Ingestion of paddy rice increases intestinal mucin secretion and goblet cell number and prevents dextran sodium sulfate-induced intestinal barrier defect in chickens

Ingestion of paddy rice increases intestinal mucin secretion and goblet cell number and prevents... ABSTRACT Paddy rice is a potential feed grain for chickens, whose strong gizzards can crush the hull. Here, we investigated whether paddy rice rich in hull-derived water-insoluble dietary fiber stimulates intestinal mucin secretion and production, as well as the possible involvement of paddy rice in intestinal barrier function. Layer male chicks at 7 d of age were divided into four groups according to the diet: corn, polished rice, brown rice, or paddy rice (650 g/kg diet), which they ate for 14 consecutive days. At 21 d of age, the birds were refed their experimental diets, and small intestinal mucin fractions were collected to determine intestinal mucin content. Small intestinal mucin secretion was induced most strongly in the paddy rice group (Experiment 1). The rank order of diet-induced mucin secretion was paddy rice > corn = brown rice > polished rice. Ileal MUC2 gene expression and ileal number of goblet cells were highest in the paddy rice group (Experiment 1). A study of bromodeoxy-U uptake into ileal epithelial cells indicated the increase in goblet cells in the paddy rice group was related to accelerate epithelial cell migration (Experiment 2). A single supplementation of isolated rice hulls without kernels increased MUC2 gene expression and goblet cell numbers (Experiment 3), suggesting the importance of the hull's bulk-forming capacity on mucin production. Finally, chicks fed corn or paddy rice were orally administered dextran sodium sulfate (DSS) to disrupt intestinal barrier function. In the DSS-treated birds, the intestinal permeability of fluorescein isothiocyanate dextran in the everted gut sacs was much lower in the paddy rice group than in the corn group (Experiment 4), showing that paddy rice protects against mucosal disruption. In conclusion, ingestion of paddy rice increases intestinal mucin secretion and production through enhanced MUC2 gene expression and epithelial turnover and prevents DSS-induced intestinal barrier defects in chickens. INTRODUCTION Corn is the primary energy source in poultry feedstuffs, constituting approximately 50 to 70% of the diet, but many types of grains, including wheat, barley, rye, and millet, are alternative energy sources. Rice is one of the most important grains, especially in the Asian monsoon region, where half of the world's rice is produced (FAOSTAT, 2017). Rice can be categorized into three groups according to how it is processed: (1) paddy rice, unprocessed natural rice kernels covered with a hull; (2) brown rice, initially processed whole grain without a hull; (3) polished rice, further milled and polished to remove the bran layer. Recent publications reported that whole grain paddy rice or ground paddy rice can serve as a valuable grain source in poultry diets (Nanto et al., 2012; Sittiya et al., 2014, 2016). Rice hulls are a complex lignocellulosic material rich in water-insoluble dietary fiber (IDF); they consist of lignin 15.4%, cellulose 35.6%, hemicellulose 12.0%, and ash rich in hydrated silica 18.7% by wet weight (Friedman, 2013). The hull is 20 to 30% of a whole rice grain; hence, the ingestion of paddy rice could broadly affect gastrointestinal physiology, mainly through bulk forming capacity of IDF in gut contents. The intraluminal surface of the intestine is covered with a mucosal layer composed of highly glycosylated mucin secreted by goblet cells in the epithelium. Mucins are mainly categorized as either secreted-type or membrane-type mucins. Mucin-2 (MUC2) is the major secreted-type mucin in the intestine, and it forms a protective gel mucosal barrier to prevent potential pathogens and antigens from accessing the underlying epithelium (McGuckin et al., 2011). MUC2-knock out mice develop severe disease when infected by pathogenic bacteria (Bergstrom et al., 2010) and exhibit delayed clearance of nematode parasites (Hasnain et al., 2010). In addition, MUC2 deficiency leads to spontaneous inflammation of the small and large intestines (Van der Sluis et al., 2006). Thus, the enhancement of mucin secretion in young chicks in development of the gut mucosal barrier might be beneficial for preventing the invasion of pathogenic bacteria and toxic antigens. Although mucins are continuously secreted, various dietary components, including dietary fiber, can stimulate mucin secretion in the small intestine (Tanabe et al., 2005; Ito et al., 2009). Small intestinal mucins are secreted in proportion to the settling volume in water (a numerical representation of bulk-forming properties) of IDF (Tanabe et al., 2005) or to the viscosity of water-soluble dietary fibers (Ito et al., 2009). The stimulatory effects of both dietary fibers on mucin secretion seem to be linked to epithelial cell turnover and the subsequent increase in goblet cell numbers (Ito et al., 2009; Hino et al., 2012). These facts led us to the hypothesis that the ingestion of a paddy rice-based diet rich in IDF could stimulate the intestinal mucin secretion and production, resulting in enhanced intestinal barrier function through the development of the mucosal layer. In the present study, to obtain insight into the potential of paddy rice in intestinal mucin secretion and production, we examined mucin secretory and synthetic effects of the ingestion of diets based on corn, polished rice, brown rice, and paddy rice in young chickens. To further elucidate possible role in intestinal barrier function, we examined whether the ingestion of paddy rice prevents increased intestinal permeability induced by dextran sodium sulfate (DSS). MATERIALS AND METHODS Animals and Experimental Diets Fertilized eggs of White Leghorn-type commercial chickens were purchased from a local supplier (Julia Light; Japan Layer, Gifu, Japan). The fertilized eggs were incubated at 37°C with a relative humidity of 58 to 68%, turned once per hour until 18 d of incubation, and then moved to a wire-bottom hatching box. After allowing 24 h for hatching, only male chicks were moved to stainless-steel cages and housed there. The hatched chicks were provided with free access to water and a semi-purified diet based on isolated-soybean protein extract and corn starch (Table 1) for 7 d. At 7 d of age, the birds were allowed free access to experimental diets containing 650 g/kg corn, polished rice, brown rice, or paddy rice (Table 1) for 14 d. The experimental diets were formulated to meet or exceed the nutrient requirements of Leghorn-type chickens (National Research Council, 1994), but the differences in crude protein (CP) and metabolizable energy (ME) values among the diets were not unified. Corn and three forms of rice (Momiroman strain cultivated in Japan) were ground into particles under 3 mm diameter. The photoperiod was set at 16L:8D with lights on at 0800 beginning at 3 d of age. Room temperature was controlled at 32°C at 0 to 3 d of age, 30°C at 3 to 7 d of age, 28°C at 7 to 14 d of age, and 26°C at 14 to 21 d of age. Animal care was in compliance with the applicable guidelines of the Nagoya University Policy on Animal Care and Use (Approved #: 2012030901, 2013021501, 2014021312). Table 1. Composition (g/kg) of experimental diets. Ingredients Semi-purified diet Corn Polished rice Brown rice Paddy rice Corn – 650 – – – Polished rice – – 650 – – Brown rice – – – 650 – Paddy rice – – – – 650 Corn starch 560.7 – – – – Cellulose 50 – – – – Soybean protein extract 250 210.7 210.7 210.7 210.7 Vitamin mixture1 10 10 10 10 10 Mineral mixture2 58.3 58.3 58.3 58.3 58.3 Choline chloride 2 2 2 2 2 Soybean oil 60 60 60 60 60 DL-Methionine 6 6 6 6 6 L-Lysine 1 1 1 1 1 L-Threonine 1 1 1 1 1 L-Tryptophan 1 1 1 1 1 Total 1,000 1,000 1,000 1,000 1,000 Calculated composition Crude protein (%) 21.9 24.3 23.0 23.5 22.8 ME (kcal/kg) 3,461 3,489 3,597 3,493 3,090 Methionine (g/kg) 8.0 8.8 9.0 9.0 8.7 Lysine (g/kg) 14.8 14.7 14.3 14.4 14.2 Threonine (g/kg) 9.3 10.1 9.5 9.6 9.0 Tryptophan (g/kg) 3.0 3.2 3.2 3.3 3.3 Ingredients Semi-purified diet Corn Polished rice Brown rice Paddy rice Corn – 650 – – – Polished rice – – 650 – – Brown rice – – – 650 – Paddy rice – – – – 650 Corn starch 560.7 – – – – Cellulose 50 – – – – Soybean protein extract 250 210.7 210.7 210.7 210.7 Vitamin mixture1 10 10 10 10 10 Mineral mixture2 58.3 58.3 58.3 58.3 58.3 Choline chloride 2 2 2 2 2 Soybean oil 60 60 60 60 60 DL-Methionine 6 6 6 6 6 L-Lysine 1 1 1 1 1 L-Threonine 1 1 1 1 1 L-Tryptophan 1 1 1 1 1 Total 1,000 1,000 1,000 1,000 1,000 Calculated composition Crude protein (%) 21.9 24.3 23.0 23.5 22.8 ME (kcal/kg) 3,461 3,489 3,597 3,493 3,090 Methionine (g/kg) 8.0 8.8 9.0 9.0 8.7 Lysine (g/kg) 14.8 14.7 14.3 14.4 14.2 Threonine (g/kg) 9.3 10.1 9.5 9.6 9.0 Tryptophan (g/kg) 3.0 3.2 3.2 3.3 3.3 1Vitamin mixture provided the following (per kg of diet): nicotinic acid, 30 mg; pantothenate, 15 mg; pyridoxine, 6 mg; thiamin, 5 mg; riboflavin, 6 mg; folic acid, 2 mg; vitamin K, 750 μg; D-biotin, 200 μg; vitamin B12, 25 μg; vitamin A, 4,000 IU; vitamin D3, 1,000 IU; vitamin E, 75 IU. 2Mineral mixture provided the following (per kg of diet): CaHPO4•2H2O, 20.7 g; KH2PO4, 10 g; CaCO3, 14.8 g; KCl, 3 g; NaCl, 6 g; MgSO4, 3 g; FeSO4•7H2O, 0.5 g; MnSO4•5H2O, 0.35 g; KI, 2.6 mg; CuSO4•5H2O, 40 mg; ZnO, 62 mg; Na2MoO4•2H2O, 8.3 mg; Na2SeO3, 0.4 mg; CoCl2•6H2O, 1.7 mg. View Large Table 1. Composition (g/kg) of experimental diets. Ingredients Semi-purified diet Corn Polished rice Brown rice Paddy rice Corn – 650 – – – Polished rice – – 650 – – Brown rice – – – 650 – Paddy rice – – – – 650 Corn starch 560.7 – – – – Cellulose 50 – – – – Soybean protein extract 250 210.7 210.7 210.7 210.7 Vitamin mixture1 10 10 10 10 10 Mineral mixture2 58.3 58.3 58.3 58.3 58.3 Choline chloride 2 2 2 2 2 Soybean oil 60 60 60 60 60 DL-Methionine 6 6 6 6 6 L-Lysine 1 1 1 1 1 L-Threonine 1 1 1 1 1 L-Tryptophan 1 1 1 1 1 Total 1,000 1,000 1,000 1,000 1,000 Calculated composition Crude protein (%) 21.9 24.3 23.0 23.5 22.8 ME (kcal/kg) 3,461 3,489 3,597 3,493 3,090 Methionine (g/kg) 8.0 8.8 9.0 9.0 8.7 Lysine (g/kg) 14.8 14.7 14.3 14.4 14.2 Threonine (g/kg) 9.3 10.1 9.5 9.6 9.0 Tryptophan (g/kg) 3.0 3.2 3.2 3.3 3.3 Ingredients Semi-purified diet Corn Polished rice Brown rice Paddy rice Corn – 650 – – – Polished rice – – 650 – – Brown rice – – – 650 – Paddy rice – – – – 650 Corn starch 560.7 – – – – Cellulose 50 – – – – Soybean protein extract 250 210.7 210.7 210.7 210.7 Vitamin mixture1 10 10 10 10 10 Mineral mixture2 58.3 58.3 58.3 58.3 58.3 Choline chloride 2 2 2 2 2 Soybean oil 60 60 60 60 60 DL-Methionine 6 6 6 6 6 L-Lysine 1 1 1 1 1 L-Threonine 1 1 1 1 1 L-Tryptophan 1 1 1 1 1 Total 1,000 1,000 1,000 1,000 1,000 Calculated composition Crude protein (%) 21.9 24.3 23.0 23.5 22.8 ME (kcal/kg) 3,461 3,489 3,597 3,493 3,090 Methionine (g/kg) 8.0 8.8 9.0 9.0 8.7 Lysine (g/kg) 14.8 14.7 14.3 14.4 14.2 Threonine (g/kg) 9.3 10.1 9.5 9.6 9.0 Tryptophan (g/kg) 3.0 3.2 3.2 3.3 3.3 1Vitamin mixture provided the following (per kg of diet): nicotinic acid, 30 mg; pantothenate, 15 mg; pyridoxine, 6 mg; thiamin, 5 mg; riboflavin, 6 mg; folic acid, 2 mg; vitamin K, 750 μg; D-biotin, 200 μg; vitamin B12, 25 μg; vitamin A, 4,000 IU; vitamin D3, 1,000 IU; vitamin E, 75 IU. 2Mineral mixture provided the following (per kg of diet): CaHPO4•2H2O, 20.7 g; KH2PO4, 10 g; CaCO3, 14.8 g; KCl, 3 g; NaCl, 6 g; MgSO4, 3 g; FeSO4•7H2O, 0.5 g; MnSO4•5H2O, 0.35 g; KI, 2.6 mg; CuSO4•5H2O, 40 mg; ZnO, 62 mg; Na2MoO4•2H2O, 8.3 mg; Na2SeO3, 0.4 mg; CoCl2•6H2O, 1.7 mg. View Large Experimental Design Experiment 1 Two independent feeding trials were conducted. In both trials, 7-d-old chickens were allocated into four groups (7 birds each) on the basis of BW to give a similar mean BW (60 to 75 g at 1 wk of age) across all groups, and each bird was caged individually. The four groups were fed each experimental diet (Table 1) for 14 d. At d 21 of age, the diets were withdrawn overnight (00 00 to 08 00) to empty the stomach and small intestine. Birds were refed their respective diets for 90 min, and then they were euthanized by decapitation. Luminal contents and gut tissue samples were sampled from all birds (n = 14/group in two trials). The small intestine was excised after the duodenal loop to the ileocecal junction (jejunum and ileum). Luminal contents were gathered by flushing with 15 mL of ice-cold PBS (pH 7.4) containing 0.02 M NaN3 and the same volume of air. The contents were freeze-dried and stored for luminal mucin analysis. Proventriculus, gizzard, duodenum, both ceca, and rectum were dissected, flushed with ice-cold saline, and weighed. Combined weights of duodenum, jejunum, and ileum were considered as small intestinal weight. Segments (1 to 2 cm) of the jejunum and ileum were further excised for the measurement of gene expression and for histological analysis. Tissue samples for gene expression were rapidly frozen in liquid nitrogen and stored at −80°C. Tissue samples for histological analysis were fixed with Mildform (Wako Pure Chemical, Osaka, Japan). Fecal samples (n = 7/group in the second trial) were collected on the day before tissue collection for a quantitative analysis of the fecal total eubacteria and Lactobacillus contents only in the second trial. The collected fecal samples were rapidly frozen in liquid nitrogen and stored at −80°C. Experiment 2 At 7 d of age, chickens were allocated into four groups (7 birds each), and each bird was caged individually. The same dietary treatments as in Experiment 1 were used. To examine epithelial cell migration, 5′-bromo-deoxyuridine (BrdU; 50 mg/kg BW) was intraperitoneally injected into each bird 48 h prior to sample collection. At 21 d of age, the birds were euthanized by decapitation. The ileum segments (n = 7/group) were removed and were fixed with Mildform. Experiment 3 At 7 d of age, chickens were allocated into four groups (7 birds each): control, bran, hull, and bran + hull groups. Each bird was caged individually. The bran (powder) and hull were isolated from the paddy rice, and the isolated hull was ground into particles under 3 mm diameter. The isolated bran and hull were externally supplemental to a semi-purified diet (Table 1) at 100 g/kg. The bran + hull diet included both bran and hull at 100 g/kg each (total 200 g/kg). At 21 d of age, the birds were euthanized by decapitation, and the jejunal and ileal segments (n = 7/group) were removed for analyses of MUC2 gene expression and goblet cell number. Experiment 4 Two feeding trials were conducted. In both trials, each bird was caged individually at 7 d of age. In the first trial, chickens were allowed continuous free access to a semi-purified diet (Table 1) until 22 d of age. At 14 d of age, the birds were allocated into two groups (3 birds each): a control group and a DSS group. The DSS group was given 2% DSS (w/v; M.W. 36,000 to 50,000; MP Biomedicals, Santa Ana, CA, USA) in pure drinking water, whereas the control group was given only pure water. After 8 d of DSS treatment, the birds were euthanized by decapitation. The jejunum, ileum, and rectum (n = 3/group) were removed and subjected to an intestinal permeability test. In the second trial, chickens were allocated into four groups (5 birds each) at 7 d of age: two groups (control and DSS groups) were given a corn-based diet, and another two groups (control and DSS groups) were given a paddy rice-based diet. The birds were freely fed these diets from 7 to 23 d of age. The DSS groups and the control groups were given 2% DSS with pure water and only pure water, respectively, from 14 to 23 d of age. Finally, the birds were euthanized by decapitation and the ileal segments (n = 5/group) were removed and subjected to an intestinal permeability test. Preparation of Mucin Fraction The mucin fraction was isolated by the method of Morita et al. (2004). Total freeze-dried samples were suspended in 0.15 M NaCl solution at 4°C. The samples were homogenized for 1 min and immediately centrifuged at 10,000 × g for 30 min. The supernatants were mixed with EtOH to give a final concentration of 60% EtOH (v/v), and the resultant precipitates were dissolved in 3 mL pure water. The crude mucin solution was freeze-dried and redissolved in 2 mL pure water for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. O-linked oligosaccharide chains in the redissolved solution were also measured as markers of mucin content. Quantitation of Mucin by SDS-PAGE and PAS Staining, and Detection of O-Linked Oligosaccharide Chains The mucin fraction at 16 μL mixed with 4 μL SDS sample loading buffer (5x) was separated by SDS-PAGE (3% stacking gel/6% running gel) under reducing conditions. The gels were stained with periodic acid-Schiff (PAS) for sugars (glycoprotein). The density of the PAS-stained area was analyzed using ImageJ ver. 1.46 (NIH: https://imagej.nih.gov/ij/). O-linked oligosaccharide chains were measured by the method of Crowther and Wetmore (1987) using a fluorometric assay discriminating O-linked glycoproteins (mucin) and N-linked glycoproteins (others). After 50 times dilution of the mucin fraction, the sample was reacted with 2-cyanoacetamide. Standard solutions of N-acetylgalactosamine (Sigma-Aldrich, St Louis, MO, USA) were used to calculate the amounts of oligosaccharide chains liberated from extracted mucins. Histologic Evaluation The fixed intestinal samples were paraffin-embedded and then sliced with a microtome into 4 μm sections. Three cross sections per bird were stained with PAS and counterstained with hematoxylin. The PAS-reactive goblet cells on one side of the villus (left side of the crypt column) were counted on 15 individual villi per bird using light microscopy according to the method of Tanabe et al. (2005) with modification. To visualize BrdU-incorporated epithelial cells, three 4-μm-thick cross sections per bird were collected on MAS-coated slides (Matsunami Glass Ind., Osaka, Japan). The sections were incubated in 10 mM citrate buffer (pH 6.0) at 100°C for 20 min to retrieve antigens. After blocking, the sections were incubated with anti-BrdU (1:100, clone: ZBU30; Merck, Darmstadt, Germany) for 1 h. The sections were further incubated with biotinylated horse anti-mouse IgG (Vectastain Elite ABC Mouse IgG kit; Vector Laboratories, Burlingame, CA, USA) for 30 min and subsequently incubated with avidin−biotin−peroxidase complex reagent for 30 min. Finally, the sections were visualized with diaminobenzidine solution (Dako, Glostrup, Denmark) followed by counterstaining with hematoxylin. The distance from the uppermost BrdU-labeled cells to its crypt was measured according to the method of Ito et al. (2009) with modification. The proportion of the uppermost-BrdU cell distance to the total villus length was calculated. The proportion was calculated for 15 individual villi per bird. RNA Preparation and Expression Analysis by Quantitative Real-Time PCR Total RNA was extracted from tissue samples using TRI reagent (Molecular Research Center, Cincinnati, OH, USA). Total RNA was then treated with DNase using a Turbo DNA-free kit (Ambion®, Thermo Fisher Scientific, Waltham, MA, USA). First-strand cDNA was synthesized from total RNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). The gene expressions were quantitated by real-time PCR with a SYBR green system (Toyobo, Osaka, Japan) according to the manufacturer's instructions. Each 15 μL qPCR mixture consisted of 7.5 μL SYBR Green Master Mix, 0.45 μL of each primer (300 nM final), 1 μL of synthesized cDNA or its diluted solution (1-100 fold), and 5.6 μL PCR-grade water. PCR was performed by initial denaturation at 95°C for 2 min, followed by 40 cycles of denaturation at 95°C for 15 s and primer annealing at 60°C for 60 s, with a final cycle of 95°C for 15 s, 60°C for 30 s, and 95°C for 15 s for analysis of the primer-dissociation curve. The expression data were normalized to endogenous 18S rRNA expression. Specific primer pairs were designed based on NCBI GenBank data (Table 2). Table 2. Primer sequences, corresponding accession numbers, and amplification sizes. Gene Accession no. Primer sequence 5′→3′ Product size (bp) Cited paper 18SrRNA AF173612 F: TCCCCTCCCGTTACTTGGAT 60 – R: GCGCTCGTCGGCATGTA MUC2 XM_421035 F: TTCATGATGCCTGCTCTTGTG 93 – R: CTGAGCCTTGGTACATTCTTGT Bacterial 16SrRNA – F:ACTCCTACGGGAGGCAGCAGT 200 Nakayama et al. (2007) R: GTATTACCGCGGCTGCTGGCAC Lactobacillus 16SrRNA – F:AGCAGTAGGGAATCTTCCA 341 Štšepetova et al. (2011) R: CACCGCTACACATGGAG Gene Accession no. Primer sequence 5′→3′ Product size (bp) Cited paper 18SrRNA AF173612 F: TCCCCTCCCGTTACTTGGAT 60 – R: GCGCTCGTCGGCATGTA MUC2 XM_421035 F: TTCATGATGCCTGCTCTTGTG 93 – R: CTGAGCCTTGGTACATTCTTGT Bacterial 16SrRNA – F:ACTCCTACGGGAGGCAGCAGT 200 Nakayama et al. (2007) R: GTATTACCGCGGCTGCTGGCAC Lactobacillus 16SrRNA – F:AGCAGTAGGGAATCTTCCA 341 Štšepetova et al. (2011) R: CACCGCTACACATGGAG View Large Table 2. Primer sequences, corresponding accession numbers, and amplification sizes. Gene Accession no. Primer sequence 5′→3′ Product size (bp) Cited paper 18SrRNA AF173612 F: TCCCCTCCCGTTACTTGGAT 60 – R: GCGCTCGTCGGCATGTA MUC2 XM_421035 F: TTCATGATGCCTGCTCTTGTG 93 – R: CTGAGCCTTGGTACATTCTTGT Bacterial 16SrRNA – F:ACTCCTACGGGAGGCAGCAGT 200 Nakayama et al. (2007) R: GTATTACCGCGGCTGCTGGCAC Lactobacillus 16SrRNA – F:AGCAGTAGGGAATCTTCCA 341 Štšepetova et al. (2011) R: CACCGCTACACATGGAG Gene Accession no. Primer sequence 5′→3′ Product size (bp) Cited paper 18SrRNA AF173612 F: TCCCCTCCCGTTACTTGGAT 60 – R: GCGCTCGTCGGCATGTA MUC2 XM_421035 F: TTCATGATGCCTGCTCTTGTG 93 – R: CTGAGCCTTGGTACATTCTTGT Bacterial 16SrRNA – F:ACTCCTACGGGAGGCAGCAGT 200 Nakayama et al. (2007) R: GTATTACCGCGGCTGCTGGCAC Lactobacillus 16SrRNA – F:AGCAGTAGGGAATCTTCCA 341 Štšepetova et al. (2011) R: CACCGCTACACATGGAG View Large Quantification of Fecal Bacteria by Real-Time PCR Bacterial genomic DNA was isolated from 200 mg of feces using a QIAamp DNA Stool Mini Kit (QIAGEN, Hilden, Germany). Bacterial 16S rDNA was quantitated by real-time PCR with an SYBR Green system as described previously (Murai et al., 2016). The primers to detect the total bacteria (Nakayama et al., 2007) and Lactobacillus group (Štšepetova et al., 2011) are listed in Table 2. Gut Permeability Test Gut permeability to fluorescein isothiocyanate (FITC)-labeled dextran with a molecular weight of 4,000 (FD-4, Sigma) was evaluated in the everted jejunum, ileum, and rectum according to the method of Azuma et al. (2013) with modification. The intestine was everted with a blunt glass rod and closed with a clip at one end. The other end was closed after injection with Tyrode's balanced salt solution including 1 g glucose/L. The everted intestine was incubated in Tyrode's solution supplemented with 100 μg/mL FITC-dextran for 30 min at 37°C in a water bath. After incubation, the inner solution was collected and the fluorescence of FITC-dextran in the inner solution was determined using a spectrofluorometer (excitation 490 nm, emission 525 nm) to calculate the amount of FITC-dextran. Statistical Analysis In Experiment 1, the data of two trials were pooled and analyzed (n = 14/group) except for bacterial population (n = 7/group). In Experiments 2 to 4, the data of single trial were analyzed (n = 7/group in Experiment 2 and 3; n = 3 or 5 in Experiment 4). In Experiments 1 to 3, the data were analyzed by one-way (Experiment 1 and 2) and two-way ANOVA (Experiment 3), and the differences between means were assessed by Tukey–Kramer's test. In Experiment 4, to compare the differences between the control group and the DSS group, the data were analyzed by Student's t-test. The results were expressed as means ± SEM. A probability value of P < 0.05 was considered statistically significant. Statistical analysis was performed with the program SAS 9.1 (SAS Institute, Cary, NC, USA). RESULTS Experiment 1: Growth Performance There were no significant differences in final BW among the four diets, although polished rice caused a 3 to 4% reduction compared to corn, brown rice, and paddy rice (Table 3). Feed intake of paddy rice was the highest among all diets (P < 0.05), probably because it had the lowest ME value. Consequently, the feed efficiency of paddy rice was the lowest among the treatments. Ingestion of paddy rice or corn tended to increase the weights of various parts of the gut compared with polished or brown rice. Gizzard weight was highest in the paddy rice birds (P < 0.05). Regardless of diet, there were no changes in small intestine weight or rectal weight. Table 3. Growth performance and final tissue weights in chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d1 (Experiment 1). Corn Polished rice Brown rice Paddy rice Final BW (g) 204.2 ± 3.1 195.8 ± 3.3 202.4 ± 2.3 201.6 ± 3.0 Feed intake (g/day) 16.8 ± 0.3b 16.4 ± 0.4b 16.7 ± 0.3b 18.0 ± 0.2a Feed efficiency 0.628 ± 0.007a 0.610 ± 0.009a,b 0.629 ± 0.011a 0.578 ± 0.007b Tissue weight (g/100 gBW) Proventriculus 0.761 ± 0.016a 0.663 ± 0.016c 0.691 ± 0.010bc 0.723 ± 0.011a,b Gizzard 4.36 ± 0.10b 2.13 ± 0.08c 2.31 ± 0.05c 5.18 ± 0.14a Small intestine 4.44 ± 0.11 4.30 ± 0.11 4.17 ± 0.12 4.24 ± 0.11 Cecum 0.520 ± 0.031a,b 0.451 ± 0.042a,b 0.403 ± 0.028b 0.546 ± 0.035a Rectum 0.177 ± 0.007 0.163 ± 0.004 0.160 ± 0.005 0.185 ± 0.010 Corn Polished rice Brown rice Paddy rice Final BW (g) 204.2 ± 3.1 195.8 ± 3.3 202.4 ± 2.3 201.6 ± 3.0 Feed intake (g/day) 16.8 ± 0.3b 16.4 ± 0.4b 16.7 ± 0.3b 18.0 ± 0.2a Feed efficiency 0.628 ± 0.007a 0.610 ± 0.009a,b 0.629 ± 0.011a 0.578 ± 0.007b Tissue weight (g/100 gBW) Proventriculus 0.761 ± 0.016a 0.663 ± 0.016c 0.691 ± 0.010bc 0.723 ± 0.011a,b Gizzard 4.36 ± 0.10b 2.13 ± 0.08c 2.31 ± 0.05c 5.18 ± 0.14a Small intestine 4.44 ± 0.11 4.30 ± 0.11 4.17 ± 0.12 4.24 ± 0.11 Cecum 0.520 ± 0.031a,b 0.451 ± 0.042a,b 0.403 ± 0.028b 0.546 ± 0.035a Rectum 0.177 ± 0.007 0.163 ± 0.004 0.160 ± 0.005 0.185 ± 0.010 1Values are means ± SEM, n = 14. a, b, cMeans having different superscripts are significantly different at P < 0.05. View Large Table 3. Growth performance and final tissue weights in chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d1 (Experiment 1). Corn Polished rice Brown rice Paddy rice Final BW (g) 204.2 ± 3.1 195.8 ± 3.3 202.4 ± 2.3 201.6 ± 3.0 Feed intake (g/day) 16.8 ± 0.3b 16.4 ± 0.4b 16.7 ± 0.3b 18.0 ± 0.2a Feed efficiency 0.628 ± 0.007a 0.610 ± 0.009a,b 0.629 ± 0.011a 0.578 ± 0.007b Tissue weight (g/100 gBW) Proventriculus 0.761 ± 0.016a 0.663 ± 0.016c 0.691 ± 0.010bc 0.723 ± 0.011a,b Gizzard 4.36 ± 0.10b 2.13 ± 0.08c 2.31 ± 0.05c 5.18 ± 0.14a Small intestine 4.44 ± 0.11 4.30 ± 0.11 4.17 ± 0.12 4.24 ± 0.11 Cecum 0.520 ± 0.031a,b 0.451 ± 0.042a,b 0.403 ± 0.028b 0.546 ± 0.035a Rectum 0.177 ± 0.007 0.163 ± 0.004 0.160 ± 0.005 0.185 ± 0.010 Corn Polished rice Brown rice Paddy rice Final BW (g) 204.2 ± 3.1 195.8 ± 3.3 202.4 ± 2.3 201.6 ± 3.0 Feed intake (g/day) 16.8 ± 0.3b 16.4 ± 0.4b 16.7 ± 0.3b 18.0 ± 0.2a Feed efficiency 0.628 ± 0.007a 0.610 ± 0.009a,b 0.629 ± 0.011a 0.578 ± 0.007b Tissue weight (g/100 gBW) Proventriculus 0.761 ± 0.016a 0.663 ± 0.016c 0.691 ± 0.010bc 0.723 ± 0.011a,b Gizzard 4.36 ± 0.10b 2.13 ± 0.08c 2.31 ± 0.05c 5.18 ± 0.14a Small intestine 4.44 ± 0.11 4.30 ± 0.11 4.17 ± 0.12 4.24 ± 0.11 Cecum 0.520 ± 0.031a,b 0.451 ± 0.042a,b 0.403 ± 0.028b 0.546 ± 0.035a Rectum 0.177 ± 0.007 0.163 ± 0.004 0.160 ± 0.005 0.185 ± 0.010 1Values are means ± SEM, n = 14. a, b, cMeans having different superscripts are significantly different at P < 0.05. View Large Mucin Secretion and Production in Intestine Ingestion of paddy rice most strongly increased PAS-reactive substances in the mucin fraction of the small intestine content, whereas the ingestion of polished rice produced the lowest amounts of PAS-reactive substances (Figure 1A; P < 0.05). Ingestion of corn or brown rice revealed intermediate levels of PAS-reactive substances between paddy rice and polished rice. O-linked oligosaccharide chain contents were also highest in the paddy rice birds (Figure 1B; P < 0.05). The rank order of diet-induced mucin secretion was paddy rice > corn = brown rice > polished rice. Prior to this study, we confirmed that MUC2 gene expression was markedly higher than the expression of other secreted-type mucins (MUC5AC, MUC5B, MUC6) in chicken intestines (data not shown). In this study, we measured MUC2 gene expression. In the jejunum, MUC2 gene expression was comparable among the groups (P > 0.05). In the ileum, MUC2 gene expression was highest in the paddy rice birds in comparison to the polished rice group (P < 0.05), but not different from the corn or brown rice groups (Figure 1C). Figure 1. View largeDownload slide PAS-reactive substances (A) and O-linked oligosaccharide chains (B) in small intestinal mucin fraction, and MUC2 gene expression in jejunum and ileum (C) of chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 1). AU; arbitrary unit. Vertical bars indicate means ± SEM, n = 14. a, b, c Means having different superscripts are significantly different at P < 0.05. Figure 1. View largeDownload slide PAS-reactive substances (A) and O-linked oligosaccharide chains (B) in small intestinal mucin fraction, and MUC2 gene expression in jejunum and ileum (C) of chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 1). AU; arbitrary unit. Vertical bars indicate means ± SEM, n = 14. a, b, c Means having different superscripts are significantly different at P < 0.05. Histological analysis showed that goblet cell numbers in the ileum were also the highest in paddy rice birds (Figure 2; P < 0.05). The increase in goblet cells was more evident in the ileal section (24% increase; paddy rice vs. polished rice) compared to the jejunal section (11% increase). Figure 2. View largeDownload slide Light micrographs of jejunum (A) and ileum (B), and number of goblet cells (C) in chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 1). Micrographs were stained with PAS reagent and hematoxylin. Black bar indicates 100 μm. Vertical bars indicate means ± SEM, n = 14. a, b Means having different superscripts are significantly different at P < 0.05. Figure 2. View largeDownload slide Light micrographs of jejunum (A) and ileum (B), and number of goblet cells (C) in chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 1). Micrographs were stained with PAS reagent and hematoxylin. Black bar indicates 100 μm. Vertical bars indicate means ± SEM, n = 14. a, b Means having different superscripts are significantly different at P < 0.05. To determine changes in the gut bacterial population, real-time PCR with total bacteria and Lactobacillus-specific primers targeting the 16S rDNA genes was performed in fecal samples. There were no changes in the numbers of total bacteria (P > 0.05), but the paddy rice birds showed significantly fewer Lactobacillus species compared to the corn and polished rice birds (Figure 3; P < 0.05). Figure 3. View largeDownload slide Total bacterial population and Lactobacillus population counted in feces of chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 1). Bacterial 16S rDNA was quantitated by real-time PCR. Vertical bars indicate means ± SEM, n = 7. a, b Means having different superscripts are significantly different at P < 0.05. Figure 3. View largeDownload slide Total bacterial population and Lactobacillus population counted in feces of chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 1). Bacterial 16S rDNA was quantitated by real-time PCR. Vertical bars indicate means ± SEM, n = 7. a, b Means having different superscripts are significantly different at P < 0.05. Experiment 2: Epithelial Cell Migration in Ileum The position of the uppermost BrdU-labeled cells from the crypt bottom of the villus differed significantly among the groups; it was highest and lowest in the paddy rice and polished rice birds, respectively (Figure 4; P < 0.05). The epithelial cell migration was parallel to changes in mucin secretion, MUC2 gene expression, and goblet cell numbers. Figure 4. View largeDownload slide Light micrographs indicating incorporation of BrdU into ileal epithelial cells in chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 2). Arrows indicate the uppermost migrated BrdU-positive cells on a villus. Black bar indicates 100 μm. Vertical bars indicate means ± SEM, n = 7. a, b Means having different superscripts are significantly different at P < 0.05. Figure 4. View largeDownload slide Light micrographs indicating incorporation of BrdU into ileal epithelial cells in chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 2). Arrows indicate the uppermost migrated BrdU-positive cells on a villus. Black bar indicates 100 μm. Vertical bars indicate means ± SEM, n = 7. a, b Means having different superscripts are significantly different at P < 0.05. Experiment 3: Effects of Rice Bran and Rice Hull on MUC2 Gene Expression and Goblet Cell Number To clarify the main component in the stimulation of mucin production, rice hulls and rice bran isolated from the identical paddy rice were used to supplement the basal semi-purified diet. Ingestion of rice hull alone doubled MUC2 gene expression in the ileum compared to the control diet (P < 0.05), with a weaker effect in the jejunum (P > 0.05) (Figure 5A). Oppositely, ingestion of rice bran tended to decrease MUC2 gene expression in both the jejunum and ileum. Ingestion of rice hulls also increased the numbers of goblet cells in both the jejunum (P < 0.05) and ileum (P = 0.058), although ingestion of rice bran did not affect these parameters (Figure 5B). Figure 5. View largeDownload slide MUC2 gene expression (A) and number of goblet cells (B) in jejunum and ileum of chickens given semi-purified diets supplemented with or without bran, hull, or bran + hull for 14 d (Experiment 3). MUC2 gene expression was quantitated by real-time PCR. Vertical bars indicate means ± SEM, n = 7. *Significant effect of the main or interaction effect at P < 0.05; **Significant effect of the main effect at P < 0.01; NS, Not significant. a, b Means having different superscripts are significantly different at P < 0.05. Figure 5. View largeDownload slide MUC2 gene expression (A) and number of goblet cells (B) in jejunum and ileum of chickens given semi-purified diets supplemented with or without bran, hull, or bran + hull for 14 d (Experiment 3). MUC2 gene expression was quantitated by real-time PCR. Vertical bars indicate means ± SEM, n = 7. *Significant effect of the main or interaction effect at P < 0.05; **Significant effect of the main effect at P < 0.01; NS, Not significant. a, b Means having different superscripts are significantly different at P < 0.05. Experiment 4: Intestinal Permeability Fluorescein isothiocyanate-dextran, FD-4, is known to permeate the paracellular pathways of intestinal epithelial cells and is used as an indicator of intestinal tight junction barrier integrity. First, birds given a basal semi-purified diet were preliminary tested to determine whether oral administration of DSS induces an intestinal barrier defect. A DSS-induced barrier defect, as indicated by increased FITC-dextran permeability, was observed in all everted gut sacs but especially those in the ileum (Figure 6A; P < 0.05). Second, birds were given the corn- or paddy rice-based diet, and then the FITC-dextran permeability test was performed using ileal everted sacs after DSS treatment. In the corn group, DSS treatment increased FITC-dextran permeability by 2.5-fold (P < 0.05), whereas in the paddy rice group FITC-dextran permeability was not significantly changed (P > 0.05) (Figure 6B). Figure 6. View largeDownload slide FITC-dextran permeability in various parts of intestine (A) and in ileum (B) of chickens administered water (control) or DSS (Experiment 4). (A) The birds were given a semi-purified diet for 22 d. (B) The birds were given a corn- or paddy rice-based diet for 16 d. The permeation of FITC-dextran into everted gut sacs was determined by a spectrofluorometer. Vertical bars indicate means ± SEM, n = 3 (A) and n = 5 (B). a, bMeans having different superscripts are significantly different at P < 0.05. Figure 6. View largeDownload slide FITC-dextran permeability in various parts of intestine (A) and in ileum (B) of chickens administered water (control) or DSS (Experiment 4). (A) The birds were given a semi-purified diet for 22 d. (B) The birds were given a corn- or paddy rice-based diet for 16 d. The permeation of FITC-dextran into everted gut sacs was determined by a spectrofluorometer. Vertical bars indicate means ± SEM, n = 3 (A) and n = 5 (B). a, bMeans having different superscripts are significantly different at P < 0.05. DISCUSSION In this study, ingestion of paddy rice stimulated small intestinal mucin secretion in chickens more significantly than did ingestion of corn, brown rice, or polished rice. The significant difference in MUC2 gene expression and rapid epithelial turnover were observed between paddy rice and polished rice; however, it was not significantly different from corn or brown rice groups. Although the feed efficiency of paddy rice was the lowest among the treatments due to low ME value, paddy rice group exhibited normal BW. Ingestion of paddy rice also ameliorated intestinal permeability in DSS-induced experimental “leaky gut,” whereas ingestion of corn did not. These results support our hypothesis that paddy rice rich in IDF can potentiate mucin secretion and production, and furthermore can enhance intestinal barrier function through development of the mucosal barrier. In rats, the importance of the physical properties served by dietary fibers on intestinal mucin secretion has been well studied. In an early report, small intestine mucin secretion was enhanced by citrus fiber ingestion including pectin, hemicellulose, and IDF (Satchithanandam et al., 1990). Tanabe et al. (2005) showed that supplementation of polystyrene foam at 10 to 90 g/kg diet increased intestinal mucin secretion in rats in proportion to its bulk-forming capacity. They also reported that various naturally occurring IDF (cellulose, corn husk, beet fiber, and wheat bran) increased intestinal mucin secretion in proportion to their bulk-forming capacities. Paddy rice is rich in IDF compared to corn and brown rice. In paddy rice, acid detergent fiber (ADF; index of indigestible lignin and cellulose content) accounts for approximately 13% of dry weight, whereas corn and brown rice consist of 3 and 1.5% ADF, respectively (NARO, 2017). Differences in cellulose and lignin contents between paddy rice and the other three groups (corn, polished rice, and brown rice) tested here are the most plausible explanation for the ability to potentiate mucin secretion and production. The increased luminal mucin secretion and ileal MUC2 gene expression in the birds fed paddy rice can be partially explained by the increased goblet cell numbers, probably due to rapid epithelial turnover. In the present results, the BrdU incorporation study showed that the position of the uppermost BrdU-labeled cell along the villi was highest in chicks fed the paddy rice diet among the four groups. We speculated that the accelerated epithelial cell migration might increase terminally differentiated goblet cells, which would