Identification of Four ATP-Binding Cassette Transporter Genes in Cnaphalocrocis medinalis and Their Expression in Response to Insecticide Treatment

Identification of Four ATP-Binding Cassette Transporter Genes in Cnaphalocrocis medinalis and... The ATP-binding cassette (ABC) transporters belong to a superfamily of genes involved in the transport of spe- cific molecules across lipid membranes, as well as insecticide resistance, present in all living organisms. In this study, we combined the Cnaphalocrocis medinals transcriptome database with a bioinformatics approach to identify four C. medinals ABCs (CmABCs), including CmABCG1, CmABCG4, CmABCC2 and CmABCC3. Tissue expression analysis showed that these genes had a tissue-specific expression pattern. CmABCG1 had signifi- cantly higher expression in the haemolymph and head compared to the other tissues. The expression of CmABCG4, CmABCC2 and CmABCC3 was highest in the midgut, followed by expression in the fat body. The developmental stage expression analysis showed that CmABCG1, CmABCG4, CmABCC2 and CmABCC3 were mainly expressed in adults. The transcription of CmABCG1, CmABCG4 and CmABCC2 was significantly induced by chlorpyrifos. Taken together, the results of our study provided useful information for understanding of the detoxification system of C. medinalis. Key words: Cnaphalocrocis medinalis, ABC transporter, mRNA expression, insecticide detoxification The rice leaffolder, Cnaphalocrocis medinalis (Lepidoptera: enzymes in Plutella xylostella, in addition to GSTs, CarEs and Pyralidae) is a major pest of rice crops, and is widely distributed in P450s (He et al. 2012). Epis et al. (2014) also identified ABC trans- tropical and temperate rice-producing regions (Khan et al. 1988, porter genes from Anopheles stephensi based on transcriptome data, Riley et al. 1995). The control of rice insect pests is mainly depend- and the results confirmed the role of ABC transporter in insecticide ent on the extensive use of chemical insecticides. However, this re- defense. ABC transporters also play an important role in the detoxi- sults in disturbance of the environment and resistance of pests to fication of insecticides. insecticides (Abudulai et al. 2001, Huang et al. 2003). Metabolic re- ABC transporters belong to a large superfamily responsible for sistance and target resistance are the two major mechanisms under- the transport of specific molecules across lipid membranes, in add- lying insecticide resistance. Metabolic resistance relies on ition to insecticide resistance, present in all living organisms (Higgins 1992). The multidomain integral membrane proteins of detoxification enzymes such as glutathione S-transferases (GSTs), carboxylesterases (CarEs) and cytochrome P450 monooxygenases ABC transporters utilize the energy produced by ATP hydrolysis to (P450s) (Ranson et al. 2002). Liu et al. (2015b) identified 25 candi- translocate solutes across cellular membranes in all phyla (Jones and date GST genes and 36 putative P450 genes in C. medinalis by George 2004). ABC transporters have a modular structure, consist- searching the transcriptome dataset, which may be involved in the ing of two nucleotide-binding domains (NBDs), which bind and insecticide detoxification displayed by these moths. The involvement hydrolyze ATP, as well as two transmembrane domains (TMDs), of ABC transporters in xenobiotic resistance for arthropods was his- which are involved in the translocation of their respective substrates torically not well documented, but an increasing number of studies (Rees et al. 2009). The NBDs contain characteristic motifs, includ- were focused on differentially gene expression analysis to show their ing Walker A, Walker B, A-loop, D-loop, H-loop and Q-loop. ABC importance (Dermauw and Leeuwen 2014). ATP-binding cassette transporter genes also contain the signature C motif, located just up- (ABC) transporters have been identified as important detoxification stream of the Walker B site (Dean et al. 2001). Sequence analyses of V C The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. 1 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 journals.permissions@oup.com by Ed 'DeepDyve' Gillespie user on 17 July 2018 2 Journal of Insect Science, 2017, Vol. 17, No. 2 eukaryotic ABC transporters revealed that they can be divided into plastic boxes, and each leaf was sprayed with 1 ml of the working eight subfamilies (ABCA-H) (Dean and Annilo 2005). In recent chlorpyrifos solution (Goh et al. 2011, Painkra and Salam 2013). years, many more species genomes have been sequenced. Liu et al. The boxes were covered with plastic netting to prevent C. medinalis (2010) and Xie et al. (2012) identified 51 putative ABC transporter escape (n ¼ 20 in each group). Control insects were treated with sterile water only. Each treatment was performed 3 biological genes in silkworms, classified into eight subfamilies (A-H) based on replicate and 10 larvae were treated in each replicate. Data was stat- whole-genome analyses. Broehan et al. (2013) found 73 ABC trans- istically analyzed by a paired Student’s t-test. All midgut samples porter genes in the genome of Tribolium castaneum, which can also were collected after 24 h, frozen in liquid nitrogen and stored at be grouped into eight subfamilies (ABCA-H). The ABC family of 80 C. coleopterans is significantly larger than that reported for insects in other taxonomic groups. In Tetranychus urticae, 103 ABC trans- porter genes have been identified, which is the highest number dis- RNA Isolation and cDNA Synthesis covered in a metazoan species to date (Dermauw et al. 2013). Total RNA was isolated from the integument, head, midgut, fat Furthermore, the different subfamilies of ABC transporters may be body and haemolymph of the larvae and adults using TRIzol re- involved in different functions. The ABC transporter C subfamily is agent, according to the manufacturer’s instructions. The A 260/280 thought to be involved in drug resistance (Labbe ´ et al. 2011). Gahan ratio and RNA concentration of the samples were detected using a et al. (2010) reported an inactivating mutation of the ABC trans- NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, New porter ABCC2 which was associated to Cry1Ac resistance, as a re- York, NY). The total RNA samples were treated with TM sult of inhibiting the binding of Cry1Ac to membrane vesicles. In PrimeScript RT kit with gDNA Eraser (TaKaRa, Dalian, China) to remove any genomic DNA, then the first strand cDNA was Drosophila melanogaster, the white, brown and scarlet genes synthesized according to the manufacturer’s instructions. Briefly, encode proteins that transport guanine or tryptophan, all of which belong to the ABC transporter superfamily. These proteins play a 2.0 llof 5 gDNA Eraser buffer, 1.0 ll of gDNA Eraser and 1.0 lg major role in the absorption of pigment precursors during eye devel- of total RNA were mixed in a 100-ll PCR tube, then RNase Free opment (Mackenzie et al. 1999). However, no studies have investi- dH O was added to reach 10 ll, which was then incubated at room gated the ABC transporter genes in C. medinalis. temperature for 5 min. Afterwards, 5 PrimeScript buffer, 1.0 ll In this study, we identified four complete C. medinalis ABC PrimeScript RT enzyme mix I and 1.0 ll of RT primer mix were added to the tube, which was made up to 20 ll with RNase Free transporters (CmABCs) based on a transcriptome database from our dH O. The mixture was incubated at 37 C for 15 min, and laboratory, which were named CmABCG1, CmABCG4, 2 then incubated at 85 C for 5 s. The cDNA was stored at 20 C for CmABCC2 and CmABCG3 (Yu et al. 2015). All sequences were later use. analyzed by bioinformatics, and their molecular characteristics and functions were predicted. Real-time quantitative PCR (RT-qPCR) analysis was performed to determine their level of expression in dif- Identification of ABC Genes From the Cnaphalocrocis ferent tissues and at different developmental stages, as well as their medinalis Transcriptome response to chlorpyrifos exposure. The results of our study will con- Transcriptome sequencing was performed on fourth-instar C. med- tribute to better understanding the detoxification systems of C. med- inalis larvae using the Illumina pair-end sequencing method inalis, in addition to assisting in the establishment of new target sites (Biomarker Technology Company, Beijing, China) to obtain the C. for insect control. medinalis transcriptome database. The ABC transporter genes were identified from the dataset using the TBLASTN algorithm in Basic Local Alignment Search Tool (BLAST). The candidate Materials and Methods ABC genes for C. medinalis were confirmed by searching the NCBI nonredundant protein database using BLASTX (cut-off E Insect Collection and Sample Preparation value of 10 ). The bioinformatic sequence analyses revealed