the recombinant mitochondria-targeted Ca probes 4mtGCaMP6 or Cepia3mt, and ratios (excitation 475/410, emission 520 nm) were imaged as described in the Materials and Methods section. Response to CCh (0.5 mM) in the presence of atropine 2þ 2þ (10 mM) in Ca -free EC medium (supplemented with 200 mM EGTA) shows Ca release mediated by RyR1 (left panel, Cepia3mt probe) and response to ATP (100 mM) in 2þ 2þ Ca -free EC medium (supplemented with 200 mM EGTA) shows Ca release mediated by IP3Rs (middle panel, 4mtGCaMP6 probe). Statistics of quantiﬁed signals (peak—basal ratios, right panels, means6 S.E.M. of>20 cells from at least three separate experiments) are shown on the right panel. Data were analysed using one- way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). (E) Quantiﬁcation of basal ratios of 4mtGCaMP6 or Cepia3mt, representing basal 2þ mitochondrial [Ca ] in siRNA scr and RYR1-transfected myotubes. Data were analysed using one-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2374 | Human Molecular Genetics, 2018, Vol. 27, No. 13 Figure 4. Mitochondrial bioenergetics in CCD and MmD patient derived and in C2C12 myotubes following RYR1 silencing. Primary myotubes, generated from biopsies of CCD (p7322) and MmD (p3369) patients and age-matched controls (p7875, p6578, pooled data) were imaged in the presence of 4 nM TMRM and 0.8 mM cyclosporin-H, þ þ þ following 30 min incubation to reach steady-state distribution of the dye. Cells were pre-incubated and imaged in control ([Na ] ¼ 140 mM) or K containing ([Na ] ¼ 70 mM, [K ] ¼ 70 mM) depolarizing recording medium, using a confocal system (ex: 535 nm, em: >560 nm) as described in the Materials and Methods section. (A) Representative images of control and patient cells, showing examples of perinuclear (PN) and SP regions of interests where average TMRM intensities were quanti- ﬁed. (B) Steady-state TMRM intensities in p3369 MmD (upper panel) and p7322 CCD (lower panel) patient myotubes. Means6 S.E.M. of>20 cells from at least three separate experiments are shown. (C) Sensitivity of mitochondrial membrane potential to inhibition of the F F ATP synthase with oligomycin (10 mM) and complex I of 1 o the respiratory chain with rotenone (2 mM) was measured in time-lapse imaging of TMRM-loaded cells as in (A). Values from PN and SP regions of interests were nor- malized to the average of the initial 5 time points. Means6 S.E.M. of>20 cells from at least three separate experiments are shown under control (Na , upper panels) and K stimulated (lower panels) conditions. Data were analysed using one-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). (D–G) OCR was measured in C2C12 mouse myoblasts (F) and differentiated myotubes (D, E, G) in a Seahorse XF-24 EC ﬂux analyser. Cells were transfected with siRNA scr or RYR1, and treated with XeB (2 lM) 30 min prior to measurements. (D) Basal OCR (pMoles/min/20 K seeded cells) were recorded followed by injection of 2 lM oligomycin to measure coupled respiration, 0.8 lM FCCP to induce maximal oxygen consumption. Rotenone and antimycin A (1 lM each) were injected to assess non-mitochondrial OCR at the end of the experiment. Data are normalized to these values in each run. (E) Quantiﬁcation of basal respiration. (F) As controls, non-differentiated myoblasts were treated and measured in the same way. Values were corrected to non-mitochondrial respiration, i.e. by subtracting OCR values after rotenone/antimycin-A addition. (G) Coupling ratios of respiration in myotubes, calculated as the ratio of basal and oligomycin-treated OCR. Data were analysed using one-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2375 Figure 5. Increased mitochondrial biogenesis in CCD and MmD patient myotubes. Western blot analysis of subunits of respiratory chain complexes I–IV and the F F 1 o ATP synthase (A) and PGC-1A (B) from differentiated human patient myotubes or C2C12 mouse myotubes following transfection with siRNA scr or siRNA RYR1 (C). About 20 ug protein extracts from differentiated myotubes were immunoblotted as described in the Materials and Methods section (left panel). Quantiﬁcation of signals from western blot analysis are shown on the right panels. Signals from the respective bands were normalized to b-tubulin, means6 S.E.M. of>3 replicates are shown. Data were analysed using two-way ANOVA with Bonferoni post-hoc test. Asterisks denote signiﬁcane between control and patient (A, B) or siRNA scr and siRNA RYR1- transfected cells (*P < 0.05, **P < 0.01, ***P < 0.001). subunits were signiﬁcantly up-regulated in C2C12 mouse myo- the male child MmD (p3369) patient, we found 690 transcripts tubes following silencing of RyR1 expression (Fig. 5C), indicating which were differentially regulated (277 up, 413 down), while in that loss of RyR1 results in increased mitochondrial biogenesis, the CCD female child (p7322 and p2638) patients 883 transcripts underlying improved oxidative phosphorylation (see Fig. 4). (504 up, 379 down) and in the CCD female adult (p4449 and In order to verify and expand these ﬁndings in muscle tissue p7379) patients 54 transcripts (23 up, 31 down) were signiﬁ- of human patient biopsies and in a mouse model of CCD/MmD, cantly altered, indicating a large-scale remodelling of gene ex- we performed microarray analysis. To represent patients at dif- pression, in particular at a young age (see the full list of the ferent ages and gender, we separately compared the transcrip- differentially regulated genes in Supplementary Material, Data tomes of male child (MmD, p3369), female child (CCDs, p7322 Set S1). Gene ontology analysis identiﬁed metabolism (in partic- and p2638) and adult female (CCDs, p4449 and p7379) patient bi- ular amino acid metabolism and oxidoreductase activity), oxy- opsies to age- and sex-matched controls (p7875, p6578 and gen transport and regulation of programmed cell death as key p8463, respectively). First, we identiﬁed differentially expressed up-regulated biological processes, while glycolysis