Homologue-specific chromosome sequencing characterizes translocation junctions and permits allelic assignment

Homologue-specific chromosome sequencing characterizes translocation junctions and permits... Chromosome translocations can be detected by cytogenetic analysis, but it is hard to character- ize the breakpoints at the sequence level. Chromosome sorting by flow cytometry produces flow karyotypes that enable the isolation of abnormal chromosomes and the generation of chromosome-specific DNA. In this study, a derivative chromosome t(9; 14) and its homologous normal chromosomes 9 and 14 from the Ishikawa 3-H-12 cell line were sorted to collect homologue-specific samples. Chromosome sequencing identified the breakpoint junction in the der(9) at 9p24.3 and 14q13.1 and uncovered the formation of a fusion gene, WASH1–NPAS3. Amplicon sequencing targeted for neighbouring genes at the fusion breakpoint revealed that the variant frequencies correlate with the allelic copy number. Sequencing of sorted chromo- somes permits the assignment of allelic variants and can lead to the characterization of abnor- mal chromosomes. We show that allele-specific chromosome sequencing of homologues is a robust technique for distinguishing alleles and this provides an efficient approach for the com- prehensive analysis of genomic changes. Key words: chromosome sorting, allelic profile, fusion gene, breakpoint junctions, variant frequency 1. Introduction recent advances in single cell analysis can distinguish differences be- Next-generation sequencing provides whole genome analysis of struc- tween cells and help to uncover genetic heterogeneity in tumour cells, 1,2 tural variants as well as sequence variants. The technique has made the investigation of allelic differences remains challenging. a significant contribution to cancer genomics and to the analysis of Chromosomes can be distinguished in fluid suspensions using a human cancer cell lines that have been accumulated in the Cancer bivariate fluorescence-activated cell sorter which separates them by Cell Line Encyclopedia and the Catalogue of Somatic Mutations in size and base pair ratio and displays the results in the form of a flow Cancer. It is noted that clinical tumour samples are often contami- karyotype, allowing accurate estimation of chromosome size and 10,11 nated with normal cells and show heterogeneity due to clonal evolu- GC content. The procedure enables the isolation and collection 5,6 7 tion which is also observed in tumour cell lines. These two not only of aberrant chromosomes but sometimes also of normal ho- features present problems in sequencing tumour samples. Although mologues that contain measurable differences in repetitive DNA. V C The Author(s) 2018. Published by Oxford University Press on behalf of Kazusa DNA Research Institute. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com 1 Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 2 Homologue-specific chromosome sequencing Analysis of sorted chromosomes can characterize cryptic allelic vari- sheath pressure to  60 psi and the drop drive frequency to  95 kHz ants occurring in a reciprocal chromosome translocation. Sorted using a 70lm cytonozzle tip. The flow karyotype was displayed by chromosome samples have been extensively exploited in diagnostic Hoechst 33258 versus Chromomycin A3 fluorescence and acquired by cytogenetics and in the production of chromosome-specific DNA for a total of 50,000–100,000 events at a rate of 1,000 events per second. 14,15 16,17 Data collected from the experiments were analysed using Summit chromosome painting and chromosome sequencing. The lat- Software Version 4.1 (Beckman Coulter). Approximately 2,000 chro- ter serves to focus on regions of interest and has application in refin- ing genome analysis and assisting genome assembly. mosomes were flow sorted into a 0.5-ml UV-treated PCR tube from In this study, chromosome-specific sequencing reveals the break- each chromosome peak. point junction and identifies a novel fusion gene in a translocation between chromosomes 9 and 14 observed in a human cancer cell 2.4. Chromosome sequencing line. The sequence analysis of homologous regions on chromosomes For chromosome-specific sequencing, chromosomes were amplified separated by flow sorting has enabled alleles at several loci to be dis- by the REPLI-g single cell kit (Qiagen) and a genomic DNA fragment tinguished by their nucleotide differences. library was prepared using the Ion Xpress Plus Fragment Library kit (Life Technologies). Emulsion PCR of the library was performed by the Ion One Touch 2 system using the Ion PGM Template OT2 400 2. Materials and methods kit (Life Technologies). Sequencing was carried out by the Ion PGM 2.1. Cell lines and DNA preparation sequencer using the Ion PGM Sequencing 400 kit and the Ion 318 The Ishikawa 3-H-12 cell line registered as JCRB1505 was estab- Chip (Life Technologies). All protocols followed the manufacturer’s lished from an endometrial cancer. Cells were cultured using MEM instructions. Alignment of sequencing reads with the human genome reference (GRCh37/hg19) was performed using the Torrent Suite with 15% non-heat-inactivated foetal bovine serum. Genomic DNA v4.1.2 software. The bam file was mapped to the hg19 reference us- was extracted using the AllPrep DNA/RNA Mini Kit (Qiagen). The ing the TMAP software v5.0.13 with standard options karyotypes and SNP array profiles are available from our previous (Supplementary Table S1). This was visualized in the Integrative study (Supplementary Fig. S1A). Because t(9; 14) was detected in all Genomics Viewer (IGV) using the mapping quality value as 1. BLAT the metaphases examined and therefore expected to be a reference search in the UCSC Genome tools was used to find similarity of marker for this cell line, this study was focused on der(9). sequence reads in the genome database. 2.2. Chromosome preparation and staining 2.5. Fusion point analysis Mitotic cells were collected by shake-off from three 175-cm flasks at The breakpoint junction was amplified by PCR at an annealing tem- passage 25* after colcemid treatment (KaryoMAX Colcemid, Gibco) perature of 65 C using the following primer pairs designed using the at a final concentration of 0.1 lg/ml for 5 h. Cells were centrifuged at Primer3 software; der9-BPf: GGAAGGCTCAGACAGAGAGG and 250 g for 8 min in 50 ml tubes. The supernatant was discarded and der9-BPr: CTCTCCCTTGCACTCAGCTC. Total RNA was pre- replaced by 10 ml of hypotonic solution (75 mM KCl, 0.2 mM sper- pared using the AllPrep DNA/RNA Mini Kit (Qiagen) and treated mine, 0.5 mM spermidine, 10 mM MgSO 7H O, pH 8.0) and incu- 4 2 with DNaseI. Reverse transcription of RNA into cDNA was per- bated at RT for 15 min. After centrifugation, the cell pellet was formed using the PrimeScript RT-PCR Kit (Takara) with random resuspended in 1 ml of ice-cold polyamine buffer (2 mM EDTA, hexamers. Amplification of the WASH1–NPAS3 fusion transcript 0.5 mM EGTA, 80 mM KCl, 0.25% Triton X-100, 0.2 mM was performed with annealing temperature at 63 C using the PCR spermine, 0.5 mM spermidine, 20 mM NaCl, pH 7.2) and incu- primer pair of WASH1f: GGAAGGCTCAGACAGAGAGG and bated on ice for 10 min. The suspension was then vortexed vigor- NPAS3r: AGCATCTCGGGATTTCTCCT. ously for 12 s and the chromosomes were stained by 5 lg/ml of Hoechst 33258 (Sigma-Aldrich, B2883), 40 lg/ml of Chromomycin A3 (Sigma-Aldrich, C2659), and 10 mM MgSO .10 mMsodium 2.6. Variant analysis citrate and 25mM sodium sulphite were added1hbefore flow Multiplex primer pools for eight genes at 9p24.3, 10 genes at 14q13 sorting. and the breakpoint boundary region at 14q13.1 were obtained using the Ion AmpliSeq Designer and are listed in Supplementary Table S2. The Ampliseq custom panels for 9p24.3 and 14q13 consist of 118 2.3. Chromosome sorting and 120 amplicons, covering 33,607 and 33,275 bp in total size, re- Flow cytometric analysis was carried out at the Cambridge Resource spectively. Sequence library and template preparations were per- Centre for Comparative Genomics. Stained chromosome suspensions formed using the Ion AmpliSeq Kit for Chef DL8 and Ion PGM Hi- were analysed on a flow cytometer (MoFlo, Beckman Coulter, Q Chef Kit (Life Technologies), respectively. Sequencing was run on Fullerton, CA, USA) equipped with two water-cooled lasers (Spectra- the Ion PGM using the Ion 316 chip. The analysis was carried out us- Physics Model 2020) spatially separated at the flow chamber. The first ing the Variant Caller plug-in in the Torrent Suit and the parameters laser was tuned to emit multiline UV (330–360 nm) which excites are given in Supplementary Table S3. Hoechst 33258. The second laser was tuned to emit light at 457 nm to excite Chromomycin A3. The power of both lasers was set to 300 mW and kept constant using light control feedback. Fluorescence emitted 3. Results from Hoechst 33258 was collected using a 400 nm long pass filter combined with a 480 nm short pass filter. Chromomycin A3 fluores- 3.1. Flow karyotype cence was collected using a 490 nm long pass filter. The instrument The flow karyotype of the Ishikawa 3-H-12 cell line at passage 25* was configured for two-way sorting with high speed sorting at a data is shown in Fig. 1, indicating the peaks resulting from chromosome rate of 8,000–12,000 events per second with the optimal setting of the 9, one of two chromosomes 14 (14S) and der(9). Based on array Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 F. Kasai et al. 3 chromosomes 9 and 14 (Supplementary Fig. S2). The fragments lo- calize to the second introns of both the WASH1 (9p24.3) and NPAS3 (14q13.1) genes (Fig. 3A). Absence of sequence homology be- tween chromosomes 9 and 14 at the breakpoints indicates non- homologous end joining. The junction was amplified by PCR on ge- nomic DNA using primers from chromosomes 9 and 14. A fusion transcript is formed as expected based on the orientation of two genes. RT-PCR followed by sequencing confirms the in-frame fusion of WASH1 exon 2 and NPAS3 exon 3 (Fig. 3B). WASH1 is located at the distal end of the short arm of chromosome 9,  22 kb from the telomere according to the genome database. As the SNP microarray reported in our previous study does not have markers located at the distal end, this rearrangement could not be characterized. The chromosome sequence data and the breakpoint sequence are deposited in DRA/DDBJ (accession number: DRA006485 and LC331302). 