High Intensity Interval Training Improves Physical Performance and Frailty in Aged Mice

High Intensity Interval Training Improves Physical Performance and Frailty in Aged Mice Abstract Sarcopenia and frailty are highly prevalent in older individuals, increasing the risk of disability and loss of independence. High intensity interval training (HIIT) may provide a robust intervention for both sarcopenia and frailty by achieving both strength and endurance benefits with lower time commitments than other exercise regimens. To better understand the impacts of HIIT during aging, we compared 24-month-old C57BL/6J sedentary mice with those that were administered 10-minute uphill treadmill HIIT sessions three times per week over 16 weeks. Baseline and end point assessments included body composition, physical performance, and frailty based on criteria from the Fried physical frailty scale. HIIT-trained mice demonstrated dramatic improvement in grip strength (HIIT 10.9% vs −3.9% in sedentary mice), treadmill endurance (32.6% vs −2.0%), and gait speed (107.0% vs 39.0%). Muscles from HIIT mice also exhibited greater mass, larger fiber size, and an increase in mitochondrial biomass. Furthermore, HIIT exercise led to a dramatic reduction in frailty scores in five of six mice that were frail or prefrail at baseline, with four ultimately becoming nonfrail. The uphill treadmill HIIT exercise sessions were well tolerated by aged mice and led to performance gains, improvement in underlying muscle physiology, and reduction in frailty. Sarcopenia, Muscle, Exercise, Mitochondria Men and women who are physically inactive are at greater risk for sarcopenia, a condition of lower muscle mass, quality, and function (1) that plays a pivotal role in the onset and progression of frailty (2). Despite well-established benefits of exercise in preventing sarcopenia, only 52% of adults aged 65 and older meet guidelines for aerobic activity (3) and only 12%–20% of adults older than 65 years routinely participate in strength training exercises (3,4). The most prevalent barrier to exercising reported in a survey involving older individuals (>60 years) is “not enough time” (5), suggesting that there would be greater participation in exercise modalities that achieve benefits with less time commitment. High intensity interval training (HIIT) exercise modalities encompass intense intervals alternated with periods of lower intensity for recovery, providing physiological benefits in less time than traditional exercise regimens (6). In particular, Tjønna and colleagues (7) demonstrated that a single 4-minute exercise session at 90% of maximal heart rate, three times a week over 10 weeks, improved VO2max in inactive but otherwise healthy 35- to 45-year-old men. Fiatarone and colleagues pioneered the use of HIIT as an intervention for those of advanced age, finding excellent tolerance, strength, and gait speed improvements, in frail nonagenarians (8). HIIT was also shown to be safe and effective in healthy 70-year-old men (9), and further studies identify a range of HIIT benefits in healthy older populations (>60 years old) that include quadriceps hypertrophy and cardiovascular improvement (10), enhancement of myofibrillar and sarcoplasmic proteins (11), greater muscle power (12), and improvement of health-related quality of life (13). However, the potential of HIIT as an intervention for frail older adults remains poorly understood. Animal models may provide a deeper understanding of the physiological benefits of exercise and have been used to model the impacts of advanced age. In particular, animal models are now emerging as tools to examine the progression and underlying mechanisms of frailty (14–19), and more recently, frailty was shown to predict survival in rats (20). Here we employ a novel HIIT program in aged mice and study the impacts on frailty status. Our findings reveal improvement across several domains of physical performance as well as underlying muscle physiology. Furthermore, we also identify improvement of frailty status as determined using a mouse frailty assessment tool with parameters that closely align to those used in the Fried physical frailty scale for humans (21). Materials and Methods Mice All studies and experimental protocols were approved by and in compliance with guidelines of the University at Buffalo and VA Western New York Healthcare System Animal Care and Use Committees. At all times mice were provided ad libitum access to chow/water and were individually housed. Twenty-two-month-old male C57BL/6 mice were acquired from the NIA aging mouse colony and at 24 months of age were randomly assigned to either sedentary (SED) or high intensity interval training (HIIT) groups (n = 12 for each group). Mice and chow from cages were weighed on a weekly basis. After 16 weeks, animals were sacrificed and heart, soleus, and extensor digitalis longus muscles were isolated and immediately weighed. In addition, 4-month-old C57BL/6 mice were acquired from Charles River Laboratories for physical performance assessments as a reference for performance in our aged cohorts (n = 19), and for which hearts were harvested (n = 7) and weighed following 16 weeks in similar housing as the aged cohorts. Dual-Energy X-ray Absorptiometry Analysis of bone mineral density, body fat %, and lean mass was performed using a Lunar PIXImus II (Inside Outside Sales, LLC., Fitchburg, WI). Animals were anesthetized and then analyzed with a single scan at baseline and end point. Physical Performance Assessment All assessments were performed by the same investigator who was blinded to the identity of the mice. In addition, the different assessments were performed in the same order over the course of 1 week at baseline and end point, and each was performed at the same time of day. Grip strength meter Mice were assessed in the best three of five trials whereby the mouse is placed on the force meter (Columbus Instruments, Columbus, OH) allowing all four limbs to grip the grid. The mouse is then pulled, whereas the body remains horizontal, until loss of grip. This process is repeated twice more with roughly 1 second between attempts, and the maximal score for the three attempts is recorded as the score for that trial. Trials are separated by no less than 10 seconds for rest (mouse left inactive on grip meter stage). Treadmill Mice are acclimated to the treadmill device (Exer 3/6, Columbus Instruments) 1 month prior to baseline assessments. Treadmill endurance assessment consists of one trial whereby the treadmill accelerates from 5 to 35 m/min over 60 minutes (increasing at a rate of 1 m/min per 2 minutes). End point occurs if the mouse touches the shock grid 10 times, receives 20 total shocks (if a mouse stays on the shock grid for multiple shocks), or runs a total of 120 minutes. To assess uphill sprint capacity, mice receive a 60-s warm up at 5 m/min and then run in intervals of 20 seconds starting at 7 m/min, then 10 m/min, and increase by 1 m/min thereafter—with 20-second periods of relative rest (belt at 5 m/min) between intervals. Trials end at exhaustion as defined by the mouse touching the shock grid three times or receiving seven total shocks. The treadmill is inclined at 25°, and assessment is performed as a single trial with the uphill sprint score being the speed (meter per minute) of the last completed interval prior to exhaustion. Gait speed analysis Gait speed analysis was performed on an apparatus that features an 8 cm wide × 12 cm tall × 1 m long channel that opens into a darkened “safe house” box (22). Mice were then scored on the quickest two of three trials whereby the mouse is placed at the start of the device and timed until the mouse reaches the “safe” house. Rotarod analysis Mice are acclimated 1 month prior to assessments. At each time point, mice are assessed in the best two of three trials whereby mice are timed until fall from