that Leaffolder larvae were collected from the rice paddy field at CmABCG1, CmABCG4, CmABCC2 and CmABCC3 had com- the Rice Institute of Anhui Academy of Agricultural Sciences and plete sequences. were reared in insectary for a few days based on previous method (Liao et al. 2012). The first instar, second instar, the first day of third instar, fourth instar, the first day of pupae and adults were Bioinformatic Analysis collected. On the first day of fourth-instar, midgut, head, integu- The molecular mass and isoelectric point was predicted using the ment, fat body and haemolymph samples were obtained from C. Compute pI and Mw tool (http://us.expasy.org/tools/pi_tool.html). medinalis larvae. All tissues samples were ground in liquid nitro- The open reading frames (ORFs) of the ABC genes were predicted gen, and 100 mg of each sample was placed into tubes. The sam- using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). ples were mixed with 1 ml TRIzol reagent (Invitrogen, Grand Conserved domains were determined using the NCBI conserved Island, NY), then homogenized using a pellet pestle and preserved domain database (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb. cgi). The homology of amino acid sequences was determined with at 80 C. DNAMAN 7.0 software (Lynnon Biosoft, Vandreuil, QC, Canada). The phylogenetic tree was constructed with MEGA 5.0 software Insecticide Treatment using the neighbor-joining method with 1,000-fold bootstrap resam- In order to understand the function of ABC transporter genes rele- pling (Tamura et al. 2011). vant to the field of insect pest control, fourth-instar larvae of C. medinalis were treated with an insecticide. Chlorpyrifos was pur- Developmental and Tissue-Specific Expression Profiles chased from Biogen Crop Science Limited (Shaanxi, Weinan, China). In order to simulate exposure of C. medinalis to insecticides of the CmABCs in the field, chlorpyrifos was diluted to a working solution with ster- In order to detect the expression of CmABCG1, CmABCG4, ile water (1:300). Fresh rice leaves were picked and placed in sterile CmABCC2 and CmABCC3 in different tissues (midgut, head, Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018 Journal of Insect Science, 2017, Vol. 17, No. 2 3 integument, fat body and haemolymph) and at different develop- contained signature C, Walker A/P-loop, Walker B, D-loop, Q-loop/ mental stages (first instar, second instar, the first day of third instar, Lid and H-loop/switch domains. However, the CmABCG4 sequence fourth instar, the first day of pupal and adult), four pairs of RT- only contained the H-loop/switch region. According to SMART on- qPCR primers were designed, including the forward and reverse pri- line software (http://smart.embl-heidelberg.de/), CmABCG1 and mers of CmABCG1, CmABCG4, CmABCC2 and CmABCC3 CmABCG4 contained one ABC2_membrane domain, whereas (Table 1). The 25-ll reaction mixture for RT-qPCR contained CmABCC2 and CmABCC3 contained two ABC_membrane and 12.5 ll SYBR II, 9.5 ll ddH O, 1.0 ll forward primer, 1.0 ll reverse two AAA domains (Fig. 1). primer and 1.0 ll cDNA template. The thermal cycling profile began Six signature motifs of the ABC transporter have previously been with an incubation at 50 C for 2 min, then denaturation for 10 min reported in Bombyx mori and Tribolium castaneum (Broehan et al. at 95 C, followed by 40 cycles of 15 s at 95 C and 1 min at 60 C. 2013). A multiple alignment analysis was performed for the amino Each gene was assayed in three replicates. The reactions were per- acid sequence of these ABC transporters, and the structural charac- formed in 96-well plates using the Multicolor RT-PCR Detection teristics were highlighted (Fig. 2). Motifs 1–6 are represented by the System (Bio-Rad, Hercules, CA). The CmActin gene (GenBank: sequences GxxGxGKx, YxxQ, LSGGQxxRxx, IYLLDxP, SAVD JN029806.1) served as the internal control. The relative expression and xxHQxx, respectively, where x is a nonspecific amino acid. DDCt levels were calculated using the 2 method, following the proto- col described by Livak and Schmittgen (2001). Data was statistically analyzed by ANOVA, and Fisher’s least significant difference (LSD) Phylogenetic Analysis of CmABCs With Those From post hoc test was used to determine between group differences. All Other Insects statistical analyses were performed using SPSS software (P<0.05 for In order to better understand the evolutionary relationships of the significant differences and P<0.01 for highly significant CmABCs with those of other insects, we selected the ABC trans- differences). porters of Bombyx mori (Lepidopteria), Drosophila melanogaster (Diptera), Tribolium castaneum (Coleoptera) and Tetranychus Results urtiace (Acarina) for amino acid homology analysis and establish- ment of a neighbor-joining phylogenetic tree with C. medinalis (Fig. Identification of ABC Genes in Cnaphalocrocis 3). In the neighbor-joining tree, four CmABCs fell into two subfami- medinalis and cDNA Sequence Analysis lies (C and G). In the C subfamily, CmABCC2 had high homology In order to identify and characterize the ABC genes from C. medina- with the ABCG-4A sequence of Tribolium castaneum, and lis, four cDNA fragments encoding ABC transporters were found CmABCC3 had a close relationship to TcABCC-9A. In the G sub- based on the transcriptome dataset, which were named CmABCG1, family, CmABCG1 and CmABCG4 only had 25% and 38% se- CmABCG4, CmABCC2 and CmABCC3 (NCBI accession numbers: quence identity, respectively, with their respective orthologs. 1943863, 1944314, 1944315 and 1944318; Supp Figs. 1–4 [online only]). Of these, four CmABC sequences contained complete ORFs. The length, molecular weight, isoelectric point and other basic infor- mation about the sequences obtained are listed in Table 2. Sequence Expression Patterns of CmABC Genes in Different analysis indicated that CmABCG1, CmABCC2 and CmABCC3 Larval Tissues In order to determine the expression patterns of the CmABC genes Table 1. Primers used for RT-qPCR experiment in the present study in larvae, we performed RT-qPCR using cDNA from the integu- 0 0 ment, head, midgut, fat body and haemolymph. The expression of Primer name Sequence (5 –3 ) Length CmABCG1 in the haemolymph was 13.5 times higher than the in- (bp) tegument, the expression in the head was 3.9 times higher than the CmABCG1 Forward: ATGGCTAACGATGGCACGC 268 integument, and CmABCG1 expression was similar in the midgut Reverse: TTGGCACACTGAAGGGCAC and fat body. CmABCG4 had the highest expression in the midgut, CmABCG4 Forward: TTAGAAATAGCGAACGGCGA 283 which was 8 times that of the integument, whereas its expression in Reverse: CCAGGAGCACCCCAATCAC the fat body was 3.6 times higher than the integument. CmABCC2 CmABCC2 Forward: TACTCATTGATTTCGGGGACATA 172 Reverse: TCTTCTTTGGGCAGATTGGTG and CmABCC3 expression was significantly higher in the midgut CmABCC3 Forward: TCCTCCCTACGAGCCATTCC 198 than in the other tissues, which were 42.9- and 61.5 times higher in Reverse: GACTTGCCAGAGCCCACAG the midgut than the integument, respectively. The CmABCC2 and CmActin Forward: GTTACTCATTCACCACCACCGCTG 234 CmABCC3 expression in the head was similar to that of the haemo- Reverse: GGATACCGCAAGATTCCATACCCA lymph (Fig. 4). Table 2. Characteristics of CmABC sequences cDNA NCBI # cDNA ORF M.W pI Signature Walker Walker B D-loop Q-loop/Lid H-loop/Switch length (bp) (aa) (kDa) C A/P-loop CmABCG1 1943863 2,474 627 70.1 8.26 138–147 42–49 158–164 166–169 85–88 192–198 CmABCG4 1944314 2,043 403 45.2 8.52 – – – – – 12–20 CmABCC2 1944315 4,648 1,348 151.5 8.66 591–600 501–508 611–616 619–622 533–536 644–650 CmABCC3 1944318 4,351 1,326 147.7 6.77 559–568 469–476 579–584 587–590 501–504 612–618 ORF, open reading frame; MW, molecular weight. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018 4 Journal of Insect Science, 2017, Vol. 17, No. 2 Fig. 1. Conserved domain analysis of Cnaphalocrocis medinalis ABC transporters. The black rectangular regions represent transmembrane domains (TMDs). The black annular regions represent nucleotide binding domains (NBDs). The blue box regions represent transmembrane domain. The AAA and BLAST region repre- sent ATPases associated with a variety of cellular activites. The pink box regions represent low complexity region. Fig. 2. Amino acid sequence alignments of CmABC catalytic domains. CmABCG1, CmABCG4, CmABCC2 and CmABCC3 from Cnaphalocrocis medinalis (1943863, 1944314, 1944315 and 1944318). Similar and identical amino acid residues are highlighted in pink and black. The red boxed regions represent different domains. Expression Patters of CmABC at Different C. medinalis (Zheng et al. 2011, Zhang et al. 2014). The expression of the four genes was compared between chlorpyrifos-treated and Developmental Stages untreated control insects. We found that the expression of In order to determine the expression of CmABCs at different devel- CmABCG1, CmABCG4 and CmABCC2 increased remarkably 24 h opmental stages, we performed RT-qPCR with cDNA from the first after chlorpyrifos exposure, indicating that these genes are likely to instar, second instar, the first day of the third instar and fourth in- be involved in the insecticide detoxification process. However, there star larval stages, as well as the pupal and adult stages. The expres- was no significant difference in CmABCC3 expression between the sion levels of CmABCG1, CmABCG4 and CmABCC2 were low in the early instar larvae (first, second, third and fourth stages) when chlorpyrifos-treated and untreated control insects (Fig. 6). compared to the late instar stages (pupae and adult). The expression increased sharply from pupae to adult. Interestingly, the relative ex- Discussion pression of CmABCG1 and CmABCC2 showed an increasing trend during the second instar. The expression of CmABCC3 fluctuated Insect ABC transporters can be classified into eight subfamilies considerably from first-instar larvae to adults. CmABCC3 was ex- (ABCA-H), according to phylogenetic tree analysis (Walker et al. pressed highly in the second instar, fourth instar and adult stages, 1981). In this study, we identified four ABC transporters by tran- but expression was low in pupae (Fig. 5). scriptome analysis, and analyzed their conserved domains. These re- sults are consistent with that previously reported for a member of the silkworm G subfamily (Liu et al. 2011). Additionally, some ABC Gene Expression Profile After Insecticide Treatment The results obtained for CmABC expression showed that most genes transporters of members of the G subfamily have been demonstrated had high expression in the midgut, except CmABCG1. Therefore, to confer resistance to xenobiotics, including insecticides (Labbe ´ the fourth-instar larval midgut was selected as the target tissue for et al. 2011). The amino acid sequences of CmABCC2 and insecticide exposure. In previous studies, the organophosphate in- CmABCC3 were found to contain two ABC_membrane and two secticide chlorpyrifos has been effectively used for the control of a AAA domains. In D. melanogaster, the ABCC transporter, encoded wide range of pests, including Chilo suppressalis, planthoppers and by CG10505, was shown to be regulated by the presence of heavy Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018 Journal of Insect Science, 2017, Vol. 17, No. 2 5 Fig. 3. Phylogenetic relationships of ATP-binding cassette (ABC) transporters from five insect species, Cnaphalocrocis medinalis (Cm); Bombyx mori (Bm), Drosophila melanogaster (CG), Tribolium castaneum (Tc) and Tetranychus urtiace (Tu). The phylogenetic tree was constructed with MEGA5 software using the neighbor-joining method. Bootstrap values indicate the analysis of 1,000 replicates. The ABC transporters of C. medinalis are highlighted in red. Fig. 4. Expression of CmABC genes in different larval tissues. The statistical analysis used the lowest expression level as a reference, and the significant differ- ences are indicated by * (P< 0.05) or ** (P< 0.01). Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018 6 Journal of Insect Science, 2017, Vol. 17, No. 2 Fig. 5. Expression of CmABC genes at different developmental stages. The statistical analysis was performed by one-way ANOVA, post hoc Tukey’s test, and the significant differences are indicated by * (P< 0.05) or ** (P< 0.01). Fig. 6. Relative expression levels of four CmABC genes in chlorpyrifos-treated and untreated control larvae. The statistical analysis was performed by paired Student’s t-test, and the significant differences are indicated by * (P< 0.05) or ** (P< 0.01). metals via metal-responsive transcription factor 1, and is involved in phylogenetic tree of Daphnia, human, worm and Drosophila ABCC the biochemical detoxification of zinc and copper (Yepiskoposyan proteins is characterized by comparatively low support of the more et al. 2006). The results obtained from the structural domain ana- basal nodes, which most probably reflects the heterogeneity of the lysis, combined with that previously reported by others, suggests ABCC subfamily. Our results showed that the CmABCC2 amino that CmABCG1, CmABCG4, CmABCC2 and CmABCC3 are likely acid sequence is closely related to TcABCC-4A, and CmABCC3 is to be involved in transmembrane transport of xenobiotics. closely related to TcABCC-9A. Within the G subfamily, CmABCG1 However, its functions were required for further study. appears to be most closely related to the Drosophila ABCC Based on the phylogenetic tree analysis, the ABC transporters CG7346, and CmABCG4 is most closely related to BmABC010557. can be widely classified into two subfamilies (C and G). In These results are suggestive of similar physiological function and Tetranychus urticae, the ABCC subfamily consists of 39 trans- evolutionary relatedness between insect species. porters, and phylogenetic analysis showed that 23 of the ABCCs of The expression of the ABC transporters differ in different tissues T. urticae were clustered with amino acid sequences of CG6214 and and at different developmental stages, depending on the species. Dappul347281 from D. melanogaster and Daphnia pulex, respect- CmABCG4, CmABCC2 and CmABCC3 were found to be tissue- ively (Dermauw et al. 2013). Sturm et al. (2014) reported the pres- specific ABC genes. They were more highly expressed in the midgut ence of seven ABCC family transporters in D. pulex. The and fat body than the other tissues evaluated. The insect midgut is a Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018 Journal of Insect Science, 2017, Vol. 17, No. 2 7 major tissue for the metabolism of various chemicals from food. The Supplementary Data midgut epithelium is the first physical barrier after oral intake, and Supplementary data are available at Journal of Insect Science online. contains abundant digestive enzymes needed to obtain nutrients from food, and also contributes to the detoxification of insecticides Acknowledgments (Smagghe and Tirry 2001). In silkworms, BmABC005226, BmABC005203 and BmABC010555 were shown to be exclusively This work was supported by the Natural Science Foundation of China expressed in the midgut, as determined by RT-qPCR. However, we (31472148). reported that CmABCG1 is highly expressed in the haemolymph and head. Insect haemolymph contains a variety proteins involved in References Cited insecticide detoxification. Therefore, CmABCG4, CmABCC2 and CmABCC3 may play an important role in detoxification, with the Abudulai, M., B. M. Shepard, and P. L. Mitchell. 2001. Parasitism and preda- midgut as a target. The expression analysis at different developmen- tion on eggs of Leptoglossus phyllopus (L.) (Hemiptera: Coreidae) in cow- tal stages showed that CmABCG1, CmABCG4 and CmABCC2 pea: impact of endosulfan sprays. J. Agric. Urban Entomol. 18: 105–115. Broehan, G., T. Kroeger, M. Lorenzen, and H. Merzendorfer. 2013. were highly expressed in adults, with lower expression levels Functional analysis of the ATP-binding cassette (ABC) transporter gene observed in the early instar larvae (first, second, third and fourth in- family of Tribolium castaneum. BMC Genomics 14: 6. star). In a previous study, Guo et al. (2015) found that expression of Cole, S. P. C., C. F. Higgins, H. I. Barry, and K. Karl. 2003. ABC proteins PxABCH1 was highest in the head of adult males, as determined by from bacteria to man Abc Proteins 263–275. spatial-temporal expression analysis. We speculated that C. medina- Dean, M., and T. Annilo. 2005. Evolution of the ATP-binding cassette (ABC) lis had a greater detoxification ability in adults when compared to transporter superfamily in vertebrates. Annu. Rev. Genomics Hum. Genet. larvae. Interestingly, our RT-qPCR results also showed that 6: 899–910. CmABCG1 expression was up-regulated by 11.8 times from the Dean, M., Y. Hamon, and G. Chimini. 2001. The human ATP-binding cas- fourth instar larvae to the pupal stage (Fig. 5). In silkworm, sette (ABC) transporter superfamily. Genome Res. 11: 1007–1017. BmABC010555 was reported to be highly expressed during the Dermauw, W., and T. V. Leeuwen. 2014. ABC transporters in Arthropods: genomic comparison and role in insecticides transport and resistance. Insect wandering and prepupal stages. However, the function of Biochem. Mol. Biol. 45: 89–110. CmABCG1 in the pupae was unknown. CmABCC3 expression Dermauw, W., E. J. Osborne, R. M. Clark, M. Grbic, L. Tirry, and T. V. showed considerable fluctuation from first instar to adult, and ex- Leeuwen. 