3.3. Variant profiles in the neighbourhood genes of the breakpoint Amplicon sequencing on total genomic DNA reveals that 117 and 118 target regions in 9p24 and 14q13, respectively, close to the breakpoint are amplified with at least 200 reads. As three amplicons Figure 1. Flow karyotype of the Ishikawa 3-H-12 cell line at P25* without re- moving the background manually by image processing was obtained after in the 14q13 region have less than 30 reads, these targets are ex- sorting a larger number of chromosomes than usual to show clearly the cluded from the data analysis. The average number of reads per der(9) peak close to the normal chromosome 3 peak. The der(9) peak is amplicon is calculated to be 2,198 and 1,982 for 9p24 and 14q13 weaker than other peaks that have pairs of normal chromosomes as it exists regions, respectively. in only one copy in each cell. Normal chromosome 9 and one of the chromo- Nucleotide variants in the total genomic DNA sample are detected some 14 homologues, 14S, are also selected for sorting. at 37 positions in the 9p24.3 region, but five positions were of low quality. The remaining 32 positions which did not include missense data, the chromosome size of der(9) is estimated to be  215 Mb. It mutations serve as informative markers for distinguishing between al- is contained in an abnormal peak, close to the normal chromosome leles at variant loci. According to their frequency in the sequence reads, 3 peak, and weaker than the other normal peaks because it contains each variant allele can be classified into two types, around 50 or nearly only half the number of chromosomes, i.e. only the derivative chro- 100% of reads. This suggests that two alleles are present in this region, mosome rather than the pairs of homologues present in other peaks. supported by our previous data based on the SNP microarray and Chromosome 14 is heteromorphic and this allows the separation of M-FISH which showed two chromosome copies (Supplementary Fig. one of the two chromosome 14 homologues by sorting. In this study, S3A). Of the 32 sequence variants, 16 were detected at 100% fre- the sorted chromosome 14 is referred to as 14S, and the other quency, reflecting their presence in both chromosomes (Table 1). The unsorted homologue is referred to as 14U. other 16 variants with a frequency of around 50% indicate their pres- ence in one of the two chromosomes, but these could not be localized 3.2. Sequence analysis of der(9) and characterization to a chromosome in the genomic DNA sample. Chromosome-specific of the fusion breakpoint sequencing on der(9) and normal chromosome 9 reveal that allelic var- In order to identify the genomic breakpoint junction in der(9), two iants were detected at 23 and 25 positions, respectively, all of which sequence libraries were prepared from amplification of the sorted showed nearly 100% frequency. This demonstrates that seven and der(9) chromosomes. The sequence data from these two runs show nine variants are specific for der(9) and the normal chromosome 9, re- 1.7 and 1.0Gb consisting of 6.4 and 4.0 M reads with the read length spectively, i.e., one allele at each locus. Because the other nine positions modes of 372 and 416 bp, respectively (Supplementary Table S4). are not amplified in sorted chromosome samples, the alleles at these Coverage analysis based on the human reference genome revealed positions could not be distinguished. that most sequence reads map to chromosomes 9 and 14, with some Variant analysis of 10 gene loci at 14q13 in the total genomic DNA on chromosome 3 (Fig. 2) corresponding to a small amount of con- reveals 36 informative positions (Table 2, Supplementary Table S5). tamination during chromosome sorting due to the close proximity of The allele frequencies at these positions show three classes; either the der(9) and chromosome 3 peaks. Although a small number of around 33 or 66, or nearly 100% of reads, corresponding to the pres- reads were not aligned to the reference, more than 99% of the reads ence of variants in one of three, two of three or all three alleles at these were aligned with 95 or 96% identities of base pairs (Supplementary positions, respectively. This suggests that this region in 14q13 is pre- Table S4). This indicates that some reads are partially aligned with sent in three copies, which agrees with the SNP microarray profile and soft-clipped sequences, corresponding to breakpoint regions. the karyotype analysis that reveal three copies of chromosome 14 Mapping data were displayed in the IGV software focusing on the (Supplementary Fig. S1). The common variants present in all three al- distal end of the 9p region (Supplementary Fig. S2). Three reads mea- leles with 100% frequency are detected at six positions. The remaining suring 242, 356 and 400 bp including unmapped sequences prove to 23 and 7 variants could be detected by frequencies of 33 and 66%, be fragments that cover the fusion point. These three sequences were corresponding to their presence in one and two chromosomes, respec- subjected to a BLAT search, which show homologies to both tively. Chromosome sequencing was run twice in each sample and Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 4 Homologue-specific chromosome sequencing Figure 2. Reference coverage charts from chromosome sequencing of der(9) are shown based on average base read depth. (A) Coverage on each chromosome indicates its contents aligned to chromosomes 9 and 14, with some sequences mapped to chromosome 3 because of contamination from the closely located peak in the flow karyotype. (B) Sequence reads are detected along chromosome 9, with a large gap at the region of the centromere and pericentromeric hetero- chromatin. (C) The majority of reads appear in the 14q13-qter region, which indicates the breakpoint at 14q13.1 shown by an arrowhead. showed that variant frequencies were all nearly 100% (Supplementary Table S5). By sorting 14S separately from the unsorted chromosome 14 (14U), variant frequencies in 14S are either 0 or 100% (Table 2), indicating successful chromosome sorting without contamination be- tween homologues. This demonstrates that der(9) and 14S samples have 13 and 29 variants, respectively (Table 2). Of these, 23 variants are specific for 14S. The total DNA sample indicates the presence of variants in 7 loci in two of three chromosomes, but they are only de- tected in der(9) and absent in 14S (Table 2). This implies that these variants must be shared between the chromosome 14 homologous re- gion on der(9) and 14U, indicating that the chromosome 14 region in der(9) represents a duplication of 14U. Among the variants in the 10 genes, five missense mutations are identified (Supplementary Table S5). One of them is known to be a polymorphism, localized to der(9) and 14U. The other four mutations involving three different gene loci are included in 14S (Supplementary Table S5). Figure 3. (A) Breakpoint junction sequence of the der(9) chromosome. Upper, middle and lower sequences indicate reference sequence of chro- 3.4. Copy number changes at the 14q13 region during mosome 14, derivative chromosome and reference sequence of chromo- some 9, respectively. Breakpoint positions are marked with arrowheads. passage Numbers are based on the nucleotide position in the UCSC genome The SNP microarray performed in our previous study shows differ- browser (GRCh37/hg19). Cen, centromere; tel, telomere. (B) The nucleo- ences of the Ishikawa 3-H-12 genome profiles between low and high tide and amino acid sequences of the fusion gene. The chimeric passages. Although the der(9) has already been found in all cells at WASH1–NPAS3 gene shows in-frame fusion of exon 2 of WASH1 to exon 3 of NPAS3. low passage, the enlarged profiles focused on the breakpoint region Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 F. Kasai et al. 5 Table 1. Variant frequency for the 9p24.3 region Table 2. Variant frequency for the 14q13 region Gene ID Position Ref Variant Total der(9) chr 9 Gene ID Position Ref Variant Total der(9) 14S 14U WASH1 14665 G A 61.2 100 EGLN3 34395149 A – 100 100 100 FOXD4 116800 C G 48.0 100 EAPP 34985645 G A 34.1 100 FOXD4 116832 T C 47.5 100 EAPP 34998705 T C 33.1 100 FOXD4 118173 C G 100 100 100 SNX6 35062166 T C 100 100 100 CBWD1 154795 T C 49.9 96.1 SNX6 35062312 C T 100 100 99.4 DOCK8 286593 C A 49.9 99.3 SNX6 35075022 G T 100 100 100 DOCK8 327938 G C 53.6 100 BAZ1A 35222627 – TTGT 32.3 90.0 DOCK8 327957 T G 53.4 100 BAZ1A 35223956 A G 35.0 91.6 DOCK8 328006 T C 53.3 99.1 BAZ1A 35223971 A G 34.9 92.5 DOCK8 334524 G A 42.6 100 BAZ1A 35227880 G T 33.1 89.9 DOCK8 417990 