In-ovo green light photostimulation during different embryonic stages affect somatotropic axis

In-ovo green light photostimulation during different embryonic stages affect somatotropic axis ABSTRACT Previous studies demonstrated that in-ovo photostimulation with monochromatic green light increased the somatotropic axis expression in broilers embryos. The objective of the current study was to detect the critical period for in-ovo GL photostimulation, in order to find the optimal targeted photostimulation period during the incubation process. Three hundred thirty-six fertile broiler eggs were divided into 4 groups. The first group was incubated under dark conditions as a negative control. The second incubated under intermittent monochromatic green light using light-emitting diode (LED) lamps with an intensity of 0.1 W\m2 at shell level from d 0 of the incubation as a positive control. The third group incubated under intermittent monochromatic green light from d 10 of the incubation. The last group incubated under intermittent monochromatic green light from d 15 of the incubation. In-ovo green light photostimulation from embryonic d 0 (ED0) increased plasma growth hormone (GH), as well as hypothalamic growth hormone releasing hormone (GHRH) and liver growth hormone receptor (GHR) and insulin-like growth factor-1 (IGF-1) mRNA levels. In-ovo green light photostimulation from ED10 increased the GH plasma levels compared to the negative control group, without affecting somatotropic axis mRNA genes expressions of GHRH, GHR, and IGF-1. In-ovo green light photostimulation from ED15 caused an increase in both the plasma GH levels and the somatotropic axis mRNA genes expressions of GHRH, GHR, and IGF-1, compared to the negative control group. These results suggest that the critical period of somatotropic axis acceleration by GL photostimulation start at 15 d of incubation. INTRODUCTION Targeted photostimulation with monochromatic light is a well-known management tool for production (growth and reproduction) enhancement in poultry (Olanrewaju et al., 2006; Rozenboim et al., 1999a; Rozenboim et al., 1999b; Rozenboim et al., 2004; Borille et al., 2013). Studies conducted in our lab showed that posthatch green light (GL, 560 nm) and blue light (BL, 480 nm) photostimulation of broilers increased body and muscle weights (Rozenboim et al., 2013). Wabeck and Skoglund (1974) found a similar effect in broilers and by Phogat et al. (1985) in quails. In-ovo GL photostimulation between embryonic d 0 (ED0) and embryonic d 21 (ED21, hatching day) was also found to increase both embryos body weight (as % of egg weight) and breast muscle weight (as % of body weight) (Rozenboim et al., 2004), as well as increase the early posthatch pectoralis weight (Zhang et al., 2014a). Furthermore, studies showed the stimulatory effect of in-ovo GL photostimulation on the proliferation, differentiation, and the number of satellite cells in the muscles, during the posthatch period, compared to the group incubated in the standard dark (D) conditions (Halevy et al., 2006a; Halevy et al., 2006b). In addition, in-ovo GL photostimulation also increased the MyoD, myogenin, and myostatin (Zhang et al., 2014a) One of the mechanisms, which were studied through the years as affecting growth and development, is the somatotropic axis, which consists of the hypothalamic growth hormone releasing hormone (GHRH), pituitary growth hormone (GH), liver and muscle insulin-like growth factors (IGFs), and their respective receptors. Several of the axis components were found to have a positive effect on the growth of muscles (including proliferation and differentiation) (Halevy et al., 2006b), and were affected by in-ovo GL photostimulation (Halevy et al., 1998; Dishon et al., 2017). Growth hormone secretion is controlled by several hypothalamic factors, mainly GHRH and thyrotropin-releasing hormone (TRH) as excitatory factors, and somatostatin (SS) as an inhibitory factor (Bossis and Porter, 2001; Porter et al., 2006; Wang et al., 2006; Lu et al., 2008). In addition, GH secretion from the pituitary is pulsatile in nature (Kim, 2010), with a rapid increase until peak levels during the early posthatch age, followed by plasma levels decline (Buyse and Decuypere 1999). It is required for avian growth and development, as well as increasing feed efficacy and reducing the abdominal fat size (Cogburn et al., 1989; Kocamis et al., 1999). Exogenous injection of GH to broilers yield conflicting results, with most of them finding that the exogenous GH cannot promote body weight gain in juvenile broilers (Vasilatos-Younken and Scanes, 1991; Moellers and Cogburn, 1995). Broilers have higher GHR mRNA expression, compared to laying hens. Furthermore, broilers also have higher GH mRNA expression on ED18, which is in correlation with the embryo/chick mass from ED18 and d 5 posthatch (Buzala et al., 2015). However, posthatch laying hens have higher GH mRNA expression compared to broilers, showing a negative correlation with the posthatch growth rate (Buzala et al., 2015). Growth hormone receptors (GHR) can be found in several tissues, including the liver, muscles, and adipose (Mao et al., 1998). It was found that laying hens have lower GHR mRNA expression in the liver, compared to broilers (Buzala et al., 2015). Halevy et al. (2006a) demonstrated that in-ovo GL photostimulation increased the expression of muscular GHR. Furthermore, in our previous study, we also found increased liver GHR gene expression (Dishon et al., 2017) as a result of in-ovo GL photostimulation from ED0 until hatching. Growth hormone activates liver IGF-1 synthesis. Another source for muscular IGF-1 is the local synthesis in the muscles, without the influence of GH (Kanacki et al., 2012). IGF-1 can be found in chicken embryos in the early stages of incubation, even before the detection of plasma GH, which shows that the IGF-1 secretion is at least partially independent of GH and its receptors. On the other hand, in the posthatch period, IGF-1 secretion is closely dependent on GH and its receptors (McMurtry et al., 1997). The IGF-1 plays an important role in the metabolism of several tissues (Kanacki et al., 2012), as well as in the proliferation and differentiation of muscles (Halevy et al., 2006b). Previously, we described the development of the somatotropic axis during embryogenesis. We demonstrated that in-ovo GL photostimulation from ED0 until ED21 increased somatotropic expression, manifested by elevation in hypothalamic GHRH gene expression, plasma GH, and both liver GHR and IGF-1 without an increase in the muscle IGF-1 gene expression. We also saw that the positive effect of the photostimulation on the plasma GH levels, GHR gene expression, and liver IGF-1 gene expression, happened on the same days, during the last stages of the incubation (Dishon et al., 2017). The objective of this study is to detect the critical period for in-ovo GL photostimulation, in order to find the optimal targeted photostimulation period during the incubation process. MATERIALS AND METHODS Animals All procedures were approved by the animal care committee of the Hebrew University of Jerusalem. Three hundred thirty-six equal weight (60 ± 3 g) fertile broiler eggs (Cobb 500) were used. The eggs were obtained from a 36-week-old broiler breeder flock (Brown hatchery, Hod Hasharon, Israel). All the eggs were set in one Petersime 9600 incubator (Petersime, Belgium), and incubated under standard conditions (37.8°C and 56% RH). On d 7 of the incubation, all the eggs were candled, and all infertile eggs were removed. On d 18 of incubation, all the eggs were transferred to hatching trays, placed inside the incubator, until the last day of the experiment. Light Management Eggs were divided into 4 treatment groups with 3 replicates (all replicates were placed in the same incubator in different setting trays at different incubator levels). The first group was incubated in the dark (negative control (NC), n = 84). The second group was incubated under GL photostimulation (560 nm, intensity of 0.1 W/m2 at eggshell level, and in intervals of 15 min light/15 min dark to avoid overheating of the egg (Rozenboim et al., 2004)) between ED0 and ED20 (positive control (GL), n = 84). The third group was incubated under GL photostimulation between ED10 and ED20 (GD10, n = 84), and the fourth group was incubated under GL photostimulation between ED15 and ED20 (GD15, n = 84). All GL photostimulation was provided by light-emitting diode (LED) strips, as described in our previous experiment (Dishon et al., 2017). The different light treated groups were separated by cardboards in order to eliminate light transfer between groups. Blood Sampling Between ED10 and ED20, 12 eggs from each treatment groups were opened and content was placed in a petri dish. Heparinized blood samples were drawn from the chorioallantoic vein from ED10 to ED18, and on ED20, from the jugular vein. Plasma samples obtained from each blood sample were stored in −20°C until assay. Tissue Sampling Following the blood sampling, embryonic BW recorded, and samples from the hypothalamus, pituitary, and liver were taken as previously described Dishon et al., 2017). The samples were placed in liquid nitrogen and stored at −80°C until the analysis of mRNA gene expression. Hormone Analysis Plasma GH was assayed by competitive enzyme-linked immunosorbent assay (ELISA), using the corresponding biotinylated tracer, as described previously (Dishon et al., 2017). RNA Extraction and Real-Time Polymerase Chain Reaction The frozen tissue samples were homogenized by HG-300 homogenizer, and total RNA was extracted using RNAzol® RT reagent according to the manufacturer protocol (Genecopeia, Rockville, MD). The extraction and real-time polymerase chain reaction (PCR) protocols previously described in (Dishon et al., 2017). The sequences of the gene-specific primers used in the PCR reactions are shown in Table 1. Table 1. Primers used in the real-time PCR reactions. gene Primers Product length GenBank accession no. GAPDH F: GGCACGCCATCACTATC 61 bp NM_204,305.1 R: CCTGCATCTGCCCATTT β-Actin F: CCGCAAATGCTTCTAAACCG 101 bp NM_205,518.1 R: AAAGCCATGCCAATCTCGTC GHRH F: GGCAAACGGCTCAGAAACAG 140 bp NM_0,010,40464.1 R: AGCATGGCTCCCAAGAAGTC GHR F: GCGTGTTCAGGAGCAAAGCT 121 bp NM_0,010,01293.1 R: TGGGACAGGCATTTCCATACTT IGF F: GCTTTTGTGATTTCTTGAAGGTGAA 195 bp NM_0,010,04384.2 R: CATACCCTGTAGGCTTACTGAAGTA gene Primers Product length GenBank accession no. GAPDH F: GGCACGCCATCACTATC 61 bp NM_204,305.1 R: CCTGCATCTGCCCATTT β-Actin F: CCGCAAATGCTTCTAAACCG 101 bp NM_205,518.1 R: AAAGCCATGCCAATCTCGTC GHRH F: GGCAAACGGCTCAGAAACAG 140 bp NM_0,010,40464.1 R: AGCATGGCTCCCAAGAAGTC GHR F: GCGTGTTCAGGAGCAAAGCT 121 bp NM_0,010,01293.1 R: TGGGACAGGCATTTCCATACTT IGF F: GCTTTTGTGATTTCTTGAAGGTGAA 195 bp NM_0,010,04384.2 R: CATACCCTGTAGGCTTACTGAAGTA View Large Table 1. Primers used in the real-time PCR reactions. gene Primers Product length GenBank accession no. GAPDH F: GGCACGCCATCACTATC 61 bp NM_204,305.1 R: CCTGCATCTGCCCATTT β-Actin F: CCGCAAATGCTTCTAAACCG 101 bp NM_205,518.1 R: AAAGCCATGCCAATCTCGTC GHRH F: GGCAAACGGCTCAGAAACAG 140 bp NM_0,010,40464.1 R: AGCATGGCTCCCAAGAAGTC GHR F: GCGTGTTCAGGAGCAAAGCT 121 bp NM_0,010,01293.1 R: TGGGACAGGCATTTCCATACTT IGF F: GCTTTTGTGATTTCTTGAAGGTGAA 195 bp NM_0,010,04384.2 R: CATACCCTGTAGGCTTACTGAAGTA gene Primers Product length GenBank accession no. GAPDH F: GGCACGCCATCACTATC 61 bp NM_204,305.1 R: CCTGCATCTGCCCATTT β-Actin F: CCGCAAATGCTTCTAAACCG 101 bp NM_205,518.1 R: AAAGCCATGCCAATCTCGTC GHRH F: GGCAAACGGCTCAGAAACAG 140 bp NM_0,010,40464.1 R: AGCATGGCTCCCAAGAAGTC GHR F: GCGTGTTCAGGAGCAAAGCT 121 bp NM_0,010,01293.1 R: TGGGACAGGCATTTCCATACTT IGF F: GCTTTTGTGATTTCTTGAAGGTGAA 195 bp NM_0,010,04384.2 R: CATACCCTGTAGGCTTACTGAAGTA View Large Statistical Analysis The experiment conducted in 3 replicates. After finding no significant difference between the replicates of each treatment group, the data were subjected to analysis of variance (ANOVA) according to the following model: the treatment (dark and the light treatments) and embryonic day (between ED10 and ED20) as the main fixed effects, including the interactions between treatment and ED. We found no significant interaction between treatment and ED. Therefore, the figures show LSMeans (± SE) of each treatment at certain embryonic day. The Tukey-Kramer HSD test was used for post-hoc testing of the differences between treatments’ LSMeans. All statistical analyses were conducted with the JMP software of the SAS Institute (Ver.12). RESULTS Throughout the incubation period, GL photostimulation did not affect either the body, muscle, or liver weights. Plasma GH Levels During the embryogenesis in all treatment groups, we found small elevation in plasma GH levels with a large and significant elevation on ED20. In-ovo GL photostimulation from ED0 (PC group) caused a significant increase in plasma GH levels (Figure 1) from ED14 until hatching day, compared to the NC group. GD10 group had higher plasma GH levels, similar to PC group, between ED14 and ED18, while the GD15 group, had significantly higher levels at ED 16 to a similar level found in PC group, and an elevation in plasma GH levels (to a level between the positive and negative controls) on ED18 and ED20. Figure 1. View largeDownload slide Plasma growth hormone levels, between ED10 to ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). Figure 1. View largeDownload slide Plasma growth hormone levels, between ED10 to ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). Hypothalamic GHRH, Liver GHR, and IGF-1 Gene Expression Elevation in GHRH mRNA expression from ED14 until hatch was detected in all treatment groups. In the PC group, a significant increase in the hypothalamic GHRH mRNA gene expression levels was detected in ED16 and ED20, compared to the NC group. The GD10 group showed no increase in the GHRH mRNA levels when compared to the negative control. On the other hand, GD 15 group showed a significant increase in GHRH mRNA levels on ED18 and ED20, compared to the negative control (Figure 2). Figure 2. View largeDownload slide Hypothalamic GHRH mRNA expression, between ED10-ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). Figure 2. View largeDownload slide Hypothalamic GHRH mRNA expression, between ED10-ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). Liver GHR mRNA gene expression, was elevated during embryogenesis peaking at ED18 and then declined at ED20. The positive control group had a significant increase in liver GHR mRNA levels on ED16 and ED18 compare to NC group. The GD10 group had same liver GHR mRNA levels, as the NC group; while the GD15 group had a similar increase in GHR mRNA levels as the PC group in ED18 (Figure 3). Figure 3. View largeDownload slide Liver GHR mRNA expression, between ED10 to ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). Figure 3. View largeDownload slide Liver GHR mRNA expression, between ED10 to ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). The liver IGF-1 mRNA gene expression was similar during the embryonic development, with a significant increase on hatching day (ED20). The PC group had a significant increase in liver IGF-1 mRNA levels between ED16 and ED18. The GD10 group had same IGF-1 mRNA levels as compared to NC group. The GD15 group, on the other hand, had significant elevation on ED18, similar to the positive control, but similar levels of the negative control, on ED20 (Figure 4). Figure 4. View largeDownload slide Liver IGF-1 mRNA expression, between ED10 to ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). Figure 4. View largeDownload slide Liver IGF-1 mRNA expression, between ED10 to ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). DISCUSSION In-ovo GL photostimulation from ED15 increased the somatotropic axis activity, similar to the acceleration in the positive control. In our study, GHRH increased naturally from ED14 until ED20. Similar results were found in our previous experiment (Dishon et al., 2017), as well as in Ellestad et al., 2011, which showed an increase in the GHRH expression from ED16 until d 1 posthatch. GL photostimulation from ED15 increased hypothalamic GHRH mRNA gene expression, to the level of the positive control mRNA gene expression and level presented in our previous study (Dishon et al., 2017). As for plasma GH levels, previous studies found natural elevation from ED 12, reaching a peak level at