the rotarod device (Med Associates Inc., Fairfax Vermont) as it accelerates from 4 to 40 revolutions/min over 300 seconds. The trial is stopped if the mouse falls, stays on the rotarod for 360 or more seconds, or the mouse retains a grip on the cylinder for two complete revolutions within 10 seconds. Mice are given no less than 15 minutes of rest in home cages between trials. Activity monitor Activity monitoring was performed as a single 30-minute trial on an eight-station device (Med Associates Inc.) that features infrared beams that track the mice over the time period and allow automated software (Med Associates Inc.) quantitation of quadrant crossings and total rearings. The experimenter was a minimum of 3 feet away from all mice during activity monitor assessments. Exercise Protocol Prior to initiating the exercise training protocol, mice were placed into various speed intensity groups based on baseline uphill sprint data (Table 1). High intensity interval training exercise was performed on an inclined treadmill (25°) using a custom program of 10 minutes, starting with a 3-minute warm-up period at base speed (Table 1), followed by three intervals of a 1-minute sprint speed interspersed with a 1-minute period of relative rest at base speed, and then a final 1-minute accelerating interval (from sprint to dash speed; Figure 1A). Mice that discontinued running were motivated to continue by prodding with a tongue depressor. Mice that were not able to complete the exercise program despite prodding were assigned to lower-intensity groups on the next session, whereas mice that did not require any prodding in two consecutive sessions were assigned to higher-intensity groups. Exercise sessions were performed 3 days a week. At baseline and end point, mice were assessed on the initial baseline program as the percent of the program complete before receiving five total shocks. Table 1. HIIT Intensity Groups Intensity Group  Baseline Uphill Sprint Score (m/min)  Starting in Group  Ending in Group  Baseline Exercise Speeds (m/min)  Base  Sprint  Dash  Group A  0–16  5  3  5  10  15  Group B  17–25  4  8  8  13  18  Group C  >25  3  1  11  16  21  Intensity Group  Baseline Uphill Sprint Score (m/min)  Starting in Group  Ending in Group  Baseline Exercise Speeds (m/min)  Base  Sprint  Dash  Group A  0–16  5  3  5  10  15  Group B  17–25  4  8  8  13  18  Group C  >25  3  1  11  16  21  Note: HIIT = high intensity interval training. Mice were divided into intensity groups depending on baseline uphill sprint data (see Methods). Mice were moved up intensity groups if there was no difficulty in two consecutive sessions and down if unable to complete a session. Five such changes occurred in the first 2 weeks and only one thereafter. Base, sprint, and dash speeds increase 1 m/min every 2 weeks. View Large Figure 1. View largeDownload slide High intensity interval training program in aged mice. Exercise was performed 3 days a week using a 10-minute exercise scheme (A). The scheme features a 3-minute warm-up period at a base speed, followed by three intervals of 1 minute at a constant sprint speed alternatively with 1 minute at base speed, finishing with a final 1-minute interval that accelerates from sprint to dash speeds. Base, sprint, and dash speeds are detailed in Table 1 and increment 1 m/min higher every 2 weeks. (B) Percent completion of training program at baseline and at end point in those mice that initially failed to complete at least 95% of their baseline program, N = 7. Figure 1. View largeDownload slide High intensity interval training program in aged mice. Exercise was performed 3 days a week using a 10-minute exercise scheme (A). The scheme features a 3-minute warm-up period at a base speed, followed by three intervals of 1 minute at a constant sprint speed alternatively with 1 minute at base speed, finishing with a final 1-minute interval that accelerates from sprint to dash speeds. Base, sprint, and dash speeds are detailed in Table 1 and increment 1 m/min higher every 2 weeks. (B) Percent completion of training program at baseline and at end point in those mice that initially failed to complete at least 95% of their baseline program, N = 7. Muscle Histology NADH staining was performed on 10-µm frozen muscle sections. Sections were submerged in a solution containing 1 mg/mL NADH (Sigma, St Louis, MO), 1 mg/mL Nitro Blue Tetrazolium (VWR #TCD0844), and 0.2 M Tris–HCl buffer at pH 7.4 for 45 minutes at 37°C. Sections were then immersed in a series of acetone baths (30%, 60%, 90%, 60%, 30% v/v), rinsed in distilled water for 1 minute, and dehydrated by immersing in ethanol (95%, 100%, 100% v/v) and xylene (2 × 100% v/v) for 1 minute each, before finally mounting a cover slip with Cytoseal (Fisher #23-244257). A blinded investigator identified and tallied fiber types and also measured cross-sectional area of the fibers using Motic software (Motic, Hong Kong). Mitochondrial Biomass Total DNA was isolated from soleus and anterior tibialis muscle using a Qiagen Tissue Quick mini-prep kit (Qiagen, Germantown, MD). Primers were designed to amplify mitochondrial DNA (forward: CCGCAAGGGAAAGATGAAAGA, reverse: TCGTTTGGTTTCGGGGTTTC) and nuclear DNA (hexokinase gene, forward: CCCTGTCATGTCCCTTTGTT, reverse: GCCACCAGCTCAGTTAAAGG) and amplified using quantitative PCR (LightCycler 2.0, Roche). Mitochondrial Activity To isolate mitochondria, soleus muscle was homogenized using a conical glass homogenizer in 10 mL of Chappel-Perry isolation medium (100 mM KCL, 50 mM Tris–HCl, 5 mM MgCl2, 1 mM ATP, 1 mM EGTA, pH 7.5). Homogenate was then filtered through gauze and centrifuged 10 minutes at 900g. Supernatant was next centrifuged for 10 minutes at 9,000g, and the pellet was washed once with 15 mL of SHE medium (250 mM sucrose, 10 mM Hepes, 1 mM EGTA, pH 7.2). Finally, the supernatant was centrifuged for 10 minutes at 9,000g, and the resultant pellet was suspended in 100 μL of SHE medium. Protein concentration was determined using a Bradford assay. Complex IV activity was determined by adding 1 μg of mitochondria into a cuvette containing 1 mL of reaction buffer (10 mM KH2PO4, 250 mM sucrose, 1 mg/mL bovine serum albumin, 10 µM reduced cytochrome C [reduced using sodium hydrosulfite], 2.5 mM lauryl maltoside, pH 6.5). Activity was determined as the rate of decline in absorbance at 412 nM. Citrate activity was determined by adding 1 μg of mitochondria extract into a cuvette containing 500 μL of reaction buffer (100 mM Tris, 2 mM DTNB [5,5-dithio-bis-2-nitrobenzoic acid], 4 mM oxaloacetic acid, 1 mM acetyl Co-A, pH 8.0). Activity was determined as the rate of increase in absorbance at 412 nM. Total activity was complex IV activity normalized to citrate activity as the average of two to three trials of each per sample. Frailty and Frailty Intervention Assessment Value Determination Assessment of frailty in mice involves five parameters that are designed to mirror parameters used in human Fried frailty assessment (21). Similarly, we defined frailty in mice as those that fall below a cutoff in three or more parameters and prefrailty below a cutoff in one or two parameters. The first parameter is weight loss, with a cutoff of losing >5% body weight during a 1-week period. The next four parameters include cutoffs greater than 1.5 SD below the control group mean (15). These parameters include grip strength, activity levels, gait speed, and endurance, which are derived from the grip force meter, quadrant crossings in the activity monitor, gait speed analysis, and treadmill endurance, respectively. The frailty intervention assessment value (FIAV) was determined as described previously (23). The score of the baseline assessment for each mouse (body weight change, grip force meter, quadrant crossings, gait speed analysis, and treadmill endurance) is converted to a Z score, which is the sample measurement minus the mean from all mice