T C 100 100 98.9 BAZ1A 35228090 G A 30.2 89.2 DOCK8 418003 T C 100 100 100 BAZ1A 35230906 G A 32.7 91.6 DOCK8 422157 T C 100 100 100 BAZ1A 35233740 T C 34.5 93.1 DOCK8 432330 C G 100 100 100 BAZ1A 35245748 A G 29.5 87.3 DOCK8 433978 A G 100 100 100 SRP54 35483882 A C 36.4 100 DOCK8 439453 G C 100 100 100 SRP54 35488309 A G 96.9 100 100 DOCK8 439467 A C 100 100 100 SRP54 35492128 C T 60.9 100 DOCK8 441827 C T 100 100 100 SRP54 35498443 G A 35.3 98.9 DOCK8 441952 G A 100 100 100 PPP2R3C 35565856 A T 32.3 95.8 DOCK8 442030 C T 100 100 100 PPP2R3C 35568756 – AA 100 100 100 DOCK8 446352 G C 100 100 100 PPP2R3C 35576458 A C 32.4 100 DOCK8 449700 G T 100 100 100 PPP2R3C 35578797 C T 71.0 98.1 KANK1 730054 A G 47.7 100 PPP2R3C 35579927 G A 30.7 100 KANK1 738434 C T 55.1 100 PPP2R3C 35591174 T C 61.2 98.6 KANK1 740901 C T 51.3 100 PPP2R3C 35591316 G A 62.3 98.2 KANK1 741084 C T 52.2 100 KIAA0391 35592491 C A 34.2 100 KANK1 742342 A G 100 100 100 KIAA0391 35592538 C G 66.3 100 DMRT1 841825 C T 53.2 89.0 KIAA0391 35593599 C G 67.3 98.2 DMRT1 841971 T A 52.6 89.1 KIAA0391 35596092 C A 32.9 100 DMRT1 967981 G C 100 100 100 KIAA0391 35736075 A G 33.2 100 DMRT3 990840 C T 100 100 100 PSMA6 35761573 C T 31.9 100 DMRT2 1057318 A G 46.5 100 PSMA6 35761675 C G 68.5 96.8 PSMA6 35777232 C T 33.4 100 Color table is available in online version. PSMA6 35777243 A G 33.8 100 PSMA6 35777270 A C 33.4 100 PSMA6 35777278 C G 33.5 100 at 14q13.1 indicate copy number changes occurring in one locus at Color table is available in online version. P3 and three loci at P20 (Supplementary Fig. S3B). The change ob- served at both P3 and P20 corresponds to the breakpoint that forms der(9). The additional changes at P20 between the other two loci in- volve breakpoints that cause a decrease in copy number. Because this 4. Discussion is not detected at P3, the cryptic deletion must have arisen in the cell Chromosome translocation is a common feature of chromosome population after long-term culture. Amplicon sequencing targeted rearrangements in tumour cells and can lead to the formation of a fu- for the 10 kb region around the breakpoint revealed that the whole 19,20 sion gene. Although fusion genes are found by RNA-seq, it is region is amplified in 14S (Supplementary Fig. S4). As the region up- hard to identify the genomic breakpoint because normal and abnor- stream of the der(9) breakpoint is absent in der(9), only the down- mal alleles usually coexist in total genomic DNA samples and cannot stream region is amplified. Similar profiles of the downstream region be distinguished by conventional analysis. The human genome size shared by 14S and der(9) suggest that no additional chromosome is 3,099 Mbp according to the golden path length of the rearrangement has occurred in the region. The patterns of variant GRCh37.p13 assembly. As the majority of the Ishikawa karyotypes frequencies across this region in the total genomic DNA sample dem- are 45, X, -X and have some gains, the size of each Ishikawa nuclear onstrates the change from 50 to 33/66/100% at P3 and from 100 to DNA is estimated to be  6,200 Mbp, including one copy of the 50/100% at P20 (Supplementary Table S6), corresponding to the der(9). When the breakpoint junction is identified by conventional chromosome copy number changes from 2 to 3 and from 1 to 2 that whole genome sequencing using total genomic DNA, theoretically it have occurred in this region (Fig. 4). Variants detected in the der(9) can appear in 1 per 15,500,000 fragments based on a 400 bp se- would be expected to be present at P3, indicating that three of them, quencing sample. However, it can be increased to 1 per 500,000 66% at P3, are shared with 14U. However, these variants are not de- fragments when the sample is from the sorted der(9) chromosome, tected in total genomic DNA at P20. This implies that two additional that is more efficient than whole genome sequencing. It is reported breaks have occurred in 14U and led to a cryptic deletion. Because that alignment of single-end long reads is straightforward to identify the other variants detected in one of three loci at P3 are specific for fusion junctions. We demonstrate that identification of genomic der(9), these changes can be related to the breakpoint event that oc- curred following duplication of chromosome 14. breakpoints detected by conventional karyotypes can be achieved by Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 6 Homologue-specific chromosome sequencing Passage 3 14S der(9) 14S No detectable change 14U gDNA Variant Chromosome 2 copies 3 copies frequency copy number 33,588,511 33,578,751 33,583,729 14U 33% 3 Two breaks Deleon 66% 3 in NPAS3 ~450 kb Passage 20 50% 2 100% 1/2/3 der(9) Duplicaon 14S 14U gDNA Fusion 1 copy 2 copies Fusion remains through cell culture WASH1- 33,588,511 33,578,751 33,583,729 NPAS3 der(9) Figure 4. Genome structure at the 14q13.1 region is illustrated from the array profiles and combined with variant frequencies obtained from amplicon se- quencing, with comparisons between passages, P3 (A) and P20 (B). The breakpoint in the der(9) is located at the position 33,583,729 bp. Variants are assigned to der(9) and 14S by amplicon sequencing in the chromosome-spe- cific DNA. The frequencies are distinguished by four different symbols. Variant assignments on chromosome homologues at P3 are estimated from Figure 5. The process of chromosome rearrangement involved in chromo- the P20 profile. A series of 100, 50 and 33/66% in total genomic DNA corre- some 14. Chromosomes 9 and 14 regions are marked by green and blue, spond to 1, 2 and 3 copies, respectively. Frequencies at three positions with respectively, and the two homologues of chromosome 14 are distin- 66% at low passage change to 50% at high passage, suggesting the presence guished by vertical and horizontal patterns. Because chromosome 14 con- of these variants in the 14U deletion indicated by a dashed line. gDNA: total sists of two different allele contents in the SNP array, it must have genomic DNA. originated from a normal pair with different allele profiles. Variant analysis in the sorted chromosome samples show that 14S and der(9) have differ- ent chromosome 14 allelic profiles, but der(9) and 14U have the same mapping analysis of single end reads on 400 bp scale without de chromosome 14 allelic profiles. This indicates that the origin of der(9) novo assembly. Although considerable efforts involving conventional was associated with duplication of 14U. One of the homologues, 14S, cloning techniques have been devoted to uncover breakpoint junc- does not have detectable changes at chromosomal level and der(9) re- tions in tumour genomes, , chromosome sequencing helps the detec- mains unchanged during cell culture. However, duplication of the long arm of 14U is fused with 9p to form der(9). The 14U chromosome at pas- tion and analysis of the genomic breakpoint junction. sage P20 has a cryptic deletion in the same region as the breakpoint in Fusion genes serve as genetic markers and can be associated with der(9). Black circles and squares show telomere and centromere, respec- disease phenotypes. Sequence analysis of the der(9) chromosome- tively. Color figure is available in online version. specific DNA isolated by flow sorting in our study reveals a WASH1–NPAS3 fusion gene at the translocation breakpoint. This variant frequencies of 0 or 100% of reads indicate that the variant is chimeric gene is formed mostly by the NPAS3 component, suggesting either absent or present in an amplicon. This permits chromosome that altered NPAS3 expression may be oncogenic. Although no re- assignment of each variant to a specific chromosome and enables dis- port has shown fusion genes between these two genes, NPAS3 is a tinction between homologues. Two chromosomes sharing the same transcription factor of a basic helix–loop–helix Per-ARNT-Sim do- allelic profile suggest that they have a common origin and are formed main family associated with tumour development in multiple forms 25 by duplication. Allele frequencies of  66% of reads reflects the of cancer. Also, it is reported that NPAS3 acts as a tumour sup- 26 presence of the same variant in two of the three alleles in three chro- pressor in human malignant astrocytomas. The fusion detected by mosomes corresponding to one in der(9) and one in 14U (Table 2, the genomic breakpoint junction and confirmed by the transcript can Fig. 5). Further analysis of the breakpoint by amplicon sequencing be a definitive marker for the Ishikawa cell line and used, possibly, of the 10 kb region that encompasses the junction in the second in- for future studies on endometrial carcinoma. tron of NPAS3 identified a cryptic deletion occurring in the chromo- Amplicon sequencing of the genes neighbouring the breakpoint some 14 allele shared with der(9). These detailed variant analyses demonstrates that variant frequencies in the total genomic DNA are elucidate the process of chromosome rearrangements involving linked to chromosome copy number. Variant frequencies of 50% of chromosomes 9 and 14. SNP allele peaks show two different allelic reads detected in chromosome 9 indicate the presence of the variant profiles of chromosome 14 in Ishikawa cells, indicating that the du- in one of two homologues. The variant frequencies of 33 or 66% of plication of 14q13–ter has occurred prior to the formation of reads in chromosome 14 reflect one or two of three homologues, re- der(9). Although the variant frequency at 14q13 reveals that the spectively (Fig. 4). This suggests that a series of patterns consisting of cryptic deletion and the breakpoint in the der(9) occur in different frequencies of approximate 50/100 or 33/66/100% are strongly cor- related to the presence of copy numbers of two or three chromo- chromosome 14 homologues, these two chromosomes must have been formed through duplication because of their otherwise identi- somes, respectively. While the fusion can be clearly distinguished at cal allelic profiles. As the deletion cannot be identified in the array the chromosome level, sequence variants cannot be regarded as alle- lic unless the chromosomes are sequenced separately. When ampli- profile at low passage, it must have occurred after the formation of con sequencing is performed on chromosome-specific DNA, the der(9) and during cell culture. These two rearrangements have Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 F. Kasai et al. 7 8. Potter, N.E., Ermini, L., Papaemmanuil, E., et al. 2013, Single-cell muta- occurred independently, possibly suggesting a tendency to breakage tional profiling and clonal phylogeny in cancer, Genome Res., 23, in the region. 