result in increased goblet cell numbers and elevated MUC2 gene expression. At present, the precise mechanism responsible for the increase in goblet cells after ingestion of paddy rice is unclear. In general, IDF causes the retention of the more bulky digesta along the small intestinal tract, leading to an increase in intraluminal pressure. Ito et al. (2009) suggested that the increased intraluminal pressure and “differential stretching force” might affect the differentiation of stem cells or immature cells committed to become goblet cells. In support of this concept, the present study showed that ingestion of grain-free rice hull stimulated MUC2 gene expression and goblet cell numbers. In addition, ingestion of a dietary fiber-rich diet, including whole paddy rice (Sittiya et al., 2016), wheat/rye (Teirlynck et al., 2009), methylcellulose (Rahmatnejad and Saki, 2016), or lignin (Baurhoo et al., 2007) increased goblet cell numbers and the proliferation of larger goblet cells in chicken intestine. The present study also showed that paddy rice-stimulated MUC2 gene expression and increased goblet cell numbers were more intense in the ileum rather than the jejunum, which might be reflected more in intraluminal pressure in the distal intestine (ileum) by residual IDF than in the proximal intestine (jejunum). We hypothesize that the ingestion of paddy rice and rice hulls enhances goblet cell differentiation in the small intestine through intense physical pressure on the intestinal wall and on epithelial cells. It remains unclear how gut microbiota contribute to mucin secretion and production during paddy rice intake. In germ-free chickens, the absence of bacteria in the gut caused a reduction in goblet cell number and density, as well as reduced MUC2 gene expression, in the small intestine compared with conventional chickens (Cheled-Shoval et al., 2014). Inversely, infection of mucosal surfaces can result in a rapid release of stored mucin granules to bolster the barrier and exclude pathogens, and then the recognition of pathogens by the host leads to the production of host inflammatory factors inducing the differentiation of goblet cells and the transcription of mucins (McGuckin et al., 2011). Similarly, a probiotic supplement consisting of Lactobacillus or other species increased goblet cell numbers and mucin gene expression in the chicken small intestine (Smirnov et al., 2005; Aliakbarpour et al., 2012). In the present study, however, ingestion of paddy rice did not influence total bacterial numbers but decreased Lactobacillus species in feces. Thus, it is unlikely that modification of the gut microbiota by paddy rice is involved in the enhancement of mucin secretion and production. The present study provides evidence of the preventive effect of paddy rice on DSS-induced “leaky gut” in chickens. Oral administration of DSS is commonly used to induce enteric inflammation in rodent models. In addition, DSS-induced colitis has been widely used as a model in studies of the pathogenesis and treatment of human inflammatory bowel disease. DSS has a high negative charge due to the presence of a sulfate group; it is toxic to gut epithelia and induces erosions that ultimately compromise barrier integrity, resulting in increased epithelial permeability (Conn, 2013). It was reported recently that oral administration of DSS is applicable to a gut leakage model in chickens (Kuttappan et al., 2015). In this study, we have successfully demonstrated that oral administration of DSS increased FITC-dextran permeability in everted gut sacs. As expected, after oral administration of DSS, ileal everted sacs for birds fed paddy rice-based diet were less permeable to FITC-dextran than those for birds fed corn-based diet. Although there was no direct evidence of an association between the increased mucin and ameliorative intestinal permeability, it seems likely that paddy rice-induced mucin secretion and production might compensate for the diminished mucosal layer by DSS. This offers the possibility that ingestion of paddy rice prevents invasion by pathogenic bacteria by fortifying intestinal mucin secretion and production. There are several limitations in this study. First, we have not examined whether ingestion of paddy rice suppresses infection by pathogens penetrating into the intestine. Second, the experimental diets used here were semi-purified diets based on isolated-soybean protein in order to allow us to focus on paddy rice-derived dietary fiber. Third, our data were limited to layer chicks, and responses in broilers and mature layers remain uncertain. Despite these limitations, this is the first report to characterize enhanced mucin secretion and production in chickens given paddy rice. Our results can help to advance our understanding of whole grains as feedstuffs to enhance gut barrier function. In conclusion, ingestion of paddy rice increases intestinal mucin secretion and production through enhanced MUC2 gene expression and epithelial turnover and prevents DSS-induced intestinal barrier defects in chickens. These results suggest a possible link between enhanced mucin secretion and intestinal barrier function. ACKNOWLEDGMENTS This research was supported in part by a Grant-in-Aid (No. 17K19321 to A.M.) from the Japan Society for the Promotion of Science. We thank Professor T. Morita, Faculty of Agriculture, Shizuoka University, Japan, for technical advice with the histological evaluation. REFERENCES Aliakbarpour H. R. , Chamani M. , Rahimi G. , Sadeghi A. A. , Qujeq D. . 2012 . The Bacillus subtilis and lactic acid bacteria probiotics influences intestinal mucin gene expression, histomorphology and growth performance in broilers. J. Anim. Sci. 25 : 1285 – 1293 . Azuma T. , Shigeshiro M. , Kodama M. , Tanabe S. , Suzuki T. . 2013 . Supplemental naringenin prevents intestinal barrier defects and inflammation in colitic mice . J. Nutr. 143 : 827 – 834 . Google Scholar CrossRef Search ADS PubMed Baurhoo B. , Phillip L. , Ruiz-Feria C. A. . 2007 . Effects of purified lignin and mannan oligosaccharides on intestinal integrity and microbial populations in the ceca and litter of broiler chickens . Poult. Sci. 86 : 1070 – 1078 . Google Scholar CrossRef Search ADS PubMed Bergstrom K. S. , Kissoon-Singh V. , Gibson D. L. , Ma C. , Montero M. , Sham H. P. , Ryz N. , Huang T. , Velcich A. , Finlay B. B. , Chadee K. , Vallance B. A. . 2010 . Muc2 protects against lethal infectious colitis by disassociating pathogenic and commensal bacteria from the colonic mucosa . PLoS Pathog. 6 : e1000902 . Google Scholar CrossRef Search ADS PubMed Cheled-Shoval S. L. , Gamage N. S. , Amit-Romach E. , Forder R. , Marshal J. , Van Kessel A. , Uni Z. . 2014 . Differences in intestinal mucin dynamics between germ-free and conventionally reared chickens after mannan-oligosaccharide supplementation . Poult. Sci. 93 : 636 – 644 . Google Scholar CrossRef Search ADS PubMed Conn P. M. 2013 . Animal Models for the Study of Human Disease . Academic Press , Cambridge, MS . Crowther R. S. , Wetmore R. F. . 1987 . Fluorometric assay of O-linked glycoproteins by reaction with 2-cyanoacetamide . Anal. Biochem. 163 : 170 – 174 . Google Scholar CrossRef Search ADS PubMed FAOSTAT . 2017 . http://www.fao.org/faostat/en/#home . Friedman M. 2013 . Rice brans, rice bran oils, and rice hulls: composition, food and industrial uses, and bioactivities in humans, animals, and cells . J. Agric. Food Chem. 61 : 10626 – 10641 . Google Scholar CrossRef Search ADS PubMed Hasnain S. Z. , Wang H. , Ghia J. E. , Haq N. , Deng Y. , Velcich A. , Grencis R. K. , Thornton D. J. , Khan W. I. . 2010 . Mucin gene deficiency in mice impairs host resistance to an enteric parasitic infection . Gastroenterology 138 : 1763 – 1771 . e5 . Google Scholar CrossRef Search ADS PubMed Hino S. , Takemura N. , Sonoyama K. , Morita A. , Kawagishi H. , Aoe S. , Morita T. . 2012 . Small intestinal goblet cell proliferation induced by ingestion of soluble and insoluble dietary fiber is characterized by an increase in sialylated mucins in rats . J. Nutr. 142 : 1429 – 1436 . Google Scholar CrossRef Search ADS PubMed Ito H. , Satsukawa M. , Arai E. , Sugiyama K. , Sonoyama K. , Kiriyama S. , Morita T. . 2009 . Soluble fiber viscosity affects both goblet cell number and small intestine mucin secretion in rats . J. Nutr. 139 : 1640 – 1647 . Google Scholar CrossRef Search ADS PubMed Kuttappan V. A. , Berghman L. R. , Vicuña E. A. , Latorre J. D. , Menconi A. , Wolchok J. D. , Wolfenden A. D. , Faulkner O. B. , Tellez G. I. , Hargis B. M. , Bielke L. R. . 2015 . Poultry enteric inflammation model with dextran sodium sulfate mediated chemical induction and feed restriction in broilers . Poult. Sci. 94 : 1220 – 1226 . Google Scholar CrossRef Search ADS PubMed McGuckin M. A. , Lindén S. K. , Sutton P. , Florin T. H. . 2011 . Mucin dynamics and enteric pathogens . Nat. Rev. Micro. 9 : 265 – 278 . Google Scholar CrossRef Search ADS Morita T. , Tanabe H. , Sugiyama K. , Kasaoka S. , Kiriyama S. . 2004 . Dietary resistant starch alters the characteristics of colonic mucosa and exerts a protective effect on trinitrobenzene sulfonic acid-induced colitis in rats . Biosci. Biotechnol. Biochem. 68 : 2155 – 2164 . Google Scholar CrossRef Search ADS PubMed Murai A. , Kitahara K. , Okumura S. , Kobayashi M. , Horio F. . 2016 . Oral antibiotics enhance antibody responses to keyhole limpet hemocyanin in orally but not muscularly immunized chickens . Anim. Sci. J. 87 : 257 – 265 . Google Scholar CrossRef Search ADS PubMed Nakayama J. , Hoshiko H. , Fukuda M. , Tanaka H. , Sakamoto N. , Tanaka S. , Ohue K. , Sakai K. , Sonomoto K. . 2007 . Molecular monitoring of bacterial community structure in long-aged nukadoko: pickling bed of fermented rice bran dominated by slow-growing lactobacilli . J. Biosci. Bioeng. 104 : 481 – 489 . Google Scholar CrossRef Search ADS PubMed Nanto F. , Kikusato M. , Ito C. , Sudo S. , Toyomizu M. . 2012 . Effects of dehulled, crushed and untreated whole-grain paddy rice on growth performance in broiler chickens . J. Poult. Sci. 49 : 291 – 299 . Google Scholar CrossRef Search ADS NARO . 2017 . Technical Manual for Production and Feeding of Rice . 2017 ver., ed . National Agriculture and Food Research Organization , Japan . National Research Council . 1994 . Nutrient Requirements of Poultry . 9th rev. ed . Natl. Acad. Press , Washington, DC . Rahmatnejad E. , Saki A. A. . 2016 . Effect of dietary fibres on small intestine histomorphology and lipid metabolism in young broiler chickens . J. Anim. Physiol. Anim. Nutr. 100 : 665 – 672 . Google Scholar CrossRef Search ADS Satchithanandam S. , Vargofcak-Apker M. , Calvert R. J. , Leeds A. R. , Cassidy M. M. . 1990 . Alteration of gastrointestinal mucin by fiber feeding in rats . J. Nutr. 120 : 1179 – 1184 . Google Scholar CrossRef Search ADS PubMed Sittiya J. , Yamauchi K. , Takata K. . 2014 . Effects of whole-grain paddy rice replacement with or without enzyme addition on broiler performance and intestinal morphology . Br. Poult. Sci. 55 : 619 – 627 . Google Scholar CrossRef Search ADS PubMed Sittiya J. , Yamauchi K. , Takata K. . 2016 . Effect of replacing corn with whole-grain paddy rice and brown rice in broiler diets on growth performance and intestinal morphology . J. Anim. Physiol. Anim. Nutr. 100 : 381 – 390 . Google Scholar CrossRef Search ADS Smirnov A. , Perez R. , Amit-Romach E. , Sklan D. , Uni Z. . 2005 . Mucin dynamics and microbial populations in chicken small intestine are changed by dietary probiotic and antibiotic growth promoter supplementation . J. Nutr. 135 : 187 – 192 . Google Scholar CrossRef Search ADS PubMed Štšepetova J. , Sepp E. , Kolk H. , Lõivukene K. , Songisepp E. , Mikelsaar M. . 2011 . Diversity and metabolic impact of intestinal Lactobacillus species in healthy adults and the elderly . Br. J. Nutr. 105 : 1235 – 1244 . Google Scholar CrossRef Search ADS PubMed Tanabe H. , Sugiyama K. , Matsuda T. , Kiriyama S. , Morita T. . 2005 . Small intestinal mucins are secreted in proportion to the settling volume in water of dietary indigestible components in rats . J. Nutr. 135 : 2431 – 2437 . Google Scholar CrossRef Search ADS PubMed Teirlynck E. , Bjerrum L. , Eeckhaut V. , Huygebaert G. , Pasmans F. , Haesebrouck F. , Dewulf J. , Ducatelle R. , Van Immerseel F. . 2009 . The cereal type in feed influences gut wall morphology and intestinal immune cell infiltration in broiler chickens . Br. J. Nutr. 102 : 1453 – 1461 . Google Scholar CrossRef Search ADS PubMed Van der Sluis M. , De Koning B. A. E. , De Bruijn A. C. J. M. , Velcich A. , Meijerink J. P. P. , Van Goudoever J. B. , Buller H. A. , Dekker J. , Van Seuningen I. , Renes I. B. , Einerhand A. W. C. . 2006 . Muc2-deficient mice spontaneously develop colitis, indicating that Muc2 is critical for colonic protection . Gastroenterology 131 : 117 – 129 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Ingestion of paddy rice increases intestinal mucin secretion and goblet cell number and prevents dextran sodium sulfate-induced intestinal barrier defect in chickens

Loading next page...