hatch (Kikuchi et al., 1991; Dishon et al., 2017). Zhang et al., 2014b, present elevation in plasma GH levels from ED 15. In addition, all light-treated groups had higher plasma GH levels during the last wk of the incubation compared to negative control group. The increase in the plasma GH levels of the GL photostimulated groups starts before the increase in hypothalamic GHRH mRNA gene expression, which may suggest that there might be a more direct, positive effect of the photostimulation on the secretion of the GH from the pituitary to the plasma. We found a natural increase in liver GHR mRNA gene expression from ED12 until ED18, followed by a decrease until hatch. Those results are similar to our previous findings (Dishon et al., 2017), which showed a similar pattern, as well as Burnside and Cogburn research (1992). Furthermore, we found that GL photostimulation from ED0 (positive control) caused elevation of the GHR mRNA gene expression on ED12 and between ED16-ED18, and that photostimulation from ED15 brought an increase similar to the positive control, on ED16 and ED18, while the GL10 group showed similar results to the negative control. The increase in the liver GHR mRNA gene expression, together with an increase in the plasma GH levels, may enable a greater utilization of GH. This mechanism is in agreement with the mechanism suggested by Kanacki et al., 2012 and the results found by Halevy et al., 1998 and Zhang et al., 2014b, which showed an increase in satellite cells GHR mRNA gene expression, and an increase in plasma GH levels, due to GL photostimulation, respectively. Under natural incubation conditions, liver IGF mRNA gene expression is low, with its level increased by hatching. When comparing the different treatment groups, we observed that GL photostimulation from ED0 increased the liver IGF-1 mRNA levels from ED16 until hatch, while photostimulation from ED15 (GD15 group) increased the expression of liver IGF-1, but with a significant difference only on ED18. The low levels of liver IGF-1 mRNA gene expression can be explained by the fact that during the embryogenesis, the liver plays only a minor role in the supply of IGF-1 to the developing embryo, while at hatch and in the posthatch period, it is the main source of IGF-1 of the chicken (McMurtry et al., 1997). The elevation in the IGF-1 because of the GL photostimulation, following the increase in both plasma GH levels, as well as liver GHR mRNA gene expression. This phenomenon may occur due to an increase activation of GH and its liver receptors, in GL photostimulated embryos. This effect, in turn, results in a greater activation of the liver to express the IGF-1 gene. This mechanism of GH connecting to liver GHR, and causes an increase in liver IGF-1, is supported by Kanacki et al., 2012. Furthermore, we suggest that the positive effect of in-ovo GL photostimulation on growth and development of broilers (Rozenboim et al., 2004), might be due to its elevation effect on liver GHR mRNA gene expression levels. According to Buzala et al., 2015, it was found that when comparing broilers and laying hens, the hens had higher levels of plasma GH, but lower levels of liver GHR expression. This, in turn, may suggest that the growth of broilers is due to higher levels of GHR, and not to GH itself. Therefore, the increase in liver GHR mRNA gene expression may explain why GL photostimulated broilers had higher body weight, compared to control, in Rozenboim et al., 2004. This may also explain why administration of GH to chicken, had conflicting effects. We suggest that in-ovo GL photostimulation might act centrally by activating neuroendocrine agents, such as melatonin, which found to be higher, when chicks exposed to GL photostimulation (Zhang et al., 2016). This elevation might increase GHRH mRNA gene expression in the hypothalamus (Zhang et al., 2016). The elevation in somatotropic axis activity in the GD15 group may suggest that the activation of this axis by GL stimulation is related to tissue photosensitivity both retinal and extraretinal sites. This was previously described by the effect of GL photostimulation on the melatonin and GHRH correlation, as well as by the locations of the GHRH secreting neurons and the extraretinal photoreceptors (Mano-Otafiri et al., 2006; Haflord et al., 2009; Zang et al., 2016). Photoreceptors can be found in the pineal gland, and they regulate the melatonin synthesis and secretion (Foster and Soni, 1998), both of which can be found as early as ED13 (and ED8 in quails) (Csernus et al., 2007) and ED10 (Csernus et al., 2007), respectively, as well as elevating GHRH expression. Furthermore, the neurons that secrete the GHRH in the hypothalamus can be found in the arcuate nucleus, which is part of the mediobasal hypothalamus (MBH) (Mano-Otafiri et al., 2006). The MBH also include photoreceptors that affect physiological responses (Halford et al., 2009) and are found as early as ED13 (unpublished data). The proximity of the extraretinal photoreceptors and melatonin, which affect the somatotropic axis, or the proximity to the GHRH secreting neurons, may suggest that the increase in the somatotropic axis expression is due to the activation of those photoreceptors and the secretion of neurotransmitters, which in turn may affect the synthesis and secretion of the GHRH. During this experiment, we found that in-ovo GL from ED10 had no effect on somatotropic axis. Embryonic d 10 is an important day for both endocrinologic (Porter and Dean, 2001) and metabolic (Janke et al., 2004; Tong et al., 2013) mechanisms. We suggest that the addition of photostimulation from ED10 might affect other related axes, such as the corticoid and the thyrotropin axis. The thyrotropin axis starts to function from ED10.5 (Porter and Dean, 2001), while the adrenals secrete corticosterone from ED8 (Jenkins and Porter, 2004). According to Porter and Dean, 2001, a combination of both T3 and corticosterone inhibited the GH secretion, which could explain the lack of positive effect of the photostimulation from ED10 on the development of the somatotropic axis. In conclusion, we suggest that the critical period of somatotropic axis acceleration by GL photostimulation start at 15 d of incubation. Further studies are conducting in order to frame this critical period and by that implementing this knowledge to the industry. In addition, other studies are conducting in order to understand the connection between the retinal and extra-retinal photoreceptors, in relation to the activation of the somatotropic axis. Further studies are required in order to understand how the in-ovo GL photostimulation affect the somatotropic axis. REFERENCES Borille R. , Garcia R. G. , Royer A. F. B. , Santana M. R. , Colet S. , Naas I. A. , Caldara F. R. , Almeida Paz I. C. L. , Rosa E. S. , Castilho V. A. R. . 2013 . The use of light-emitting diodes (LED) in commercial layer production . Braz. J. Poult. Sci. 14 : 135 – 140 . Bossis I. , Porter T. E. . 2001 . Identification of the somatostatin receptor subtypes involved in regulation of growth hormone secretion in chickens . Mol. Cell. Endocrinol. 182 : 203 – 213 . Google Scholar CrossRef Search ADS PubMed Burnside J. , Cogburn L. A. . 1992 . Developmental expression of hepatic growth hormone receptor and insulin-like growth factor-I mRNA in the chicken . Mol. Cell. Endocrinol. 89 : 91 – 96 . Google Scholar CrossRef Search ADS PubMed Buyse J. , Decuypere E. . 1999 . The role of the somatotrophic axis in the metabolism of the chicken . Domest. Anim. Endocrinol. 17 : 245 – 255 . Google Scholar CrossRef Search ADS PubMed Buzala M. , Janicki B. , Czarnecki R. . 2015 . Consequences of different growth rates in broiler breeder and layer hens on embryogenesis, metabolism and metabolic rate: A review . Poult. Sci. 94 : 728 – 733 . Google Scholar CrossRef Search ADS PubMed Cogburn L. A. , Liou S. S. , Rand A. L. , Mcmurtry J. P. . 1989 . Growth, metabolic and endocrine responses of broiler cockerels given a daily subcutaneous injection of natural or biosynthetic chicken growth hormone . J. Nutr . 1213 – 1222 . Csernus V. J. , Nagy A. D. , Faluhelyi N. . 2007 . Development of the rhythmic melatonin secretion in the embryonic chicken pineal gland . Gen. Comp. Endocrinol . 