and myoﬁbril gene sets (see Materials and Methods and Supplementary assembly pathways were down-regulated. Importantly, signiﬁ- Material sections), which were further analysed for enrichments cant enrichment of genes in the mitochondrial, SR and cytosolic of speciﬁc cellular compartments and biological function (by compartments were equally present. Interestingly, remarkably gene ontology analysis using gProﬁler (38) and for the presence less variations in gene expression and associated signiﬁcant 2þ of transcripts representing genes of Ca signalling (http:// gene ontology terms were found in adult patient samples. www.ebi.ac.uk/QuickGO/term/GO: 0006874; date last accessed Details of the gene ontology analysis are shown in May 2, 2018) or mitochondrial pathways [MitoCarta 2.0 (39)]. In Supplementary Material, Data Set S2. No alterations in IP3R and Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2376 | Human Molecular Genetics, 2018, Vol. 27, No. 13 RYR1 gene transcripts were found in the patients indicating degradation (ERAD) system has been recently established (40), that RyR1 loss and the parallel increase in IP3Rs is the result of and down-regulation of this pathways might provide explana- post-transcriptional mechanisms, most likely alterations of pro- tion for increased IP3R levels following loss of RyR1 function. tein stability and degradation (40). However, highly signiﬁcant Indeed, we have observed signiﬁcant down-regulation of sev- 2þ alterations of other Ca signaling-related genes were found eral ubiquitin E3 ligases in human muscle samples and the (Fig. 6A), including almost complete down-regulation of ATP2A1 overall ubiquitin-dependent protein catabolic process term (GO: 2þ I4859T/wt (SR Ca -ATPase 1, SERCA1), the SERCA isoform speciﬁc for fast 0006511) in the RyR mouse model (Supplementary ﬁbres (21), most likely reﬂecting type 1 (slow) ﬁbre predomi- Material, Data Set S3). 2þ nance (11). Importantly, components of the mitochondrial Ca Previously, one study by Zhou et al. (17) has shown up-regu- 2þ uniporter (MCU and MCUR1), mediating Ca uptake in the or- lation of IP3Rs both at the transcriptional and proteins levels in ganelle, were up-regulated in both MmD (p3369) and CCD (p7322 patient-derived myotubes with recessive RyR1 mutations. Here, 2þ and p2638) patients. Induction of mitochondrial Ca transport using microarrays from muscle biopsies we could not detect proteins was accompanied by an overall increase in nuclear- alterations of any of the ITPR1–3 genes, probably due to the low encoded mitochondrial genes, as shown by the analysis of sig- sensitivity of the method, compared with the quantitative PCR niﬁcantly altered genes intersecting with the human MitoCarta approach used in the previous study. Alternatively, up-regula- 2.0 list (Fig. 6B). The majority of these genes showed more than tion of IP3Rs might be present only in in vitro differentiated twofold increase in transcript abundance (Fig. 6C), and were myotubes, which might represent an early stage of muscle ﬁbre enriched in genes coding for components of the respiratory chain development. Importantly however, from functional point of in both the MmD and CCD child patient cohorts (p3369, p7322 and view, here we demonstrated the ﬁrst time that increased IP3R 2þ p2638, Fig. 6D). To test whether the elevated mitochondrial pro- levels lead to elevated IP3-mediated Ca signalling in both hu- tein expression levels reﬂect increased mitochondrial content, we man and mouse myotubes, which affects the mitochondrial have assessed the relative mitochondrial DNA (mtDNA) content and nuclear compartments. in patient biopsies. As shown in Figure 6E,boththe MmDand Although the general trend in all the models studied was up- 2þ CCD child patient cohorts (p3369, p7322 and p2638) also showed regulation of IP3R-mediated Ca signalling, the compartment elevated mtDNA copy number, conﬁrming that mitochondrial speciﬁcity varied between different mutations and the C2C12 biogenesis I increased in the early stages of the disease. mouse myoblast models (see Figs 2 and 3) Moreover, when we 2þ 2þ In order to evaluate the hypothesis that gene expression measured Ca signals in the presence of EC Ca , i.e. when ei- 2þ changes are induced by RyR1 mutations, we performed microar- ther ATP- or CCh-induced Ca inﬂux was allowed in the sys- ray analysis in an established mouse model of RYR1-linked core tem, the overall picture was more complex. In the patient cells, 2þ myopathies, carrying the I4859T mutation in the RyR1 gene (16). we observed signiﬁcant down-regulation of CCh-induced Ca We used muscle tissue extracts from two types of muscles of signals in the cytosol of both patients and signiﬁcant reduction I4859T/wt 2þ the heterozygous RyR mice with high and low mitochon- of nuclear Ca signals in myotubes from patient p3369 but not drial content (m. soleus, type 1 and m. extensor digitorum longus, from patient p7322. On the other hand, we noted a signiﬁcant 2þ EDL, type 2A/2X, respectively). Similarly to the human core my- up-regulation of ATP-induced nuclear Ca signals in patient opathy patient biopsies, we found alterations in a large gene set p7322, an effect which was missing in patient p3369, while cyto- 2þ in both muscle types (soleus: 1039 transcripts differentially reg- solic Ca was not affected in any patients (see Supplementary ulated, 579 up, 460 down; EDL: 974 transcripts differentially reg- Material, Fig. S1). However, a more homogenous up-regulation ulated, 502 up, 471 down, Supplementary Material, Data Set S1), in all compartments was observed in C2C12 myotubes following 2þ which had a marked intersection with mouse MitoCarta gene RYR1 silencing. These differences in the remodelling of Ca sig- set (Supplementary Material, Fig. S2A). Moreover, these nuclear- nals might reﬂect different levels of the loss of RyR1 protein and encoded mitochondrial gene transcripts also showed overall function, as well as the different distribution of IP3R expression 2þ up-regulation with enrichment of respiratory chain compo- in the various cellular models. Whether remodelling of Ca sig- nents (Supplementary Material, Fig. S1B and C). nalling pathways in fully differentiated myoﬁbres have similar Altogether these results show that RyR1 dysfunction, silenc- pattern, remains to be determined. ing or loss, apart from direct consequences of RyR1-mediated Apart from demonstrating the functional role of IP3Rs in 2þ 2þ Ca signalling, leads to large-scale rearrangement of muscle remodelling compartmentalized Ca signalling and increased 2þ 2þ gene expression, which involves both Ca signalling and mito- mitochondrial Ca uptake, our study provides the ﬁrst evi- chondrial biogenesis pathways in human and murine samples. dence for altered mitochondrial gene expression and function Further analysis of promoters of de-regulated genes also indi- as the consequence of RyR1 mutations associated with loss of 2þ cated a set of key transcription factors (TFs) responsible for the the Ca release channel. Mitochondrial damage due to domi- altered gene expression proﬁle in human patients and animal nant RyR1 mutations (41), disruption of mitochondrial distribu- models of RyR1-related core myopathies (see Supplementary tion (13) has been previously shown in mouse models, zebraﬁsh Material, Data Set S3). (15) and well documented in human muscle biopsies (6,5,11,42), but whether these alterations are the primary cause of core de- velopment and muscle pathology is not known. While direct Discussion 2þ damage of mitochondria due to excess Ca leak has been previ- The RyR1 mutations analysed in this study were associated ously proposed (30), our results indicate a different role for IP3R- 2þ 2þ with loss of expression and function of the SR Ca release mediated Ca signals. Up-regulation of IP3R and concomitant 2þ channel. We have shown that loss of RyR1 leads to signiﬁcant increase in mitochondrial Ca load appear to increase the met- 2þ remodelling of skeletal muscle Ca signalling, driven by up- abolic competence of mitochondria in the myotube models of regulation of the IP3R at post-translational level and a set of both CCD and MmD patients. Of note, muscle biopsies also 2þ 2þ Ca homeostasis-related proteins at the transcriptional level in showed up-regulation of members of the mitochondrial Ca both human and mouse myotubes. Dynamic regulation of IP3R uptake machinery (MCU, MCUR1), indicating that increased mi- 2þ levels by ubiquitination and degradation by the ER-associated tochondrial Ca uptake might also happen in vivo, as part of Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2377 2þ Figure 6. Transcriptome analysis of patient biopsies reveal remodelling of gene expression in Ca signalling pathways and mitochondria. Total RNA extracts from male child (MmD, p3369), female child (CCDs, p7322 and p2638) and adult female (CCDs, p4449 and p7379) patient biopsies and age and sex-matched controls (p7875, 2þ p6578 and p8463, respectively), were used for microarray analysis as described in the Materials and Methods section. (A) Differentially expressed genes related to Ca signalling pathways (GO: 0006874) identiﬁed by gene ontology analysis. Log 2 values of gene expression differences between p3369 MmD (left panel) and p7322 CCD (right panel) and respective controls are plotted. Consensus gene names are listed at the left. (B) Genes with signiﬁcantly altered expression are shown in Venn dia- grams in the human dataset. Overlaps between patients and with mitochondrial genes listed in the MitoCarta 2.0 database are shown. All differentially expressed genes and the Venn diagram intersections are listed in Supplementary Material, Data Set S1. (C) Differential expression values of mitochondrial genes in human patients. Log 2 values of up-regulated genes are shown in red, down-regulated genes are in green. (D) Differentially expressed mitochondrial genes coding for proteins of the respiratory chain and energy metabolism in human patient transcriptomes. Log 2 values of gene expression differences between p3369 MmD (left panel) and p7322 CCD (right panel) and respective controls are plotted. (E) Relative mtDNA copy number data from biopsies of all patients and age/sex-matched controls. Means 6 S.E.M. of three replicates are shown. Data were analysed using two-way ANOVA with Bonferoni post-hoc tests for multiple comparisons (*P < 0.05). Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2378 | Human Molecular Genetics, 2018, Vol. 27, No. 13 the pathological process in core myopathies. However, whether transfection, the medium was replaced with DMEM supple- the localization of IP3Rs (25) and the (43) with respect to mito- mented with 10% FBS; 12 h later the medium was replaced with chondria in fully differentiated muscle ﬁbres would allow this differentiation medium. Transfection efﬁciencies were tested by direct activation of mitochondrial metabolism remains to be co-transfecting cells with GFP, and were typically> 80%. 2þ shown. The direct, Ca -mediated activation of mitochondria in Myoblasts differentiate in mature myotubes after 5 days in differ- our models is also accompanied by increased mitochondrial entiation medium. Cell passage numbers were all less than 15. biogenesis. Although no apparent adaptive proliferation of mi- tochondria has been previously described in CCD and MmD, se- Patient samples lective up-regulation of genes involved in the respiratory chain 2þ and energy production by activation of Ca -dependent TFs or Patient’s samples were selected by screening archived muscle epigenetic changes (8) might provide adaptation to the overall biopsies hosted at the Neuromuscular Bank of Tissues and DNA loss of mitochondria in the core areas. samples of the University of Padova. Selection criteria were his- Our patient material comprised autosomal dominant cases, topathological diagnosis of core myopathy, characterized RYR1 such as p4449/p7379, cases with dominant de novo mutations gene mutations, the availability of