 
/lp/ou_press/ingestion-of-paddy-rice-increases-intestinal-mucin-secretion-and-ULgfqbplzX
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pey202
Publisher site
See Article on Publisher Site

Abstract

ABSTRACT Paddy rice is a potential feed grain for chickens, whose strong gizzards can crush the hull. Here, we investigated whether paddy rice rich in hull-derived water-insoluble dietary fiber stimulates intestinal mucin secretion and production, as well as the possible involvement of paddy rice in intestinal barrier function. Layer male chicks at 7 d of age were divided into four groups according to the diet: corn, polished rice, brown rice, or paddy rice (650 g/kg diet), which they ate for 14 consecutive days. At 21 d of age, the birds were refed their experimental diets, and small intestinal mucin fractions were collected to determine intestinal mucin content. Small intestinal mucin secretion was induced most strongly in the paddy rice group (Experiment 1). The rank order of diet-induced mucin secretion was paddy rice > corn = brown rice > polished rice. Ileal MUC2 gene expression and ileal number of goblet cells were highest in the paddy rice group (Experiment 1). A study of bromodeoxy-U uptake into ileal epithelial cells indicated the increase in goblet cells in the paddy rice group was related to accelerate epithelial cell migration (Experiment 2). A single supplementation of isolated rice hulls without kernels increased MUC2 gene expression and goblet cell numbers (Experiment 3), suggesting the importance of the hull's bulk-forming capacity on mucin production. Finally, chicks fed corn or paddy rice were orally administered dextran sodium sulfate (DSS) to disrupt intestinal barrier function. In the DSS-treated birds, the intestinal permeability of fluorescein isothiocyanate dextran in the everted gut sacs was much lower in the paddy rice group than in the corn group (Experiment 4), showing that paddy rice protects against mucosal disruption. In conclusion, ingestion of paddy rice increases intestinal mucin secretion and production through enhanced MUC2 gene expression and epithelial turnover and prevents DSS-induced intestinal barrier defects in chickens. INTRODUCTION Corn is the primary energy source in poultry feedstuffs, constituting approximately 50 to 70% of the diet, but many types of grains, including wheat, barley, rye, and millet, are alternative energy sources. Rice is one of the most important grains, especially in the Asian monsoon region, where half of the world's rice is produced (FAOSTAT, 2017). Rice can be categorized into three groups according to how it is processed: (1) paddy rice, unprocessed natural rice kernels covered with a hull; (2) brown rice, initially processed whole grain without a hull; (3) polished rice, further milled and polished to remove the bran layer. Recent publications reported that whole grain paddy rice or ground paddy rice can serve as a valuable grain source in poultry diets (Nanto et al., 2012; Sittiya et al., 2014, 2016). Rice hulls are a complex lignocellulosic material rich in water-insoluble dietary fiber (IDF); they consist of lignin 15.4%, cellulose 35.6%, hemicellulose 12.0%, and ash rich in hydrated silica 18.7% by wet weight (Friedman, 2013). The hull is 20 to 30% of a whole rice grain; hence, the ingestion of paddy rice could broadly affect gastrointestinal physiology, mainly through bulk forming capacity of IDF in gut contents. The intraluminal surface of the intestine is covered with a mucosal layer composed of highly glycosylated mucin secreted by goblet cells in the epithelium. Mucins are mainly categorized as either secreted-type or membrane-type mucins. Mucin-2 (MUC2) is the major secreted-type mucin in the intestine, and it forms a protective gel mucosal barrier to prevent potential pathogens and antigens from accessing the underlying epithelium (McGuckin et al., 2011). MUC2-knock out mice develop severe disease when infected by pathogenic bacteria (Bergstrom et al., 2010) and exhibit delayed clearance of nematode parasites (Hasnain et al., 2010). In addition, MUC2 deficiency leads to spontaneous inflammation of the small and large intestines (Van der Sluis et al., 2006). Thus, the enhancement of mucin secretion in young chicks in development of the gut mucosal barrier might be beneficial for preventing the invasion of pathogenic bacteria and toxic antigens. Although mucins are continuously secreted, various dietary components, including dietary fiber, can stimulate mucin secretion in the small intestine (Tanabe et al., 2005; Ito et al., 2009). Small intestinal mucins are secreted in proportion to the settling volume in water (a numerical representation of bulk-forming properties) of IDF (Tanabe et al., 2005) or to the viscosity of water-soluble dietary fibers (Ito et al., 2009). The stimulatory effects of both dietary fibers on mucin secretion seem to be linked to epithelial cell turnover and the subsequent increase in goblet cell numbers (Ito et al., 2009; Hino et al., 2012). These facts led us to the hypothesis that the ingestion of a paddy rice-based diet rich in IDF could stimulate the intestinal mucin secretion and production, resulting in enhanced intestinal barrier function through the development of the mucosal layer. In the present study, to obtain insight into the potential of paddy rice in intestinal mucin secretion and production, we examined mucin secretory and synthetic effects of the ingestion of diets based on corn, polished rice, brown rice, and paddy rice in young chickens. To further elucidate possible role in intestinal barrier function, we examined whether the ingestion of paddy rice prevents increased intestinal permeability induced by dextran sodium sulfate (DSS). MATERIALS AND METHODS Animals and Experimental Diets Fertilized eggs of White Leghorn-type commercial chickens were purchased from a local supplier (Julia Light; Japan Layer, Gifu, Japan). The fertilized eggs were incubated at 37°C with a relative humidity of 58 to 68%, turned once per hour until 18 d of incubation, and then moved to a wire-bottom hatching box. After allowing 24 h for hatching, only male chicks were moved to stainless-steel cages and housed there. The hatched chicks were provided with free access to water and a semi-purified diet based on isolated-soybean protein extract and corn starch (Table 1) for 7 d. At 7 d of age, the birds were allowed free access to experimental diets containing 650 g/kg corn, polished rice, brown rice, or paddy rice (Table 1) for 14 d. The experimental diets were formulated to meet or exceed the nutrient requirements of Leghorn-type chickens (National Research Council, 1994), but the differences in crude protein (CP) and metabolizable energy (ME) values among the diets were not unified. Corn and three forms of rice (Momiroman strain cultivated in Japan) were ground into particles under 3 mm diameter. The photoperiod was set at 16L:8D with lights on at 0800 beginning at 3 d of age. Room temperature was controlled at 32°C at 0 to 3 d of age, 30°C at 3 to 7 d of age, 28°C at 7 to 14 d of age, and 26°C at 14 to 21 d of age. Animal care was in compliance with the applicable guidelines of the Nagoya University Policy on Animal Care and Use (Approved #: 2012030901, 2013021501, 2014021312). Table 1. Composition (g/kg) of experimental diets. Ingredients Semi-purified diet Corn Polished rice Brown rice Paddy rice Corn – 650 – – – Polished rice – – 650 – – Brown rice – – – 650 – Paddy rice – – – – 650 Corn starch 560.7 – – – – Cellulose 50 – – – – Soybean protein extract 250 210.7 210.7 210.7 210.7 Vitamin mixture1 10 10 10 10 10 Mineral mixture2 58.3 58.3 58.3 58.3 58.3 Choline chloride 2 2 2 2 2 Soybean oil 60 60 60 60 60 DL-Methionine 6 6 6 6 6 L-Lysine 1 1 1 1 1 L-Threonine 1 1 1 1 1 L-Tryptophan 1 1 1 1 1 Total 1,000 1,000 1,000 1,000 1,000 Calculated composition Crude protein (%) 21.9 24.3 23.0 23.5 22.8 ME (kcal/kg) 3,461 3,489 3,597 3,493 3,090 Methionine (g/kg) 8.0 8.8 9.0 9.0 8.7 Lysine (g/kg) 14.8 14.7 14.3 14.4 14.2 Threonine (g/kg) 9.3 10.1 9.5 9.6 9.0 Tryptophan (g/kg) 3.0 3.2 3.2 3.3 3.3 Ingredients Semi-purified diet Corn Polished rice Brown rice Paddy rice Corn – 650 – – – Polished rice – – 650 – – Brown rice – – – 650 – Paddy rice – – – – 650 Corn starch 560.7 – – – – Cellulose 50 – – – – Soybean protein extract 250 210.7 210.7 210.7 210.7 Vitamin mixture1 10 10 10 10 10 Mineral mixture2 58.3 58.3 58.3 58.3 58.3 Choline chloride 2 2 2 2 2 Soybean oil 60 60 60 60 60 DL-Methionine 6 6 6 6 6 L-Lysine 1 1 1 1 1 L-Threonine 1 1 1 1 1 L-Tryptophan 1 1 1 1 1 Total 1,000 1,000 1,000 1,000 1,000 Calculated composition Crude protein (%) 21.9 24.3 23.0 23.5 22.8 ME (kcal/kg) 3,461 3,489 3,597 3,493 3,090 Methionine (g/kg) 8.0 8.8 9.0 9.0 8.7 Lysine (g/kg) 14.8 14.7 14.3 14.4 14.2 Threonine (g/kg) 9.3 10.1 9.5 9.6 9.0 Tryptophan (g/kg) 3.0 3.2 3.2 3.3 3.3 1Vitamin mixture provided the following (per kg of diet): nicotinic acid, 30 mg; pantothenate, 15 mg; pyridoxine, 6 mg; thiamin, 5 mg; riboflavin, 6 mg; folic acid, 2 mg; vitamin K, 750 μg; D-biotin, 200 μg; vitamin B12, 25 μg; vitamin A, 4,000 IU; vitamin D3, 1,000 IU; vitamin E, 75 IU. 2Mineral mixture provided the following (per kg of diet): CaHPO4•2H2O, 20.7 g; KH2PO4, 10 g; CaCO3, 14.8 g; KCl, 3 g; NaCl, 6 g; MgSO4, 3 g; FeSO4•7H2O, 0.5 g; MnSO4•5H2O, 0.35 g; KI, 2.6 mg; CuSO4•5H2O, 40 mg; ZnO, 62 mg; Na2MoO4•2H2O, 8.3 mg; Na2SeO3, 0.4 mg; CoCl2•6H2O, 1.7 mg. View Large Table 1. Composition (g/kg) of experimental diets. Ingredients Semi-purified diet Corn Polished rice Brown rice Paddy rice Corn – 650 – – – Polished rice – – 650 – – Brown rice – – – 650 – Paddy rice – – – – 650 Corn starch 560.7 – – – – Cellulose 50 – – – – Soybean protein extract 250 210.7 210.7 210.7 210.7 Vitamin mixture1 10 10 10 10 10 Mineral mixture2 58.3 58.3 58.3 58.3 58.3 Choline chloride 2 2 2 2 2 Soybean oil 60 60 60 60 60 DL-Methionine 6 6 6 6 6 L-Lysine 1 1 1 1 1 L-Threonine 1 1 1 1 1 L-Tryptophan 1 1 1 1 1 Total 1,000 1,000 1,000 1,000 1,000 Calculated composition Crude protein (%) 21.9 24.3 23.0 23.5 22.8 ME (kcal/kg) 3,461 3,489 3,597 3,493 3,090 Methionine (g/kg) 8.0 8.8 9.0 9.0 8.7 Lysine (g/kg) 14.8 14.7 14.3 14.4 14.2 Threonine (g/kg) 9.3 10.1 9.5 9.6 9.0 Tryptophan (g/kg) 3.0 3.2 3.2 3.3 3.3 Ingredients Semi-purified diet Corn Polished rice Brown rice Paddy rice Corn – 650 – – – Polished rice – – 650 – – Brown rice – – – 650 – Paddy rice – – – – 650 Corn starch 560.7 – – – – Cellulose 50 – – – – Soybean protein extract 250 210.7 210.7 210.7 210.7 Vitamin mixture1 10 10 10 10 10 Mineral mixture2 58.3 58.3 58.3 58.3 58.3 Choline chloride 2 2 2 2 2 Soybean oil 60 60 60 60 60 DL-Methionine 6 6 6 6 6 L-Lysine 1 1 1 1 1 L-Threonine 1 1 1 1 1 L-Tryptophan 1 1 1 1 1 Total 1,000 1,000 1,000 1,000 1,000 Calculated composition Crude protein (%) 21.9 24.3 23.0 23.5 22.8 ME (kcal/kg) 3,461 3,489 3,597 3,493 3,090 Methionine (g/kg) 8.0 8.8 9.0 9.0 8.7 Lysine (g/kg) 14.8 14.7 14.3 14.4 14.2 Threonine (g/kg) 9.3 10.1 9.5 9.6 9.0 Tryptophan (g/kg) 3.0 3.2 3.2 3.3 3.3 1Vitamin mixture provided the following (per kg of diet): nicotinic acid, 30 mg; pantothenate, 15 mg; pyridoxine, 6 mg; thiamin, 5 mg; riboflavin, 6 mg; folic acid, 2 mg; vitamin K, 750 μg; D-biotin, 200 μg; vitamin B12, 25 μg; vitamin A, 4,000 IU; vitamin D3, 1,000 IU; vitamin E, 75 IU. 2Mineral mixture provided the following (per kg of diet): CaHPO4•2H2O, 20.7 g; KH2PO4, 10 g; CaCO3, 14.8 g; KCl, 3 g; NaCl, 6 g; MgSO4, 3 g; FeSO4•7H2O, 0.5 g; MnSO4•5H2O, 0.35 g; KI, 2.6 mg; CuSO4•5H2O, 40 mg; ZnO, 62 mg; Na2MoO4•2H2O, 8.3 mg; Na2SeO3, 0.4 mg; CoCl2•6H2O, 1.7 mg. View Large Experimental Design Experiment 1 Two independent feeding trials were conducted. In both trials, 7-d-old chickens were allocated into four groups (7 birds each) on the basis of BW to give a similar mean BW (60 to 75 g at 1 wk of age) across all groups, and each bird was caged individually. The four groups were fed each experimental diet (Table 1) for 14 d. At d 21 of age, the diets were withdrawn overnight (00 00 to 08 00) to empty the stomach and small intestine. Birds were refed their respective diets for 90 min, and then they were euthanized by decapitation. Luminal contents and gut tissue samples were sampled from all birds (n = 14/group in two trials). The small intestine was excised after the duodenal loop to the ileocecal junction (jejunum and ileum). Luminal contents were gathered by flushing with 15 mL of ice-cold PBS (pH 7.4) containing 0.02 M NaN3 and the same volume of air. The contents were freeze-dried and stored for luminal mucin analysis. Proventriculus, gizzard, duodenum, both ceca, and rectum were dissected, flushed with ice-cold saline, and weighed. Combined weights of duodenum, jejunum, and ileum were considered as small intestinal weight. Segments (1 to 2 cm) of the jejunum and ileum were further excised for the measurement of gene expression and for histological analysis. Tissue samples for gene expression were rapidly frozen in liquid nitrogen and stored at −80°C. Tissue samples for histological analysis were