2013. A burst of ABC genes in the genome of the polyphagous spi- pression was lowest on the first day of the third instar stage. We der mite Tetranychus urticae. BMC Genomics 14: 22. considered that the first day of the third instar was at molting stage, Epis, S., D. Porretta, V. Mastrantonio, F. Comandatore, D. Sassera, P. Rossi, which was regulated by ecdysone and juvenile hormone. In an un- C. Cafarchia, D. Otranto, G. Favia, C. Genchi et al. 2014a. ABC trans- published study of D. melanogaster, we found that several ABCG porters are involved in defense against permethrin insecticide in the malatria transporters were exclusively expressed in two important endocrine vector Anopheles stephensi. Parasites Vector 7: 1–7. organs, the corpus allatum, which produces juvenile hormone, and Epis, S., D. Porretta, V. Mastrantonio, S. Urbanelli, D. Sassera, M. L. De, V. the prothoracic gland, which produces ecdysone (the immediate pre- Mereghetti, M. Montagna, I. Ricci, and G. Favia. 2014b. Temporal dy- cursor to 20E). namics of the ABC transporter response to insecticide treatment: insights In recent years, ABC transporters have been identified as detoxi- from the malaria vector Anopheles stephensi. Sci. Rep. 4: 7435–7435. fication enzymes, in addition to GSTs, CarEs and P450s. ABC trans- Gahan, L. J., Y. Pauchet, H. Vogel, and D. G. Heckel. 2010. An ABC trans- porter mutation is correlated with insect resistance to Bacillus thuringiensis porters play important roles in the detoxification of insecticides. Cry1Ac toxin. PLoS Genet. 6: e1001248. Chlorpyrifos is a broad-spectrum organophosphate insecticide. This Goh, W. L., P. H. Yiu, S. C. Wong, and A. Rahan. 2011. Safe use of chlorpyri- compound can bind to the active site of cholinesterase (ChE), result- fos for insect pest management in leaf mustard (Brassica juncea L. Coss). ing in accumulation of acetylcholine in the synaptic cleft (Karanth J. Food Agric. Environ. 9: 1064–1066. and Pope 2000). In this study, we found that expression of Guo, Z. J., S. Kang, X. Zhu, J. X. Xia, Q. J. Wu, S. L. Wang, W. Xie, and Y. J. CmABCG1, CmABCG4 and CmABCC2 was induced after chlor- Zhang. 2015. The novel ABC transporter ABCH1 is a potential target for pyrifos application, and therefore, these genes are possibly involved RNAi-based insect pest control and resistance management. Sci. Rep. 5: in the detoxification of insecticides. The expression of several in- secticide genes can be induced by xenobiotics, and these are known He, W., M. You, L. Vasseur, G. Yang, M. Xie, K. Cui, J. Bai, C. Liu, X. Li, to be involved in the detoxification of insecticides. Epis et al. (2014) and X. Xu. 2012. Developmental and insecticide-resistant insights from the reported that AnstABCG4 expression was threefold higher in de novo assembled transcriptome of the diamondback moth, Plutella xylos- permethrin-treated Anopheles stephensi compared to the untreated tella. Genomics 99: 169–177. control insects after 24 h. In pyrethroid-resistant Culex pipiens, Higgins, C. F. 1992. ABC transporters: from microorganisms to man. Annu. Rev. Cell Biol. 8: 67–113. CpGSTD1 was shown to be able to metabolize 1,1,1-trichloro-2,2- Huang, J., R. Hu, C. Pray, F. Qiao, and S. Rozelle. 2003. Biotechnology as an bis (4-chlorophenyl) ethane (DTT) (Samra et al. 2012). However, alternative to chemical pesticides: a case study of Bt cotton in China. Agric. we found no significant differences in the expression of CmABCC3 Econ. 29: 55–67. between chlorpyrifos-treated and untreated control insects. Jones, P. M., and A. M. George. 2004. The ABC transporter structure and Therefore, we speculate that CmABCC3 is mainly associated with mechanism: perspectives on recent research. Cell. Mol. Life Sci. 61: C. medinalis development. 682–699. In conclusion, we identified four ABC transporter genes in C. Karanth, S., and C. Pope. 2000. Carboxylesterase and A-esterase activities medinalis for the first time, in addition to analyzing their structure during maturation and aging: relationship to the toxicity of chlorpyrifos and and expression patterns, based on bioinformatic and RT-qPCR parathion in rats. Toxicol. Sci. 58: 282–289. approaches. These results will assist in establishing new target sites Khan, Z. R., A. T. Barrion, J. A. Litsinger, N. P. Castilla, and R. C. Joshi. for insect control, and provide a theoretical basis for the develop- 1988. A bibliography of rice leaffolders (Lepidoptera: Pyralidae). Int. J. ment of biopesticides. Trop. Insect Sci. 9: 129–174. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018 8 Journal of Insect Science, 2017, Vol. 17, No. 2 Korada, R. R. 1999. Host plant induced response to insecticides and haemo- (Lepidoptera: Pyralidae) and other moths in eastern China. Bull. Entomol. lymph esterase patterns in American Bollworm, Helicoverpa armigera Res. 85: 397–414. (Hubner). Entomology 24: 9–13. Samra, A. I., S. G. Kamita, H. W. Yao, A. J. Cornel, and B. D. Hammock. Labbe´, R., S. Caveney, and C. Donly. 2011. Genetic analysis of the xenobiotic 2012. Cloning and characterization of two glutathione S-transferases from resistance-associated ABC gene subfamilies of the Lepidoptera. Insect Mol. pyrethroid resistant Culex pipiens. Pest Manag. Sci. 68: 764–772. Biol. 20: 243–256. Smagghe, G., and L. Tirry. 2001. Insect midgut as a site for insecticide detoxi- Liao, H. J., J. R. Huang, and X. D. Liu. 2012. The method for mass rearing of fication and resistance. Springer, Berlin, pp. 297–321. rice leaf folder Cnaphalocrocis medinalis using maize seedlings. Chin. J. Sturm, A., P. Cunningham, and M. Dean. 2014. The ABC transporter gene Appl. Entomol. 49: 1078–1082. family of Daphnia pulex. BMC Genomics 10: 1–18. Liu, S., S. Zhou, L. Tian, E. Guo, Y. Luan, J. Zhang, and S. Li. 2010. Genome- Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar. wide identification and characterization of ATP-binding cassette trans- 2011. MEGA5: molecular evolutionary genetics analysis using maximum porters in the silkworm, Bombyx mori. BMC Genomics 12: 78–82. likelihood, evolutionary distance, and maximum parsimony methods. Mol. Liu, S., X. J. Rao, M. Y. Li, and S. G. Li. 2015b. Identification and expression Biol. Evol. 28: 2731–2739. profiles of putative cytochrome P450 monooxygenase genes from Walker, J. E., M. Saraste, M. J. Runswick, and N. J. Gay. 1981. Distantly Cnaphalocrocis medinalis (Lepidoptera: Pyralidae). Entomol. Res. 45: related sequences in the alpha- and beta-subunits of ATP synthase, myosin, 141–149. kinases and other ATP-requiring enzymes and a common nucleotide binding Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression fold. EMBO J. 1: 945–951. DD CT data using real-time quantitative PCR and the 2 method. Methods Xie, X. D., T. C. Cheng, G. H. Wang, J. Duan, W. H. Niu, and Q. Y. Xia. 25: 402–408. 2012. Genome-wide analysis of the ATP-binding cassette (ABC) transporter Mackenzie, S. M., M. R. Brooker, T. R. Gill, G. B. Cox, A. J. Howells, and G. gene family in the silkworm, Bombyx mori. Mol. Biol. Rep. 39: 7281–7291. D. Ewart. 1999. Mutations in the white gene of Drosophila melanogaster Yepiskoposyan, H., D. Egli, T. Fergestad, A. Selvaraj, C. Treiber, G. affecting ABC transporters that determine eye colouration. Biochim. Multhaup, O. Georgiev, and W. Schaffner. 2006. Transcriptome response Biophys. Acta Biomembr. 1419: 173–185. to heavy metal stress in Drosophila reveals a new zinc transporter that con- Painkra, G. P., and D. C. Salam. 2013. Management of leaf folder, fers resistance to zinc. Nucleic Acids Res. 34: 4866–4877. Cnaphalocrosis medinalis G. (Lepidoptera: Pyralidae) in rice at north zone Yu, H. Z., D. F. Wen, W. L. Wang, L. Geng, Y. Zhang, and J. P. Xu. 2015. of Chhattisgarh. Progress. Res. 2: 321–322. Identification of genes putatively involved in chitin metabolism and insecti- Ranson, H., C. Claudianos, F. Ortelli, C. Abgrall, J. Hemingway, M. V. cide detoxification in the rice leaf folder (Cnaphalocrocis medinalis) larvae Sharakhova, M. F. Unger, F. H. Collins, and R. Feyereisen. 2002. Evolution through transcriptomic analysis. Int. J. Mol. Sci. 16: 21873–21896. of supergene families associated with insecticide resistance. Science 298: Zhang, S. K., X. B. Ren, Y. C. Wang, and J. Y. Su. 2014. Resistance in 179–181. Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) to new chemistry insecti- Rees, D. C., E. Johnson, and O. Lewinson. 2009. ABC transporters: the power cides. J. Econ. Entomol. 107: 815–820. to change. Nat. Rev. Mol. Cell Biol. 10: 218–227. Zheng, X. S., X. B. Ren, and J. Y. Su. 2011. Insecticide susceptibility of Riley, J. R., D. R. Reynolds, A. D. Smith, A. S. Edwards, X. X. Zhang, X. N. Cheng, H. K. Wang, J. Y. Cheng, and B. P. Zhai. 1995. Observations of the Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) in China. J. Econ. autumn migration of the rice leaf roller Cnaphalocrocis medinalis Entomol. 104: 653–658. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Insect Science Oxford University Press

Identification of Four ATP-Binding Cassette Transporter Genes in Cnaphalocrocis medinalis and Their Expression in Response to Insecticide Treatment

Free
8 pages

Loading next page...