divided by the SD from all mice. The collective Z scores are summed to establish the baseline FIAV (FIAV1). End point FIAV (FIAV2) is similarly calculated from end point assessments, but calculated using the baseline mean and SD. Total FIAV score is thus the difference between FIAV2 and FIAV1. Statistics Statistical validation of comparisons between HIIT and sedentary groups was performed using a student’s t test (XLStat software, Addinsoft, New York, NY) with significance levels defined as (*) < .05, (**) < .01, (***) < .001, and (****) < .0001. Two-way analysis of variance, followed by post hoc Tukey’s multiple comparisons test, was applied to analyze differences between young sedentary, old sedentary, and old HIIT, where applicable. All data were screened for potential outliers using a Grubb’s test with a significance cutoff of 0.05. Data are provided with SD where applicable. Results Exercise Model for High Intensity Interval Training The HIIT program was carried out on an inclined treadmill (25°). Initially, baseline uphill sprint assessments were used to assign mice to one of three intensity groups for training (Table 1). The HIIT program consists of a warm-up period followed by four alternating intensity intervals (Figure 1A). The 10-minute program was administered to mice 3 days a week over 16 weeks with an increase in intensity every 2 weeks. Over the course of the experiment, three mice were reassigned to greater-intensity groups and three to lesser-intensity groups based on performance (see Materials and Methods), with all but one doing so within the first 2 weeks. Initially, 7 of the 12 mice in the HIIT group were not able to complete the baseline exercise program before reaching exhaustion (completing on average 30.4% ± 12.6%). Following 16 weeks of HIIT exercise, these seven mice were retested on the baseline exercise program and completed 79.3% ± 26.9%, p = .0064 (Figure 1B). Body Weight and Composition Analysis As there is a natural decline in body weight as mice reach advanced ages (24,25), we set out to understand how HIIT might alter this natural progression. Interestingly, we did identify a deviation in the pattern of decline, as HIIT mice exhibited greater body weight at two time points (Week 10: HIIT 33.3 ± 4.0 g vs SED 30.3 ± 1.9 g, p = .0283, and Week 12: HIIT 32.8 ± 3.3 g vs SED 29.9 ± 1.3 g, p = .0097). Yet after 16 weeks of HIIT, our data reveal a similar decline in overall body weight in both HIIT and SED groups (HIIT 5.3 ± 3.7 g vs SED 5.4 ± 3.0 g; Figure 2A). Despite no difference in body weight change, HIIT exercised mice consumed more food than did mice in the SED group (HIIT 9.9 ± 0.5 kcal/mouse/day vs 9.3 ± 0.6 kcal/mouse/day, p = .0155; Figure 2B). We also performed dual X-ray absorptiometry at baseline and end point (DEXA; Figure 2C and D) to assess changes in bone mineral density, body fat percentage, and lean mass. We did not detect a significant difference in end point bone mineral density between HIIT and SED mice (Supplementary Figure S1); however, p values for greater bone mineral density after 16 weeks were 0.06 and 0.12 in HIIT mice and SED mice, respectively. Surprisingly, we observed a decline in body fat % in SED mice (Week 0: 21.7 ± 3.3% vs Week 16: 16.5 ± 3.1%, p = .0020), yet we did not observe such a decline in body fat % in HIIT mice (Week 0: 20.9 ± 7.1% vs Week 16: 17.8 ± 3.8%, p = .13). Both SED and HIIT mice exhibited a decline in total lean mass (SED Week 0: 26.8 ± 1.6 g vs Week 16: 23.9 ± 1.7 g, p = .0003 and HIIT Week 0: 27.0 ± 1.8 g vs Week 16: 24.2 ± 2.8 g, p = .0071). Figure 2. View largeDownload slide High intensity interval training (HIIT) exercise increases muscle mass in aged mice. Measurement of bodyweight (A) and average daily caloric intake (B) in sedentary and HIIT training mice over 16 weeks. At baseline and end point, body fat % (C) and total lean mass (D) were determined using DEXA. Following sacrifice, soleus and extensor digitorum longus (EDL) muscles were isolated and weighed (E). Heart weight was also determined from experimental cohorts and 10-month-old young sedentary mice (F). Figure 2. View largeDownload slide High intensity interval training (HIIT) exercise increases muscle mass in aged mice. Measurement of bodyweight (A) and average daily caloric intake (B) in sedentary and HIIT training mice over 16 weeks. At baseline and end point, body fat % (C) and total lean mass (D) were determined using DEXA. Following sacrifice, soleus and extensor digitorum longus (EDL) muscles were isolated and weighed (E). Heart weight was also determined from experimental cohorts and 10-month-old young sedentary mice (F). Despite the similar declines in total lean mass, tissue analysis following sacrifice revealed that HIIT mice exhibit greater soleus muscle mass (HIIT 9.4 ± 1.7 mg vs SED 7.3 ± 1.0 mg, n = 12, p = .0013) and extensor digitorum longus muscle mass (HIIT 12.2 ± 1.2 mg vs SED 10.8 ± 1.0 mg, n = 9 and 6, p = .0334; Figure 2E). Heart size was not significantly different between SED and HIIT exercised mice (p = .40; Figure 2F). However, relative to sedentary young mice, old SED mice exhibit significantly greater heart size (young 143.6 ± 20.9 mg vs old SED 170.8 ± 12.7 mg, n = 7 and 6, p = .0150), whereas HIIT exercised older mice do not (young 143.6 ± 20.9 mg vs HIIT 158.6 ± 15.4 mg, n = 7 and 11, p = .19). Physical Performance Assessments HIIT results in physical performance gains in human studies yet the nature of the improvement (i.e. maximal strength, anaerobic/aerobic capacity, balance and coordination, etc.) is not entirely understood. To capture a physical performance profile, we undertook a battery of assessments at baseline and end point following 16 weeks of HIIT (Figure 3). Our data reveal marked improvement in grip strength (HIIT 10.9 ± 7.7% vs SED −3.9 ± 10.8%, p = .0016), gait speed (HIIT 107.0 ± 51.5% vs SED 39.0 ± 29.0%, p = .0009), and treadmill endurance (HIIT 32.6 ± 24.8% vs SED −2.0 ± 14.4%, p = .0004). We also developed an uphill sprint assessment protocol to further elucidate changes in anaerobic capacity and found that HIIT-trained mice also improved (HIIT 29.3 ± 34.0% vs −15.6 ± 37.0%, p = .0052). In addition, the end point grip strength, treadmill endurance, uphill sprint, and gait speed performance in HIIT equaled or exceeded the performance of younger sedentary mice (Supplementary Table S1). However, benefits were not observed across all domains of physical performance as we did not observe improvement in rotarod performance (HIIT −4.8 ± 16.4% vs SED 12.4 ± 33.4%, p = .12) or open field crossings between quadrants (HIIT −20.9 ± 33.8% vs SED −5.9 ± 39.4%, p = .33). Figure 3. View largeDownload slide Improvement of physical performance in high intensity interval training (HIIT) exercised mice. At baseline and end point, mice were assessed in several domains of physical performance, including grip strength meter (best three of five trials), gait speed (top two of three times to move 1 m), treadmill endurance, uphill sprint, rotarod (best two of three trials), and quadrant crossings during 30 minutes of open field activity. Figure 3. View largeDownload slide Improvement of physical performance in high intensity interval training (HIIT) exercised mice. At baseline and end point, mice were assessed in several domains of physical performance, including grip strength meter (best three of five trials), gait speed (top two of three times to move 1 m), treadmill endurance, uphill sprint, rotarod (best two of three trials), and quadrant crossings during 30 minutes of open field activity. Analysis of Muscle Cell and Mitochondrial Quality To characterize the underlying physiology driving physical performance phenotypes, we performed NADH histological analysis of anterior tibialis muscle (Figure 4A). Darker stained fibers correspond to increased amounts of NADH and corresponding greater aerobic capacity. First, we