152 : 148 – 153 . Google Scholar CrossRef Search ADS PubMed Dishon L. , Avital-Cohen N. , Malamud D. , Heiblum R. , Druyan S. , Porter T. E. , Gumułka M. , Rozenboim I. . 2017 . In-ovo monochromatic green light photostimulation enhances embryonic somatotropic axis activity . Poult. Sci . 96 : 1884 – 1890 . Google Scholar CrossRef Search ADS PubMed Ellestad L. E. , Saliba J. , Porter T. E. . 2011 . Ontogenic characterization of gene expression in the developing neuroendocrine system of the chick . Gen. Comp. Endocrinol . 171 : 82 – 93 . Google Scholar CrossRef Search ADS PubMed Foster R. G. , Soni B. G. . 1998 . Extraretinal photoreceptors and their regulation of temporal physiology . J. Reprod. Fertil . 3 : 145 – 150 . Haflord S. , Pires S. S. , Turton M. , Zheng L. , González-Menéndez I. , Davies W. L. , Peirson S. N. , García-Fernández J. M. , Hankins M. W. , Foster R. G. . 2009 . VA Opsin-Based photoreceptors in the hypothalamus of birds . Curr. Biol . 19 : 1396 – 1402 . Google Scholar CrossRef Search ADS PubMed Halevy O. , Biran I. , Rozenboim I. . 1998 . Various light source treatments affect body and skeletal muscle growth by affecting skeletal muscle satellite cell proliferation in broilers . Comp. Biochem. Physiol. Pt. A Mol. Integr. Physiol. 120 : 317 – 323 . Google Scholar CrossRef Search ADS Halevy O. , Piestun Y. , Rozenboim I. , Yablonka-Reuveni Z. . 2006a . In ovo exposure to monochromatic green light promotes skeletal muscle cell proliferation and affects myofiber growth in posthatch chicks . Am. J. Physiol. Regul. Integr. Comp. Physiol . 290 : R1062 – R1070 . Google Scholar CrossRef Search ADS Halevy O. , Yahav S. , Rozenboim I. . 2006b . Enhancement of meat production by environmental manipulations in embryo and young broilers . Worlds. Poult. Sci. J. 62 : 485 – 497 . Janke O. , Tzschentke B. , Boerjan M. . 2004 . Comparative investigations of heat production and body temperature in embryos of modern chicken breeds . Avian Poult. Biol. Rev. 15 : 191 – 196 (6). Google Scholar CrossRef Search ADS Jenkins S. A. , Porter T. E. . 2004 . Ontogeny of the hypothalamo–pituitary–adrenocortical axis in the chicken embryo: a review . Domest. Anim. Endocrinol. 26 : 267 – 275 . Google Scholar CrossRef Search ADS PubMed Kanački Z. , Stojanović S. , Ušćebrka G. , Žikić D. . 2012 . The development pattern of IGF-1 (insulin- like growth factor-1) protein expression in breast muscle of broiler chickens . Biotechnol. Anim. Husb . 28 : 797 – 805 . Google Scholar CrossRef Search ADS Kikuchi K. , Buonomo F. C. , Kajimoto Y. , Rotwein P. . 1991 . Expression of Insulin-Like growth Factor-I during chicken development . Endocrinology 128 : 1323 – 1328 . Google Scholar CrossRef Search ADS PubMed Kim J. W. 2010 . The endocrine regulation of chicken growth . Asian-Australas. J. Anim. Sci . 23 : 1668 – 1676 . Google Scholar CrossRef Search ADS Kocamis H. , Yeni T. N. , Kirkpatrick-Keller D. C. , Killefer J. . 1999 . Postnatal growth of broilers in response to in ovo administration of chicken growth hormone . Poult. Sci. 78 : 1219 – 1226 . Google Scholar CrossRef Search ADS PubMed Lu F. Z. , Wang X. X. , Pan Q. X. , Huang R. H. , Liu H. L. . 2008 . Expression of genes involved in the somatotropic, thyrotropic, and corticotropic axes during development of Langshan and Arbor Acres chickens . Poult. Sci. 87 : 2087 – 2097 . Google Scholar CrossRef Search ADS PubMed Mano-Otagiri A. , Nemoto T. , Sekino A. , Yamauchi N. , Shuto Y. , Sugihara H. , oikawa S. , Shibasaki T. . 2006 . Growth hormone-releasing hormone (GHRH) neurons in the arcuate nucleus (Arc) of the hypothalamus are decreased in transgenic rats whose expression of ghrelin receptor is attenuated: Evidence that ghrelin receptor is involved in the up-regulation of GHRH expression in the arc . Endocrinology . 147 : 4093 – 4103 . Google Scholar CrossRef Search ADS PubMed Mao J. N. C. , Burnside J. , Postel-Vinay M. C. , Pesek J. D. , Chambers J. R. , Cogburn L. A. . 1998 . Ontogeny of growth hormone receptor gene expression in tissue of growth-selected strains of broiler chickens . Endocrinology 156 : 67 – 75 . Google Scholar CrossRef Search ADS McMurtry J. P. , Francis G. L. , Upton Z. . 1997 . Insulin-like growth factors in poultry . Domest. Anim. Endocrinol . 14 : 199 – 229 . Google Scholar CrossRef Search ADS PubMed Moellers R. F. , Cogburn L. A. . 1995 . Chronic intravenous infusion of chicken growth hormone increases body fat content of young broiler chickens . Comp. Biochem. Physiol. Pt. A: Physiol . 110 : 47 – 56 . Google Scholar CrossRef Search ADS Phogat S. B. , Aggarwal C. K. , Chopra S. K. . 1985 . Effect of red and green lights on growth of quail . Indian J. Poult. Sci. 20 , 126 – 128 . Porter T. E. , Dean K. J. . 2001 . Regulation of chicken embryonic growth hormone secretion by corticosterone and triiodothyronine: evidence for a negative synergistic response . Endocrine . 14 : 363 – 368 . Google Scholar CrossRef Search ADS PubMed Porter T. E. , Ellestad L. E. , Fay A. , Stewart J. L. , Bossis I. . 2006 . Identification of the chicken growth hormone-releasing hormone receptor (GHRH-R) mRNA and gene: regulation of anterior pituitary GHRH-R mRNA levels by homologous and heterologous hormones . Endocrinology 147 : 2535 – 2543 . Google Scholar CrossRef Search ADS PubMed Rozenboim I. , Biran I. , Uni Z. , Halevy O. . 1999a . The effect of monochromatic light on broiler growth and development . Poult. Sci. 78 : 135 – 138 . Google Scholar CrossRef Search ADS Rozenboim I. , Robinzon B. , Rosenstrauch A. . 1999b . Effect of light source and regimen on growing broilers . Br. Poult. Sci. 40 , 452 – 457 . Google Scholar CrossRef Search ADS Rozenboim I. , Piestun Y. , Mobarkey N. , Barak M. , Hoyzman A. , Halevy O. . 2004 . Monochromatic light stimuli during embryogenesis enhance embryo development and posthatch growth . Poult. Sci. 83 : 1413 – 1419 . Google Scholar CrossRef Search ADS PubMed Rozenboim I. , El Halawani M. E. , Kashash Y. , Piestun Y. , Halevy O. . 2013 . The effect of monochromatic photostimulation on growth and development of broiler birds . Gen. Comp. Endocrinol . 190 : 214 – 219 . Google Scholar CrossRef Search ADS PubMed Tong Q. , Romanini C. E. , Exadaktylos V. , Bahr C. , Berckmans D. , Bergoug H. , Eterradossi N. , Roulston N. , Verhelst R. , McGonnell I. M. , Demmers T. . 2013 . Embryonic development and the physiological factors that coordinate hatching in domestic chickens . Poult. Sci. 92 : 620 – 628 . Google Scholar CrossRef Search ADS PubMed Vasilatos-Younken R. , Scanes C. G. . 1991 . Growth hormone and insulin-like growth factors in poultry growth: required, optimal, or ineffective? Poult. Sci. 70 : 1764 – 1780 . Google Scholar CrossRef Search ADS PubMed Wabeck C. J. , Skuglund W. C. . 1974 . Influence of radiant energy from fluorescent light sources on growth, mortality, and feed conversion of broilers . Poult. Sci. 53 : 2055 – 2059 . Google Scholar CrossRef Search ADS PubMed Wang C. Y. , Wang Y. , Li J. , Leung F. C. . 2006 . Expression profiles of growth hormone-releasing hormone and growth hormone-releasing hormone receptor during chicken embryonic pituitary development . Poult. Sci. 85 : 569 – 576 . Google Scholar CrossRef Search ADS PubMed Zhang L. , Zhang H. J. , Wang J. , Wu S. G. . 2014a . Stimulation with monochromatic green light during incubation alters satellite cell mitotic activity and gene expression in relation to embryonic and posthatch muscle growth of broiler chickens . Animal 8 : 86 – 93 . Google Scholar CrossRef Search ADS Zhang L. , Wu S. , Wang J. , Qiao X. , Yue H. , Yao J. , Zhang H. , Qi G. . 2014b . Changes of plasma growth hormone, insulin-like growth factors-1, thyroid hormones, and testosterone concentrations in embryos and broiler chickens incubated under monochromatic green light . Ital. J. Anim. Sci. 13 : 530 – 535 . Zhang L. , Cao J. , Wang Z. , Dong Y. , Chen Y. . 2016 . Melatonin modulates monochromatic light-induced GHRH expression in the hypothalamus and GH secretion in chicks . Acta Histochem . 118 : 286 – 292 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

In-ovo green light photostimulation during different embryonic stages affect somatotropic axis

Loading next page...