2115–25. Our chromosome sorting using a dual laser flow cytometer was 9. Carter, N.P., Ferguson-Smith, M.E., Affara, N.A., Briggs, H. and first introduced in 1992 to generate chromosome-specific DNA for 14 Ferguson-Smith, M.A. 1990, Study of X chromosome abnormality in XX diagnostic cytogenetics. This led to the development of chromo- males using bivariate flow karyotype analysis and flow sorted dot blots, some painting probes for phylogenetic studies in a wide variety of Cytometry, 11, 202–7. species including human that has revealed homologous syntenic 10. Kasai, F., O’Brien, P.C.M. and Ferguson-Smith, M.A. 2012, blocks conserved between species not only in mammals but also Reassessment of genome size in turtle and crocodile based on chromo- 15,27,28 among birds and reptiles. These studies provide many ex- some measurement by flow karyotyping: close similarity to chicken, Biol. amples of chromosome-specific mapping and sequencing. In one Lett., 8, 631–5. study in dogs (2n ¼ 78), although there are many acrocentric chro- 11. Kasai, F., O’Brien, P.C.M. and Ferguson-Smith, M.A. 2013, Afrotheria mosomes of similar size and seven peaks in the flow karyotype genome; overestimation of genome size and distinct chromosome GC con- tent revealed by flow karyotyping, Genomics, 102, 468–71. that contain 2 chromosome pairs, each dog chromosome was 12. Ferguson-Smith, M.A. 1997, Genetic analysis by chromosome sorting and successfully isolated, some by single chromosome sorting; a com- painting: phylogenetic and diagnostic applications, Eur. J. Hum. Genet., plete set of painting probes was produced with each probe specific 30 5, 253–65. for a single type of dog chromosome. Another study demon- 13. Kasai, F., Yoshihara, M., Matsukuma, S., O’Brien, P. and Ferguson- strated that chicken microchromosomes can be characterized by Smith, M.A. 2007, Emergence of complex rearrangements at transloca- single chromosome sorting. Single chromosome sorting has been tion breakpoints in a transgenic mouse; implications for mechanisms applied more recently to haplotyping normal human chromosome involved in the formation of chromosome rearrangements, Cytogenet. 19, by demonstrating allele heterozygosity. When derivative Genome Res., 119, 83–90. chromosomes are different in size from the normal homologues, 14. Carter, N.P., Ferguson-Smith, M.A., Perryman, M.T., et al. 1992, Reverse they form a unique peak in the flow karyotype and can be resolved chromosome painting: a method for the rapid analysis of aberrant chro- easily and collected by flow sorting. We show here the isolation mosomes in clinical cytogenetics, J. Med. Genet., 29, 299–307. 15. Ferguson-Smith, M.A., Yang, F. and O’Brien, P.C. 1998, Comparative of chromosome homologues in a tumour cell line by chromosome mapping using chromosome sorting and painting, ILAR J., 39, 68–76. sorting that allows homologue-specific sequencing, chromosome 16. Edwards, A.M., Cameron, E.Z., Pereira, J.C., Wapstra, E., Ferguson- assignment of allelic variants and improved characterization of ab- Smith, M.A., Horton, S.R. and Thomasson, K. 2016, Gestational experi- normal chromosomes. ence alters sex allocation in the subsequent generation, R. Soc. Open Sci., 3, 160210. 17. Gomes, A.J., Nagamachi, C.Y., Rodrigues, L.R., et al. 2016, Acknowledgements Chromosomal phylogeny of Vampyressine bats (Chiroptera, Authors would like to thank Dr. Ryoka Miki (Thermo Fisher Scientific, Japan) Phyllostomidae) with description of two new sex chromosome systems, and Mr. Takashi Ishikura (Thermo Fisher Scientific, Japan) for their technical BMC Evol. Biol., 16, 119. comments on data analysis. 18. Nishida, M. 1985, Establishment of a new human endometrial adenocar- cinoma cell line, Ishikawa cells, containing estrogen and progesterone re- ceptors, Nihon Sanka Fujinka Gakkai Zasshi, 37, 1103–11. Conflict of interest 19. Aplan, P. D. 2006, Causes of oncogenic chromosomal translocation, Trends Genet., 22, 46–55. None declared. 20. Roukos, V. and Misteli, T. 2014, The biogenesis of chromosome translo- cations, Nat. Cell Biol., 16, 293–300. 21. Suzuki, T., Tsurusaki, Y., Nakashima, M., Miyake, N., Saitsu, H., Supplementary data Takeda, S. and Matsumoto, N. 2014, Precise detection of chromosomal Supplementary data are available at DNARES online. translocation or inversion breakpoints by whole-genome sequencing, J. Hum. Genet., 59, 649–54. 22. Ge, H., Liu, K., Juan, T., Fang, F., Newman, M. and Hoeck, W. 2011, References FusionMap: detecting fusion genes from next-generation sequencing data at base-pair resolution, Bioinformatics, 27, 1922–8. 1. Henson, J., Tischler, G. and Ning, Z. 2012, Next-generation sequencing 23. Ford, A.M., Mansur, M.B., Furness, C.L., et al. 2015, Protracted dor- and large genome assemblies, Pharmacogenomics, 13, 901–15. mancy of pre-leukemic stem cells, Leukemia, 29, 2202–7. 2. Pabinger, S., Dander, A., Fischer, M., et al. 2014, A survey of tools for 24. Kawamura, M., Taki, T., Kaku, H., Ohki, K. and Hayashi, Y. 2015, variant analysis of next-generation genome sequencing data, Brief. Identification of SPAG9 as a novel JAK2 fusion partner gene in pediatric Bioinformatics, 15, 256–78. acute lymphoblastic leukemia with t(9; 17)(p24; q21), Genes 3. Barretina, J., Caponigro, G. and Stransky, N. 2012, The cancer cell line Chromosomes Cancer, 54, 401–8. encyclopedia enables predictive modelling of anticancer drug sensitivity, 25. Bersten, D.C., Sullivan, A.E., Peet, D.J. and Whitelaw, M.L. 2013, Nature, 483, 603–7. bHLH-PAS proteins in cancer, Nat. Rev. Cancer, 13, 827–41. 4. Forbes, S. A., Beare, D., Boutselakis, H., et al. 2017, COSMIC: somatic 26. Moreira, F., Kiehl, T.R., So, K., et al. 2011, NPAS3 demonstrates features cancer genetics at high-resolution, Nucleic Acids Res., 45, D777–83. 5. Marusyk, A. and Polyak, K. 2010, Tumor heterog eneity: causes and con- of a tumor suppressive role in driving the progression of Astrocytomas, Am. J. Pathol., 179, 462–76. sequences, Biochim. Biophys. Acta, 1805, 105–17. 27. Ferguson-Smith, M.A., Yang, F., Rens, W. and O’Brien, P.C. 2005, The 6. Greaves, M. and Maley, C.C. 2012, Clonal evolution in cancer, Nature, impact of chromosome sorting and painting on the comparative analysis 481, 306–13. of primate genomes, Cytogenet. Genome Res., 108, 112–21. 7. Kasai, F., Hirayama, N., Ozawa, M., Iemura, M. and Kohara, A. 2016, 28. Kasai, F., O’Brien, P.C., Martin, S. and Ferguson-Smith, M.A. 2012, Changes of heterogeneous cell population in the Ishikawa cell line during long-term culture; proposal of an in vitro clonal evolution model of tumor Extensive homology of chicken macrochromosomes in the karyotypes of cells, Genomics, 107, 259–66. Trachemys scripta elegans and Crocodylus niloticus revealed by Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 8 Homologue-specific chromosome sequencing chromosome painting despite long divergence times, Cytogenet. Genome 31. Masabanda, J.S., Burt, D.W., O’Brien, P.C., et al. 2004, Molecular cyto- Res., 136, 303–7. genetic definition of the chicken genome: the first complete avian karyo- 29. Yang, F., O’Brien, P.C., Milne, B.S., et al. 1999, A complete comparative type, Genetics, 166, 1367–73. chromosome map for the dog, red fox, and human and its integration 32. Yang, H., Chen, X. and Wong, W.H. 2011, Completely phased genome with canine genetic maps, Genomics, 62, 189–202. sequencing through chromosome sorting, Proc. Natl Acad. Sci. U S A., 30. Graphodatsky, A.S., Yang, F., Serdukova, N., Perelman, P., Zhdanova, 108, 12–7. N.S. and Ferguson-Smith, M.A. 2000, Dog chromosome-specific paints 33. Gribble, S.M., Ng, B.L., Prigmore, E., Fitzgerald, T. and Carter, N.P. reveal evolutionary inter- and intrachromosomal rearrangements in the 2009, Array painting: a protocol for the rapid analysis of aberrant chro- American mink and human, Cytogenet. Cell Genet., 90, 275–8. mosomes using DNA microarrays, Nat. Protoc., 4, 1722–36. Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png DNA Research Oxford University Press

Homologue-specific chromosome sequencing characterizes translocation junctions and permits allelic assignment

Free
8 pages

Loading next page...
 
/lp/ou_press/homologue-specific-chromosome-sequencing-characterizes-translocation-8NCZejHv8i
Publisher
Oxford University Press
Copyright
© The Author(s) 2018. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
ISSN
1340-2838
eISSN
1756-1663
D.O.I.