clinical data and availability (p7322/p2638) and the autosomal recessive case p3369. The lat- of cultured myoblast cell lines. Muscle biopsies were obtained ter resulted in MmD while all other cases in CCD. Importantly, at the time of diagnosis after signing of an informed consent. in both functionally studied cases (p3369/p7322) mutations led The study was carried out in accordance with the ethical rules to loss of RyR1, which thus can accompany both AD- and AR- and guidelines issued by the Ethical committee of the partici- inherited disease, and both MMD and CCD histology. Moreover, pating centres and with the declaration of Helsinki. Five biop- since our study was limited to cases where RyR1 loss of protein sies were selected for the study. and function dominated the pathomechanism, and thus partial silencing of the mouse RyR1 in C2C12 myotubes provided an ap- 2þ propriate model to study compartmentalized Ca signalling. Mouse model Interestingly, results from microarray studies of the AD patients RyR1 I4895T knock-in mice on a 129S2/SvPasCrl background were showed partial overlap with the AR case, indicating that the ob- kindly provided by the S. Hamilton laboratory, Texas, USA. These served mitochondrial phenotype is independent of the mode of founder mice were rederived using C57BL/6J for breeding. This inheritance. However, the consequences of mutations on RyR1 resulted in a new sub-line with a mixed genetic background (ap- expression and function vary wildly in speciﬁc cases (10,17), proximately 50% 129S2/SvPasCrl and 50% C57BL/6J after rederiva- 2þ thus whether IP3R-mediated Ca signals operate as an overall tion). Since homozygotes have a perinatal lethal phenotype (44), adaptive mechanism in core myopathies remains to be studied. heterozygotes (HET) were crossed with wild-type (WT) littermates However, our study corroborated previous results showing neg- 2þ or C57BL/6J mice (Charles River) to maintain the colony. At least ative correlation between the two main SR Ca release chan- ﬁve such crosses had occurred before the experiments. Ear snips nels, RyR1 and the IP3R. Moreover, by rendering an overall from adult mice and tail snips from sacriﬁced neonates were adaptive function most likely for the up-regulation of IP3Rs, the 2þ retained for genotyping. DNA was extracted from tissue samples hypothesis of IP3-mediated Ca overload as a ruling pathome- using the Extract-N-Amp kit (Sigma) and PCR was used to amplify chanism in RyR1-related myopathies is implausible. the fragment covering the mutation site. Forward and reverse pri- 0 0 mers were 5 -GGTCTTCCTGTCTCAATAACCCGATCTAGAAAC-3 0 0 and 5 -GATGGAGAAACCAAAGCTCAGAGAGACCAC-3,respec- Materials and Methods tively. Since the inserted mutation site also contains an Age I tar- Cell culture and transfection get sequence, only samples containing the mutated allele undergo Age I digestion. Primary cultures of myoblasts from human quadriceps biopsies were obtained after collagenase A (Roche) digestion in 1% gelatin pre-coated dishes. Human myoblasts were grown in 2þ Ca imaging HAMF12 w/o glutamine medium (Euroclone), supplemented with 20% heat inactivated fetal bovine serum (FBS, Invitrogen), Cells for imaging were seeded on 1% gelatin pre-coated 24 mm coverslips placed in six-well plates. Human-derived primary 100 mg/ml penicillin and streptomycin, 25 ng/ml ﬁbroblast growth factor 2 (FGF2) (lowered to 5 nM for cell maintenance af- myoblasts were plated at a concentration of 2 10 while C2C12 myoblasts were plated at a concentration of 1, 5 10 . To mea- ter second cell passage). Cells were incubated at 37 C under 5% 2þ CO and passaged 1: 5 or 1: 10 at 70% conﬂuence. Myoblasts sure cytosolic and nuclear Ca dynamics, differentiated cells were loaded with 2 mM Fura-2/AM (Life Technologies) for 20 min were differentiated into myotubes at 80% conﬂuence in a me- dium containing Dulbecco’s modiﬁed Eagle medium (DMEM, at 37 in modiﬁed Krebs-Ringer buffer (KRB) (135 mM NaCl, 5 mM KCl, 1 mM MgCl ,20mM HEPES,1mM MgSO , 0.4 mM KH PO ,1 Invitrogen) supplemented with 2% horse serum (HS, Invitrogen), 2 4 2 4 100 mg/ml penicillin and streptomycin, 30 mg/ml insulin; mM CaCl , 5.5 mM glucose, pH 7.4). Images were acquired at 1/s (with exposure time set to 400 ms for all experiments) using alter- myoblasts differentiate into mature myotubes after 5 days in dif- ferentiation medium. nate excitation at 380 and 340 nm and collecting emitted light 2þ with a 505/20 emission ﬁlter. To measure mitochondrial [Ca ]in C2C12 mouse myoblasts were grown in DMEM (Invitrogen), supplemented with 10% heat inactivated FBS (Invitrogen), C2C12 myotubes we co-transfected myoblast with 3 mM of the mi- tochondrial targeted probes 2mtGCaMP6m or Cepia3mt and 1 mM 100 mg/ml penicillin and streptomycin. Cells were cultured and myoblasts were differentiated using the same protocol as for hu- siRNA-RYR1 (with exposure time set to 200 ms for all experi- ments). Images acquisition rate was 1/s. Images were generated man cells. Transfection of C2C12 myoblasts with siRNAs or with cDNAs was carried out with Lipofectamine 2000 (Invitrogen) using a 475–415 excitation ﬁlter with exposure time set to 200 ms for 475 nm and 100 ms for 415 nm, emitted light was collected according to the manufacturer’s instructions. After 6 h of Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2379 was collected through a 515/30 nm band-pass ﬁlter (Semrock). respectively) for 1 h at RT. Proteins were visualized by the 2þ To measure mitochondrial Ca levels in patient-derived differ- chemiluminescent reagent ‘super signal west pico chemiolumi- entiated myotubes we infected cells with an adenoviral nescent substrate’ (Thermo, 34080). Densitometric analyses 2mtGCaMP6m construct (1 ug/well in six-well plates) by adding were performed by using ImageJ analysis software. We analysed the virus directly to the culture medium 36 h before performing by means of densitometric measurements of at least three inde- the experiments. Imaging was performed using an Zeiss Axiovert pendent experiments, normalized to b-tubulin. 