compared the cross-sectional area in the muscle fibers (Figure 4B) and found HIIT mice exhibited larger light stained muscle fibers than SED mice (HIIT 5,043.5 ± 717.2 μm2 vs SED 4,282.9 ± 606.5 μm2, n = 11 and 12, p = .0119). However, we did not identify a statistically significant difference in the size of the dark-stained fibers in these mice (HIIT 2,222.4 ± 444.5 μm2 vs SED 2,077.4 ± 237.1 μm2, n = 11 and 12, p = .33). Next, we determined the relative percentage of dark, intermediate, and light stained fibers (Figure 4C) and found that muscles from HIIT mice exhibited a greater number of dark fibers than did SED mice (HIIT 17.1 ± 4.4% vs SED 12.3 ± 3.4%, p = .0081) and fewer light stained fibers (HIIT 30.2 ± 9.7% vs SED 38.5 ± 7.7%, p = .0322), which is indicative of greater aerobic capacity. Figure 4. View largeDownload slide High intensity interval training (HIIT) alters muscle fiber type and mitochondrial biomass. Cross-sectional slices of tibialis anterior muscle from sedentary (SED) and HIIT mice were analyzed histologically using NADH staining (A). Images were analyzed with Motic software to determine fiber cross-sectional area (B) and distribution of light, intermediate, and dark-stained fibers (C). Mitochondrial biomass was determined via quantitative PCR analysis of whole DNA purified from either soleus or tibialis anterior muscle (D). In addition, mitochondria were isolated from soleus muscle allowing for determination of complex IV activity as normalized to citrate synthase activity (E). Figure 4. View largeDownload slide High intensity interval training (HIIT) alters muscle fiber type and mitochondrial biomass. Cross-sectional slices of tibialis anterior muscle from sedentary (SED) and HIIT mice were analyzed histologically using NADH staining (A). Images were analyzed with Motic software to determine fiber cross-sectional area (B) and distribution of light, intermediate, and dark-stained fibers (C). Mitochondrial biomass was determined via quantitative PCR analysis of whole DNA purified from either soleus or tibialis anterior muscle (D). In addition, mitochondria were isolated from soleus muscle allowing for determination of complex IV activity as normalized to citrate synthase activity (E). To further explore potential changes in aerobic capacity, we assessed changes in mitochondrial biomass due to HIIT by analyzing whole DNA extracts from both soleus and anterior tibialis muscles using qPCR (Figure 4D). As expected, we found greater amounts of mitochondrial DNA (normalized to nuclear DNA) in both soleus and anterior tibialis muscles of HIIT exercised mice (soleus, HIIT 1.32 ± 0.07 vs SED 1.21 ± 0.10, p = .0048; TA, HIIT 1.35 ± 0.10 vs SED 1.22 ± 0.10, p = .0110). Biochemical analysis of complex IV activity and citrate activity revealed no statistically significant differences in normalized activity (complex IV activity/citrate activity: HIIT 1.93 ± 0.78 vs SED 1.48 ± 0.45, p = .11); Figure 4E. Reduction of Frailty The Fried scale characterizes frailty in humans using the following five parameters: weight loss (>5% in 1 year), weakness (grip strength), slow walking speed, self-reported exhaustion, and low physical activity (21). Individuals identified as possessing three or more of these parameters were considered frail, whereas having one or two is prefrail, and both frail and prefrail individuals showed greater risk of worsening mobility, risk of hospitalization, disability, and death (21). We utilized mouse equivalents of these parameters in the assessment of frailty in aged mice. Frailty cutoff parameters included weight loss (>5% weight loss over 1 week), grip strength (grip force meter, <1.5 SD below group mean), gait speed (<1.5 SD below group mean), exhaustion (treadmill endurance, <1.5 SD below group mean), and low activity (open field crossing activity, <1.5 SD below group mean). Using this mouse frailty assessment tool, we detected three prefrail (below cutoff on one or two parameters) mice in the sedentary group (Figure 5A), and we detected one frail mouse (below cutoff on greater than three parameters) and five prefrail mice in the HIIT exercise group (Figure 5B) at baseline. Of the eight mice that were frail or prefrail, six were below cutoff in grip strength, four in activity, two in endurance, and two in gait speed (Supplementary Tables S2 and S3). After 16 weeks, five of the six frail or prefrail mice in the HIIT group markedly improved, with four mice improving to a robust state (exhibiting no frailty parameters below cutoff). Several mice that were previously robust declined in both groups, and at the end point, there were three sedentary and four HIIT mice that were prefrail with no mice in either group being frail. Figure 5. View largeDownload slide High intensity interval training (HIIT) improves frailty status. Frailty status for sedentary (A) and HIIT (B) mice was determined at baseline and end point as falling below cutoff on three or more of the following parameters: weight loss, poor grip strength, poor endurance, slow gait speed, and low activity. Letters denote individual mice that either improve (solid line) or worsen (dashed line) over 16 weeks, and only mice with frailty scores greater than 0 are shown in this analysis. Frailty intervention assessment value (FIAV) was also determined as the difference of end point (FIAV2) minus baseline (FIAV1) performance scores (C). We found baseline frailty scores correlated with FIAV1 (p = .016; D), but not end point frailty scores with FIAV2 (p = .06; E). Figure 5. View largeDownload slide High intensity interval training (HIIT) improves frailty status. Frailty status for sedentary (A) and HIIT (B) mice was determined at baseline and end point as falling below cutoff on three or more of the following parameters: weight loss, poor grip strength, poor endurance, slow gait speed, and low activity. Letters denote individual mice that either improve (solid line) or worsen (dashed line) over 16 weeks, and only mice with frailty scores greater than 0 are shown in this analysis. Frailty intervention assessment value (FIAV) was also determined as the difference of end point (FIAV2) minus baseline (FIAV1) performance scores (C). We found baseline frailty scores correlated with FIAV1 (p = .016; D), but not end point frailty scores with FIAV2 (p = .06; E). The frailty intervention assessment value (FIAV) is a composite score designed to provide objective determination of the benefits of an intervention (23). Total FIAV represents the difference between baseline (FIAV1) and end point (FIAV2) scores, which are separately calculated as the sum of the differences between an individual animal’s aggregate performance score and the mean, divided by the SD. Using FIAV analyses, we found HIIT-trained mice had a larger increase in FIAV relative to sedentary controls (7.3 ± 4.4 vs 1.7 ± 3.9, p = .0031; Figure 5C). To further understand the relationship between frailty and FIAV scores, we analyzed whether the two scores correlated at either baseline (Figure 5D) or end point (Figure 5E) and found frailty and FIAV were correlated at baseline (R2 = .24, p = .0161), but not at end point (R2 = .15, p = .06). Discussion Frailty is a condition associated with greater vulnerability to adverse outcomes, for which sarcopenia and declines in physical performance are significant contributors (2). Exercise is increasingly being looked at as an intervention for frailty (8,26–29), and a systematic review of eight clinical trials involving exercise in frail cohorts identified benefits, although the specific form (resistance training, endurance, etc.) that was most beneficial was unclear (28). Here we demonstrate that 10-minute-long HIIT sessions, involving 4 minutes of intense running and administered only 3 days a week, significantly enhanced physical performance and reduced markers of frailty in aged mice. Parameters chosen for the