10.1093/dnares/dsy007
Publisher site
See Article on Publisher Site

Abstract

Chromosome translocations can be detected by cytogenetic analysis, but it is hard to character- ize the breakpoints at the sequence level. Chromosome sorting by flow cytometry produces flow karyotypes that enable the isolation of abnormal chromosomes and the generation of chromosome-specific DNA. In this study, a derivative chromosome t(9; 14) and its homologous normal chromosomes 9 and 14 from the Ishikawa 3-H-12 cell line were sorted to collect homologue-specific samples. Chromosome sequencing identified the breakpoint junction in the der(9) at 9p24.3 and 14q13.1 and uncovered the formation of a fusion gene, WASH1–NPAS3. Amplicon sequencing targeted for neighbouring genes at the fusion breakpoint revealed that the variant frequencies correlate with the allelic copy number. Sequencing of sorted chromo- somes permits the assignment of allelic variants and can lead to the characterization of abnor- mal chromosomes. We show that allele-specific chromosome sequencing of homologues is a robust technique for distinguishing alleles and this provides an efficient approach for the com- prehensive analysis of genomic changes. Key words: chromosome sorting, allelic profile, fusion gene, breakpoint junctions, variant frequency 1. Introduction recent advances in single cell analysis can distinguish differences be- Next-generation sequencing provides whole genome analysis of struc- tween cells and help to uncover genetic heterogeneity in tumour cells, 1,2 tural variants as well as sequence variants. The technique has made the investigation of allelic differences remains challenging. a significant contribution to cancer genomics and to the analysis of Chromosomes can be distinguished in fluid suspensions using a human cancer cell lines that have been accumulated in the Cancer bivariate fluorescence-activated cell sorter which separates them by Cell Line Encyclopedia and the Catalogue of Somatic Mutations in size and base pair ratio and displays the results in the form of a flow Cancer. It is noted that clinical tumour samples are often contami- karyotype, allowing accurate estimation of chromosome size and 10,11 nated with normal cells and show heterogeneity due to clonal evolu- GC content. The procedure enables the isolation and collection 5,6 7 tion which is also observed in tumour cell lines. These two not only of aberrant chromosomes but sometimes also of normal ho- features present problems in sequencing tumour samples. Although mologues that contain measurable differences in repetitive DNA. V C The Author(s) 2018. Published by Oxford University Press on behalf of Kazusa DNA Research Institute. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com 1 Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 2 Homologue-specific chromosome sequencing Analysis of sorted chromosomes can characterize cryptic allelic vari- sheath pressure to  60 psi and the drop drive frequency to  95 kHz ants occurring in a reciprocal chromosome translocation. Sorted using a 70lm cytonozzle tip. The flow karyotype was displayed by chromosome samples have been extensively exploited in diagnostic Hoechst 33258 versus Chromomycin A3 fluorescence and acquired by cytogenetics and in the production of chromosome-specific DNA for a total of 50,000–100,000 events at a rate of 1,000 events per second. 14,15 16,17 Data collected from the experiments were analysed using Summit chromosome painting and chromosome sequencing. The lat- Software Version 4.1 (Beckman Coulter). Approximately 2,000 chro- ter serves to focus on regions of interest and has application in refin- ing genome analysis and assisting genome assembly. mosomes were flow sorted into a 0.5-ml UV-treated PCR tube from In this study, chromosome-specific sequencing reveals the break- each chromosome peak. point junction and identifies a novel fusion gene in a translocation between chromosomes 9 and 14 observed in a human cancer cell 2.4. Chromosome sequencing line. The sequence analysis of homologous regions on chromosomes For chromosome-specific sequencing, chromosomes were amplified separated by flow sorting has enabled alleles at several loci to be dis- by the REPLI-g single cell kit (Qiagen) and a genomic DNA fragment tinguished by their nucleotide differences. library was prepared using the Ion Xpress Plus Fragment Library kit (Life Technologies). Emulsion PCR of the library was performed by the Ion One Touch 2 system using the Ion PGM Template OT2 400 2. Materials and methods kit (Life Technologies). Sequencing was carried out by the Ion PGM 2.1. Cell lines and DNA preparation sequencer using the Ion PGM Sequencing 400 kit and the Ion 318 The Ishikawa 3-H-12 cell line registered as JCRB1505 was estab- Chip (Life Technologies). All protocols followed the manufacturer’s lished from an endometrial cancer. Cells were cultured using MEM instructions. Alignment of sequencing reads with the human genome reference (GRCh37/hg19) was performed using the Torrent Suite with 15% non-heat-inactivated foetal bovine serum. Genomic DNA v4.1.2 software. The bam file was mapped to the hg19 reference us- was extracted using the AllPrep DNA/RNA Mini Kit (Qiagen). The ing the TMAP software v5.0.13 with standard options karyotypes and SNP array profiles are available from our previous (Supplementary Table S1). This was visualized in the Integrative study (Supplementary Fig. S1A). Because t(9; 14) was detected in all Genomics Viewer (IGV) using the mapping quality value as 1. BLAT the metaphases examined and therefore expected to be a reference search in the UCSC Genome tools was used to find similarity of marker for this cell line, this study was focused on der(9). sequence reads in the genome database. 2.2. Chromosome preparation and staining 2.5. Fusion point analysis Mitotic cells were collected by shake-off from three 175-cm flasks at The breakpoint junction was amplified by PCR at an annealing tem- passage 25* after colcemid treatment (KaryoMAX Colcemid, Gibco) perature of 65 C using the following primer pairs designed using the at a final concentration of 0.1 lg/ml for 5 h. Cells were centrifuged at Primer3 software; der9-BPf: GGAAGGCTCAGACAGAGAGG and 250 g for 8 min in 50 ml tubes. The supernatant was discarded and der9-BPr: CTCTCCCTTGCACTCAGCTC. Total RNA was pre- replaced by 10 ml of hypotonic solution (75 mM KCl, 0.2 mM sper- pared using the AllPrep DNA/RNA Mini Kit (Qiagen) and treated mine, 0.5 mM spermidine, 10 mM MgSO 7H O, pH 8.0) and incu- 4 2 with DNaseI. Reverse transcription of RNA into cDNA was per- bated at RT for 15 min. After centrifugation, the cell pellet was formed using the PrimeScript RT-PCR Kit (Takara) with random resuspended in 1 ml of ice-cold polyamine buffer (2 mM EDTA, hexamers. Amplification of the WASH1–NPAS3 fusion transcript 0.5 mM EGTA, 80 mM KCl, 0.25% Triton X-100, 0.2 mM was performed with annealing temperature at 63 C using the PCR spermine, 0.5 mM spermidine, 20 mM NaCl, pH 7.2) and incu- primer pair of WASH1f: GGAAGGCTCAGACAGAGAGG and bated on ice for 10 min. The suspension was then vortexed vigor- NPAS3r: AGCATCTCGGGATTTCTCCT. ously for 12 s and the chromosomes were stained by 5 lg/ml of Hoechst 33258 (Sigma-Aldrich, B2883), 40 lg/ml of Chromomycin A3 (Sigma-Aldrich, C2659), and 10 mM MgSO .10 mMsodium 2.6. Variant analysis citrate and 25mM sodium sulphite were added1hbefore flow Multiplex primer pools for eight genes at 9p24.3, 10 genes at 14q13 sorting. and the breakpoint boundary region at 14q13.1 were obtained using the Ion AmpliSeq Designer and are listed in Supplementary Table S2. The Ampliseq custom panels for 9p24.3 and 14q13 consist of 118 2.3. Chromosome sorting and 120 amplicons, covering 33,607 and 33,275 bp in total size, re- Flow cytometric analysis was carried out at the Cambridge Resource spectively. Sequence library and template preparations were per- Centre for Comparative Genomics. Stained chromosome suspensions formed using the Ion AmpliSeq Kit for Chef DL8 and Ion PGM Hi- were analysed on a flow cytometer (MoFlo, Beckman Coulter, Q Chef Kit (Life Technologies), respectively. Sequencing was run on Fullerton, CA, USA) equipped with two water-cooled lasers (Spectra- the Ion PGM using the Ion 316 chip. The analysis was carried out us- Physics Model 2020) spatially separated at the flow chamber. The first ing the Variant Caller plug-in in the Torrent Suit and the parameters laser was tuned to emit multiline UV (330–360 nm) which excites are given in Supplementary Table S3. Hoechst 33258. The second laser was tuned to emit light at 457 nm to excite Chromomycin A3. The power of both lasers was set to 300 mW and kept constant using light control feedback. Fluorescence emitted 3. Results from Hoechst 33258 was collected using a 400 nm long pass filter combined with a 480 nm short pass filter. Chromomycin A3 fluores- 3.1. Flow karyotype cence was collected using a 490 nm long pass filter. The instrument The flow karyotype of the Ishikawa 3-H-12 cell line at passage 25* was configured for two-way sorting with high speed sorting at a data is shown in Fig. 1, indicating the peaks resulting from chromosome rate of 8,000–12,000 events per second with the optimal setting of the 9, one of two chromosomes 14 (14S) and der(9). Based on array Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 F. Kasai et al. 3 chromosomes 9 and 14 (Supplementary Fig. S2). The fragments lo- calize to the second introns of both the WASH1 (9p24.3) and NPAS3 (14q13.1) genes (Fig. 3A). Absence of sequence homology be- tween chromosomes 9 and 14 at the breakpoints indicates non- homologous end joining. The junction was amplified by PCR on ge- nomic DNA using primers from chromosomes 9 and 14. A fusion transcript is formed as expected based on the orientation of two genes. RT-PCR followed by sequencing confirms the in-frame fusion of WASH1 exon 2 and NPAS3 exon 3 (Fig. 3B). WASH1 is located at the distal end of the short arm of chromosome 9,  22 kb from the telomere according to the genome database. As the SNP microarray reported in our previous study does not have markers located at the distal end, this rearrangement could not be characterized. The chromosome sequence data and the breakpoint sequence are deposited in DRA/DDBJ (accession number: DRA006485 and LC331302). 