 
/lp/ou_press/in-ovo-green-light-photostimulation-during-different-embryonic-stages-FB0FxS4IHl
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pey078
Publisher site
See Article on Publisher Site

Abstract

ABSTRACT Previous studies demonstrated that in-ovo photostimulation with monochromatic green light increased the somatotropic axis expression in broilers embryos. The objective of the current study was to detect the critical period for in-ovo GL photostimulation, in order to find the optimal targeted photostimulation period during the incubation process. Three hundred thirty-six fertile broiler eggs were divided into 4 groups. The first group was incubated under dark conditions as a negative control. The second incubated under intermittent monochromatic green light using light-emitting diode (LED) lamps with an intensity of 0.1 W\m2 at shell level from d 0 of the incubation as a positive control. The third group incubated under intermittent monochromatic green light from d 10 of the incubation. The last group incubated under intermittent monochromatic green light from d 15 of the incubation. In-ovo green light photostimulation from embryonic d 0 (ED0) increased plasma growth hormone (GH), as well as hypothalamic growth hormone releasing hormone (GHRH) and liver growth hormone receptor (GHR) and insulin-like growth factor-1 (IGF-1) mRNA levels. In-ovo green light photostimulation from ED10 increased the GH plasma levels compared to the negative control group, without affecting somatotropic axis mRNA genes expressions of GHRH, GHR, and IGF-1. In-ovo green light photostimulation from ED15 caused an increase in both the plasma GH levels and the somatotropic axis mRNA genes expressions of GHRH, GHR, and IGF-1, compared to the negative control group. These results suggest that the critical period of somatotropic axis acceleration by GL photostimulation start at 15 d of incubation. INTRODUCTION Targeted photostimulation with monochromatic light is a well-known management tool for production (growth and reproduction) enhancement in poultry (Olanrewaju et al., 2006; Rozenboim et al., 1999a; Rozenboim et al., 1999b; Rozenboim et al., 2004; Borille et al., 2013). Studies conducted in our lab showed that posthatch green light (GL, 560 nm) and blue light (BL, 480 nm) photostimulation of broilers increased body and muscle weights (Rozenboim et al., 2013). Wabeck and Skoglund (1974) found a similar effect in broilers and by Phogat et al. (1985) in quails. In-ovo GL photostimulation between embryonic d 0 (ED0) and embryonic d 21 (ED21, hatching day) was also found to increase both embryos body weight (as % of egg weight) and breast muscle weight (as % of body weight) (Rozenboim et al., 2004), as well as increase the early posthatch pectoralis weight (Zhang et al., 2014a). Furthermore, studies showed the stimulatory effect of in-ovo GL photostimulation on the proliferation, differentiation, and the number of satellite cells in the muscles, during the posthatch period, compared to the group incubated in the standard dark (D) conditions (Halevy et al., 2006a; Halevy et al., 2006b). In addition, in-ovo GL photostimulation also increased the MyoD, myogenin, and myostatin (Zhang et al., 2014a) One of the mechanisms, which were studied through the years as affecting growth and development, is the somatotropic axis, which consists of the hypothalamic growth hormone releasing hormone (GHRH), pituitary growth hormone (GH), liver and muscle insulin-like growth factors (IGFs), and their respective receptors. Several of the axis components were found to have a positive effect on the growth of muscles (including proliferation and differentiation) (Halevy et al., 2006b), and were affected by in-ovo GL photostimulation (Halevy et al., 1998; Dishon et al., 2017). Growth hormone secretion is controlled by several hypothalamic factors, mainly GHRH and thyrotropin-releasing hormone (TRH) as excitatory factors, and somatostatin (SS) as an inhibitory factor (Bossis and Porter, 2001; Porter et al., 2006; Wang et al., 2006; Lu et al., 2008). In addition, GH secretion from the pituitary is pulsatile in nature (Kim, 2010), with a rapid increase until peak levels during the early posthatch age, followed by plasma levels decline (Buyse and Decuypere 1999). It is required for avian growth and development, as well as increasing feed efficacy and reducing the abdominal fat size (Cogburn et al., 1989; Kocamis et al., 1999). Exogenous injection of GH to broilers yield conflicting results, with most of them finding that the exogenous GH cannot promote body weight gain in juvenile broilers (Vasilatos-Younken and Scanes, 1991; Moellers and Cogburn, 1995). Broilers have higher GHR mRNA expression, compared to laying hens. Furthermore, broilers also have higher GH mRNA expression on ED18, which is in correlation with the embryo/chick mass from ED18 and d 5 posthatch (Buzala et al., 2015). However, posthatch laying hens have higher GH mRNA expression compared to broilers, showing a negative correlation with the posthatch growth rate (Buzala et al., 2015). Growth hormone receptors (GHR) can be found in several tissues, including the liver, muscles, and adipose (Mao et al., 1998). It was found that laying hens have lower GHR mRNA expression in the liver, compared to broilers (Buzala et al., 2015). Halevy et al. (2006a) demonstrated that in-ovo GL photostimulation increased the expression of muscular GHR. Furthermore, in our previous study, we also found increased liver GHR gene expression (Dishon et al., 2017) as a result of in-ovo GL photostimulation from ED0 until hatching. Growth hormone activates liver IGF-1 synthesis. Another source for muscular IGF-1 is the local synthesis in the muscles, without the influence of GH (Kanacki et al., 2012). IGF-1 can be found in chicken embryos in the early stages of incubation, even before the detection of plasma GH, which shows that the IGF-1 secretion is at least partially independent of GH and its receptors. On the other hand, in the posthatch period, IGF-1 secretion is closely dependent on GH and its receptors (McMurtry et al., 1997). The IGF-1 plays an important role in the metabolism of several tissues (Kanacki et al., 2012), as well as in the proliferation and differentiation of muscles (Halevy et al., 2006b). Previously, we described the development of the somatotropic axis during embryogenesis. We demonstrated that in-ovo GL photostimulation from ED0 until ED21 increased somatotropic expression, manifested by elevation in hypothalamic GHRH gene expression, plasma GH, and both liver GHR and IGF-1 without an increase in the muscle IGF-1 gene expression. We also saw that the positive effect of the photostimulation on the plasma GH levels, GHR gene expression, and liver IGF-1 gene expression, happened on the same days, during the last stages of the incubation (Dishon et al., 2017). The objective of this study is to detect the critical period for in-ovo GL photostimulation, in order to find the optimal targeted photostimulation period during the incubation process. MATERIALS AND METHODS Animals All procedures were approved by the animal care committee of the Hebrew University of Jerusalem. Three hundred thirty-six equal weight (60 ± 3 g) fertile broiler eggs (Cobb 500) were used. The eggs were obtained from a 36-week-old broiler breeder flock (Brown hatchery, Hod Hasharon, Israel). All the eggs were set in one Petersime 9600 incubator (Petersime, Belgium), and incubated under standard conditions (37.8°C and 56% RH). On d 7 of the incubation, all the eggs were candled, and all infertile eggs were removed. On d 18 of incubation, all the eggs were transferred to hatching trays, placed inside the incubator, until the last day of the experiment. Light Management Eggs were divided into 4 treatment groups with 3 replicates (all replicates were placed in the same incubator in different setting trays at different incubator levels). The first group was incubated in the dark (negative control (NC), n = 84). The second group was incubated under GL photostimulation (560 nm, intensity of 0.1 W/m2 at eggshell level, and in intervals of 15 min light/15 min dark to avoid overheating of the egg (Rozenboim et al., 2004)) between ED0 and ED20 (positive control (GL), n = 84). The third group was incubated under GL photostimulation