fixed with Mildform (Wako Pure Chemical, Osaka, Japan). Fecal samples (n = 7/group in the second trial) were collected on the day before tissue collection for a quantitative analysis of the fecal total eubacteria and Lactobacillus contents only in the second trial. The collected fecal samples were rapidly frozen in liquid nitrogen and stored at −80°C. Experiment 2 At 7 d of age, chickens were allocated into four groups (7 birds each), and each bird was caged individually. The same dietary treatments as in Experiment 1 were used. To examine epithelial cell migration, 5′-bromo-deoxyuridine (BrdU; 50 mg/kg BW) was intraperitoneally injected into each bird 48 h prior to sample collection. At 21 d of age, the birds were euthanized by decapitation. The ileum segments (n = 7/group) were removed and were fixed with Mildform. Experiment 3 At 7 d of age, chickens were allocated into four groups (7 birds each): control, bran, hull, and bran + hull groups. Each bird was caged individually. The bran (powder) and hull were isolated from the paddy rice, and the isolated hull was ground into particles under 3 mm diameter. The isolated bran and hull were externally supplemental to a semi-purified diet (Table 1) at 100 g/kg. The bran + hull diet included both bran and hull at 100 g/kg each (total 200 g/kg). At 21 d of age, the birds were euthanized by decapitation, and the jejunal and ileal segments (n = 7/group) were removed for analyses of MUC2 gene expression and goblet cell number. Experiment 4 Two feeding trials were conducted. In both trials, each bird was caged individually at 7 d of age. In the first trial, chickens were allowed continuous free access to a semi-purified diet (Table 1) until 22 d of age. At 14 d of age, the birds were allocated into two groups (3 birds each): a control group and a DSS group. The DSS group was given 2% DSS (w/v; M.W. 36,000 to 50,000; MP Biomedicals, Santa Ana, CA, USA) in pure drinking water, whereas the control group was given only pure water. After 8 d of DSS treatment, the birds were euthanized by decapitation. The jejunum, ileum, and rectum (n = 3/group) were removed and subjected to an intestinal permeability test. In the second trial, chickens were allocated into four groups (5 birds each) at 7 d of age: two groups (control and DSS groups) were given a corn-based diet, and another two groups (control and DSS groups) were given a paddy rice-based diet. The birds were freely fed these diets from 7 to 23 d of age. The DSS groups and the control groups were given 2% DSS with pure water and only pure water, respectively, from 14 to 23 d of age. Finally, the birds were euthanized by decapitation and the ileal segments (n = 5/group) were removed and subjected to an intestinal permeability test. Preparation of Mucin Fraction The mucin fraction was isolated by the method of Morita et al. (2004). Total freeze-dried samples were suspended in 0.15 M NaCl solution at 4°C. The samples were homogenized for 1 min and immediately centrifuged at 10,000 × g for 30 min. The supernatants were mixed with EtOH to give a final concentration of 60% EtOH (v/v), and the resultant precipitates were dissolved in 3 mL pure water. The crude mucin solution was freeze-dried and redissolved in 2 mL pure water for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. O-linked oligosaccharide chains in the redissolved solution were also measured as markers of mucin content. Quantitation of Mucin by SDS-PAGE and PAS Staining, and Detection of O-Linked Oligosaccharide Chains The mucin fraction at 16 μL mixed with 4 μL SDS sample loading buffer (5x) was separated by SDS-PAGE (3% stacking gel/6% running gel) under reducing conditions. The gels were stained with periodic acid-Schiff (PAS) for sugars (glycoprotein). The density of the PAS-stained area was analyzed using ImageJ ver. 1.46 (NIH: https://imagej.nih.gov/ij/). O-linked oligosaccharide chains were measured by the method of Crowther and Wetmore (1987) using a fluorometric assay discriminating O-linked glycoproteins (mucin) and N-linked glycoproteins (others). After 50 times dilution of the mucin fraction, the sample was reacted with 2-cyanoacetamide. Standard solutions of N-acetylgalactosamine (Sigma-Aldrich, St Louis, MO, USA) were used to calculate the amounts of oligosaccharide chains liberated from extracted mucins. Histologic Evaluation The fixed intestinal samples were paraffin-embedded and then sliced with a microtome into 4 μm sections. Three cross sections per bird were stained with PAS and counterstained with hematoxylin. The PAS-reactive goblet cells on one side of the villus (left side of the crypt column) were counted on 15 individual villi per bird using light microscopy according to the method of Tanabe et al. (2005) with modification. To visualize BrdU-incorporated epithelial cells, three 4-μm-thick cross sections per bird were collected on MAS-coated slides (Matsunami Glass Ind., Osaka, Japan). The sections were incubated in 10 mM citrate buffer (pH 6.0) at 100°C for 20 min to retrieve antigens. After blocking, the sections were incubated with anti-BrdU (1:100, clone: ZBU30; Merck, Darmstadt, Germany) for 1 h. The sections were further incubated with biotinylated horse anti-mouse IgG (Vectastain Elite ABC Mouse IgG kit; Vector Laboratories, Burlingame, CA, USA) for 30 min and subsequently incubated with avidin−biotin−peroxidase complex reagent for 30 min. Finally, the sections were visualized with diaminobenzidine solution (Dako, Glostrup, Denmark) followed by counterstaining with hematoxylin. The distance from the uppermost BrdU-labeled cells to its crypt was measured according to the method of Ito et al. (2009) with modification. The proportion of the uppermost-BrdU cell distance to the total villus length was calculated. The proportion was calculated for 15 individual villi per bird. RNA Preparation and Expression Analysis by Quantitative Real-Time PCR Total RNA was extracted from tissue samples using TRI reagent (Molecular Research Center, Cincinnati, OH, USA). Total RNA was then treated with DNase using a Turbo DNA-free kit (Ambion®, Thermo Fisher Scientific, Waltham, MA, USA). First-strand cDNA was synthesized from total RNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). The gene expressions were quantitated by real-time PCR with a SYBR green system (Toyobo, Osaka, Japan) according to the manufacturer's instructions. Each 15 μL qPCR mixture consisted of 7.5 μL SYBR Green Master Mix, 0.45 μL of each primer (300 nM final), 1 μL of synthesized cDNA or its diluted solution (1-100 fold), and 5.6 μL PCR-grade water. PCR was performed by initial denaturation at 95°C for 2 min, followed by 40 cycles of denaturation at 95°C for 15 s and primer annealing at 60°C for 60 s, with a final cycle of 95°C for 15 s, 60°C for 30 s, and 95°C for 15 s for analysis of the primer-dissociation curve. The expression data were normalized to endogenous 18S rRNA expression. Specific primer pairs were designed based on NCBI GenBank data (Table 2). Table 2. Primer sequences, corresponding accession numbers, and amplification sizes. Gene Accession no. Primer sequence 5′→3′ Product size (bp) Cited paper 18SrRNA AF173612 F: TCCCCTCCCGTTACTTGGAT 60 – R: GCGCTCGTCGGCATGTA MUC2 XM_421035 F: TTCATGATGCCTGCTCTTGTG 93 – R: CTGAGCCTTGGTACATTCTTGT Bacterial 16SrRNA – F:ACTCCTACGGGAGGCAGCAGT 200 Nakayama et al. (2007) R: GTATTACCGCGGCTGCTGGCAC Lactobacillus 16SrRNA – F:AGCAGTAGGGAATCTTCCA 341 Štšepetova et al. (2011) R: CACCGCTACACATGGAG Gene Accession no. Primer sequence 5′→3′ Product size (bp) Cited paper 18SrRNA AF173612 F: TCCCCTCCCGTTACTTGGAT 60 – R: GCGCTCGTCGGCATGTA MUC2 XM_421035 F: TTCATGATGCCTGCTCTTGTG 93 – R: CTGAGCCTTGGTACATTCTTGT Bacterial 16SrRNA – F:ACTCCTACGGGAGGCAGCAGT 200 Nakayama et al. (2007) R: GTATTACCGCGGCTGCTGGCAC Lactobacillus 16SrRNA – F:AGCAGTAGGGAATCTTCCA 341 Štšepetova et al. (2011) R: CACCGCTACACATGGAG View Large Table 2. Primer sequences, corresponding accession numbers, and amplification sizes. Gene Accession no. Primer sequence 5′→3′ Product size (bp) Cited paper 18SrRNA AF173612 F: TCCCCTCCCGTTACTTGGAT 60 – R: GCGCTCGTCGGCATGTA MUC2 XM_421035 F: TTCATGATGCCTGCTCTTGTG 93 – R: CTGAGCCTTGGTACATTCTTGT Bacterial 16SrRNA – F:ACTCCTACGGGAGGCAGCAGT 200 Nakayama et al. (2007) R: GTATTACCGCGGCTGCTGGCAC Lactobacillus 16SrRNA – F:AGCAGTAGGGAATCTTCCA 341 Štšepetova et al. (2011) R: CACCGCTACACATGGAG Gene Accession no. Primer sequence 5′→3′ Product size (bp) Cited paper 18SrRNA AF173612 F: TCCCCTCCCGTTACTTGGAT 60 – R: GCGCTCGTCGGCATGTA MUC2 XM_421035 F: TTCATGATGCCTGCTCTTGTG 93 – R: CTGAGCCTTGGTACATTCTTGT Bacterial 16SrRNA – F:ACTCCTACGGGAGGCAGCAGT 200 Nakayama et al. (2007) R: GTATTACCGCGGCTGCTGGCAC Lactobacillus 16SrRNA – F:AGCAGTAGGGAATCTTCCA 341 Štšepetova et al. (2011) R: CACCGCTACACATGGAG View Large Quantification of Fecal Bacteria by Real-Time PCR Bacterial genomic DNA was isolated from 200 mg of feces using a QIAamp DNA Stool Mini Kit (QIAGEN, Hilden, Germany). Bacterial 16S rDNA was quantitated by real-time PCR with an SYBR Green system as described previously (Murai et al., 2016). The primers to detect the total bacteria (Nakayama et al., 2007) and Lactobacillus group (Štšepetova et al., 2011) are listed in Table 2. Gut Permeability Test Gut permeability to fluorescein isothiocyanate (FITC)-labeled dextran with a molecular weight of 4,000 (FD-4, Sigma) was evaluated in the everted jejunum, ileum, and rectum according to the method of Azuma et al. (2013) with modification. The intestine was everted with a blunt glass rod and closed with a clip at one end. The other end was closed after injection with Tyrode's balanced salt solution including 1 g glucose/L. The everted intestine was incubated in Tyrode's solution supplemented with 100 μg/mL FITC-dextran for 30 min at 37°C in a water bath. After incubation, the inner solution was collected and the fluorescence of FITC-dextran in the inner solution was determined using a spectrofluorometer (excitation 490 nm, emission 525 nm) to calculate the amount of FITC-dextran. Statistical Analysis In Experiment 1, the data of two trials were pooled and analyzed (n = 14/group) except for bacterial population (n = 7/group). In Experiments 2 to 4, the data of single trial were analyzed (n = 7/group in Experiment 2 and 3; n = 3 or 5 in Experiment 4). In Experiments 1 to 3, the data were analyzed by one-way (Experiment 1 and 2) and two-way ANOVA (Experiment 3), and the differences between means were assessed by Tukey–Kramer's test. In Experiment 4, to compare the differences between the control group and the DSS group, the data were analyzed by Student's t-test. The results were expressed as means ± SEM. A probability value of P < 0.05 was considered statistically significant. Statistical analysis was performed with the program SAS 9.1 (SAS Institute, Cary, NC, USA). RESULTS Experiment 1: Growth Performance There were no significant differences in final BW among the four diets, although polished rice caused a 3 to 4% reduction compared to corn, brown rice, and paddy rice (Table 3). Feed intake of paddy rice was the highest among all diets (P < 0.05), probably because it had the lowest ME value. Consequently, the feed efficiency of paddy rice was the lowest among the treatments. Ingestion of paddy rice or corn tended to increase the weights of various parts of the gut compared with polished or brown rice. Gizzard weight was highest in the paddy rice birds (P < 0.05). Regardless of diet, there were no changes in small intestine weight or rectal weight. Table 3. Growth performance and final tissue weights in chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d1 (Experiment 1). Corn Polished rice Brown rice Paddy rice Final BW (g) 204.2 ± 3.1 195.8 ± 3.3 202.4 ± 2.3 201.6 ± 3.0 Feed intake (g/day) 16.8 ± 0.3b 16.4 ± 0.4b 16.7 ± 0.3b 18.0 ± 0.2a Feed efficiency 0.628 ± 0.007a 0.610 ± 0.009a,b 0.629 ± 0.011a 0.578 ± 0.007b Tissue weight (g/100 gBW) Proventriculus 0.761 ± 0.016a 0.663 ± 0.016c 0.691 ± 0.010bc 0.723 ± 0.011a,b Gizzard 4.36 ± 0.10b 2.13 ± 0.08c 2.31 ± 0.05c 5.18 ± 0.14a Small intestine 4.44 ± 0.11 4.30 ± 0.11 4.17 ± 0.12 4.24 ± 0.11 Cecum 0.520 ± 0.031a,b 0.451 ± 0.042a,b 0.403 ± 0.028b 0.546 ± 0.035a Rectum 0.177 ± 0.007 0.163 ± 0.004 0.160 ± 0.005 0.185 ± 0.010 Corn Polished rice Brown rice Paddy rice Final BW (g) 204.2 ± 3.1 195.8 ± 3.3 202.4 ± 2.3 201.6 ± 3.0 Feed intake (g/day) 16.8 ± 0.3b 16.4 ± 0.4b 16.7 ± 0.3b 18.0 ± 0.2a Feed efficiency 0.628 ± 0.007a 0.610 ± 0.009a,b 0.629 ± 0.011a 0.578 ± 0.007b Tissue weight (g/100 gBW) Proventriculus 0.761 ± 0.016a 0.663 ± 0.016c 0.691 ± 0.010bc 0.723 ± 0.011a,b Gizzard 4.36 ± 0.10b 2.13 ± 0.08c 2.31 ± 0.05c 5.18 ± 0.14a Small intestine 4.44 ± 0.11 4.30 ± 0.11 4.17 ± 0.12 4.24 ± 0.11 Cecum 0.520 ± 0.031a,b 0.451 ± 0.042a,b 0.403 ± 0.028b 0.546 ± 0.035a Rectum 0.177 ± 0.007 0.163 ± 0.004 0.160 ± 0.005 0.185 ± 0.010 1Values are means ± SEM, n = 14. a, b, cMeans having different superscripts are significantly different at P < 0.05. View Large Table 3. Growth performance and final tissue weights in chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d1 (Experiment 1). Corn Polished rice Brown rice Paddy rice Final BW (g) 204.2 ± 3.1 195.8 ± 3.3 202.4 ± 2.3 201.6 ± 3.0 Feed intake (g/day) 16.8 ± 0.3b 16.4 ± 0.4b 16.7 ± 0.3b 18.0 ± 0.2a Feed efficiency 0.628 ± 0.007a 0.610 ± 0.009a,b 0.629 ± 0.011a 0.578 ± 0.007b Tissue weight (g/100 gBW) Proventriculus 0.761 ± 0.016a 0.663 ± 0.016c 0.691 ± 0.010bc 0.723 ± 0.011a,b Gizzard 4.36 ± 0.10b 2.13 ± 0.08c 2.31 ± 0.05c 5.18 ± 0.14a Small intestine 4.44 ± 0.11 4.30 ± 0.11 4.17 ± 0.12 4.24 ± 0.11 Cecum 0.520 ± 0.031a,b 0.451 ± 0.042a,b 0.403 ± 0.028b 0.546 ± 0.035a Rectum 0.177 ± 0.007 0.163 ± 0.004 0.160 ± 0.005 0.185 ± 0.010 Corn Polished rice Brown rice Paddy rice Final BW (g) 204.2 ± 3.1 195.8 ± 3.3 202.4 ± 2.3 201.6 ± 3.0 Feed intake (g/day) 16.8 ± 0.3b 16.4 ± 0.4b 16.7 ± 0.3b 18.0 ± 0.2a Feed efficiency 0.628 ± 0.007a 0.610 ± 0.009a,b 0.629 ± 0.011a 0.578 ± 0.007b Tissue weight (g/100 gBW) Proventriculus 0.761 ± 0.016a 0.663 ± 0.016c 0.691 ± 0.010bc 0.723 ± 0.011a,b Gizzard 4.36 ± 0.10b 2.13 ± 0.08c 2.31 ± 0.05c 5.18 ± 0.14a Small intestine 4.44 ± 0.11 4.30 ± 0.11 4.17 ± 0.12 4.24 ± 0.11 Cecum 0.520 ± 0.031a,b 0.451 ± 0.042a,b 0.403 ± 0.028b 0.546 ± 0.035a Rectum 0.177 ± 0.007 0.163 ± 0.004 0.160 ± 0.005 0.185 ± 0.010 1Values are means ± SEM, n = 14. a, b, cMeans having different superscripts are significantly different at P < 0.05. View Large Mucin Secretion and Production in Intestine Ingestion of paddy rice most strongly increased PAS-reactive substances in the mucin fraction of the small intestine content, whereas the ingestion of polished rice produced the lowest amounts of PAS-reactive substances (Figure 1A; P < 0.05). Ingestion of corn or brown rice revealed intermediate levels of PAS-reactive substances between paddy rice and polished rice. O-linked oligosaccharide chain contents were also highest in the paddy rice birds (Figure 1B; P < 0.05). The rank order of diet-induced mucin secretion was paddy rice > corn = brown rice > polished rice. Prior to this study, we confirmed that MUC2 gene expression was markedly higher than the expression of other secreted-type mucins (MUC5AC, MUC5B, MUC6) in chicken intestines (data not shown). In this study, we measured MUC2 gene expression. In the jejunum, MUC2 gene expression was comparable among the groups (P > 0.05). In the ileum, MUC2 gene expression was highest in the paddy rice birds in comparison to the polished rice group (P < 0.05), but not different from the corn or brown rice groups (Figure 1C). Figure 1. View largeDownload slide PAS-reactive substances (A) and O-linked oligosaccharide chains (B) in small intestinal mucin fraction, and MUC2 gene expression in jejunum and ileum (C) of chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 1). AU; arbitrary unit. Vertical bars indicate means ± SEM, n = 14. a, b, c Means having different superscripts are significantly different at P < 0.05. Figure 1. View largeDownload slide PAS-reactive substances (A) and O-linked oligosaccharide chains (B) in small intestinal mucin fraction, and MUC2 gene expression in jejunum and ileum (C) of chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 1). AU; arbitrary unit. Vertical bars indicate means ± SEM, n = 14. a, b, c Means having different superscripts are significantly different at P < 0.05. Histological analysis showed that goblet cell numbers in the ileum were also the highest in paddy rice birds (Figure 2; P < 0.05). The increase in goblet cells was more evident in the ileal section (24% increase; paddy rice vs. polished rice) compared to the jejunal section (11% increase). Figure 2. View largeDownload slide Light micrographs of jejunum (A) and ileum (B), and number of goblet cells (C) in chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 1). Micrographs were stained with PAS reagent and hematoxylin. Black bar indicates 100 μm. Vertical bars indicate means ± SEM, n = 14. a, b Means having different superscripts are significantly different at P < 0.05. Figure 2. View largeDownload slide Light micrographs of jejunum (A) and ileum (B), and number of goblet cells (C) in chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 1). Micrographs were stained with PAS reagent and hematoxylin. Black bar indicates 100 μm. Vertical bars indicate means ± SEM, n = 14. a, b Means having different superscripts are significantly different at P < 0.05. To determine changes in the gut bacterial population, real-time PCR with total bacteria and Lactobacillus-specific primers targeting the 16S rDNA genes was performed in fecal samples. There were no changes in the numbers of total bacteria (P > 0.05), but the paddy rice birds showed significantly fewer Lactobacillus species compared to the corn and polished rice birds (Figure 3; P < 0.05). Figure 3. View largeDownload slide Total bacterial population and Lactobacillus population counted in feces of chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 1). Bacterial 16S rDNA was quantitated by real-time PCR. Vertical bars indicate means ± SEM, n = 7. a, b Means having different superscripts are significantly different at P < 0.05. Figure 3. View largeDownload slide Total bacterial population and Lactobacillus population counted in feces of chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 1). Bacterial 16S rDNA was quantitated by real-time PCR. Vertical bars indicate means ± SEM, n = 7. a, b Means having different superscripts are significantly different at P < 0.05. Experiment 2: Epithelial Cell Migration in Ileum The position of the uppermost BrdU-labeled cells from the crypt bottom of the villus differed significantly among the groups; it was highest and lowest in the paddy rice and polished rice birds, respectively (Figure 4; P < 0.05). The epithelial cell migration was parallel to changes in mucin secretion, MUC2 gene expression, and goblet cell numbers. Figure 4. View largeDownload slide Light micrographs indicating incorporation of BrdU into ileal epithelial cells in chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 2). Arrows indicate the uppermost migrated BrdU-positive cells on a villus. Black bar indicates 100 μm. Vertical bars indicate means ± SEM, n = 7. a, b Means having different superscripts are significantly different at P < 0.05. Figure 4. View largeDownload slide Light micrographs indicating incorporation of BrdU into ileal epithelial cells in chickens given a corn-, polished rice-, brown rice-, or paddy rice-based diet for 14 d (Experiment 2). Arrows indicate the uppermost migrated BrdU-positive cells on a villus. Black bar indicates 100 μm. Vertical bars indicate means ± SEM, n = 7. a, b Means having different superscripts are significantly different at P < 0.05. Experiment 3: Effects of Rice Bran and Rice Hull on MUC2 Gene Expression and Goblet Cell Number To clarify the main component in the stimulation of mucin production, rice hulls and rice bran isolated from the identical paddy rice were used to supplement the basal semi-purified diet. Ingestion of rice hull alone doubled MUC2 gene expression in the ileum compared to the control diet (P < 0.05), with a weaker effect in the jejunum (P > 0.05) (Figure 5A). Oppositely, ingestion of rice bran tended to decrease MUC2 gene expression in both the jejunum and ileum. Ingestion of rice hulls also increased the numbers of goblet cells in both the jejunum (P < 0.05) and ileum (P = 0.058), although ingestion of rice bran did not affect these parameters (Figure 5B). Figure 5. View largeDownload slide MUC2 gene expression (A) and number of goblet cells (B) in jejunum and ileum of chickens given semi-purified diets supplemented with or without bran, hull, or bran + hull for 14 d (Experiment 3). MUC2 gene expression was quantitated by real-time PCR. Vertical bars indicate means ± SEM, n = 7. *Significant effect of the main or interaction effect at P < 0.05; **Significant effect of the main effect at P < 0.01; NS, Not significant. a, b Means having different superscripts are significantly different at P < 0.05. Figure 5. View largeDownload slide MUC2 gene expression (A) and number of goblet cells (B) in jejunum and ileum of chickens given semi-purified diets supplemented with or without bran, hull, or bran + hull for 14 d (Experiment 3). MUC2 gene expression was quantitated by real-time PCR. Vertical bars indicate means ± SEM, n = 7. *Significant effect of the main or interaction effect at P < 0.05; **Significant effect of the main effect at P < 0.01; NS, Not significant. a, b Means having different superscripts are significantly different at P < 0.05. Experiment 4: Intestinal Permeability Fluorescein isothiocyanate-dextran, FD-4, is known to permeate the paracellular pathways of intestinal epithelial cells and is used as an indicator of intestinal tight junction barrier integrity. First, birds given a basal semi-purified diet were preliminary tested to determine whether oral administration of DSS induces an intestinal barrier defect. A DSS-induced barrier defect, as indicated by increased FITC-dextran permeability, was observed in all everted gut sacs but especially those in the ileum (Figure 6A; P < 0.05). Second, birds were given the corn- or paddy rice-based diet, and then the FITC-dextran permeability test was performed using ileal everted sacs after DSS treatment. In the corn group, DSS treatment increased FITC-dextran permeability by 2.5-fold (P < 0.05), whereas in the paddy rice group FITC-dextran permeability was not significantly changed (P > 0.05) (Figure 6B). Figure 6. View largeDownload slide FITC-dextran permeability in various parts of intestine (A) and in ileum (B) of chickens administered water (control) or DSS (Experiment 4). (A) The birds were given a semi-purified diet for 22 d. (B) The birds were given a corn- or paddy rice-based diet for 16 d. The permeation of FITC-dextran into everted gut sacs was determined by a spectrofluorometer. Vertical bars indicate means ± SEM, n = 3 (A) and n = 5 (B). a, bMeans having different superscripts are significantly different at P < 0.05. Figure 6. View largeDownload slide FITC-dextran permeability in various parts of intestine (A) and in ileum (B) of chickens administered water (control) or DSS (Experiment 4). (A) The birds were given a semi-purified diet for 22 d. (B) The birds were given a corn- or paddy rice-based diet for 16 d. The permeation of FITC-dextran into everted gut sacs was determined by a spectrofluorometer. Vertical bars indicate means ± SEM, n = 3 (A) and n = 5 (B). a, bMeans having different superscripts are significantly different at P < 0.05. DISCUSSION In this study, ingestion of paddy rice stimulated small intestinal mucin secretion in chickens more significantly than did ingestion of corn, brown rice, or polished rice. The significant difference in MUC2 gene expression and rapid epithelial turnover were observed between paddy rice and polished rice; however, it was not significantly different from corn or brown rice groups. Although the feed efficiency of paddy rice was the lowest among the treatments due to low ME value, paddy rice group exhibited normal BW. Ingestion of paddy rice also ameliorated intestinal permeability in DSS-induced experimental “leaky gut,” whereas ingestion of corn did not. These results support our hypothesis that paddy rice rich in IDF can potentiate mucin secretion and production, and furthermore can enhance intestinal barrier function through development of the mucosal barrier. In rats, the importance of the physical properties served by dietary fibers on intestinal mucin secretion has been well studied. In an early report, small intestine mucin secretion was enhanced by citrus fiber ingestion including pectin, hemicellulose, and IDF (Satchithanandam et al., 1990). Tanabe et al. (2005) showed that supplementation of polystyrene foam at 10 to 90 g/kg diet increased intestinal mucin secretion in rats in proportion to its bulk-forming capacity. They also reported that various naturally occurring IDF (cellulose, corn husk, beet fiber, and wheat bran) increased intestinal mucin secretion in proportion to their bulk-forming capacities. Paddy rice is rich in IDF compared to corn and brown rice. In paddy rice, acid detergent fiber (ADF; index of indigestible lignin and cellulose content) accounts for approximately 13% of dry weight, whereas corn and brown rice consist of 3 and 1.5% ADF, respectively (NARO, 2017). Differences in cellulose and lignin contents between paddy rice and the other three groups (corn, polished rice, and brown rice) tested here are the most plausible explanation for the ability to potentiate mucin secretion and production. The increased luminal mucin secretion and ileal MUC2 gene expression in the birds fed paddy rice can be partially explained by the increased goblet cell numbers, probably due to rapid epithelial turnover. In the present results, the BrdU incorporation study showed that the position of the uppermost BrdU-labeled cell along the villi was highest in chicks fed the paddy rice diet among the four groups. We speculated that the accelerated epithelial cell migration might increase