200 microscope equipped with a 63/1.4 N.A. Plan Apochromat objective. Excitation was performed with a DeltaRAM V high- Mitochondrial membrane potential measurements speed monochromator (Photon Technology International) equipped with a 75 W xenon arc lamp. Images were captured Human myoblasts were seeded at a density of 1.8 10 on 1% gel- with a high-sensitivity Evolve 512 Delta EMCCD (Photometrics). atin pre-coated 24 mm coverslips.After 5daysindifferentiation The system was controlled by MetaMorph 7.5 (Molecular Devices) medium, mitochondrial membrane potential (Dw ) was measured and was assembled by Crisel Instruments. by confocal imaging. Cells were loaded with 4 nM tetramethyl- rhodamine-methyl-ester (TMRM, Life Technologies) for 30 min at 37 C in KRB (supplemented with 2 mM CaCl )tomeasure Dw at 2 m 2þ [Ca ] measurements with aequorin resting conditions (steady state) or loaded in a modiﬁed KRB with C2C12 myoblasts were seeded on 1% gelatin pre-coated 13 mm [NaCl] lowered to 70 mM and supplemented with 2 mM CaCl and 70 mM KCl. About 0.8 lM cyclosporine-H was also used in coverslips placed in 24-well plates plated at a concentration of 4 10 . 4 days after addition of differentiation medium, cells these experiments to reduce active TMRM extrusion. Z-stack were infected with 1 mM adenoviral cytosolic-targeted aequorin images were acquired with a Leica Confocal SP5 microscope using (cytAEQ). The following day (5th day in differentiation medium) a100 immersion oil objective (Zeiss). TMRM was excited at coverslips with infected cells were incubated with 2 lMcoelen- 535 nm and emission was measured with a 560 nm LP ﬁlter. Eight terazine for 2 h in KRB supplemented with 1 mM CaCl , and then bit images were taken every 20 s for 4 min with a ﬁxed 1 s transferred to the perfusion chamber. All luminometer measure- exposure time; laser power was set to 8%. Pinhole was set to ments were carried out in KRB and agonists were added to the 1.5 airy units and pixel size was set as 1024 1024 nm. ImageJ same medium. Experiments were terminated by lysing the cells was used to quantify TMRM intensity on background-corrected 2þ with 100 lM digitonin in a hypotonic high [Ca ] solution (10 mM images applying a constant threshold and quantifying the ﬂuores- cence intensity mean values in selected region of interests CaCl in water), to discharge the remaining aequorin pool. The 2þ light signal was collected and calibrated into [Ca ]values byan (see Fig. 5A). 2þ algorithm based on the Ca response curve of aequorin at physi- 2þ ological conditions of pH, [Mg ]and ionicstrength(45). Oxygen consumption rate (OCR) measurements in C2C12 mouse myotubes and myoblasts Western blot analysis Low-passage C2C12 myoblast were seeded 20.000/well in a V7 C2C12 siRNA RYR1-transfected and human-derived differenti- XF 24-well cell culture microplate (XF24 EC ﬂux assay kit, ated myotubes were harvested with ice-cold PBS and centri- Seahorse, Bioscience) in culture medium. Cells were transfected fuged 10 min at 4000 rpm at 4 C. Cellular extracts were prepared (as reported in the previous section) with 0.1 ug/well siRNA by solubilizing cells for 30 min in ice-cold lysis buffer (RIPA RyR1 (Sigma) and 0.5 ul lipofectamine 2000 (Invitrogen) per well buffer 80%, 9% complete protease inhibitor cocktail tablets, and the following day culture medium was replaced with differ- Roche, 04693159001), 0.9% PMSF, 0.1% DTT, 9% phosphostop entiation medium. After 5 days in differentiation medium, ma- phosphatase inhibitor cocktail tablets, Roche 04906845001) sup- ture myotubes were gently rinsed in measurement buffer (MB) plemented with a cocktail of protease inhibitors (1%) (Sigma). consisting of DMEM (Sigma, D5030) 8.3 g/l, sodium pyruvate Supernatants were collected after 25 min centrifugation at 1 mM (1.1 g/l), glucose 25 mM (4.5 g/l), NaCl 33 mM (1.85 g/l), 12 000 rpm at 4 C. The total protein content was determined us- phenol red (15 mg/l), L-Glut 10 ml/l, pH 7.4, and placed in a 37 ing the BCA protein assay (Thermo, 23209). A total of 20 mg pro- humidiﬁed un-buffered incubator for 2 h to allow temperature teins were loaded on a Nu-page 3–8% tris-acetate precast gel and pH equilibration. Myotubes were visually inspected prior to (Lifetechnologies) immersed in tris-acetate SDS running buffer and after MB addition then loaded onto the instrument. Bio- (Lifetechnologies). Running was set up as follows: for IP3R and energetic analysis was performed utilizing an XF24–3 Seahorse RyR1 30 min at 50 V and 2 h at 70 V; for mitochondrial respira- Extracellular Flux Analyzer (Seahorse Bio-Science). After an tory complexes and PGC1-a 1 h 30 min at 130 V. Wet transfer equilibration step, basal OCR(pMoles/min) were recorded using was performed 2 h onto nitrocellulose (IP3R and RyR1) or meth- 3 min mix, 2 min wait and 3 min measure (looped three times) anol pre-activated PVDF membrane (Biorad) (mitochondrial re- cycles prior to the injection of 2 uM oligomycin to inhibit the spiratory complexes and PGC1-a). Membranes were blocked ATP synthase. Three more measurement loops were recorded with 5% milk in TBS-Tween 1% for 1 h and incubated with pri- prior to injection of substrate plus 0.8 uM FCCP to induce maxi- mary antibodies overnight at 4 C in 1% milk in TBS-Tween 1%. mal oxygen consumption. Following recording of three more We used the following antibodies: rabbit-IP3R (Santa Cruz, H- measurement loops, rotenone 1 uM and 1 uM antimycin A 300, sc-28613), mouse RyR1 (Thermo, 34C, MA3–925), mouse (inhibitors of mitochondrial respiration) were injected to assess mitoproﬁle (Mitosciences, MS604/H3941) rabbit PGC1-a (Santa non-mitochondrial OCR. Stimuli prepared in MB (70 ll volumes) Cruz, H-300, sc-13067), rabbit b-tubulin (Santa Cruz, H-235, sc- were pre-loaded and sequentially injected as indicated through 9104). Detection was carried out by incubation with secondary ports in the XF24 calibration cartridge to ﬁnal concentrations