3.3. Variant profiles in the neighbourhood genes of the breakpoint Amplicon sequencing on total genomic DNA reveals that 117 and 118 target regions in 9p24 and 14q13, respectively, close to the breakpoint are amplified with at least 200 reads. As three amplicons Figure 1. Flow karyotype of the Ishikawa 3-H-12 cell line at P25* without re- moving the background manually by image processing was obtained after in the 14q13 region have less than 30 reads, these targets are ex- sorting a larger number of chromosomes than usual to show clearly the cluded from the data analysis. The average number of reads per der(9) peak close to the normal chromosome 3 peak. The der(9) peak is amplicon is calculated to be 2,198 and 1,982 for 9p24 and 14q13 weaker than other peaks that have pairs of normal chromosomes as it exists regions, respectively. in only one copy in each cell. Normal chromosome 9 and one of the chromo- Nucleotide variants in the total genomic DNA sample are detected some 14 homologues, 14S, are also selected for sorting. at 37 positions in the 9p24.3 region, but five positions were of low quality. The remaining 32 positions which did not include missense data, the chromosome size of der(9) is estimated to be  215 Mb. It mutations serve as informative markers for distinguishing between al- is contained in an abnormal peak, close to the normal chromosome leles at variant loci. According to their frequency in the sequence reads, 3 peak, and weaker than the other normal peaks because it contains each variant allele can be classified into two types, around 50 or nearly only half the number of chromosomes, i.e. only the derivative chro- 100% of reads. This suggests that two alleles are present in this region, mosome rather than the pairs of homologues present in other peaks. supported by our previous data based on the SNP microarray and Chromosome 14 is heteromorphic and this allows the separation of M-FISH which showed two chromosome copies (Supplementary Fig. one of the two chromosome 14 homologues by sorting. In this study, S3A). Of the 32 sequence variants, 16 were detected at 100% fre- the sorted chromosome 14 is referred to as 14S, and the other quency, reflecting their presence in both chromosomes (Table 1). The unsorted homologue is referred to as 14U. other 16 variants with a frequency of around 50% indicate their pres- ence in one of the two chromosomes, but these could not be localized 3.2. Sequence analysis of der(9) and characterization to a chromosome in the genomic DNA sample. Chromosome-specific of the fusion breakpoint sequencing on der(9) and normal chromosome 9 reveal that allelic var- In order to identify the genomic breakpoint junction in der(9), two iants were detected at 23 and 25 positions, respectively, all of which sequence libraries were prepared from amplification of the sorted showed nearly 100% frequency. This demonstrates that seven and der(9) chromosomes. The sequence data from these two runs show nine variants are specific for der(9) and the normal chromosome 9, re- 1.7 and 1.0Gb consisting of 6.4 and 4.0 M reads with the read length spectively, i.e., one allele at each locus. Because the other nine positions modes of 372 and 416 bp, respectively (Supplementary Table S4). are not amplified in sorted chromosome samples, the alleles at these Coverage analysis based on the human reference genome revealed positions could not be distinguished. that most sequence reads map to chromosomes 9 and 14, with some Variant analysis of 10 gene loci at 14q13 in the total genomic DNA on chromosome 3 (Fig. 2) corresponding to a small amount of con- reveals 36 informative positions (Table 2, Supplementary Table S5). tamination during chromosome sorting due to the close proximity of The allele frequencies at these positions show three classes; either the der(9) and chromosome 3 peaks. Although a small number of around 33 or 66, or nearly 100% of reads, corresponding to the pres- reads were not aligned to the reference, more than 99% of the reads ence of variants in one of three, two of three or all three alleles at these were aligned with 95 or 96% identities of base pairs (Supplementary positions, respectively. This suggests that this region in 14q13 is pre- Table S4). This indicates that some reads are partially aligned with sent in three copies, which agrees with the SNP microarray profile and soft-clipped sequences, corresponding to breakpoint regions. the karyotype analysis that reveal three copies of chromosome 14 Mapping data were displayed in the IGV software focusing on the (Supplementary Fig. S1). The common variants present in all three al- distal end of the 9p region (Supplementary Fig. S2). Three reads mea- leles with 100% frequency are detected at six positions. The remaining suring 242, 356 and 400 bp including unmapped sequences prove to 23 and 7 variants could be detected by frequencies of 33 and 66%, be fragments that cover the fusion point. These three sequences were corresponding to their presence in one and two chromosomes, respec- subjected to a BLAT search, which show homologies to both tively. Chromosome sequencing was run twice in each sample and Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 4 Homologue-specific chromosome sequencing Figure 2. Reference coverage charts from chromosome sequencing of der(9) are shown based on average base read depth. (A) Coverage on each chromosome indicates its contents aligned to chromosomes 9 and 14, with some sequences mapped to chromosome 3 because of contamination from the closely located peak in the flow karyotype. (B) Sequence reads are detected along chromosome 9, with a large gap at the region of the centromere and pericentromeric hetero- chromatin. (C) The majority of reads appear in the 14q13-qter region, which indicates the breakpoint at 14q13.1 shown by an arrowhead. showed that variant frequencies were all nearly 100% (Supplementary Table S5). By sorting 14S separately from the unsorted chromosome 14 (14U), variant frequencies in 14S are either 0 or 100% (Table 2), indicating successful chromosome sorting without contamination be- tween homologues. This demonstrates that der(9) and 14S samples have 13 and 29 variants, respectively (Table 2). Of these, 23 variants are specific for 14S. The total DNA sample indicates the presence of variants in 7 loci in two of three chromosomes, but they are only de- tected in der(9) and absent in 14S (Table 2). This implies that these variants must be shared between the chromosome 14 homologous re- gion on der(9) and 14U, indicating that the chromosome 14 region in der(9) represents a duplication of 14U. Among the variants in the 10 genes, five missense mutations are identified (Supplementary Table S5). One of them is known to be a polymorphism, localized to der(9) and 14U. The other four mutations involving three different gene loci are included in 14S (Supplementary Table S5). Figure 3. (A) Breakpoint junction sequence of the der(9) chromosome. Upper, middle and lower sequences indicate reference sequence of chro- 3.4. Copy number changes at the 14q13 region during mosome 14, derivative chromosome and reference sequence of chromo- some 9, respectively. Breakpoint positions are marked with arrowheads. passage Numbers are based on the nucleotide position in the UCSC genome The SNP microarray performed in our previous study shows differ- browser (GRCh37/hg19). Cen, centromere; tel, telomere. (B) The nucleo- ences of the Ishikawa 3-H-12 genome profiles between low and high tide and amino acid sequences of the fusion gene. The chimeric passages. Although the der(9) has already been found in all cells at WASH1–NPAS3 gene shows in-frame fusion of exon 2 of WASH1 to exon 3 of NPAS3. low passage, the enlarged profiles focused on the breakpoint region Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 F. Kasai et al. 5 Table 1. Variant frequency for the 9p24.3 region Table 2. Variant frequency for the 14q13 region Gene ID Position Ref Variant Total der(9) chr 9 Gene ID Position Ref Variant Total der(9) 14S 14U WASH1 14665 G A 61.2 100 EGLN3 34395149 A – 100 100 100 FOXD4 116800 C G 48.0 100 EAPP 34985645 G A 34.1 100 FOXD4 116832 T C 47.5 100 EAPP 34998705 T C 33.1 100 FOXD4 118173 C G 100 100 100 SNX6 35062166 T C 100 100 100 CBWD1 154795 T C 49.9 96.1 SNX6 35062312 C T 100 100 99.4 DOCK8 286593 C A 49.9 99.3 SNX6 35075022 G T 100 100 100 DOCK8 327938 G C 53.6 100 BAZ1A 35222627 – TTGT 32.3 90.0 DOCK8 327957 T G 53.4 100 BAZ1A 35223956 A G 35.0 91.6 DOCK8 328006 T C 53.3 99.1 BAZ1A 35223971 A G 34.9 92.5 DOCK8 334524 G A 42.6 100 