 
/lp/ou_press/identification-of-four-atp-binding-cassette-transporter-genes-in-hQmrmXWROE
Publisher
Entomological Society of America
Copyright
© The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.
eISSN
1536-2442
D.O.I.
10.1093/jisesa/iex017
Publisher site
See Article on Publisher Site

Abstract

The ATP-binding cassette (ABC) transporters belong to a superfamily of genes involved in the transport of spe- cific molecules across lipid membranes, as well as insecticide resistance, present in all living organisms. In this study, we combined the Cnaphalocrocis medinals transcriptome database with a bioinformatics approach to identify four C. medinals ABCs (CmABCs), including CmABCG1, CmABCG4, CmABCC2 and CmABCC3. Tissue expression analysis showed that these genes had a tissue-specific expression pattern. CmABCG1 had signifi- cantly higher expression in the haemolymph and head compared to the other tissues. The expression of CmABCG4, CmABCC2 and CmABCC3 was highest in the midgut, followed by expression in the fat body. The developmental stage expression analysis showed that CmABCG1, CmABCG4, CmABCC2 and CmABCC3 were mainly expressed in adults. The transcription of CmABCG1, CmABCG4 and CmABCC2 was significantly induced by chlorpyrifos. Taken together, the results of our study provided useful information for understanding of the detoxification system of C. medinalis. Key words: Cnaphalocrocis medinalis, ABC transporter, mRNA expression, insecticide detoxification The rice leaffolder, Cnaphalocrocis medinalis (Lepidoptera: enzymes in Plutella xylostella, in addition to GSTs, CarEs and Pyralidae) is a major pest of rice crops, and is widely distributed in P450s (He et al. 2012). Epis et al. (2014) also identified ABC trans- tropical and temperate rice-producing regions (Khan et al. 1988, porter genes from Anopheles stephensi based on transcriptome data, Riley et al. 1995). The control of rice insect pests is mainly depend- and the results confirmed the role of ABC transporter in insecticide ent on the extensive use of chemical insecticides. However, this re- defense. ABC transporters also play an important role in the detoxi- sults in disturbance of the environment and resistance of pests to fication of insecticides. insecticides (Abudulai et al. 2001, Huang et al. 2003). Metabolic re- ABC transporters belong to a large superfamily responsible for sistance and target resistance are the two major mechanisms under- the transport of specific molecules across lipid membranes, in add- lying insecticide resistance. Metabolic resistance relies on ition to insecticide resistance, present in all living organisms (Higgins 1992). The multidomain integral membrane proteins of detoxification enzymes such as glutathione S-transferases (GSTs), carboxylesterases (CarEs) and cytochrome P450 monooxygenases ABC transporters utilize the energy produced by ATP hydrolysis to (P450s) (Ranson et al. 2002). Liu et al. (2015b) identified 25 candi- translocate solutes across cellular membranes in all phyla (Jones and date GST genes and 36 putative P450 genes in C. medinalis by George 2004). ABC transporters have a modular structure, consist- searching the transcriptome dataset, which may be involved in the ing of two nucleotide-binding domains (NBDs), which bind and insecticide detoxification displayed by these moths. The involvement hydrolyze ATP, as well as two transmembrane domains (TMDs), of ABC transporters in xenobiotic resistance for arthropods was his- which are involved in the translocation of their respective substrates torically not well documented, but an increasing number of studies (Rees et al. 2009). The NBDs contain characteristic motifs, includ- were focused on differentially gene expression analysis to show their ing Walker A, Walker B, A-loop, D-loop, H-loop and Q-loop. ABC importance (Dermauw and Leeuwen 2014). ATP-binding cassette transporter genes also contain the signature C motif, located just up- (ABC) transporters have been identified as important detoxification stream of the Walker B site (Dean et al. 2001). Sequence analyses of V C The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. 1 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 journals.permissions@oup.com by Ed 'DeepDyve' Gillespie user on 17 July 2018 2 Journal of Insect Science, 2017, Vol. 17, No. 2 eukaryotic ABC transporters revealed that they can be divided into plastic boxes, and each leaf was sprayed with 1 ml of the working eight subfamilies (ABCA-H) (Dean and Annilo 2005). In recent chlorpyrifos solution (Goh et al. 2011, Painkra and Salam 2013). years, many more species genomes have been sequenced. Liu et al. The boxes were covered with plastic netting to prevent C. medinalis (2010) and Xie et al. (2012) identified 51 putative ABC transporter escape (n ¼ 20 in each group). Control insects were treated with sterile water only. Each treatment was performed 3 biological genes in silkworms, classified into eight subfamilies (A-H) based on replicate and 10 larvae were treated in each replicate. Data was stat- whole-genome analyses. Broehan et al. (2013) found 73 ABC trans- istically analyzed by a paired Student’s t-test. All midgut samples porter genes in the genome of Tribolium castaneum, which can also were collected after 24 h, frozen in liquid nitrogen and stored at be grouped into eight subfamilies (ABCA-H). The ABC family of 80 C. coleopterans is significantly larger than that reported for insects in other taxonomic groups. In Tetranychus urticae, 103 ABC trans- porter genes have been identified, which is the highest number dis- RNA Isolation and cDNA Synthesis covered in a metazoan species to date (Dermauw et al. 2013). Total RNA was isolated from the integument, head, midgut, fat Furthermore, the different subfamilies of ABC transporters may be body and haemolymph of the larvae and adults using TRIzol re- involved in different functions. The ABC transporter C subfamily is agent, according to the manufacturer’s instructions. The A 260/280 thought to be involved in drug resistance (Labbe ´ et al. 2011). Gahan ratio and RNA concentration of the samples were detected using a et al. (2010) reported an inactivating mutation of the ABC trans- NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, New porter ABCC2 which was associated to Cry1Ac resistance, as a re- York, NY). The total RNA samples were treated with TM sult of inhibiting the binding of Cry1Ac to membrane vesicles. In PrimeScript RT kit with gDNA Eraser (TaKaRa, Dalian, China) to remove any genomic DNA, then the first strand cDNA was Drosophila melanogaster, the white, brown and scarlet genes synthesized according to the manufacturer’s instructions. Briefly, encode proteins that transport guanine or tryptophan, all of which belong to the ABC transporter superfamily. These proteins play a 2.0 llof 5 gDNA Eraser buffer, 1.0 ll of gDNA Eraser and 1.0 lg major role in the absorption of pigment precursors during eye devel- of total RNA were mixed in a 100-ll PCR tube, then RNase Free opment (Mackenzie et al. 1999). However, no studies have investi- dH O was added to reach 10 ll, which was then incubated at room gated the ABC transporter genes in C. medinalis. temperature for 5 min. Afterwards, 5 PrimeScript buffer, 1.0 ll In this study, we identified four complete C. medinalis ABC PrimeScript RT enzyme mix I and 1.0 ll of RT primer mix were added to the tube, which was made up to 20 ll with RNase Free transporters (CmABCs) based on a transcriptome database from our dH O. The mixture was incubated at 37 C for 15 min, and laboratory, which were named CmABCG1, CmABCG4, 2 then incubated at 85 C for 5 s. The cDNA was stored at 20 C for CmABCC2 and CmABCG3 (Yu et al. 2015). All sequences were later use. analyzed by bioinformatics, and their molecular characteristics and functions were predicted. Real-time quantitative PCR (RT-qPCR) analysis was performed to determine their level of expression in dif- Identification of ABC Genes From the Cnaphalocrocis ferent tissues and at different developmental stages, as well as their medinalis Transcriptome response to chlorpyrifos exposure. The results of our study will con- Transcriptome sequencing was performed on fourth-instar C. med- tribute to better understanding the detoxification systems of C. med- inalis larvae using the Illumina pair-end sequencing method inalis, in addition to assisting in the establishment of new target sites (Biomarker Technology Company, Beijing, China) to obtain the C. for insect control. medinalis transcriptome database. The ABC transporter genes were identified from the dataset using the TBLASTN algorithm in Basic Local Alignment Search Tool (BLAST). The candidate Materials and Methods ABC genes for C. medinalis were confirmed by searching the NCBI nonredundant protein database using BLASTX (cut-off E Insect Collection and Sample Preparation value of 