of horseradish peroxidase-conjugated goat anti-rabbit or goat 1 lg/ml oligomycin, 800 nM FCCP and 1 lM rotenone and anti-mouse IgG antibodies (Biorad, 170–6515 and 170–6516, antimycin-A. XeB (2 lM) was added to siRNA scr and siRNA Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2380 | Human Molecular Genetics, 2018, Vol. 27, No. 13 RYR1-transfected cells 30 min prior to measurements, and was algorithm (http://biit.cs.ut.ee/gproﬁler/help.cgi? help_id¼21). included in ports in the XF24 calibration cartridge to maintain ﬁ- Signiﬁcant TFs were further analysed by listing all the genes or- nal concentrations of 2 lM when injected. Since the number of dered by how many TFs target them in the human patient and differentiated cells in the culture was not feasible to determine, mouse model samples. In addition, we created heatmap plots of OCR values are expressed as pMoles/min/20 K seeded cells. As the genes ordered by this ranking and the TFs ordered by hierar- controls, non-differentiated myoblasts were treated and mea- chical clustering (see Supplementary Material, Data Set S3). In sured in the same way. Values were corrected to non- the heatmaps, blue signiﬁes that the gene is regulated by the TF mitochondrial respiration, i.e. by subtracting OCR values after and white signiﬁes that it is not. TFs belonging to the individual rotenone/antimycin-A addition. clusters were ranked according to signiﬁcance values. Statistical analysis Quantiﬁcation of mtDNA Data are reported as mean6 S.E.M. Statistical differences were Total DNA for mtDNA copy number estimation was extracted evaluated by ANOVA and post-hoc tests for multiple compari- from muscle biopsies with Qiagen DNeasy Blood & Tissue kit sons, or Student’s t-tests. according to the manufacturer’s protocol. The quantitative real- time PCR measurement of mtDNA copy number was conducted according to the protocol in Rooney et al. (46), by utilizing hu- Supplementary Material man sequence-speciﬁc primers targeting the mtDNA region Supplementary Material is available at HMG online. coding for the tRNALeu (UUR) gene (F: CACCCAAGAACA GGGTTTGT; R: TGGCCATGGGTATGTTGTTA) and the nuclear re- gion coding for the B2-microglobulin gene (F: TGCTGTCTC Acknowledgements CATGTTTGATGTATCT; R: TCTCTGCTCCCCACCTCTAAGT). RT- We thank for the helpful discussions and technical assistance PCR reaction parameters were set according to protocol in to the members of the laboratory of Rosario Rizzuto, Anna V C Rooney et al. (46), using SYBR Green JumpstartTM TaqTM Raffaello, Diego De Stefani and Cristina Mammucari. The person- ReadyMixTM (Sigma) on a Biorad CFX96 Thermocycler. Ct analy- nel of the MicroCribi Microarray Service (http://array9.wix.com/ sis was conducted through the Biorad CFX manager software. microcribi), Beniamina Pacchioni and Caterina Millino are kindly For the determination of relative mtDNA copy number the fol- acknowledged for help in array production and data analysis. lowing equations were used: Conﬂict of Interest statement. None declared. a. DCt ¼ Nuclear Ct – Mitochondrial Ct b. Relative mtDNA content ¼ 2 2DCt Funding This work was supported by the following grants: Telethon Microarray analysis (GEP12066 and GGP16026), University College London COMPLeX/ Total mRNA was extracted from 40 mg of frozen human or British Heart Foundation Fund (SP/08/004), the Biotechnology mouse muscle tissues using 1 ml trizol per sample using a tissue and Biological Sciences Research Council (BB/L020874/1 and BB/ lyser (Tissue lyser II, Qiagen). Gene expression studies were per- P018726/1) to G.S. and M.R.D.; Ricerca Finalizzata, Italian formed using Agilent technology with one-color (quick amp la- Ministry of Health (RF-2013–02359065) to G.S. and E.P. The sup- belling) kit following the manufacturer’s instructions. port of the Medical Research Council to the Neuromuscular Quantitative and qualitative analysis of total RNA were per- Centre Biobank is gratefully acknowledged. We greatly appreci- formed with NanoDrop spectrophotometers (Thermo Scientiﬁc) ate support from the Telethon BioBank (GTB12001D), and the and Nanochip BioAnalyzer (Agilent). Human samples were EuroBioBank network. F.M. was supported by the National analysed using the Human 4x44K V2 platform (Agilent) and data Institute of Health Research Biomedical Research Centre at were normalized with the intra-array (Multiplicatively Great Ormond Street Hospital for Children NHS Foundation Detrended) and the inter-array (Quantile) methods. To evaluate Trust. The support of MDUK to the Dubowitz Neuromuscular the differences in transcript expression levels we used Centre and of NHSE to the NSCT Diagnostic Service for signiﬁcance analysis of microarray (SAM) and we performed Congenital Myopathies is also acknowledged. V.N.K. was sup- cluster analysis only on altered transcripts with false discovery ported by an Action Medical Research grant (GN2158). Funding to rate (FDR) analysis of 0% using the complete linkage Euclidean pay the Open Access publication charges for this article was pro- method. EDL and soleus mouse samples were analysed using the vided by Biotechnology and Biological Sciences Research Council. Mus musculus 4x44K platform and data were normalized with the intra-array (Multiplicatively Detrended) and the inter-array References (Quantile) methods. Differentially expressed transcripts were found using permutations of t-test with Bonferroni method 1. Jungbluth, H. and Gautel, M. (2014) Pathogenic mechanisms (P-value < 0.05). Enrichment analyses were performed using g: in centronuclear myopathies. Front. Aging Neurosci., 6, 339. Proﬁler (38). To identify altered mitochondrial transcripts, we 2. Amburgey, K., Bailey, A., Hwang, J.H., Tarnopolsky, M.A., compared our results with The Human and Mouse MitoCarta 2.0 Bonnemann, C.G., Medne, L., Mathews, K.D., Collins, J., list (Broad Institute, Cambridge, MA, USA, https://www.broadinsti Daube, J.R., Wellman, G.P. et al. (2013) Genotype-phenotype tute.org/scientiﬁc-community/science/programs/metabolic-dis correlations in recessive RYR1-related myopathies. Orph. ease-program/publications/mitocarta/mitocarta-in-0) (39), using J. Rare Dis., 8, 117. Venn diagrams (http://bioinfogp.cnb.csic.es/tools/venny/index. 