terminally differentiated goblet cells, which would result in increased goblet cell numbers and elevated MUC2 gene expression. At present, the precise mechanism responsible for the increase in goblet cells after ingestion of paddy rice is unclear. In general, IDF causes the retention of the more bulky digesta along the small intestinal tract, leading to an increase in intraluminal pressure. Ito et al. (2009) suggested that the increased intraluminal pressure and “differential stretching force” might affect the differentiation of stem cells or immature cells committed to become goblet cells. In support of this concept, the present study showed that ingestion of grain-free rice hull stimulated MUC2 gene expression and goblet cell numbers. In addition, ingestion of a dietary fiber-rich diet, including whole paddy rice (Sittiya et al., 2016), wheat/rye (Teirlynck et al., 2009), methylcellulose (Rahmatnejad and Saki, 2016), or lignin (Baurhoo et al., 2007) increased goblet cell numbers and the proliferation of larger goblet cells in chicken intestine. The present study also showed that paddy rice-stimulated MUC2 gene expression and increased goblet cell numbers were more intense in the ileum rather than the jejunum, which might be reflected more in intraluminal pressure in the distal intestine (ileum) by residual IDF than in the proximal intestine (jejunum). We hypothesize that the ingestion of paddy rice and rice hulls enhances goblet cell differentiation in the small intestine through intense physical pressure on the intestinal wall and on epithelial cells. It remains unclear how gut microbiota contribute to mucin secretion and production during paddy rice intake. In germ-free chickens, the absence of bacteria in the gut caused a reduction in goblet cell number and density, as well as reduced MUC2 gene expression, in the small intestine compared with conventional chickens (Cheled-Shoval et al., 2014). Inversely, infection of mucosal surfaces can result in a rapid release of stored mucin granules to bolster the barrier and exclude pathogens, and then the recognition of pathogens by the host leads to the production of host inflammatory factors inducing the differentiation of goblet cells and the transcription of mucins (McGuckin et al., 2011). Similarly, a probiotic supplement consisting of Lactobacillus or other species increased goblet cell numbers and mucin gene expression in the chicken small intestine (Smirnov et al., 2005; Aliakbarpour et al., 2012). In the present study, however, ingestion of paddy rice did not influence total bacterial numbers but decreased Lactobacillus species in feces. Thus, it is unlikely that modification of the gut microbiota by paddy rice is involved in the enhancement of mucin secretion and production. The present study provides evidence of the preventive effect of paddy rice on DSS-induced “leaky gut” in chickens. Oral administration of DSS is commonly used to induce enteric inflammation in rodent models. In addition, DSS-induced colitis has been widely used as a model in studies of the pathogenesis and treatment of human inflammatory bowel disease. DSS has a high negative charge due to the presence of a sulfate group; it is toxic to gut epithelia and induces erosions that ultimately compromise barrier integrity, resulting in increased epithelial permeability (Conn, 2013). It was reported recently that oral administration of DSS is applicable to a gut leakage model in chickens (Kuttappan et al., 2015). In this study, we have successfully demonstrated that oral administration of DSS increased FITC-dextran permeability in everted gut sacs. As expected, after oral administration of DSS, ileal everted sacs for birds fed paddy rice-based diet were less permeable to FITC-dextran than those for birds fed corn-based diet. Although there was no direct evidence of an association between the increased mucin and ameliorative intestinal permeability, it seems likely that paddy rice-induced mucin secretion and production might compensate for the diminished mucosal layer by DSS. This offers the possibility that ingestion of paddy rice prevents invasion by pathogenic bacteria by fortifying intestinal mucin secretion and production. There are several limitations in this study. First, we have not examined whether ingestion of paddy rice suppresses infection by pathogens penetrating into the intestine. Second, the experimental diets used here were semi-purified diets based on isolated-soybean protein in order to allow us to focus on paddy rice-derived dietary fiber. Third, our data were limited to layer chicks, and responses in broilers and mature layers remain uncertain. Despite these limitations, this is the first report to characterize enhanced mucin secretion and production in chickens given paddy rice. Our results can help to advance our understanding of whole grains as feedstuffs to enhance gut barrier function. In conclusion, ingestion of paddy rice increases intestinal mucin secretion and production through enhanced MUC2 gene expression and epithelial turnover and prevents DSS-induced intestinal barrier defects in chickens. These results suggest a possible link between enhanced mucin secretion and intestinal barrier function. ACKNOWLEDGMENTS This research was supported in part by a Grant-in-Aid (No. 17K19321 to A.M.) from the Japan Society for the Promotion of Science. We thank Professor T. Morita, Faculty of Agriculture, Shizuoka University, Japan, for technical advice with the histological evaluation. REFERENCES Aliakbarpour H. R. , Chamani M. , Rahimi G. , Sadeghi A. A. , Qujeq D. . 2012 . The Bacillus subtilis and lactic acid bacteria probiotics influences intestinal mucin gene expression, histomorphology and growth performance in broilers. J. Anim. Sci. 25 : 1285 – 1293 . Azuma T. , Shigeshiro M. , Kodama M. , Tanabe S. , Suzuki T. . 2013 . Supplemental naringenin prevents intestinal barrier defects and inflammation in colitic mice . J. Nutr. 143 : 827 – 834 . Google Scholar CrossRef Search ADS PubMed Baurhoo B. , Phillip L. , Ruiz-Feria C. A. . 2007 . Effects of purified lignin and mannan oligosaccharides on intestinal integrity and microbial populations in the ceca and litter of broiler chickens . Poult. Sci. 86 : 1070 – 1078 . Google Scholar CrossRef Search ADS PubMed Bergstrom K. S. , Kissoon-Singh V. , Gibson D. L. , Ma C. , Montero M. , Sham H. P. , Ryz N. , Huang T. , Velcich A. , Finlay B. B. , Chadee K. , Vallance B. A. . 2010 . Muc2 protects against lethal infectious colitis by disassociating pathogenic and commensal bacteria from the colonic mucosa . PLoS Pathog. 6 : e1000902 . Google Scholar CrossRef Search ADS PubMed Cheled-Shoval S. L. , Gamage N. S. , Amit-Romach E. , Forder R. , Marshal J. , Van Kessel A. , Uni Z. . 2014 . Differences in intestinal mucin dynamics between germ-free and conventionally reared chickens after mannan-oligosaccharide supplementation . Poult. Sci. 93 : 636 – 644 . Google Scholar CrossRef Search ADS PubMed Conn P. M. 2013 . Animal Models for the Study of Human Disease . Academic Press , Cambridge, MS . Crowther R. S. , Wetmore R. F. . 1987 . Fluorometric assay of O-linked glycoproteins by reaction with 2-cyanoacetamide . Anal. Biochem. 163 : 170 – 174 . Google Scholar CrossRef Search ADS PubMed FAOSTAT . 2017 . http://www.fao.org/faostat/en/#home . Friedman M. 2013 . Rice brans, rice bran oils, and rice hulls: composition, food and industrial uses, and bioactivities in humans, animals, and cells . J. Agric. Food Chem. 61 : 10626 – 10641 . Google Scholar CrossRef Search ADS PubMed Hasnain S. Z. , Wang H. , Ghia J. E. , Haq N. , Deng Y. , Velcich A. , Grencis R. K. , Thornton D. J. , Khan W. I. . 2010 . Mucin gene deficiency in mice impairs host resistance to an enteric parasitic infection . Gastroenterology 138 : 1763 – 1771 . e5 . Google Scholar CrossRef Search ADS PubMed Hino S. , Takemura N. , Sonoyama K. , Morita A. , Kawagishi H. , Aoe S. , Morita T. . 2012 . Small intestinal goblet cell proliferation induced by ingestion of soluble and insoluble dietary fiber is characterized by an increase in sialylated mucins in rats . J. Nutr. 142 : 1429 – 1436 . Google Scholar CrossRef Search ADS PubMed Ito H. , Satsukawa M. , Arai E. , Sugiyama K. , Sonoyama K. , Kiriyama S. , Morita T. . 2009 . Soluble fiber viscosity affects both goblet cell number and small intestine mucin secretion in rats . J. Nutr. 139 : 1640 – 1647 . Google Scholar CrossRef Search ADS PubMed Kuttappan V. A. , Berghman L. R. , Vicuña E. A. , Latorre J. D. , Menconi A. , Wolchok J. D. , Wolfenden A. D. , Faulkner O. B. , Tellez G. I. , Hargis B. M. , Bielke L. R. . 2015 . Poultry enteric inflammation model with dextran sodium sulfate mediated chemical induction and feed restriction in broilers . Poult. Sci. 94 : 1220 – 1226 . Google Scholar CrossRef Search ADS PubMed McGuckin M. A. , Lindén S. K. , Sutton P. , Florin T. H. . 2011 . Mucin dynamics and enteric pathogens . Nat. Rev. Micro. 9 : 265 – 278 . Google Scholar CrossRef Search ADS Morita T. , Tanabe H. , Sugiyama K. , Kasaoka S. , Kiriyama S. . 2004 . Dietary resistant starch alters the characteristics of colonic mucosa and exerts a protective effect on trinitrobenzene sulfonic acid-induced colitis in rats . Biosci. Biotechnol. Biochem. 68 : 2155 – 2164 . Google Scholar CrossRef Search ADS PubMed Murai A. , Kitahara K. , Okumura S. , Kobayashi M. , Horio F. . 2016 . Oral antibiotics enhance antibody responses to keyhole limpet hemocyanin in orally but not muscularly immunized chickens . Anim. Sci. J. 87 : 257 – 265 . Google Scholar CrossRef Search ADS PubMed Nakayama J. , Hoshiko H. , Fukuda M. , Tanaka H. , Sakamoto N. , Tanaka S. , Ohue K. , Sakai K. , Sonomoto K. . 2007 . Molecular monitoring of bacterial community structure in long-aged nukadoko: pickling bed of fermented rice bran dominated by slow-growing lactobacilli . J. Biosci. Bioeng. 104 : 481 – 489 . Google Scholar CrossRef Search ADS PubMed Nanto F. , Kikusato M. , Ito C. , Sudo S. , Toyomizu M. . 2012 . Effects of dehulled, crushed and untreated whole-grain paddy rice on growth performance in broiler chickens . J. Poult. Sci. 49 : 291 – 299 . Google Scholar CrossRef Search ADS NARO . 2017 . Technical Manual for Production and Feeding of Rice . 2017 ver., ed . National Agriculture and Food Research Organization , Japan . National Research Council . 1994 . Nutrient Requirements of Poultry . 9th rev. ed . Natl. Acad. Press , Washington, DC . Rahmatnejad E. , Saki A. A. . 2016 . Effect of dietary fibres on small intestine histomorphology and lipid metabolism in young broiler chickens . J. Anim. Physiol. Anim. Nutr. 100 : 665 – 672 . Google Scholar CrossRef Search ADS Satchithanandam S. , Vargofcak-Apker M. , Calvert R. J. , Leeds A. R. , Cassidy M. M. . 1990 . Alteration of gastrointestinal mucin by fiber feeding in rats . J. Nutr. 120 : 1179 – 1184 . Google Scholar CrossRef Search ADS PubMed Sittiya J. , Yamauchi K. , Takata K. . 2014 . Effects of whole-grain paddy rice replacement with or without enzyme addition on broiler performance and intestinal morphology . Br. Poult. Sci. 55 : 619 – 627 . Google Scholar CrossRef Search ADS PubMed Sittiya J. , Yamauchi K. , Takata K. . 2016 . Effect of replacing corn with whole-grain paddy rice and brown rice in broiler diets on growth performance and intestinal morphology . J. Anim. Physiol. Anim. Nutr. 100 : 381 – 390 . Google Scholar CrossRef Search ADS Smirnov A. , Perez R. , Amit-Romach E. , Sklan D. , Uni Z. . 2005 . Mucin dynamics and microbial populations in chicken small intestine are changed by dietary probiotic and antibiotic growth promoter supplementation . J. Nutr. 135 : 187 – 192 . Google Scholar CrossRef Search ADS PubMed Štšepetova J. , Sepp E. , Kolk H. , Lõivukene K. , Songisepp E. , Mikelsaar M. . 2011 . Diversity and metabolic impact of intestinal Lactobacillus species in healthy adults and the elderly . Br. J. Nutr. 105 : 1235 – 1244 . Google Scholar CrossRef Search ADS PubMed Tanabe H. , Sugiyama K. , Matsuda T. , Kiriyama S. , Morita T. . 2005 . Small intestinal mucins are secreted in proportion to the settling volume in water of dietary indigestible components in rats . J. Nutr. 135 : 2431 – 2437 . Google Scholar CrossRef Search ADS PubMed Teirlynck E. , Bjerrum L. , Eeckhaut V. , Huygebaert G. , Pasmans F. , Haesebrouck F. , Dewulf J. , Ducatelle R. , Van Immerseel F. . 2009 . The cereal type in feed influences gut wall morphology and intestinal immune cell infiltration in broiler chickens . Br. J. Nutr. 102 : 1453 – 1461 . Google Scholar CrossRef Search ADS PubMed Van der Sluis M. , De Koning B. A. E. , De Bruijn A. C. J. M. , Velcich A. , Meijerink J. P. P. , Van Goudoever J. B. , Buller H. A. , Dekker J. , Van Seuningen I. , Renes I. B. , Einerhand A. W. C. . 2006 . Muc2-deficient mice spontaneously develop colitis, indicating that Muc2 is critical for colonic protection . Gastroenterology 131 : 117 – 129 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Poultry ScienceOxford University Press

Published: May 30, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off