characterization of frailty in mice mirrored the human parameters utilized in Fried and colleagues (21). Baseline assessment of the 24-month-old mice (age equivalent of a 65- to 70-year-old human (30)) identified one frail mouse (4.1% of total) and eight prefrail (33.3%) mice, which is consistent with the percentage of frailty (~3.7%) and prefrailty (~41.5%) in 65- to 74-year-old participants in the Cardiovascular Health Study (21). The most common parameters identified in our study were low grip strength (25%) and low activity (16.7%), whereas low grip strength (20%) and low endurance (24%) were identified in a clinical study of prefrail older individuals (31). The 16 weeks of HIIT reduced frailty parameters in five of the six HIIT mice that were frail or prefrail at baseline, demonstrating both the ability to conduct frailty analysis in aged mice and to detect the benefits of HIIT for frailty. The utility of HIIT for maintaining or improving functional capacity in healthy older individuals is increasingly being examined (32,33), as is the possibility that HIIT is beneficial in those with comorbidities (34). The present study raises the possibility that HIIT administered in a progressive manner and that is tailored to the individual may be beneficial as part of a therapeutic strategy in frailty in humans. Interestingly, 3 of the 12 (25%) HIIT mice failed to improve or worsened to a prefrail state, yet none of these mice exhibited more than one parameter below cutoff. This may be a reflection of the dynamic state of frailty. Interestingly there existed a natural fluctuation between robust and prefrail states in a community-dwelling elderly adults (35). This notion also partially explains the improvement of two prefrail SED mice to robust. Frailty status did not substantially decline in the SED mice as they aged; however, this may be due to the relatively limited time span of the study. Future studies to monitor frailty status until death may be necessary to better understand frailty progression in mice. Two studies have demonstrated that individualized high intensity exercises improved Barthel activities of daily-living (36) index scores (37,38). Here we demonstrate that HIIT increases FIAV scores in aged mice, which has been described as a mouse equivalent to the Barthel ADL index (23). Interestingly, although HIIT mice exhibited statistically significantly greater FIAV improvement than SED mice, our data show both HIIT and SED mice had greater FIAV scores at end point. These unexpected gains in the SED mice may be due to a learning effect in gait speed performance. We also found that the baseline FIAV score correlated with baseline frailty assessment, but the end point FIAV score narrowly missed attaining a statistically significant correlation with the end point frailty assessment. This finding suggests a close relationship between the two tools, yet our understanding of the utility and predictive power of mouse frailty or FIAV analysis would be strengthened by additional studies that identify correlations with survival and/or underlying pathology (14). The use of low time commitment exercise regimens is gaining traction as an alternative to traditional exercise since “lack of time” is a significant contributor to poor participation (6). Short exercise strategies that have improved health outcomes include single 4-minute bouts at 90% of maximal heart rate three times a week (7), three to six bouts of 30 seconds at max intensity (39), and even just three bouts of 20 seconds three times a week (40). Similarly, our exercise program yielded cellular, tissue, and functional benefits with only 4 minutes of high intensity exercise three times a week. Others have demonstrated benefits of HIIT in rats and mice (36,41–43), yet to our knowledge, our protocol is the first to use HIIT with aged animals. Importantly, this study adds to the growing body of literature that suggests aged organisms respond well to exercise. Despite the short exercise times, we identified benefits that are consistent with other studies involving regular exercise in aged animals including increases in muscle mass and strength (44), grip strength (45), and mitochondrial biomass (46). We also identified increases in muscle cross-sectional area that are observed in human trials using HIIT (47). Open field activity did not improve in HIIT mice, which is surprising given the improvements in gait speed and treadmill performance. However, this finding is similar to two other studies involving forced exercise protocols (48,49). Although the possibility that forced exercise is not beneficial to exploratory behavior in mice exists, examination of other forms of voluntary physical activity would aid understanding of this phenomenon. The lack of significant differences in body fat is also surprising in light of reported benefits of HIIT as reviewed by Boutcher (50). However, HIIT may not always reduce body fat (51), and the loss of body fat in our study may have been masked by the natural decline that occurs in mice during middle and advanced ages (52). The benefits of HIIT in humans is well reviewed (1,53), yet there is some concern whether HIIT is safe during advanced ages (51) and whether HIIT might induce physiological strain (54). Likewise, strength training also increases strength in frail older persons (55), but such exercise may raise the concern for risk of fracture or other injury (56). Injury concerns and overestimation of the effort to get involved in exercise programs are common barriers to exercise for older individuals, which might lead to inactivity and contribute to frailty progression (57). Thus, to avoid potential injury and increase participation, a successful exercise regimen should be tailored to the individual and be adapted as the individual improves. Therefore, for our exercise protocol, we assigned mice to one of the three groups with increasing intensity depending on the baseline exercise capacity of each mouse. We also increased or decreased training intensity based on the ongoing performance of the mouse. Following the 4-month exercise protocol, mouse mortality rates were comparable to sedentary animals, and no animals died or were injured during the exercise protocol. These findings are consistent with the evidence that HIIT is safe for both healthy and frail older adults (8,9,27) and also supports individually tailoring exercise programs (58). Conclusions Our study demonstrates that a 10-minute, three times a week, 4-month progressive HIIT protocol improves frailty status in aged mice. Physical performance improved across multiple domains (strength, endurance, gait speed), but not all (balance and coordination and spontaneous activity). HIIT also improved underlying physiology including greater muscle mass, fiber cross-sectional area, and mitochondrial biomass. Our study demonstrates the feasibility and benefits of HIIT during aging and provides a framework to examine combinatorial therapeutic strategies that might further enhance these benefits. Furthermore, these findings suggest that tailoring progressive exercise protocols to the individual may offer a strategy for the safe improvement of health span in frail older adults. Supplementary Material Supplementary data is available at The Journals of Gerontology, Series A: Biological Sciences and Medical Sciences online. Funding This work was funded by Veteran Affairs Rehabilitation Research and Development Grant RX001066 and the Indian Trail Foundation. Acknowledgments We thank Claudia Recinos, Reema Sutton, and Jessica Reynolds for editorial and administrative support. We also thank Kathleen Thaler and the veterinary and animal facility staff at the Buffalo Laboratory Animal Facility and the Buffalo CTRC. Conflict of Interest None reported. References 1. Zembroń-Łacny A, Dziubek W, Rogowski Ł, Skorupka E, Dąbrowska G. Sarcopenia: monitoring, molecular mechanisms, and physical intervention. Physiol Res . 