10 ). The bioinformatic sequence analyses revealed that Leaffolder larvae were collected from the rice paddy field at CmABCG1, CmABCG4, CmABCC2 and CmABCC3 had com- the Rice Institute of Anhui Academy of Agricultural Sciences and plete sequences. were reared in insectary for a few days based on previous method (Liao et al. 2012). The first instar, second instar, the first day of third instar, fourth instar, the first day of pupae and adults were Bioinformatic Analysis collected. On the first day of fourth-instar, midgut, head, integu- The molecular mass and isoelectric point was predicted using the ment, fat body and haemolymph samples were obtained from C. Compute pI and Mw tool (http://us.expasy.org/tools/pi_tool.html). medinalis larvae. All tissues samples were ground in liquid nitro- The open reading frames (ORFs) of the ABC genes were predicted gen, and 100 mg of each sample was placed into tubes. The sam- using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). ples were mixed with 1 ml TRIzol reagent (Invitrogen, Grand Conserved domains were determined using the NCBI conserved Island, NY), then homogenized using a pellet pestle and preserved domain database (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb. cgi). The homology of amino acid sequences was determined with at 80 C. DNAMAN 7.0 software (Lynnon Biosoft, Vandreuil, QC, Canada). The phylogenetic tree was constructed with MEGA 5.0 software Insecticide Treatment using the neighbor-joining method with 1,000-fold bootstrap resam- In order to understand the function of ABC transporter genes rele- pling (Tamura et al. 2011). vant to the field of insect pest control, fourth-instar larvae of C. medinalis were treated with an insecticide. Chlorpyrifos was pur- Developmental and Tissue-Specific Expression Profiles chased from Biogen Crop Science Limited (Shaanxi, Weinan, China). In order to simulate exposure of C. medinalis to insecticides of the CmABCs in the field, chlorpyrifos was diluted to a working solution with ster- In order to detect the expression of CmABCG1, CmABCG4, ile water (1:300). Fresh rice leaves were picked and placed in sterile CmABCC2 and CmABCC3 in different tissues (midgut, head, Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018 Journal of Insect Science, 2017, Vol. 17, No. 2 3 integument, fat body and haemolymph) and at different develop- contained signature C, Walker A/P-loop, Walker B, D-loop, Q-loop/ mental stages (first instar, second instar, the first day of third instar, Lid and H-loop/switch domains. However, the CmABCG4 sequence fourth instar, the first day of pupal and adult), four pairs of RT- only contained the H-loop/switch region. According to SMART on- qPCR primers were designed, including the forward and reverse pri- line software (http://smart.embl-heidelberg.de/), CmABCG1 and mers of CmABCG1, CmABCG4, CmABCC2 and CmABCC3 CmABCG4 contained one ABC2_membrane domain, whereas (Table 1). The 25-ll reaction mixture for RT-qPCR contained CmABCC2 and CmABCC3 contained two ABC_membrane and 12.5 ll SYBR II, 9.5 ll ddH O, 1.0 ll forward primer, 1.0 ll reverse two AAA domains (Fig. 1). primer and 1.0 ll cDNA template. The thermal cycling profile began Six signature motifs of the ABC transporter have previously been with an incubation at 50 C for 2 min, then denaturation for 10 min reported in Bombyx mori and Tribolium castaneum (Broehan et al. at 95 C, followed by 40 cycles of 15 s at 95 C and 1 min at 60 C. 2013). A multiple alignment analysis was performed for the amino Each gene was assayed in three replicates. The reactions were per- acid sequence of these ABC transporters, and the structural charac- formed in 96-well plates using the Multicolor RT-PCR Detection teristics were highlighted (Fig. 2). Motifs 1–6 are represented by the System (Bio-Rad, Hercules, CA). The CmActin gene (GenBank: sequences GxxGxGKx, YxxQ, LSGGQxxRxx, IYLLDxP, SAVD JN029806.1) served as the internal control. The relative expression and xxHQxx, respectively, where x is a nonspecific amino acid. DDCt levels were calculated using the 2 method, following the proto- col described by Livak and Schmittgen (2001). Data was statistically analyzed by ANOVA, and Fisher’s least significant difference (LSD) Phylogenetic Analysis of CmABCs With Those From post hoc test was used to determine between group differences. All Other Insects statistical analyses were performed using SPSS software (P<0.05 for In order to better understand the evolutionary relationships of the significant differences and P<0.01 for highly significant CmABCs with those of other insects, we selected the ABC trans- differences). porters of Bombyx mori (Lepidopteria), Drosophila melanogaster (Diptera), Tribolium castaneum (Coleoptera) and Tetranychus Results urtiace (Acarina) for amino acid homology analysis and establish- ment of a neighbor-joining phylogenetic tree with C. medinalis (Fig. Identification of ABC Genes in Cnaphalocrocis 3). In the neighbor-joining tree, four CmABCs fell into two subfami- medinalis and cDNA Sequence Analysis lies (C and G). In the C subfamily, CmABCC2 had high homology In order to identify and characterize the ABC genes from C. medina- with the ABCG-4A sequence of Tribolium castaneum, and lis, four cDNA fragments encoding ABC transporters were found CmABCC3 had a close relationship to TcABCC-9A. In the G sub- based on the transcriptome dataset, which were named CmABCG1, family, CmABCG1 and CmABCG4 only had 25% and 38% se- CmABCG4, CmABCC2 and CmABCC3 (NCBI accession numbers: quence identity, respectively, with their respective orthologs. 1943863, 1944314, 1944315 and 1944318; Supp Figs. 1–4 [online only]). Of these, four CmABC sequences contained complete ORFs. The length, molecular weight, isoelectric point and other basic infor- mation about the sequences obtained are listed in Table 2. Sequence Expression Patterns of CmABC Genes in Different analysis indicated that CmABCG1, CmABCC2 and CmABCC3 Larval Tissues In order to determine the expression patterns of the CmABC genes Table 1. Primers used for RT-qPCR experiment in the present study in larvae, we performed RT-qPCR using cDNA from the integu- 0 0 ment, head, midgut, fat body and haemolymph. The expression of Primer name Sequence (5 –3 ) Length CmABCG1 in the haemolymph was 13.5 times higher than the in- (bp) tegument, the expression in the head was 3.9 times higher than the CmABCG1 Forward: ATGGCTAACGATGGCACGC 268 integument, and CmABCG1 expression was similar in the midgut Reverse: TTGGCACACTGAAGGGCAC and fat body. CmABCG4 had the highest expression in the midgut, CmABCG4 Forward: TTAGAAATAGCGAACGGCGA 283 which was 8 times that of the integument, whereas its expression in Reverse: CCAGGAGCACCCCAATCAC the fat body was 3.6 times higher than the integument. CmABCC2 CmABCC2 Forward: TACTCATTGATTTCGGGGACATA 172 Reverse: TCTTCTTTGGGCAGATTGGTG and CmABCC3 expression was significantly higher in the midgut CmABCC3 Forward: TCCTCCCTACGAGCCATTCC 198 than in the other tissues, which were 42.9- and 61.5 times higher in Reverse: GACTTGCCAGAGCCCACAG the midgut than the integument, respectively. The CmABCC2 and CmActin Forward: GTTACTCATTCACCACCACCGCTG 234 CmABCC3 expression in the head was similar to that of the haemo- Reverse: GGATACCGCAAGATTCCATACCCA lymph (Fig. 4). Table 2. Characteristics of CmABC sequences cDNA NCBI # cDNA ORF M.W pI Signature Walker Walker B D-loop Q-loop/Lid H-loop/Switch length (bp) (aa) (kDa) C A/P-loop CmABCG1 1943863 2,474 627 70.1 8.26 138–147 42–49 158–164 166–169 85–88 192–198 CmABCG4 1944314 2,043 403 45.2 8.52 – – – – – 12–20 CmABCC2 1944315 4,648 1,348 151.5 8.66 591–600 501–508 611–616 619–622 533–536 644–650 CmABCC3 1944318 4,351 1,326 147.7 6.77 559–568 469–476 579–584 587–590 501–504 612–618 ORF, open reading frame; MW, molecular weight. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018 4 Journal of Insect Science, 2017, Vol. 17, No. 2 Fig. 1. Conserved domain analysis of Cnaphalocrocis medinalis ABC transporters. The black rectangular regions represent transmembrane domains (TMDs). The black annular regions represent nucleotide binding domains (NBDs). The blue box regions represent transmembrane domain. The AAA and BLAST region repre- sent ATPases associated with a variety of cellular activites. The pink box regions represent low complexity region. Fig. 2. Amino acid sequence alignments of CmABC catalytic domains. CmABCG1, CmABCG4, CmABCC2 and CmABCC3 from Cnaphalocrocis medinalis (1943863, 1944314, 1944315 and 1944318). Similar and identical amino acid residues are highlighted in pink and black. The red boxed regions represent different domains. Expression Patters of CmABC at Different C. medinalis (Zheng et al. 2011, Zhang et al. 2014). The expression of the four genes was compared between chlorpyrifos-treated and Developmental Stages untreated control insects. We found that the expression of In order to determine the expression of CmABCs at different devel- CmABCG1, CmABCG4 and CmABCC2 increased remarkably 24 h opmental stages, we performed RT-qPCR with cDNA from the first after chlorpyrifos exposure, indicating that these genes are likely to instar, second instar, the first day of the third instar and fourth in- be involved in the insecticide detoxification process. However, there star larval stages, as well as the pupal and adult stages. The expres- was no significant difference in CmABCC3 expression between the sion levels of CmABCG1, CmABCG4 and CmABCC2 were low in the early instar larvae (first, second, third and fourth stages) when chlorpyrifos-treated and untreated control insects (Fig. 6). compared to the late instar stages (pupae and adult). The expression increased sharply from pupae to adult. Interestingly, the relative ex- Discussion pression of CmABCG1 and CmABCC2 showed an increasing trend during the second instar. The expression of CmABCC3 fluctuated Insect ABC transporters can be classified into eight subfamilies considerably from first-instar larvae to adults. CmABCC3 was ex- (ABCA-H), according to phylogenetic tree analysis (Walker et al. pressed highly in the second instar, fourth instar and adult stages, 1981). In this study, we identified four ABC transporters by tran- but expression was low in pupae (Fig. 5). scriptome analysis, and analyzed their conserved domains. These re- sults are consistent with that previously reported for a member of the silkworm G subfamily (Liu et al. 2011). Additionally, some ABC Gene Expression Profile After Insecticide Treatment The results obtained for CmABC expression showed that most genes transporters of members of the G subfamily have been demonstrated had high expression in the midgut, except CmABCG1. Therefore, to confer resistance to xenobiotics, including insecticides (Labbe ´ the fourth-instar larval midgut was selected as the target tissue for et al. 2011). The amino acid sequences of CmABCC2 and insecticide exposure. In previous studies, the organophosphate in- CmABCC3 were found to contain two ABC_membrane and two secticide chlorpyrifos has been effectively used for the control of a AAA domains. In D. melanogaster, the ABCC transporter, encoded wide range of pests, including Chilo suppressalis, planthoppers and by CG10505, was shown to be regulated by the presence of heavy Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018 Journal of Insect Science, 2017, Vol. 17, No. 2 5 Fig. 3. Phylogenetic relationships of ATP-binding cassette (ABC) transporters from five insect species, Cnaphalocrocis medinalis (Cm); Bombyx mori (Bm), Drosophila melanogaster (CG), Tribolium castaneum (Tc) and Tetranychus urtiace (Tu). The phylogenetic tree was constructed with MEGA5 software using the neighbor-joining method. Bootstrap values indicate the analysis of 1,000 replicates. The ABC transporters of C. medinalis are highlighted in red. Fig. 4. Expression of CmABC genes in different larval tissues. The statistical analysis used the lowest expression level as a reference, and the significant differ- ences are indicated by * (P< 0.05) or ** (P< 0.01). Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018 6 Journal of Insect Science, 2017, Vol. 17, No. 2 Fig. 5. Expression of CmABC genes at different developmental stages. The statistical analysis was performed by one-way ANOVA, post hoc Tukey’s test, and the significant differences are indicated by * (P< 0.05) or ** (P< 0.01). Fig. 6. Relative expression levels of four CmABC genes in chlorpyrifos-treated and untreated control larvae. The statistical analysis was performed by paired Student’s t-test, and the significant differences are indicated by * (P< 0.05) or ** (P< 0.01). metals via metal-responsive transcription factor 1, and is involved in phylogenetic tree of Daphnia, human, worm and Drosophila ABCC the biochemical detoxification of zinc and copper (Yepiskoposyan proteins is characterized by comparatively low support of the more et al. 2006). The results obtained from the structural domain ana- basal nodes, which most probably reflects the heterogeneity of the lysis, combined with that previously reported by others, suggests ABCC subfamily. Our results showed that the CmABCC2 amino that CmABCG1, CmABCG4, CmABCC2 and CmABCC3 are likely acid sequence is closely related to TcABCC-4A, and CmABCC3 is to be involved in transmembrane transport of xenobiotics. closely related to TcABCC-9A. Within the G subfamily, CmABCG1 However, its functions were required for further study. appears to be most closely related to the Drosophila ABCC Based on the phylogenetic tree analysis, the ABC transporters CG7346, and CmABCG4 is most closely related to BmABC010557. can be widely classified into two subfamilies (C and G). In These results are suggestive of similar physiological function and Tetranychus urticae, the ABCC subfamily consists of 39 trans- evolutionary relatedness between insect species. porters, and phylogenetic analysis showed that 23 of the ABCCs of The expression of the ABC transporters differ in different tissues T. urticae were clustered with amino acid sequences of CG6214 and and at different developmental stages, depending on the species. Dappul347281 from D. melanogaster and Daphnia pulex, respect- CmABCG4, CmABCC2 and CmABCC3 were found to be tissue- ively (Dermauw et al. 2013). Sturm et al. (2014) reported the pres- specific ABC genes. They were more highly expressed in the midgut ence of seven ABCC family transporters in D. pulex. The and fat body than the other tissues evaluated. The insect midgut is a Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018 Journal of Insect Science, 2017, Vol. 17, No. 2 7 major tissue for the metabolism of various chemicals from food. The Supplementary Data midgut epithelium is the first physical barrier after oral intake, and Supplementary data are available at Journal of Insect Science online. contains abundant digestive enzymes needed to obtain nutrients from food, and also contributes to the detoxification of insecticides Acknowledgments (Smagghe and Tirry 2001). In silkworms, BmABC005226, BmABC005203 and BmABC010555 were shown to be exclusively This work was supported by the Natural Science Foundation of China expressed in the midgut, as determined by RT-qPCR. However, we (31472148). reported that CmABCG1 is highly expressed in the haemolymph and head. Insect haemolymph contains a variety proteins involved in References Cited insecticide detoxification. Therefore, CmABCG4, CmABCC2 and CmABCC3 may play an important role in detoxification, with the Abudulai, M., B. M. Shepard, and P. L. Mitchell. 2001. Parasitism and preda- midgut as a target. The expression analysis at different developmen- tion on eggs of Leptoglossus phyllopus (L.) (Hemiptera: Coreidae) in cow- tal stages showed that CmABCG1, CmABCG4 and CmABCC2 pea: impact of endosulfan sprays. J. Agric. Urban Entomol. 18: 105–115. Broehan, G., T. Kroeger, M. Lorenzen, and H. Merzendorfer. 2013. were highly expressed in adults, with lower expression levels Functional analysis of the ATP-binding cassette (ABC) transporter gene observed in the early instar larvae (first, second, third and fourth in- family of Tribolium castaneum. BMC Genomics 14: 6. star). In a previous study, Guo et al. (2015) found that expression of Cole, S. P. C., C. F. Higgins, H. I. Barry, and K. Karl. 2003. ABC proteins PxABCH1 was highest in the head of adult males, as determined by from bacteria to man Abc Proteins 263–275. spatial-temporal expression analysis. We speculated that C. medina- Dean, M., and T. Annilo. 2005. Evolution of the ATP-binding cassette (ABC) lis had a greater detoxification ability in adults when compared to transporter superfamily in vertebrates. Annu. Rev. Genomics Hum. Genet. larvae. Interestingly, our RT-qPCR results also showed that 6: 899–910. CmABCG1 expression was up-regulated by 11.8 times from the Dean, M., Y. Hamon, and G. Chimini. 2001. The human ATP-binding cas- fourth instar larvae to the pupal stage (Fig. 5). In silkworm, sette (ABC) transporter superfamily. Genome Res. 11: 1007–1017. BmABC010555 was reported to be highly expressed during the Dermauw, W., and T. V. Leeuwen. 2014. ABC transporters in Arthropods: genomic comparison and role in insecticides transport and resistance. Insect wandering and prepupal stages. However, the function of Biochem. Mol. Biol. 45: 89–110. CmABCG1 in the pupae was unknown. CmABCC3 expression Dermauw, W., E. J. Osborne, R. M. Clark, M. Grbic, L. Tirry, and T. V. showed considerable fluctuation from first instar to adult, and ex- Leeuwen. 