3. Snoeck, M., Treves, S., Molenaar, J.P., Kamsteeg, E.J., html). Microarray data have been deposited in GEO (GSE103855). Jungbluth, H. and Voermans, N.C. (2016) “Human stress Putative TF-binding sites were determined using the syndrome” and the expanding spectrum of RYR1-related TRANSFAC database (2015.3) (47) by a custom g: Proﬁler myopathies. Cell Biochem. Biophys., 74, 85–87. Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 Human Molecular Genetics, 2018, Vol. 27, No. 13 | 2381 4. Klein, A., Lillis, S., Munteanu, I., Scoto, M., Zhou, H., 19. Arias-Caldero ´ n, M., Almarza, G., Dı ´az-Vegas, A., Contreras- Quinlivan, R., Straub, V., Manzur, A.Y., Roper, H., Jeannet, Ferrat, A., Valladares, D., Casas, M., Toledo, H., Jaimovich, E. P.Y. et al. (2012) Clinical and genetic ﬁndings in a large cohort and Buvinic, S. (2016) Characterization of a multiprotein of patients with ryanodine receptor 1 gene-associated my- complex involved in excitation-transcription coupling of opathies. Hum. Mutat., 33, 981–988. skeletal muscle. Skelet. Muscle, 6, 15. 5. Jungbluth, H., Sewry, C.A. and Muntoni, F. (2011) Core myop- 20. Ibarra, C., Vicencio, J.M., Estrada, M., Lin, Y., Rocco, P., athies. Semin. Pediatr. Neurol., 18, 239–249. Rebellato, P., Munoz, J.P., Garcia-Prieto, J., Quest, A.F., 6. Sewry, C.A. and Wallgren-Pettersson, C. (2017) Chiong, M. et al. (2013) Local control of nuclear calcium sig- Myopathology in congenital myopathies. Neuropathol. Appl. naling in cardiac myocytes by perinuclear microdomains of Neurobiol., 43, 5–23. sarcolemmal insulin-like growth factor 1 receptors. Circ. 7. Hwang, J.H., Zorzato, F., Clarke, N.F. and Treves, S. (2012) Res., 112, 236–245. Mapping domains and mutations on the skeletal muscle 21. Schiafﬁno, S. and Reggiani, C. (2011) Fiber types in mamma- ryanodine receptor channel. Trends Mol. Med., 18, 644–657. lian skeletal muscles. Physiol. Rev., 91, 1447–1531. 8. Rokach, O., Sekulic-Jablanovic, M., Voermans, N., 22. Freyssenet, D., Irrcher, I., Connor, M.K., Di Carlo, M. and Wilmshurst, J., Pillay, K., Heytens, L., Zhou, H., Muntoni, F., Hood, D.A. (2004) Calcium-regulated changes in mitochon- Gautel, M., Nevo, Y. et al. (2015) Epigenetic changes as a com- drial phenotype in skeletal muscle cells. Am. J. Physiol. Cell mon trigger of muscle weakness in congenital myopathies. Physiol., 286, C1053–C1061. Hum. Mol. Genet., 24, 4636–4647. 23. Yi, M., Weaver, D., Eisner, V., Va ´ rnai, P., Hunyady, L., Ma, J., 9. Jungbluth, H. (2007) Multi-minicore disease. Orph. J. Rare Dis., Csorda ´ s, G. and Hajno ´ czky, G. (2012) Switch from 2, 31. ER-mitochondrial to SR-mitochondrial calcium coupling 10. Zhou, H., Jungbluth, H., Sewry, C.A., Feng, L., Bertini, E., during muscle differentiation. Cell Calcium, 52, 355–365. Bushby, K., Straub, V., Roper, H., Rose, M.R., Brockington, M. 24. Glancy, B., Hartnell, L.M., Malide, D., Yu, Z.-X., Combs, C.A., et al. (2007) Molecular mechanisms and phenotypic variation Connelly, P.S., Subramaniam, S. and Balaban, R.S. (2015) in RYR1-related congenital myopathies. Brain, 130, 2024–2036. Mitochondrial reticulum for cellular energy distribution in 11. North, K.N., Wang, C.H., Clarke, N., Jungbluth, H., Vainzof, muscle. Nature, 523, 617–620. M., Dowling, J.J., Amburgey, K., Quijano-Roy, S., Beggs, A.H., 25. Vassilopoulos, S., Thevenon, D., Rezgui, S.S., Brocard, J., Sewry, C. et al. (2014) Approach to the diagnosis of congenital Chapel, A., Lacampagne, A., Lunardi, J., DeWaard, M. and myopathies. Neuromusc. Disord., 24, 97–116. Marty, I. (2005) Triadins are not triad-speciﬁc proteins. J. Biol. 12. Ravenscroft, G., Laing, N.G. and Bo ¨ nnemann, C.G. (2015) Chem., 280, 28601–28609. Pathophysiological concepts in the congenital myopathies: 26. Szabadkai, G., Pitter, J.G. and Spa ¨ t, A. (2001) Cytoplasmic blurring the boundaries, sharpening the focus. Brain, 138, Ca2þ at low submicromolar concentration stimulates mito- 246–268. chondrial metabolism in rat luteal cells. Pﬂugers Archiv., 441, 13. Boncompagni, S., Loy, R.E., Dirksen, R.T. and Franzini- 678–685. Armstrong, C. (2010) The I4895T mutation in the type 1 rya- 27. Szabadkai, G. and Duchen, M.R. (2008) Mitochondria: the hub nodine receptor induces ﬁber-type speciﬁc alterations in of cellular Ca2þ signaling. Physiology, 23, 84–94. skeletal muscle that mimic premature aging. Aging Cell, 9, 28. Giorgio, V., Guo, L., Bassot, C., Petronilli, V., and Bernardi, P. 958–970. (2018) Calcium and regulation of the mitochondrial perme- 14. Loy, R.E., Orynbayev, M., Xu, L., Andronache, Z., Apostol, S., ability transition. Cell Calcium, 70, 56–63. Zvaritch, E., MacLennan, D.H., Meissner, G., Melzer, W., 29. Irwin, W.A., Bergamin, N., Sabatelli, P., Reggiani, C., Dirksen, R.T. et al. (2011) Muscle weakness in Ryr1I4895T/WT Megighian, A., Merlini, L., Braghetta, P., Columbaro, M., knock-in mice as a result of reduced ryanodine receptor Volpin, D., Bressan, G.M. et al. (2003) Mitochondrial dysfunc- Ca2þ ion permeation and release from the sarcoplasmic re- tion and apoptosis in myopathic mice with collagen VI deﬁ- ticulum. J. Gen. Physiol., 137, 43–57. ciency. Nat. Genet., 35, 367–371. 15. Dowling, J.J., Arbogast, S., Hur, J., Nelson, D.D., McEvoy, A., 30. Rossi, A.E., Boncompagni, S., Wei, L., Protasi, F. and Dirksen, Waugh, T., Marty, I., Lunardi, J., Brooks, S.V., Kuwada, J.Y. et al. R.T. (2011) Differential impact of mitochondrial positioning (2012) Oxidative stress and successful antioxidant treatment on mitochondrial Ca2 uptake and Ca2 spark suppression in in models of RYR1-related myopathy. Brain, 135, 1115–1127. skeletal muscle. AJP Cell Physiol., 301, C1128–C1139. 