2014; 63: 683– 691. Google Scholar PubMed  2. Fried LP. Interventions for human frailty: physical activity as a model. Cold Spring Harb Perspect Med . 2016; 6:a025916. doi: 10.1101/cshperspect.a025916 3. Centers for Disease Control and Prevention. Adult participation in aerobic and muscle-strengthening physical activities – United States, 2011. MMWR Morb Mortal Wkly Rep . 2013; 62: 326– 330. PubMed  4. Centers for Disease Control and Prevention. Strength training among adults aged >/=65 years – United States, 2001. MMWR Morb Mortal Wkly Rep . 2004; 53: 25– 28. PubMed  5. Justine M, Azizan A, Hassan V, Salleh Z, Manaf H. Barriers to participation in physical activity and exercise among middle-aged and elderly individuals. Singapore Med J . 2013; 54: 581– 586. doi:10.11622/smedj.2013203 Google Scholar CrossRef Search ADS PubMed  6. Gillen JB, Gibala MJ. Is high-intensity interval training a time-efficient exercise strategy to improve health and fitness? Appl Physiol Nutr Metab . 2014; 39: 409– 412. doi: 10.1139/apnm-2013-0187 Google Scholar CrossRef Search ADS PubMed  7. Tjønna AE, Leinan IM, Bartnes ATet al.   Low- and high-volume of intensive endurance training significantly improves maximal oxygen uptake after 10-weeks of training in healthy men. PLoS One . 2013; 8: e65382. doi: 10.1371/journal.pone.0065382 Google Scholar CrossRef Search ADS PubMed  8. Fiatarone MA, Marks EC, Ryan ND, Meredith CN, Lipsitz LA, Evans WJ. High-intensity strength training in nonagenarians. Effects on skeletal muscle. JAMA . 1990; 263: 3029– 3034. doi:10.1001/jama.1990.03440220053029 Google Scholar CrossRef Search ADS PubMed  9. Verney J, Kadi F, Saafi MA, Piehl-Aulin K, Denis C. Combined lower body endurance and upper body resistance training improves performance and health parameters in healthy active elderly. Eur J Appl Physiol . 2006; 97: 288– 297. doi: 10.1007/s00421-006-0175-z Google Scholar CrossRef Search ADS PubMed  10. Bruseghini P, Calabria E, Tam Eet al.   Effects of eight weeks of aerobic interval training and of isoinertial resistance training on risk factors of cardiometabolic diseases and exercise capacity in healthy elderly subjects. Oncotarget . 2015; 6: 16998– 17015. doi: 10.18632/oncotarget.4031 Google Scholar CrossRef Search ADS PubMed  11. Bell KE, Séguin C, Parise G, Baker SK, Phillips SM. Day-to-day changes in muscle protein synthesis in recovery from resistance, aerobic, and high-intensity interval exercise in older men. J Gerontol A Biol Sci Med Sci . 2015; 70: 1024– 1029. doi: 10.1093/gerona/glu313 Google Scholar CrossRef Search ADS PubMed  12. Sculthorpe N, Herbert P, Grace FM. Low-frequency high-intensity interval training is an effective method to improve muscle power in lifelong sedentary aging men: a randomized controlled trial. J Am Geriatr Soc . 2015; 63: 2412– 2413. doi: 10.1111/jgs.13863 Google Scholar CrossRef Search ADS PubMed  13. Knowles AM, Herbert P, Easton C, Sculthorpe N, Grace FM. Impact of low-volume, high-intensity interval training on maximal aerobic capacity, health-related quality of life and motivation to exercise in ageing men. Age . 2015; 37: 25. doi: 10.1007/s11357-015-9763-3 Google Scholar CrossRef Search ADS PubMed  14. Seldeen KL, Pang M, Troen BR. Mouse Models of Frailty: an Emerging Field. Curr Osteoporos Rep . 2015; 13: 280– 286. doi: 10.1007/s11914-015-0283-y Google Scholar CrossRef Search ADS PubMed  15. Liu H, Graber TG, Ferguson-Stegall L, Thompson LV. Clinically relevant frailty index for mice. J Gerontol A Biol Sci Med Sci . 2014; 69: 1485– 1491. doi: 10.1093/gerona/glt188 Google Scholar CrossRef Search ADS PubMed  16. Whitehead JC, Hildebrand BA, Sun Met al.   A clinical frailty index in aging mice: comparisons with frailty index data in humans. J Gerontol A Biol Sci Med Sci . 2014; 69: 621– 632. doi: 10.1093/gerona/glt136 Google Scholar CrossRef Search ADS PubMed  17. Gomez-Cabrera MC, Garcia-Valles R, Rodriguez-Mañas Let al.   A new frailty score for experimental animals based on the clinical phenotype: inactivity as a model of frailty. J Gerontol A Biol Sci Med Sci . 2017; 72: 885– 891. doi: 10.1093/gerona/glw337 Google Scholar CrossRef Search ADS PubMed  18. Kane AE, Howlett SE. Advances in preclinical models of frailty. J Gerontol A Biol Sci Med Sci . 2017; 72: 867– 869. doi: 10.1093/gerona/glx072 Google Scholar CrossRef Search ADS PubMed  19. Kane AE, Huizer-Pajkos A, Mach Jet al.   A comparison of two mouse frailty assessment tools. J Gerontol A Biol Sci Med Sci . 2017; 72: 904– 909. doi: 10.1093/gerona/glx009 Google Scholar CrossRef Search ADS PubMed  20. Miller MG, Thangthaeng N, Shukitt-Hale B. A clinically relevant frailty index for aging rats. J Gerontol A Biol Sci Med Sci . 2017; 72: 892– 896. doi: 10.1093/gerona/glw338 Google Scholar CrossRef Search ADS PubMed  21. Fried LP, Tangen CM, Walston Jet al.  ; Cardiovascular Health Study Collaborative Research Group. Frailty in older adults: evidence for a phenotype. J Gerontol A Biol Sci Med Sci . 2001; 56: M146– M156. doi:10.1093/gerona/56.3.M146 Google Scholar CrossRef Search ADS PubMed  22. Justice JN, Carter CS, Beck HJet al.   Battery of behavioral tests in mice that models age-associated changes in human motor function. Age . 2014; 36: 583– 592. doi: 10.1007/s11357-013-9589-9 Google Scholar CrossRef Search ADS PubMed  23. Graber TG, Ferguson-Stegall L, Liu H, Thompson LV. Voluntary aerobic exercise reverses frailty in old mice. J Gerontol A Biol Sci Med Sci . 2015; 70: 1045– 1058. doi: 10.1093/gerona/glu163 Google Scholar CrossRef Search ADS PubMed  24. Anisimov VN, Piskunova TS, Popovich IGet al.   Gender differences in metformin effect on aging, life span and spontaneous tumorigenesis in 129/Sv mice. Aging . 2010; 2: 945– 958. doi: 10.18632/aging.100245 Google Scholar CrossRef Search ADS PubMed  25. Dubrovsky YV, Samsa WE, Kondratov RV. Deficiency of circadian protein CLOCK reduces lifespan and increases age-related cataract development in mice. Aging . 2010; 2: 936– 944. doi: 10.18632/aging.100241 Google Scholar CrossRef Search ADS PubMed  26. Cesari M, Vellas B, Hsu FCet al.  ; LIFE Study Group. A physical activity intervention to treat the frailty syndrome in older persons-results from the LIFE-P study. J Gerontol A Biol Sci Med Sci . 2015; 70: 216– 222. doi: 10.1093/gerona/glu099 Google Scholar CrossRef Search ADS PubMed  27. Fiatarone MA, O’Neill EF, Ryan NDet al.   Exercise training and nutritional supplementation for physical frailty in very elderly people. N Engl J Med . 1994; 330: 1769– 1775. doi: 10.1056/NEJM199406233302501 Google Scholar CrossRef Search ADS PubMed  28. Giné-Garriga M, Roqué-Fíguls M, Coll-Planas L, Sitjà-Rabert M, Salvà A. Physical exercise interventions for improving performance-based measures of physical function in community-dwelling, frail older adults: a systematic review and meta-analysis. Arch Phys Med Rehabil . 2014; 95: 753– 769.e3. doi: 10.1016/j.apmr.2013.11.007 Google Scholar CrossRef Search ADS PubMed  29. Pahor M, Guralnik JM, Ambrosius WTet al.  ; LIFE Study Investigators. Effect of structured physical activity on prevention of major mobility disability in older adults: the LIFE study randomized clinical trial. JAMA . 2014; 311: 2387– 2396. doi: 10.1001/jama.2014.5616 Google Scholar CrossRef Search ADS PubMed  30. Flurkey KCJ, Harrison DE. The mouse in aging research. In: Fox JG, Barthold S, Davisson M, Newcomer CE, Quimby FW, Smith A, eds. The Mouse in Biomedical Research . Burlington, MA: Elsevier; 2007: 637– 672. 31. Drey M, Pfeifer K, Sieber CC, Bauer JM. The Fried frailty criteria as inclusion criteria for a randomized controlled trial: personal experience and literature review. Gerontology . 2011; 57: 11– 18. doi: 10.1159/000313433 Google Scholar CrossRef Search ADS PubMed  32. Herbert P, Hayes LD, Sculthorpe Net al.   