BAZ1A 35227880 G T 33.1 89.9 DOCK8 417990 T C 100 100 98.9 BAZ1A 35228090 G A 30.2 89.2 DOCK8 418003 T C 100 100 100 BAZ1A 35230906 G A 32.7 91.6 DOCK8 422157 T C 100 100 100 BAZ1A 35233740 T C 34.5 93.1 DOCK8 432330 C G 100 100 100 BAZ1A 35245748 A G 29.5 87.3 DOCK8 433978 A G 100 100 100 SRP54 35483882 A C 36.4 100 DOCK8 439453 G C 100 100 100 SRP54 35488309 A G 96.9 100 100 DOCK8 439467 A C 100 100 100 SRP54 35492128 C T 60.9 100 DOCK8 441827 C T 100 100 100 SRP54 35498443 G A 35.3 98.9 DOCK8 441952 G A 100 100 100 PPP2R3C 35565856 A T 32.3 95.8 DOCK8 442030 C T 100 100 100 PPP2R3C 35568756 – AA 100 100 100 DOCK8 446352 G C 100 100 100 PPP2R3C 35576458 A C 32.4 100 DOCK8 449700 G T 100 100 100 PPP2R3C 35578797 C T 71.0 98.1 KANK1 730054 A G 47.7 100 PPP2R3C 35579927 G A 30.7 100 KANK1 738434 C T 55.1 100 PPP2R3C 35591174 T C 61.2 98.6 KANK1 740901 C T 51.3 100 PPP2R3C 35591316 G A 62.3 98.2 KANK1 741084 C T 52.2 100 KIAA0391 35592491 C A 34.2 100 KANK1 742342 A G 100 100 100 KIAA0391 35592538 C G 66.3 100 DMRT1 841825 C T 53.2 89.0 KIAA0391 35593599 C G 67.3 98.2 DMRT1 841971 T A 52.6 89.1 KIAA0391 35596092 C A 32.9 100 DMRT1 967981 G C 100 100 100 KIAA0391 35736075 A G 33.2 100 DMRT3 990840 C T 100 100 100 PSMA6 35761573 C T 31.9 100 DMRT2 1057318 A G 46.5 100 PSMA6 35761675 C G 68.5 96.8 PSMA6 35777232 C T 33.4 100 Color table is available in online version. PSMA6 35777243 A G 33.8 100 PSMA6 35777270 A C 33.4 100 PSMA6 35777278 C G 33.5 100 at 14q13.1 indicate copy number changes occurring in one locus at Color table is available in online version. P3 and three loci at P20 (Supplementary Fig. S3B). The change ob- served at both P3 and P20 corresponds to the breakpoint that forms der(9). The additional changes at P20 between the other two loci in- volve breakpoints that cause a decrease in copy number. Because this 4. Discussion is not detected at P3, the cryptic deletion must have arisen in the cell Chromosome translocation is a common feature of chromosome population after long-term culture. Amplicon sequencing targeted rearrangements in tumour cells and can lead to the formation of a fu- for the 10 kb region around the breakpoint revealed that the whole 19,20 sion gene. Although fusion genes are found by RNA-seq, it is region is amplified in 14S (Supplementary Fig. S4). As the region up- hard to identify the genomic breakpoint because normal and abnor- stream of the der(9) breakpoint is absent in der(9), only the down- mal alleles usually coexist in total genomic DNA samples and cannot stream region is amplified. Similar profiles of the downstream region be distinguished by conventional analysis. The human genome size shared by 14S and der(9) suggest that no additional chromosome is 3,099 Mbp according to the golden path length of the rearrangement has occurred in the region. The patterns of variant GRCh37.p13 assembly. As the majority of the Ishikawa karyotypes frequencies across this region in the total genomic DNA sample dem- are 45, X, -X and have some gains, the size of each Ishikawa nuclear onstrates the change from 50 to 33/66/100% at P3 and from 100 to DNA is estimated to be  6,200 Mbp, including one copy of the 50/100% at P20 (Supplementary Table S6), corresponding to the der(9). When the breakpoint junction is identified by conventional chromosome copy number changes from 2 to 3 and from 1 to 2 that whole genome sequencing using total genomic DNA, theoretically it have occurred in this region (Fig. 4). Variants detected in the der(9) can appear in 1 per 15,500,000 fragments based on a 400 bp se- would be expected to be present at P3, indicating that three of them, quencing sample. However, it can be increased to 1 per 500,000 66% at P3, are shared with 14U. However, these variants are not de- fragments when the sample is from the sorted der(9) chromosome, tected in total genomic DNA at P20. This implies that two additional that is more efficient than whole genome sequencing. It is reported breaks have occurred in 14U and led to a cryptic deletion. Because that alignment of single-end long reads is straightforward to identify the other variants detected in one of three loci at P3 are specific for fusion junctions. We demonstrate that identification of genomic der(9), these changes can be related to the breakpoint event that oc- curred following duplication of chromosome 14. breakpoints detected by conventional karyotypes can be achieved by Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 6 Homologue-specific chromosome sequencing Passage 3 14S der(9) 14S No detectable change 14U gDNA Variant Chromosome 2 copies 3 copies frequency copy number 33,588,511 33,578,751 33,583,729 14U 33% 3 Two breaks Deleon 66% 3 in NPAS3 ~450 kb Passage 20 50% 2 100% 1/2/3 der(9) Duplicaon 14S 14U gDNA Fusion 1 copy 2 copies Fusion remains through cell culture WASH1- 33,588,511 33,578,751 33,583,729 NPAS3 der(9) Figure 4. Genome structure at the 14q13.1 region is illustrated from the array profiles and combined with variant frequencies obtained from amplicon se- quencing, with comparisons between passages, P3 (A) and P20 (B). The breakpoint in the der(9) is located at the position 33,583,729 bp. Variants are assigned to der(9) and 14S by amplicon sequencing in the chromosome-spe- cific DNA. The frequencies are distinguished by four different symbols. Variant assignments on chromosome homologues at P3 are estimated from Figure 5. The process of chromosome rearrangement involved in chromo- the P20 profile. A series of 100, 50 and 33/66% in total genomic DNA corre- some 14. Chromosomes 9 and 14 regions are marked by green and blue, spond to 1, 2 and 3 copies, respectively. Frequencies at three positions with respectively, and the two homologues of chromosome 14 are distin- 66% at low passage change to 50% at high passage, suggesting the presence guished by vertical and horizontal patterns. Because chromosome 14 con- of these variants in the 14U deletion indicated by a dashed line. gDNA: total sists of two different allele contents in the SNP array, it must have genomic DNA. originated from a normal pair with different allele profiles. Variant analysis in the sorted chromosome samples show that 14S and der(9) have differ- ent chromosome 14 allelic profiles, but der(9) and 14U have the same mapping analysis of single end reads on 400 bp scale without de chromosome 14 allelic profiles. This indicates that the origin of der(9) novo assembly. Although considerable efforts involving conventional was associated with duplication of 14U. One of the homologues, 14S, cloning techniques have been devoted to uncover breakpoint junc- does not have detectable changes at chromosomal level and der(9) re- tions in tumour genomes, , chromosome sequencing helps the detec- mains unchanged during cell culture. However, duplication of the long arm of 14U is fused with 9p to form der(9). The 14U chromosome at pas- tion and analysis of the genomic breakpoint junction. sage P20 has a cryptic deletion in the same region as the breakpoint in Fusion genes serve as genetic markers and can be associated with der(9). Black circles and squares show telomere and centromere, respec- disease phenotypes. Sequence analysis of the der(9) chromosome- tively. Color figure is available in online version. specific DNA isolated by flow sorting in our study reveals a WASH1–NPAS3 fusion gene at the translocation breakpoint. This variant frequencies of 0 or 100% of reads indicate that the variant is chimeric gene is formed mostly by the NPAS3 component, suggesting either absent or present in an amplicon. This permits chromosome that altered NPAS3 expression may be oncogenic. Although no re- assignment of each variant to a specific chromosome and enables dis- port has shown fusion genes between these two genes, NPAS3 is a tinction between homologues. Two chromosomes sharing the same transcription factor of a basic helix–loop–helix Per-ARNT-Sim do- allelic profile suggest that they have a common origin and are formed main family associated with tumour development in multiple forms 25 by duplication. Allele frequencies of  66% of reads reflects the of cancer. Also, it is reported that NPAS3 acts as a tumour sup- 26 presence of the same variant in two of the three alleles in three chro- pressor in human malignant astrocytomas. The fusion detected by mosomes corresponding to one in der(9) and one in 14U (Table 2, the genomic breakpoint junction and confirmed by the transcript can Fig. 5). Further analysis of the breakpoint by amplicon sequencing be a definitive marker for the Ishikawa cell line and used, possibly, of the 10 kb region that encompasses the junction in the second in- for future studies on endometrial carcinoma. tron of NPAS3 identified a cryptic deletion occurring in the chromo- Amplicon sequencing of the genes neighbouring the breakpoint some 14 allele shared with der(9). These detailed variant analyses demonstrates that variant frequencies in the total genomic DNA are elucidate the process of chromosome rearrangements involving linked to chromosome copy number. Variant frequencies of 50% of chromosomes 9 and 14. SNP allele peaks show two different allelic reads detected in chromosome 9 indicate the presence of the variant profiles of chromosome 14 in Ishikawa cells, indicating that the du- in one of two homologues. The variant frequencies of 33 or 66% of plication of 14q13–ter has occurred prior to the formation of reads in chromosome 14 reflect one or two of three homologues, re- der(9). Although the variant frequency at 14q13 reveals that the spectively (Fig. 4). This suggests that a series of patterns consisting of cryptic deletion and the breakpoint in the der(9) occur in different frequencies of approximate 50/100 or 33/66/100% are strongly cor- related to the presence of copy numbers of two or three chromo- chromosome 14 homologues, these two chromosomes must have been formed through duplication because of their otherwise identi- somes, respectively. While the fusion can be clearly distinguished at cal allelic profiles. As the deletion cannot be identified in the array the chromosome level, sequence variants cannot be regarded as alle- lic unless the chromosomes are sequenced separately. When ampli- profile at low passage, it must have occurred after the formation of con sequencing is performed on chromosome-specific DNA, the der(9) and during cell culture. These two rearrangements have Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 F. Kasai et al. 7 8. Potter, N.E., Ermini, L., Papaemmanuil, E., et al. 2013, Single-cell muta- occurred independently, possibly suggesting a tendency to breakage tional profiling and clonal phylogeny in cancer, Genome Res., 23, in the region. 