16. Zvaritch, E., Kraeva, N., Bombardier, E., McCloy, R.A., 31. Hill, J.M., De Stefani, D., Jones, A.W., Ruiz, A., Rizzuto, R. and Depreux, F., Holmyard, D., Kraev, A., Seidman, C.E., Szabadkai, G. (2014) Measuring baseline Ca(2þ) levels in sub- Seidman, J.G., Tupling, A.R. et al. (2009) Ca2þ dysregulation cellular compartments using genetically engineered ﬂuores- in Ryr1(I4895T/wt) mice causes congenital myopathy with cent indicators. Methods Enzymol., 543, 47–72. progressive formation of minicores, cores, and nemaline 32. Jaimovich, E., Mattei, C., Liberona, J.L., Cardenas, C., Estrada, rods. Proc. Natl. Acad. Sci. U.S.A., 106, 21813–21818. M., Barbier, J., Debitus, C., Laurent, D. and Molgo ´ , J. (2005) 17. Zhou, H., Rokach, O., Feng, L., Munteanu, I., Mamchaoui, K., Xestospongin B, a competitive inhibitor of IP3-mediated Wilmshurst, J.M., Sewry, C., Manzur, A.Y., Pillay, K., Mouly, Ca2þ signalling in cultured rat myotubes, isolated myonu- V. et al. (2013) RyR1 deﬁciency in congenital myopathies dis- clei, and neuroblastoma (NG108-15) cells. FEBS Lett., 579, rupts excitation-contraction coupling. Hum. Mutat., 34, 2051–2057. 986–996. 33. Suzuki, J., Kanemaru, K., Ishii, K., Ohkura, M., Okubo, Y. and 18. Zhou, H., Feng, L., Munteanu, I., Duchen, M., Treves, S., Iino, M. (2014) Imaging intraorganellar Ca2 at subcellular res- Jungbluth, H. and Muntoni, F. (2012) P91 RyR1 deﬁciency in olution using CEPIA. Nat. Commun., 5, 4153. congenital myopathies disrupts excitation-contraction cou- 34. Ca ´ rdenas, C., Miller, R.A., Smith, I., Bui, T., Molgo ´ , J., Mu ¨ ller, pling and induces the second calcium release system via M., Vais, H., Cheung, K.-H., Yang, J., Parker, I. et al. (2010) IP3R. Neuromusc. Disord., 22, S32. Essential regulation of cell bioenergetics by constitutive Downloaded from https://academic.oup.com/hmg/article/27/13/2367/4986434 by DeepDyve user on 12 July 2022 2382 | Human Molecular Genetics, 2018, Vol. 27, No. 13 InsP3 receptor Ca2þ transfer to mitochondria. Cell, 142, mouse model of malignant hyperthermia. Proc. Natl. Acad. 270–283. Sci. U.S.A., 106, 21996–22001. 35. Bravo, R. Vicencio, J.M., Parra, V., Troncoso, R., Munoz, J.P., 42. Sato, I., Wu, S., Ibarra, M.C.A., Hayashi, Y.K., Fujita, H., Tojo, Bui, M., Quiroga, C., Rodriguez, A.E., Verdejo, H.E., Ferreira, J. M., Oh, S.J., Nonaka, I., Noguchi, S., Nishino, I. et al. (2008) et al. (2011) Increased ER-mitochondrial coupling promotes Congenital neuromuscular disease with uniform type 1 ﬁber mitochondrial respiration and bioenergetics during early and RYR1 mutation. Neurology, 70, 114–122. phases of ER stress. J. Cell Sci., 124, 2143–2152. 43. Boncompagni, S., Rossi, A.E., Micaroni, M., Beznoussenko, 36. Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G.V., Polishchuk, R.S., Dirksen, R.T. and Protasi, F. (2008) G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R.C. Mitochondria are linked to calcium stores in striated muscle et al. (1999) Mechanisms controlling mitochondrial biogene- by developmentally regulated tethering structures. Mol. Biol. sis and respiration through the thermogenic coactivator Cell, 20, 1058–1067. PGC-1. Cell, 98, 115–124. 44. Zvaritch, E., Depreux, F.,Kraeva, N.,Loy,R.E., 37. Jones, A.W.E., Yao, Z., Vicencio, J.M., Karkucinska- Goonasekera, S.A., Boncompagni, S., Kraev, A., Gramolini, Wieckowska, A. and Szabadkai, G. (2012) PGC-1 family coac- A.O., Dirksen, R.T., Franzini-Armstrong, C. et al. (2007) An tivators and cell fate: roles in cancer, neurodegeneration, Ryr1I4895T mutation abolishes Ca2þ release channel cardiovascular disease and retrograde mitochondria– function and delays development in homozygous off- nucleus signalling. Mitochondrion, 12, 86–99. spring of a mutant mouse line. Proc. Natl. Acad. Sci. U.S.A., 38. Reimand, J., Arak, T., Adler, P., Kolberg, L., Reisberg, S., 104, 18537–18542. Peterson, H. and Vilo, J. (2016) g: proﬁler-a web server for 45. Chiesa, A., Rapizzi, E., Tosello, V., Pinton, P., De Virgilio, M., functional interpretation of gene lists (2016 update). Nucleic Fogarty, K.E. and Rizzuto, R. (2001) Recombinant aequorin Acids Res., 44, W83–W89. and green ﬂuorescent protein as valuable tools in the study 39. Calvo, S.E., Clauser, K.R. and Mootha, V.K. (2016) of cell signalling. Biochem. J., 355, 1–12. MitoCarta2.0: an updated inventory of mammalian mito- 46. Rooney, J.P., Ryde, I.T., Sanders, L.H., Howlett, E.H., Colton, chondrial proteins. Nucleic Acids Res., 44, D1251–D1257. M.D., Germ, K.E., Mayer, G.D., Greenamyre, J.T. and Meyer, 40. Wright, F.A. and Wojcikiewicz, R.J.H. (2016) Chapter 4 - J.N. (2015) PCR based determination of mitochondrial DNA Inositol 1, 4, 5-Trisphosphate Receptor Ubiquitination. Prog. copy number in multiple species. Methods Mol. Biol., 1241, Mol. Biol. Transl. Sci., 141, 141–159. 23–38. 41. Boncompagni, S., Rossi, A.E., Micaroni, M., Hamilton, S.L., 47. Wingender, E. (2008) The TRANSFAC project as an example Dirksen, R.T., Franzini-Armstrong, C. and Protasi, F. (2009) of framework technology that supports the analysis of geno- Characterization and temporal development of cores in a mic regulation. Brief. Bioinform., 9, 326–332.

Journal

Human Molecular Genetics – Oxford University Press

Published: Jul 1, 2018

Keywords: signal transduction; mutation; mitochondria; myopathy; mice; ryr1; skeletal myocytes; biopsy

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Inositol trisphosphate receptor-mediated Ca2+ signalling stimulates mitochondrial function and gene expression in core myopathy patients

Inositol trisphosphate receptor-mediated Ca2+ signalling stimulates mitochondrial function and gene expression in core myopathy patients

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Inositol trisphosphate receptor-mediated Ca2+ signalling stimulates mitochondrial function and gene expression in core myopathy patients

Inositol trisphosphate receptor-mediated Ca2+ signalling stimulates mitochondrial function and gene expression in core myopathy patients

References (49)

Abstract

Journal

Recommended Articles

There are no references for this article.

Our policy towards the use of cookies