between ED10 and ED20 (GD10, n = 84), and the fourth group was incubated under GL photostimulation between ED15 and ED20 (GD15, n = 84). All GL photostimulation was provided by light-emitting diode (LED) strips, as described in our previous experiment (Dishon et al., 2017). The different light treated groups were separated by cardboards in order to eliminate light transfer between groups. Blood Sampling Between ED10 and ED20, 12 eggs from each treatment groups were opened and content was placed in a petri dish. Heparinized blood samples were drawn from the chorioallantoic vein from ED10 to ED18, and on ED20, from the jugular vein. Plasma samples obtained from each blood sample were stored in −20°C until assay. Tissue Sampling Following the blood sampling, embryonic BW recorded, and samples from the hypothalamus, pituitary, and liver were taken as previously described Dishon et al., 2017). The samples were placed in liquid nitrogen and stored at −80°C until the analysis of mRNA gene expression. Hormone Analysis Plasma GH was assayed by competitive enzyme-linked immunosorbent assay (ELISA), using the corresponding biotinylated tracer, as described previously (Dishon et al., 2017). RNA Extraction and Real-Time Polymerase Chain Reaction The frozen tissue samples were homogenized by HG-300 homogenizer, and total RNA was extracted using RNAzol® RT reagent according to the manufacturer protocol (Genecopeia, Rockville, MD). The extraction and real-time polymerase chain reaction (PCR) protocols previously described in (Dishon et al., 2017). The sequences of the gene-specific primers used in the PCR reactions are shown in Table 1. Table 1. Primers used in the real-time PCR reactions. gene Primers Product length GenBank accession no. GAPDH F: GGCACGCCATCACTATC 61 bp NM_204,305.1 R: CCTGCATCTGCCCATTT β-Actin F: CCGCAAATGCTTCTAAACCG 101 bp NM_205,518.1 R: AAAGCCATGCCAATCTCGTC GHRH F: GGCAAACGGCTCAGAAACAG 140 bp NM_0,010,40464.1 R: AGCATGGCTCCCAAGAAGTC GHR F: GCGTGTTCAGGAGCAAAGCT 121 bp NM_0,010,01293.1 R: TGGGACAGGCATTTCCATACTT IGF F: GCTTTTGTGATTTCTTGAAGGTGAA 195 bp NM_0,010,04384.2 R: CATACCCTGTAGGCTTACTGAAGTA gene Primers Product length GenBank accession no. GAPDH F: GGCACGCCATCACTATC 61 bp NM_204,305.1 R: CCTGCATCTGCCCATTT β-Actin F: CCGCAAATGCTTCTAAACCG 101 bp NM_205,518.1 R: AAAGCCATGCCAATCTCGTC GHRH F: GGCAAACGGCTCAGAAACAG 140 bp NM_0,010,40464.1 R: AGCATGGCTCCCAAGAAGTC GHR F: GCGTGTTCAGGAGCAAAGCT 121 bp NM_0,010,01293.1 R: TGGGACAGGCATTTCCATACTT IGF F: GCTTTTGTGATTTCTTGAAGGTGAA 195 bp NM_0,010,04384.2 R: CATACCCTGTAGGCTTACTGAAGTA View Large Table 1. Primers used in the real-time PCR reactions. gene Primers Product length GenBank accession no. GAPDH F: GGCACGCCATCACTATC 61 bp NM_204,305.1 R: CCTGCATCTGCCCATTT β-Actin F: CCGCAAATGCTTCTAAACCG 101 bp NM_205,518.1 R: AAAGCCATGCCAATCTCGTC GHRH F: GGCAAACGGCTCAGAAACAG 140 bp NM_0,010,40464.1 R: AGCATGGCTCCCAAGAAGTC GHR F: GCGTGTTCAGGAGCAAAGCT 121 bp NM_0,010,01293.1 R: TGGGACAGGCATTTCCATACTT IGF F: GCTTTTGTGATTTCTTGAAGGTGAA 195 bp NM_0,010,04384.2 R: CATACCCTGTAGGCTTACTGAAGTA gene Primers Product length GenBank accession no. GAPDH F: GGCACGCCATCACTATC 61 bp NM_204,305.1 R: CCTGCATCTGCCCATTT β-Actin F: CCGCAAATGCTTCTAAACCG 101 bp NM_205,518.1 R: AAAGCCATGCCAATCTCGTC GHRH F: GGCAAACGGCTCAGAAACAG 140 bp NM_0,010,40464.1 R: AGCATGGCTCCCAAGAAGTC GHR F: GCGTGTTCAGGAGCAAAGCT 121 bp NM_0,010,01293.1 R: TGGGACAGGCATTTCCATACTT IGF F: GCTTTTGTGATTTCTTGAAGGTGAA 195 bp NM_0,010,04384.2 R: CATACCCTGTAGGCTTACTGAAGTA View Large Statistical Analysis The experiment conducted in 3 replicates. After finding no significant difference between the replicates of each treatment group, the data were subjected to analysis of variance (ANOVA) according to the following model: the treatment (dark and the light treatments) and embryonic day (between ED10 and ED20) as the main fixed effects, including the interactions between treatment and ED. We found no significant interaction between treatment and ED. Therefore, the figures show LSMeans (± SE) of each treatment at certain embryonic day. The Tukey-Kramer HSD test was used for post-hoc testing of the differences between treatments’ LSMeans. All statistical analyses were conducted with the JMP software of the SAS Institute (Ver.12). RESULTS Throughout the incubation period, GL photostimulation did not affect either the body, muscle, or liver weights. Plasma GH Levels During the embryogenesis in all treatment groups, we found small elevation in plasma GH levels with a large and significant elevation on ED20. In-ovo GL photostimulation from ED0 (PC group) caused a significant increase in plasma GH levels (Figure 1) from ED14 until hatching day, compared to the NC group. GD10 group had higher plasma GH levels, similar to PC group, between ED14 and ED18, while the GD15 group, had significantly higher levels at ED 16 to a similar level found in PC group, and an elevation in plasma GH levels (to a level between the positive and negative controls) on ED18 and ED20. Figure 1. View largeDownload slide Plasma growth hormone levels, between ED10 to ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). Figure 1. View largeDownload slide Plasma growth hormone levels, between ED10 to ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). Hypothalamic GHRH, Liver GHR, and IGF-1 Gene Expression Elevation in GHRH mRNA expression from ED14 until hatch was detected in all treatment groups. In the PC group, a significant increase in the hypothalamic GHRH mRNA gene expression levels was detected in ED16 and ED20, compared to the NC group. The GD10 group showed no increase in the GHRH mRNA levels when compared to the negative control. On the other hand, GD 15 group showed a significant increase in GHRH mRNA levels on ED18 and ED20, compared to the negative control (Figure 2). Figure 2. View largeDownload slide Hypothalamic GHRH mRNA expression, between ED10-ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). Figure 2. View largeDownload slide Hypothalamic GHRH mRNA expression, between ED10-ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). Liver GHR mRNA gene expression, was elevated during embryogenesis peaking at ED18 and then declined at ED20. The positive control group had a significant increase in liver GHR mRNA levels on ED16 and ED18 compare to NC group. The GD10 group had same liver GHR mRNA levels, as the NC group; while the GD15 group had a similar increase in GHR mRNA levels as the PC group in ED18 (Figure 3). Figure 3. View largeDownload slide Liver GHR mRNA expression, between ED10 to ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). Figure 3. View largeDownload slide Liver GHR mRNA expression, between ED10 to ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). The liver IGF-1 mRNA gene expression was similar during the embryonic development, with a significant increase on hatching day (ED20). The PC group had a significant increase in liver IGF-1 mRNA levels between ED16 and ED18. The GD10 group had same IGF-1 mRNA levels as compared to NC group. The GD15 group, on the other hand, had significant elevation on ED18, similar to the positive control, but similar levels of the negative control, on ED20 (Figure 4). Figure 4. View largeDownload slide Liver IGF-1 mRNA expression, between ED10 to ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). Figure 4. View largeDownload slide Liver IGF-1 mRNA expression, between ED10 to ED20, of broilers incubated in the dark (NC) or under monochromatic green light from different days of incubation (GL, GD10, and GD15). Data are presented as mean ± SEM. Means of the group within a specific day with no common lowercase letter, differ significantly (P < 0.05). Means of the day within a specific treatment group with no common capital letter, differ significantly (P < 0.05). DISCUSSION In-ovo GL photostimulation from ED15 increased the somatotropic axis activity, similar to the acceleration in the positive control. In our study, GHRH increased naturally from ED14 until ED20. Similar results were found in our previous experiment (Dishon et al., 2017), as well as in Ellestad et al., 2011, which showed an increase in the GHRH expression from ED16 until d 1 posthatch. GL photostimulation from ED15 increased hypothalamic GHRH mRNA gene expression, to the level of the positive control mRNA gene