2115–25. Our chromosome sorting using a dual laser flow cytometer was 9. Carter, N.P., Ferguson-Smith, M.E., Affara, N.A., Briggs, H. and first introduced in 1992 to generate chromosome-specific DNA for 14 Ferguson-Smith, M.A. 1990, Study of X chromosome abnormality in XX diagnostic cytogenetics. This led to the development of chromo- males using bivariate flow karyotype analysis and flow sorted dot blots, some painting probes for phylogenetic studies in a wide variety of Cytometry, 11, 202–7. species including human that has revealed homologous syntenic 10. Kasai, F., O’Brien, P.C.M. and Ferguson-Smith, M.A. 2012, blocks conserved between species not only in mammals but also Reassessment of genome size in turtle and crocodile based on chromo- 15,27,28 among birds and reptiles. These studies provide many ex- some measurement by flow karyotyping: close similarity to chicken, Biol. amples of chromosome-specific mapping and sequencing. In one Lett., 8, 631–5. study in dogs (2n ¼ 78), although there are many acrocentric chro- 11. Kasai, F., O’Brien, P.C.M. and Ferguson-Smith, M.A. 2013, Afrotheria mosomes of similar size and seven peaks in the flow karyotype genome; overestimation of genome size and distinct chromosome GC con- tent revealed by flow karyotyping, Genomics, 102, 468–71. that contain 2 chromosome pairs, each dog chromosome was 12. Ferguson-Smith, M.A. 1997, Genetic analysis by chromosome sorting and successfully isolated, some by single chromosome sorting; a com- painting: phylogenetic and diagnostic applications, Eur. J. Hum. Genet., plete set of painting probes was produced with each probe specific 30 5, 253–65. for a single type of dog chromosome. Another study demon- 13. Kasai, F., Yoshihara, M., Matsukuma, S., O’Brien, P. and Ferguson- strated that chicken microchromosomes can be characterized by Smith, M.A. 2007, Emergence of complex rearrangements at transloca- single chromosome sorting. Single chromosome sorting has been tion breakpoints in a transgenic mouse; implications for mechanisms applied more recently to haplotyping normal human chromosome involved in the formation of chromosome rearrangements, Cytogenet. 19, by demonstrating allele heterozygosity. When derivative Genome Res., 119, 83–90. chromosomes are different in size from the normal homologues, 14. Carter, N.P., Ferguson-Smith, M.A., Perryman, M.T., et al. 1992, Reverse they form a unique peak in the flow karyotype and can be resolved chromosome painting: a method for the rapid analysis of aberrant chro- easily and collected by flow sorting. We show here the isolation mosomes in clinical cytogenetics, J. Med. Genet., 29, 299–307. 15. Ferguson-Smith, M.A., Yang, F. and O’Brien, P.C. 1998, Comparative of chromosome homologues in a tumour cell line by chromosome mapping using chromosome sorting and painting, ILAR J., 39, 68–76. sorting that allows homologue-specific sequencing, chromosome 16. Edwards, A.M., Cameron, E.Z., Pereira, J.C., Wapstra, E., Ferguson- assignment of allelic variants and improved characterization of ab- Smith, M.A., Horton, S.R. and Thomasson, K. 2016, Gestational experi- normal chromosomes. ence alters sex allocation in the subsequent generation, R. Soc. Open Sci., 3, 160210. 17. Gomes, A.J., Nagamachi, C.Y., Rodrigues, L.R., et al. 2016, Acknowledgements Chromosomal phylogeny of Vampyressine bats (Chiroptera, Authors would like to thank Dr. Ryoka Miki (Thermo Fisher Scientific, Japan) Phyllostomidae) with description of two new sex chromosome systems, and Mr. Takashi Ishikura (Thermo Fisher Scientific, Japan) for their technical BMC Evol. Biol., 16, 119. comments on data analysis. 18. Nishida, M. 1985, Establishment of a new human endometrial adenocar- cinoma cell line, Ishikawa cells, containing estrogen and progesterone re- ceptors, Nihon Sanka Fujinka Gakkai Zasshi, 37, 1103–11. Conflict of interest 19. Aplan, P. D. 2006, Causes of oncogenic chromosomal translocation, Trends Genet., 22, 46–55. None declared. 20. Roukos, V. and Misteli, T. 2014, The biogenesis of chromosome translo- cations, Nat. Cell Biol., 16, 293–300. 21. Suzuki, T., Tsurusaki, Y., Nakashima, M., Miyake, N., Saitsu, H., Supplementary data Takeda, S. and Matsumoto, N. 2014, Precise detection of chromosomal Supplementary data are available at DNARES online. translocation or inversion breakpoints by whole-genome sequencing, J. Hum. Genet., 59, 649–54. 22. Ge, H., Liu, K., Juan, T., Fang, F., Newman, M. and Hoeck, W. 2011, References FusionMap: detecting fusion genes from next-generation sequencing data at base-pair resolution, Bioinformatics, 27, 1922–8. 1. Henson, J., Tischler, G. and Ning, Z. 2012, Next-generation sequencing 23. Ford, A.M., Mansur, M.B., Furness, C.L., et al. 2015, Protracted dor- and large genome assemblies, Pharmacogenomics, 13, 901–15. mancy of pre-leukemic stem cells, Leukemia, 29, 2202–7. 2. Pabinger, S., Dander, A., Fischer, M., et al. 2014, A survey of tools for 24. Kawamura, M., Taki, T., Kaku, H., Ohki, K. and Hayashi, Y. 2015, variant analysis of next-generation genome sequencing data, Brief. Identification of SPAG9 as a novel JAK2 fusion partner gene in pediatric Bioinformatics, 15, 256–78. acute lymphoblastic leukemia with t(9; 17)(p24; q21), Genes 3. Barretina, J., Caponigro, G. and Stransky, N. 2012, The cancer cell line Chromosomes Cancer, 54, 401–8. encyclopedia enables predictive modelling of anticancer drug sensitivity, 25. Bersten, D.C., Sullivan, A.E., Peet, D.J. and Whitelaw, M.L. 2013, Nature, 483, 603–7. bHLH-PAS proteins in cancer, Nat. Rev. Cancer, 13, 827–41. 4. Forbes, S. A., Beare, D., Boutselakis, H., et al. 2017, COSMIC: somatic 26. Moreira, F., Kiehl, T.R., So, K., et al. 2011, NPAS3 demonstrates features cancer genetics at high-resolution, Nucleic Acids Res., 45, D777–83. 5. Marusyk, A. and Polyak, K. 2010, Tumor heterog eneity: causes and con- of a tumor suppressive role in driving the progression of Astrocytomas, Am. J. Pathol., 179, 462–76. sequences, Biochim. Biophys. Acta, 1805, 105–17. 27. Ferguson-Smith, M.A., Yang, F., Rens, W. and O’Brien, P.C. 2005, The 6. Greaves, M. and Maley, C.C. 2012, Clonal evolution in cancer, Nature, impact of chromosome sorting and painting on the comparative analysis 481, 306–13. of primate genomes, Cytogenet. Genome Res., 108, 112–21. 7. Kasai, F., Hirayama, N., Ozawa, M., Iemura, M. and Kohara, A. 2016, 28. Kasai, F., O’Brien, P.C., Martin, S. and Ferguson-Smith, M.A. 2012, Changes of heterogeneous cell population in the Ishikawa cell line during long-term culture; proposal of an in vitro clonal evolution model of tumor Extensive homology of chicken macrochromosomes in the karyotypes of cells, Genomics, 107, 259–66. Trachemys scripta elegans and Crocodylus niloticus revealed by Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018 8 Homologue-specific chromosome sequencing chromosome painting despite long divergence times, Cytogenet. Genome 31. Masabanda, J.S., Burt, D.W., O’Brien, P.C., et al. 2004, Molecular cyto- Res., 136, 303–7. genetic definition of the chicken genome: the first complete avian karyo- 29. Yang, F., O’Brien, P.C., Milne, B.S., et al. 1999, A complete comparative type, Genetics, 166, 1367–73. chromosome map for the dog, red fox, and human and its integration 32. Yang, H., Chen, X. and Wong, W.H. 2011, Completely phased genome with canine genetic maps, Genomics, 62, 189–202. sequencing through chromosome sorting, Proc. Natl Acad. Sci. U S A., 30. Graphodatsky, A.S., Yang, F., Serdukova, N., Perelman, P., Zhdanova, 108, 12–7. N.S. and Ferguson-Smith, M.A. 2000, Dog chromosome-specific paints 33. Gribble, S.M., Ng, B.L., Prigmore, E., Fitzgerald, T. and Carter, N.P. reveal evolutionary inter- and intrachromosomal rearrangements in the 2009, Array painting: a protocol for the rapid analysis of aberrant chro- American mink and human, Cytogenet. Cell Genet., 90, 275–8. mosomes using DNA microarrays, Nat. Protoc., 4, 1722–36. Downloaded from https://academic.oup.com/dnaresearch/advance-article-abstract/doi/10.1093/dnares/dsy007/4922629 by Ed 'DeepDyve' Gillespie user on 12 July 2018

Journal

DNA ResearchOxford University Press

Published: Mar 6, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off