High-intensity interval training (HIIT) increases insulin-like growth factor-I (IGF-I) in sedentary aging men but not masters’ athletes: an observational study. Aging Male . 2016: 20: 54– 59. doi: 10.1080/13685538.2016.1260108 Google Scholar CrossRef Search ADS PubMed  33. Hwang CL, Yoo JK, Kim HKet al.   Novel all-extremity high-intensity interval training improves aerobic fitness, cardiac function and insulin resistance in healthy older adults. Exp Gerontol . 2016; 82: 112– 119. doi: 10.1016/j.exger.2016.06.009 Google Scholar CrossRef Search ADS PubMed  34. Guadalupe-Grau A, Aznar-Laín S, Mañas Aet al.   Short- and long-term effects of concurrent strength and HIIT training in octogenarians with COPD. J Aging Phys Act . 2017; 25: 105– 115. doi: 10.1123/japa.2015-0307 Google Scholar CrossRef Search ADS PubMed  35. Gill TM, Gahbauer EA, Allore HG, Han L. Transitions between frailty states among community-living older persons. Arch Intern Med . 2006; 166: 418– 423. doi: 10.1001/archinte.166.4.418 Google Scholar CrossRef Search ADS PubMed  36. Hafstad AD, Lund J, Hadler-Olsen E, Höper AC, Larsen TS, Aasum E. High- and moderate-intensity training normalizes ventricular function and mechanoenergetics in mice with diet-induced obesity. Diabetes . 2013; 62: 2287– 2294. doi: 10.2337/db12-1580 Google Scholar CrossRef Search ADS PubMed  37. Lindelöf N, Rosendahl E, Gustafsson S, Nygaard J, Gustafson Y, Nyberg L. Perceptions of participating in high-intensity functional exercise among older people dependent in activities of daily living (ADL). Arch Gerontol Geriatr . 2013; 57: 369– 376. doi: 10.1016/j.archger.2013.05.003 Google Scholar CrossRef Search ADS PubMed  38. Toots A, Littbrand H, Lindelöf Net al.   Effects of a high-intensity functional exercise program on dependence in activities of daily living and balance in older adults with dementia. J Am Geriatr Soc . 2016; 64: 55– 64. doi: 10.1111/jgs.13880 Google Scholar CrossRef Search ADS PubMed  39. Place N, Ivarsson N, Venckunas Tet al.   Ryanodine receptor fragmentation and sarcoplasmic reticulum Ca2+ leak after one session of high-intensity interval exercise. Proc Natl Acad Sci USA . 2015; 112: 15492– 15497. doi: 10.1073/pnas.1507176112 Google Scholar CrossRef Search ADS PubMed  40. Gillen JB, Martin BJ, MacInnis MJ, Skelly LE, Tarnopolsky MA, Gibala MJ. Twelve weeks of sprint interval training improves indices of cardiometabolic health similar to traditional endurance training despite a five-fold lower exercise volume and time commitment. PLoS One . 2016; 11: e0154075. doi: 10.1371/journal.pone.0154075 Google Scholar CrossRef Search ADS PubMed  41. Hafstad AD, Boardman NT, Lund Jet al.   High intensity interval training alters substrate utilization and reduces oxygen consumption in the heart. J Appl Physiol . 2011; 111: 1235– 1241. doi: 10.1152/japplphysiol.00594.2011 Google Scholar CrossRef Search ADS PubMed  42. Perry CG, Heigenhauser GJ, Bonen A, Spriet LL. High-intensity aerobic interval training increases fat and carbohydrate metabolic capacities in human skeletal muscle. Appl Physiol Nutr Metab . 2008; 33: 1112– 1123. doi: 10.1139/H08-097 Google Scholar CrossRef Search ADS PubMed  43. Cho J, Kim S, Lee Set al.   Effect of training intensity on nonalcoholic fatty liver disease. Med Sci Sports Exerc . 2015; 47: 1624– 1634. doi: 10.1249/MSS.0000000000000595 Google Scholar CrossRef Search ADS PubMed  44. Ko IG, Jeong JW, Kim YHet al.   Aerobic exercise affects myostatin expression in aged rat skeletal muscles: a possibility of antiaging effects of aerobic exercise related with pelvic floor muscle and urethral rhabdosphincter. Int Neurourol J . 2014; 18: 77– 85. doi: 10.5213/inj.2014.18.2.77 Google Scholar CrossRef Search ADS PubMed  45. Garcia-Valles R, Gomez-Cabrera MC, Rodriguez-Mañas Let al.   Life-long spontaneous exercise does not prolong lifespan but improves health span in mice. Longev Healthspan . 2013; 2: 14. doi: 10.1186/2046-2395-2-14 Google Scholar CrossRef Search ADS PubMed  46. Kang C, Chung E, Diffee G, Ji LL. Exercise training attenuates aging-associated mitochondrial dysfunction in rat skeletal muscle: role of PGC-1α. Exp Gerontol . 2013; 48: 1343– 1350. doi: 10.1016/j.exger.2013.08.004 Google Scholar CrossRef Search ADS PubMed  47. Osawa Y, Azuma K, Tabata Set al.   Effects of 16-week high-intensity interval training using upper and lower body ergometers on aerobic fitness and morphological changes in healthy men: a preliminary study. Open Access J Sports Med . 2014; 5: 257– 265. doi: 10.2147/OAJSM.S68932 Google Scholar CrossRef Search ADS PubMed  48. Fabene PF, Mariotti R, Navarro Mora G, Chakir A, Zancanaro C. Forced mild physical training-induced effects on cognitive and locomotory behavior in old mice. J Nutr Health Aging . 2008; 12: 388– 390. doi:10.1007/BF02982671 Google Scholar CrossRef Search ADS PubMed  49. Viidik A, Skalicky M. Influence of physical exercise on old rats: changes in patterns of spontaneous activity and connective tissues. Aging . 1997; 9: 64– 72. doi:10.1007/BF03340129 Google Scholar PubMed  50. Boutcher SH. High-intensity intermittent exercise and fat loss. J Obes . 2011; 2011: 868305. doi: 10.1155/2011/868305 Google Scholar CrossRef Search ADS PubMed  51. Keating SE, Machan EA, O’Connor HTet al.   Continuous exercise but not high intensity interval training improves fat distribution in overweight adults. J Obes . 2014; 2014: 834865. doi: 10.1155/2014/834865 Google Scholar CrossRef Search ADS PubMed  52. Hamrick MW, Ding KH, Pennington Cet al.   Age-related loss of muscle mass and bone strength in mice is associated with a decline in physical activity and serum leptin. Bone . 2006; 39: 845– 853. doi: 10.1016/j.bone.2006.04.011 Google Scholar CrossRef Search ADS PubMed  53. Raymond MJ, Bramley-Tzerefos RE, Jeffs KJ, Winter A, Holland AE. Systematic review of high-intensity progressive resistance strength training of the lower limb compared with other intensities of strength training in older adults. Arch Phys Med Rehabil . 2013; 94: 1458– 1472. doi: 10.1016/j.apmr.2013.02.022 Google Scholar CrossRef Search ADS PubMed  54. Buchheit M, Kuitunen S, Voss SC, Williams BK, Mendez-Villanueva A, Bourdon PC. Physiological strain associated with high-intensity hypoxic intervals in highly trained young runners. J Strength Cond Res . 2012; 26: 94– 105. doi: 10.1519/JSC.0b013e3182184fcb Google Scholar CrossRef Search ADS PubMed  55. Dirks ML, Tieland M, Verdijk LBet al.   Protein supplementation augments muscle fiber hypertrophy but does not modulate satellite cell content during prolonged resistance-type exercise training in frail elderly. J Am Med Dir Assoc . 2017;18(7):608–615. doi: 10.1016/j.jamda.2017.02.006 56. Taunton JE, Martin AD, Rhodes EC, Wolski LA, Donelly M, Elliot J. Exercise for the older woman: choosing the right prescription. Br J Sports Med . 1997; 31: 5– 10. doi:10.1136/bjsm.31.1.5 Google Scholar CrossRef Search ADS PubMed  57. Freiberger E, Kemmler W, Siegrist M, Sieber C. Frailty and exercise interventions: evidence and barriers for exercise programs. Z Gerontol Geriatr . 2016; 49: 606– 611. doi: 10.1007/s00391-016-1134-x Google Scholar CrossRef Search ADS PubMed  58. Mair JL, Nevill AM, De Vito G, Boreham CA. Personalised prescription of scalable high intensity interval training to inactive female adults of different ages. PLoS One . 2016; 11: e0148702. doi: 10.1371/journal.pone.0148702 Google Scholar CrossRef Search ADS PubMed  Published by Oxford University Press on behalf of The Gerontological Society of America 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The Journals of Gerontology Series A: Biomedical Sciences and Medical Sciences Oxford University Press

Loading next page...
 
/lp/ou_press/high-intensity-interval-training-improves-physical-performance-and-r0FEG0wF9F
Publisher
Oxford University Press
Copyright
Published by Oxford University Press on behalf of The Gerontological Society of America 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.