expression and level presented in our previous study (Dishon et al., 2017). As for plasma GH levels, previous studies found natural elevation from ED 12, reaching a peak level at hatch (Kikuchi et al., 1991; Dishon et al., 2017). Zhang et al., 2014b, present elevation in plasma GH levels from ED 15. In addition, all light-treated groups had higher plasma GH levels during the last wk of the incubation compared to negative control group. The increase in the plasma GH levels of the GL photostimulated groups starts before the increase in hypothalamic GHRH mRNA gene expression, which may suggest that there might be a more direct, positive effect of the photostimulation on the secretion of the GH from the pituitary to the plasma. We found a natural increase in liver GHR mRNA gene expression from ED12 until ED18, followed by a decrease until hatch. Those results are similar to our previous findings (Dishon et al., 2017), which showed a similar pattern, as well as Burnside and Cogburn research (1992). Furthermore, we found that GL photostimulation from ED0 (positive control) caused elevation of the GHR mRNA gene expression on ED12 and between ED16-ED18, and that photostimulation from ED15 brought an increase similar to the positive control, on ED16 and ED18, while the GL10 group showed similar results to the negative control. The increase in the liver GHR mRNA gene expression, together with an increase in the plasma GH levels, may enable a greater utilization of GH. This mechanism is in agreement with the mechanism suggested by Kanacki et al., 2012 and the results found by Halevy et al., 1998 and Zhang et al., 2014b, which showed an increase in satellite cells GHR mRNA gene expression, and an increase in plasma GH levels, due to GL photostimulation, respectively. Under natural incubation conditions, liver IGF mRNA gene expression is low, with its level increased by hatching. When comparing the different treatment groups, we observed that GL photostimulation from ED0 increased the liver IGF-1 mRNA levels from ED16 until hatch, while photostimulation from ED15 (GD15 group) increased the expression of liver IGF-1, but with a significant difference only on ED18. The low levels of liver IGF-1 mRNA gene expression can be explained by the fact that during the embryogenesis, the liver plays only a minor role in the supply of IGF-1 to the developing embryo, while at hatch and in the posthatch period, it is the main source of IGF-1 of the chicken (McMurtry et al., 1997). The elevation in the IGF-1 because of the GL photostimulation, following the increase in both plasma GH levels, as well as liver GHR mRNA gene expression. This phenomenon may occur due to an increase activation of GH and its liver receptors, in GL photostimulated embryos. This effect, in turn, results in a greater activation of the liver to express the IGF-1 gene. This mechanism of GH connecting to liver GHR, and causes an increase in liver IGF-1, is supported by Kanacki et al., 2012. Furthermore, we suggest that the positive effect of in-ovo GL photostimulation on growth and development of broilers (Rozenboim et al., 2004), might be due to its elevation effect on liver GHR mRNA gene expression levels. According to Buzala et al., 2015, it was found that when comparing broilers and laying hens, the hens had higher levels of plasma GH, but lower levels of liver GHR expression. This, in turn, may suggest that the growth of broilers is due to higher levels of GHR, and not to GH itself. Therefore, the increase in liver GHR mRNA gene expression may explain why GL photostimulated broilers had higher body weight, compared to control, in Rozenboim et al., 2004. This may also explain why administration of GH to chicken, had conflicting effects. We suggest that in-ovo GL photostimulation might act centrally by activating neuroendocrine agents, such as melatonin, which found to be higher, when chicks exposed to GL photostimulation (Zhang et al., 2016). This elevation might increase GHRH mRNA gene expression in the hypothalamus (Zhang et al., 2016). The elevation in somatotropic axis activity in the GD15 group may suggest that the activation of this axis by GL stimulation is related to tissue photosensitivity both retinal and extraretinal sites. This was previously described by the effect of GL photostimulation on the melatonin and GHRH correlation, as well as by the locations of the GHRH secreting neurons and the extraretinal photoreceptors (Mano-Otafiri et al., 2006; Haflord et al., 2009; Zang et al., 2016). Photoreceptors can be found in the pineal gland, and they regulate the melatonin synthesis and secretion (Foster and Soni, 1998), both of which can be found as early as ED13 (and ED8 in quails) (Csernus et al., 2007) and ED10 (Csernus et al., 2007), respectively, as well as elevating GHRH expression. Furthermore, the neurons that secrete the GHRH in the hypothalamus can be found in the arcuate nucleus, which is part of the mediobasal hypothalamus (MBH) (Mano-Otafiri et al., 2006). The MBH also include photoreceptors that affect physiological responses (Halford et al., 2009) and are found as early as ED13 (unpublished data). The proximity of the extraretinal photoreceptors and melatonin, which affect the somatotropic axis, or the proximity to the GHRH secreting neurons, may suggest that the increase in the somatotropic axis expression is due to the activation of those photoreceptors and the secretion of neurotransmitters, which in turn may affect the synthesis and secretion of the GHRH. During this experiment, we found that in-ovo GL from ED10 had no effect on somatotropic axis. Embryonic d 10 is an important day for both endocrinologic (Porter and Dean, 2001) and metabolic (Janke et al., 2004; Tong et al., 2013) mechanisms. We suggest that the addition of photostimulation from ED10 might affect other related axes, such as the corticoid and the thyrotropin axis. The thyrotropin axis starts to function from ED10.5 (Porter and Dean, 2001), while the adrenals secrete corticosterone from ED8 (Jenkins and Porter, 2004). According to Porter and Dean, 2001, a combination of both T3 and corticosterone inhibited the GH secretion, which could explain the lack of positive effect of the photostimulation from ED10 on the development of the somatotropic axis. In conclusion, we suggest that the critical period of somatotropic axis acceleration by GL photostimulation start at 15 d of incubation. Further studies are conducting in order to frame this critical period and by that implementing this knowledge to the industry. In addition, other studies are conducting in order to understand the connection between the retinal and extra-retinal photoreceptors, in relation to the activation of the somatotropic axis. Further studies are required in order to understand how the in-ovo GL photostimulation affect the somatotropic axis. REFERENCES Borille R. , Garcia R. G. , Royer A. F. B. , Santana M. R. , Colet S. , Naas I. A. , Caldara F. R. , Almeida Paz I. C. L. , Rosa E. S. , Castilho V. A. R. . 2013 . The use of light-emitting diodes (LED) in commercial layer production . Braz. J. Poult. Sci. 14 : 135 – 140 . Bossis I. , Porter T. E. . 2001 . Identification of the somatostatin receptor subtypes involved in regulation of growth hormone secretion in chickens . Mol. Cell. Endocrinol. 182 : 203 – 213 . Google Scholar CrossRef Search ADS PubMed Burnside J. , Cogburn L. A. . 1992 . Developmental expression of hepatic growth hormone receptor and insulin-like growth factor-I mRNA in the chicken . Mol. Cell. Endocrinol. 89 : 91 – 96 . Google Scholar CrossRef Search ADS PubMed Buyse J. , Decuypere E. . 1999 . The role of the somatotrophic axis in the metabolism of the chicken . Domest. Anim. Endocrinol. 17 : 245 – 255 . Google Scholar CrossRef Search ADS PubMed Buzala M. , Janicki B. , Czarnecki R. . 2015 . Consequences of different growth rates in broiler breeder and layer hens on embryogenesis, metabolism and metabolic rate: A review . Poult. Sci. 94 : 728 – 733 . Google Scholar CrossRef Search ADS PubMed Cogburn L. A. , Liou S. S. , Rand A. L. , Mcmurtry J. P. . 1989 . Growth, metabolic and endocrine responses of broiler cockerels given a daily subcutaneous injection of natural or biosynthetic chicken growth hormone . J. Nutr . 1213 – 1222 . Csernus V. J. , Nagy A. D. , Faluhelyi N. . 