2013. A burst of ABC genes in the genome of the polyphagous spi- pression was lowest on the first day of the third instar stage. We der mite Tetranychus urticae. BMC Genomics 14: 22. considered that the first day of the third instar was at molting stage, Epis, S., D. Porretta, V. Mastrantonio, F. Comandatore, D. Sassera, P. Rossi, which was regulated by ecdysone and juvenile hormone. In an un- C. Cafarchia, D. Otranto, G. Favia, C. Genchi et al. 2014a. ABC trans- published study of D. melanogaster, we found that several ABCG porters are involved in defense against permethrin insecticide in the malatria transporters were exclusively expressed in two important endocrine vector Anopheles stephensi. Parasites Vector 7: 1–7. organs, the corpus allatum, which produces juvenile hormone, and Epis, S., D. Porretta, V. Mastrantonio, S. Urbanelli, D. Sassera, M. L. De, V. the prothoracic gland, which produces ecdysone (the immediate pre- Mereghetti, M. Montagna, I. Ricci, and G. Favia. 2014b. Temporal dy- cursor to 20E). namics of the ABC transporter response to insecticide treatment: insights In recent years, ABC transporters have been identified as detoxi- from the malaria vector Anopheles stephensi. Sci. Rep. 4: 7435–7435. fication enzymes, in addition to GSTs, CarEs and P450s. ABC trans- Gahan, L. J., Y. Pauchet, H. Vogel, and D. G. Heckel. 2010. An ABC trans- porter mutation is correlated with insect resistance to Bacillus thuringiensis porters play important roles in the detoxification of insecticides. Cry1Ac toxin. PLoS Genet. 6: e1001248. Chlorpyrifos is a broad-spectrum organophosphate insecticide. This Goh, W. L., P. H. Yiu, S. C. Wong, and A. Rahan. 2011. Safe use of chlorpyri- compound can bind to the active site of cholinesterase (ChE), result- fos for insect pest management in leaf mustard (Brassica juncea L. Coss). ing in accumulation of acetylcholine in the synaptic cleft (Karanth J. Food Agric. Environ. 9: 1064–1066. and Pope 2000). In this study, we found that expression of Guo, Z. J., S. Kang, X. Zhu, J. X. Xia, Q. J. Wu, S. L. Wang, W. Xie, and Y. J. CmABCG1, CmABCG4 and CmABCC2 was induced after chlor- Zhang. 2015. The novel ABC transporter ABCH1 is a potential target for pyrifos application, and therefore, these genes are possibly involved RNAi-based insect pest control and resistance management. Sci. Rep. 5: in the detoxification of insecticides. The expression of several in- secticide genes can be induced by xenobiotics, and these are known He, W., M. You, L. Vasseur, G. Yang, M. Xie, K. Cui, J. Bai, C. Liu, X. Li, to be involved in the detoxification of insecticides. Epis et al. (2014) and X. Xu. 2012. Developmental and insecticide-resistant insights from the reported that AnstABCG4 expression was threefold higher in de novo assembled transcriptome of the diamondback moth, Plutella xylos- permethrin-treated Anopheles stephensi compared to the untreated tella. Genomics 99: 169–177. control insects after 24 h. In pyrethroid-resistant Culex pipiens, Higgins, C. F. 1992. ABC transporters: from microorganisms to man. Annu. Rev. Cell Biol. 8: 67–113. CpGSTD1 was shown to be able to metabolize 1,1,1-trichloro-2,2- Huang, J., R. Hu, C. Pray, F. Qiao, and S. Rozelle. 2003. Biotechnology as an bis (4-chlorophenyl) ethane (DTT) (Samra et al. 2012). However, alternative to chemical pesticides: a case study of Bt cotton in China. Agric. we found no significant differences in the expression of CmABCC3 Econ. 29: 55–67. between chlorpyrifos-treated and untreated control insects. Jones, P. M., and A. M. George. 2004. The ABC transporter structure and Therefore, we speculate that CmABCC3 is mainly associated with mechanism: perspectives on recent research. Cell. Mol. Life Sci. 61: C. medinalis development. 682–699. In conclusion, we identified four ABC transporter genes in C. Karanth, S., and C. Pope. 2000. Carboxylesterase and A-esterase activities medinalis for the first time, in addition to analyzing their structure during maturation and aging: relationship to the toxicity of chlorpyrifos and and expression patterns, based on bioinformatic and RT-qPCR parathion in rats. Toxicol. Sci. 58: 282–289. approaches. These results will assist in establishing new target sites Khan, Z. R., A. T. Barrion, J. A. Litsinger, N. P. Castilla, and R. C. Joshi. for insect control, and provide a theoretical basis for the develop- 1988. A bibliography of rice leaffolders (Lepidoptera: Pyralidae). Int. J. ment of biopesticides. Trop. Insect Sci. 9: 129–174. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018 8 Journal of Insect Science, 2017, Vol. 17, No. 2 Korada, R. R. 1999. Host plant induced response to insecticides and haemo- (Lepidoptera: Pyralidae) and other moths in eastern China. Bull. Entomol. lymph esterase patterns in American Bollworm, Helicoverpa armigera Res. 85: 397–414. (Hubner). Entomology 24: 9–13. Samra, A. I., S. G. Kamita, H. W. Yao, A. J. Cornel, and B. D. Hammock. Labbe´, R., S. Caveney, and C. Donly. 2011. Genetic analysis of the xenobiotic 2012. Cloning and characterization of two glutathione S-transferases from resistance-associated ABC gene subfamilies of the Lepidoptera. Insect Mol. pyrethroid resistant Culex pipiens. Pest Manag. Sci. 68: 764–772. Biol. 20: 243–256. Smagghe, G., and L. Tirry. 2001. Insect midgut as a site for insecticide detoxi- Liao, H. J., J. R. Huang, and X. D. Liu. 2012. The method for mass rearing of fication and resistance. Springer, Berlin, pp. 297–321. rice leaf folder Cnaphalocrocis medinalis using maize seedlings. Chin. J. Sturm, A., P. Cunningham, and M. Dean. 2014. The ABC transporter gene Appl. Entomol. 49: 1078–1082. family of Daphnia pulex. BMC Genomics 10: 1–18. Liu, S., S. Zhou, L. Tian, E. Guo, Y. Luan, J. Zhang, and S. Li. 2010. Genome- Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar. wide identification and characterization of ATP-binding cassette trans- 2011. MEGA5: molecular evolutionary genetics analysis using maximum porters in the silkworm, Bombyx mori. BMC Genomics 12: 78–82. likelihood, evolutionary distance, and maximum parsimony methods. Mol. Liu, S., X. J. Rao, M. Y. Li, and S. G. Li. 2015b. Identification and expression Biol. Evol. 28: 2731–2739. profiles of putative cytochrome P450 monooxygenase genes from Walker, J. E., M. Saraste, M. J. Runswick, and N. J. Gay. 1981. Distantly Cnaphalocrocis medinalis (Lepidoptera: Pyralidae). Entomol. Res. 45: related sequences in the alpha- and beta-subunits of ATP synthase, myosin, 141–149. kinases and other ATP-requiring enzymes and a common nucleotide binding Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression fold. EMBO J. 1: 945–951. DD CT data using real-time quantitative PCR and the 2 method. Methods Xie, X. D., T. C. Cheng, G. H. Wang, J. Duan, W. H. Niu, and Q. Y. Xia. 25: 402–408. 2012. Genome-wide analysis of the ATP-binding cassette (ABC) transporter Mackenzie, S. M., M. R. Brooker, T. R. Gill, G. B. Cox, A. J. Howells, and G. gene family in the silkworm, Bombyx mori. Mol. Biol. Rep. 39: 7281–7291. D. Ewart. 1999. Mutations in the white gene of Drosophila melanogaster Yepiskoposyan, H., D. Egli, T. Fergestad, A. Selvaraj, C. Treiber, G. affecting ABC transporters that determine eye colouration. Biochim. Multhaup, O. Georgiev, and W. Schaffner. 2006. Transcriptome response Biophys. Acta Biomembr. 1419: 173–185. to heavy metal stress in Drosophila reveals a new zinc transporter that con- Painkra, G. P., and D. C. Salam. 2013. Management of leaf folder, fers resistance to zinc. Nucleic Acids Res. 34: 4866–4877. Cnaphalocrosis medinalis G. (Lepidoptera: Pyralidae) in rice at north zone Yu, H. Z., D. F. Wen, W. L. Wang, L. Geng, Y. Zhang, and J. P. Xu. 2015. of Chhattisgarh. Progress. Res. 2: 321–322. Identification of genes putatively involved in chitin metabolism and insecti- Ranson, H., C. Claudianos, F. Ortelli, C. Abgrall, J. Hemingway, M. V. cide detoxification in the rice leaf folder (Cnaphalocrocis medinalis) larvae Sharakhova, M. F. Unger, F. H. Collins, and R. Feyereisen. 2002. Evolution through transcriptomic analysis. Int. J. Mol. Sci. 16: 21873–21896. of supergene families associated with insecticide resistance. Science 298: Zhang, S. K., X. B. Ren, Y. C. Wang, and J. Y. Su. 2014. Resistance in 179–181. Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) to new chemistry insecti- Rees, D. C., E. Johnson, and O. Lewinson. 2009. ABC transporters: the power cides. J. Econ. Entomol. 107: 815–820. to change. Nat. Rev. Mol. Cell Biol. 10: 218–227. Zheng, X. S., X. B. Ren, and J. Y. Su. 2011. Insecticide susceptibility of Riley, J. R., D. R. Reynolds, A. D. Smith, A. S. Edwards, X. X. Zhang, X. N. Cheng, H. K. Wang, J. Y. Cheng, and B. P. Zhai. 1995. Observations of the Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) in China. J. Econ. autumn migration of the rice leaf roller Cnaphalocrocis medinalis Entomol. 104: 653–658. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/17/2/44/3076207 by Ed 'DeepDyve' Gillespie user on 17 July 2018

Journal

Journal of Insect ScienceOxford University Press

Published: Mar 20, 2017

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off