2007 . Development of the rhythmic melatonin secretion in the embryonic chicken pineal gland . Gen. Comp. Endocrinol . 152 : 148 – 153 . Google Scholar CrossRef Search ADS PubMed Dishon L. , Avital-Cohen N. , Malamud D. , Heiblum R. , Druyan S. , Porter T. E. , Gumułka M. , Rozenboim I. . 2017 . In-ovo monochromatic green light photostimulation enhances embryonic somatotropic axis activity . Poult. Sci . 96 : 1884 – 1890 . Google Scholar CrossRef Search ADS PubMed Ellestad L. E. , Saliba J. , Porter T. E. . 2011 . Ontogenic characterization of gene expression in the developing neuroendocrine system of the chick . Gen. Comp. Endocrinol . 171 : 82 – 93 . Google Scholar CrossRef Search ADS PubMed Foster R. G. , Soni B. G. . 1998 . Extraretinal photoreceptors and their regulation of temporal physiology . J. Reprod. Fertil . 3 : 145 – 150 . Haflord S. , Pires S. S. , Turton M. , Zheng L. , González-Menéndez I. , Davies W. L. , Peirson S. N. , García-Fernández J. M. , Hankins M. W. , Foster R. G. . 2009 . VA Opsin-Based photoreceptors in the hypothalamus of birds . Curr. Biol . 19 : 1396 – 1402 . Google Scholar CrossRef Search ADS PubMed Halevy O. , Biran I. , Rozenboim I. . 1998 . Various light source treatments affect body and skeletal muscle growth by affecting skeletal muscle satellite cell proliferation in broilers . Comp. Biochem. Physiol. Pt. A Mol. Integr. Physiol. 120 : 317 – 323 . Google Scholar CrossRef Search ADS Halevy O. , Piestun Y. , Rozenboim I. , Yablonka-Reuveni Z. . 2006a . In ovo exposure to monochromatic green light promotes skeletal muscle cell proliferation and affects myofiber growth in posthatch chicks . Am. J. Physiol. Regul. Integr. Comp. Physiol . 290 : R1062 – R1070 . Google Scholar CrossRef Search ADS Halevy O. , Yahav S. , Rozenboim I. . 2006b . Enhancement of meat production by environmental manipulations in embryo and young broilers . Worlds. Poult. Sci. J. 62 : 485 – 497 . Janke O. , Tzschentke B. , Boerjan M. . 2004 . Comparative investigations of heat production and body temperature in embryos of modern chicken breeds . Avian Poult. Biol. Rev. 15 : 191 – 196 (6). Google Scholar CrossRef Search ADS Jenkins S. A. , Porter T. E. . 2004 . Ontogeny of the hypothalamo–pituitary–adrenocortical axis in the chicken embryo: a review . Domest. Anim. Endocrinol. 26 : 267 – 275 . Google Scholar CrossRef Search ADS PubMed Kanački Z. , Stojanović S. , Ušćebrka G. , Žikić D. . 2012 . The development pattern of IGF-1 (insulin- like growth factor-1) protein expression in breast muscle of broiler chickens . Biotechnol. Anim. Husb . 28 : 797 – 805 . Google Scholar CrossRef Search ADS Kikuchi K. , Buonomo F. C. , Kajimoto Y. , Rotwein P. . 1991 . Expression of Insulin-Like growth Factor-I during chicken development . Endocrinology 128 : 1323 – 1328 . Google Scholar CrossRef Search ADS PubMed Kim J. W. 2010 . The endocrine regulation of chicken growth . Asian-Australas. J. Anim. Sci . 23 : 1668 – 1676 . Google Scholar CrossRef Search ADS Kocamis H. , Yeni T. N. , Kirkpatrick-Keller D. C. , Killefer J. . 1999 . Postnatal growth of broilers in response to in ovo administration of chicken growth hormone . Poult. Sci. 78 : 1219 – 1226 . Google Scholar CrossRef Search ADS PubMed Lu F. Z. , Wang X. X. , Pan Q. X. , Huang R. H. , Liu H. L. . 2008 . Expression of genes involved in the somatotropic, thyrotropic, and corticotropic axes during development of Langshan and Arbor Acres chickens . Poult. Sci. 87 : 2087 – 2097 . Google Scholar CrossRef Search ADS PubMed Mano-Otagiri A. , Nemoto T. , Sekino A. , Yamauchi N. , Shuto Y. , Sugihara H. , oikawa S. , Shibasaki T. . 2006 . Growth hormone-releasing hormone (GHRH) neurons in the arcuate nucleus (Arc) of the hypothalamus are decreased in transgenic rats whose expression of ghrelin receptor is attenuated: Evidence that ghrelin receptor is involved in the up-regulation of GHRH expression in the arc . Endocrinology . 147 : 4093 – 4103 . Google Scholar CrossRef Search ADS PubMed Mao J. N. C. , Burnside J. , Postel-Vinay M. C. , Pesek J. D. , Chambers J. R. , Cogburn L. A. . 1998 . Ontogeny of growth hormone receptor gene expression in tissue of growth-selected strains of broiler chickens . Endocrinology 156 : 67 – 75 . Google Scholar CrossRef Search ADS McMurtry J. P. , Francis G. L. , Upton Z. . 1997 . Insulin-like growth factors in poultry . Domest. Anim. Endocrinol . 14 : 199 – 229 . Google Scholar CrossRef Search ADS PubMed Moellers R. F. , Cogburn L. A. . 1995 . Chronic intravenous infusion of chicken growth hormone increases body fat content of young broiler chickens . Comp. Biochem. Physiol. Pt. A: Physiol . 110 : 47 – 56 . Google Scholar CrossRef Search ADS Phogat S. B. , Aggarwal C. K. , Chopra S. K. . 1985 . Effect of red and green lights on growth of quail . Indian J. Poult. Sci. 20 , 126 – 128 . Porter T. E. , Dean K. J. . 2001 . Regulation of chicken embryonic growth hormone secretion by corticosterone and triiodothyronine: evidence for a negative synergistic response . Endocrine . 14 : 363 – 368 . Google Scholar CrossRef Search ADS PubMed Porter T. E. , Ellestad L. E. , Fay A. , Stewart J. L. , Bossis I. . 2006 . Identification of the chicken growth hormone-releasing hormone receptor (GHRH-R) mRNA and gene: regulation of anterior pituitary GHRH-R mRNA levels by homologous and heterologous hormones . Endocrinology 147 : 2535 – 2543 . Google Scholar CrossRef Search ADS PubMed Rozenboim I. , Biran I. , Uni Z. , Halevy O. . 1999a . The effect of monochromatic light on broiler growth and development . Poult. Sci. 78 : 135 – 138 . Google Scholar CrossRef Search ADS Rozenboim I. , Robinzon B. , Rosenstrauch A. . 1999b . Effect of light source and regimen on growing broilers . Br. Poult. Sci. 40 , 452 – 457 . Google Scholar CrossRef Search ADS Rozenboim I. , Piestun Y. , Mobarkey N. , Barak M. , Hoyzman A. , Halevy O. . 2004 . Monochromatic light stimuli during embryogenesis enhance embryo development and posthatch growth . Poult. Sci. 83 : 1413 – 1419 . Google Scholar CrossRef Search ADS PubMed Rozenboim I. , El Halawani M. E. , Kashash Y. , Piestun Y. , Halevy O. . 2013 . The effect of monochromatic photostimulation on growth and development of broiler birds . Gen. Comp. Endocrinol . 190 : 214 – 219 . Google Scholar CrossRef Search ADS PubMed Tong Q. , Romanini C. E. , Exadaktylos V. , Bahr C. , Berckmans D. , Bergoug H. , Eterradossi N. , Roulston N. , Verhelst R. , McGonnell I. M. , Demmers T. . 2013 . Embryonic development and the physiological factors that coordinate hatching in domestic chickens . Poult. Sci. 92 : 620 – 628 . Google Scholar CrossRef Search ADS PubMed Vasilatos-Younken R. , Scanes C. G. . 1991 . Growth hormone and insulin-like growth factors in poultry growth: required, optimal, or ineffective? Poult. Sci. 70 : 1764 – 1780 . Google Scholar CrossRef Search ADS PubMed Wabeck C. J. , Skuglund W. C. . 1974 . Influence of radiant energy from fluorescent light sources on growth, mortality, and feed conversion of broilers . Poult. Sci. 53 : 2055 – 2059 . Google Scholar CrossRef Search ADS PubMed Wang C. Y. , Wang Y. , Li J. , Leung F. C. . 2006 . Expression profiles of growth hormone-releasing hormone and growth hormone-releasing hormone receptor during chicken embryonic pituitary development . Poult. Sci. 85 : 569 – 576 . Google Scholar CrossRef Search ADS PubMed Zhang L. , Zhang H. J. , Wang J. , Wu S. G. . 2014a . Stimulation with monochromatic green light during incubation alters satellite cell mitotic activity and gene expression in relation to embryonic and posthatch muscle growth of broiler chickens . Animal 8 : 86 – 93 . Google Scholar CrossRef Search ADS Zhang L. , Wu S. , Wang J. , Qiao X. , Yue H. , Yao J. , Zhang H. , Qi G. . 2014b . Changes of plasma growth hormone, insulin-like growth factors-1, thyroid hormones, and testosterone concentrations in embryos and broiler chickens incubated under monochromatic green light . Ital. J. Anim. Sci. 13 : 530 – 535 . Zhang L. , Cao J. , Wang Z. , Dong Y. , Chen Y. . 2016 . Melatonin modulates monochromatic light-induced GHRH expression in the hypothalamus and GH secretion in chicks . Acta Histochem . 118 : 286 – 292 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Poultry ScienceOxford University Press

Published: Mar 16, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off