ISSN
1079-5006
eISSN
1758-535X
D.O.I.
10.1093/gerona/glx120
Publisher site
See Article on Publisher Site

Abstract

Abstract Sarcopenia and frailty are highly prevalent in older individuals, increasing the risk of disability and loss of independence. High intensity interval training (HIIT) may provide a robust intervention for both sarcopenia and frailty by achieving both strength and endurance benefits with lower time commitments than other exercise regimens. To better understand the impacts of HIIT during aging, we compared 24-month-old C57BL/6J sedentary mice with those that were administered 10-minute uphill treadmill HIIT sessions three times per week over 16 weeks. Baseline and end point assessments included body composition, physical performance, and frailty based on criteria from the Fried physical frailty scale. HIIT-trained mice demonstrated dramatic improvement in grip strength (HIIT 10.9% vs −3.9% in sedentary mice), treadmill endurance (32.6% vs −2.0%), and gait speed (107.0% vs 39.0%). Muscles from HIIT mice also exhibited greater mass, larger fiber size, and an increase in mitochondrial biomass. Furthermore, HIIT exercise led to a dramatic reduction in frailty scores in five of six mice that were frail or prefrail at baseline, with four ultimately becoming nonfrail. The uphill treadmill HIIT exercise sessions were well tolerated by aged mice and led to performance gains, improvement in underlying muscle physiology, and reduction in frailty. Sarcopenia, Muscle, Exercise, Mitochondria Men and women who are physically inactive are at greater risk for sarcopenia, a condition of lower muscle mass, quality, and function (1) that plays a pivotal role in the onset and progression of frailty (2). Despite well-established benefits of exercise in preventing sarcopenia, only 52% of adults aged 65 and older meet guidelines for aerobic activity (3) and only 12%–20% of adults older than 65 years routinely participate in strength training exercises (3,4). The most prevalent barrier to exercising reported in a survey involving older individuals (>60 years) is “not enough time” (5), suggesting that there would be greater participation in exercise modalities that achieve benefits with less time commitment. High intensity interval training (HIIT) exercise modalities encompass intense intervals alternated with periods of lower intensity for recovery, providing physiological benefits in less time than traditional exercise regimens (6). In particular, Tjønna and colleagues (7) demonstrated that a single 4-minute exercise session at 90% of maximal heart rate, three times a week over 10 weeks, improved VO2max in inactive but otherwise healthy 35- to 45-year-old men. Fiatarone and colleagues pioneered the use of HIIT as an intervention for those of advanced age, finding excellent tolerance, strength, and gait speed improvements, in frail nonagenarians (8). HIIT was also shown to be safe and effective in healthy 70-year-old men (9), and further studies identify a range of HIIT benefits in healthy older populations (>60 years old) that include quadriceps hypertrophy and cardiovascular improvement (10), enhancement of myofibrillar and sarcoplasmic proteins (11), greater muscle power (12), and improvement of health-related quality of life (13). However, the potential of HIIT as an intervention for frail older adults remains poorly understood. Animal models may provide a deeper understanding of the physiological benefits of exercise and have been used to model the impacts of advanced age. In particular, animal models are now emerging as tools to examine the progression and underlying mechanisms of frailty (14–19), and more recently, frailty was shown to predict survival in rats (20). Here we employ a novel HIIT program in aged mice and study the impacts on frailty status. Our findings reveal improvement across several domains of physical performance as well as underlying muscle physiology. Furthermore, we also identify improvement of frailty status as determined using a mouse frailty assessment tool with parameters that closely align to those used in the Fried physical frailty scale for humans (21). Materials and Methods Mice All studies and experimental protocols were approved by and in compliance with guidelines of the University at Buffalo and VA Western New York Healthcare System Animal Care and Use Committees. At all times mice were provided ad libitum access to chow/water and were individually housed. Twenty-two-month-old male C57BL/6 mice were acquired from the NIA aging mouse colony and at 24 months of age were randomly assigned to either sedentary (SED) or high intensity interval training (HIIT) groups (n = 12 for each group). Mice and chow from cages were weighed on a weekly basis. After 16 weeks, animals were sacrificed and heart, soleus, and extensor digitalis longus muscles were isolated and immediately weighed. In addition, 4-month-old C57BL/6 mice were acquired from Charles River Laboratories for physical performance assessments as a reference for performance in our aged cohorts (n = 19), and for which hearts were harvested (n = 7) and weighed following 16 weeks in similar housing as the aged cohorts. Dual-Energy X-ray Absorptiometry Analysis of bone mineral density, body fat %, and lean mass was performed using a Lunar PIXImus II (Inside Outside Sales, LLC., Fitchburg, WI). Animals were anesthetized and then analyzed with a single scan at baseline and end point. Physical Performance Assessment All assessments were performed by the same investigator who was blinded to the identity of the mice. In addition, the different assessments were performed in the same order over the course of 1 week at baseline and end point, and each was performed at the same time of day. Grip strength meter Mice were assessed in the best three of five trials whereby the mouse is placed on the force meter (Columbus Instruments, Columbus, OH) allowing all four limbs to grip the grid. The mouse is then pulled, whereas the body remains horizontal, until loss of grip. This process is repeated twice more with roughly 1 second between attempts, and the maximal score for the three attempts is recorded as the score for that trial. Trials are separated by no less than 10 seconds for rest (mouse left inactive on grip meter stage). Treadmill Mice are acclimated to the treadmill device (Exer 3/6, Columbus Instruments) 1 month prior to baseline assessments. Treadmill endurance assessment consists of one trial whereby the treadmill accelerates from 5 to 35 m/min over 60 minutes (increasing at a rate of 1 m/min per 2 minutes). End point occurs if the mouse touches the shock grid 10 times, receives 20 total shocks (if a mouse stays on the shock grid for multiple shocks), or runs a total of 120 minutes. To assess uphill sprint capacity, mice receive a 60-s warm up at 5 m/min and then run in intervals of 20 seconds starting at 7 m/min, then 10 m/min, and increase by 1 m/min thereafter—with 20-second periods of relative rest (belt at 5 m/min) between intervals. Trials end at exhaustion as defined by the mouse touching the shock grid three times or receiving seven total shocks. The treadmill is inclined at 25°, and assessment is performed as a single trial with the uphill sprint score being the speed (meter per minute) of the last completed interval prior to exhaustion. Gait speed analysis Gait speed analysis was performed on an apparatus that features an 8 cm wide × 12 cm tall × 1 m long channel that opens into a darkened “safe house” box (22). Mice were then scored on the quickest two of three trials whereby the mouse is placed at the start of the device and timed until the mouse reaches the “safe” house. Rotarod analysis Mice are acclimated 1 month prior to assessments. At each time point, mice are assessed in the best two of three trials whereby mice are timed until fall from the rotarod device (Med Associates Inc., Fairfax Vermont) as it accelerates from 4 to 40 revolutions/min over 300 seconds. The trial is stopped if the mouse falls, stays on the rotarod for 360 or more seconds, or the mouse retains a grip on the cylinder for two complete revolutions within 10 seconds. Mice are given no less than 15 minutes of rest in home cages between trials. Activity monitor Activity monitoring was performed as a single 30-minute trial on an eight-station device (Med Associates Inc.) that features infrared beams that track the mice over the time period and allow automated software (Med Associates Inc.) quantitation of quadrant crossings and total rearings. The experimenter was a minimum of 3 feet away from all mice during activity monitor assessments. Exercise Protocol Prior to initiating the exercise training protocol, mice were placed into various speed intensity groups based on baseline uphill sprint data (Table 1). High intensity interval training exercise was performed on an inclined treadmill (25°) using a custom program of 10 minutes, starting with a 3-minute warm-up period at base speed (Table 1), followed by three intervals of a 1-minute sprint speed interspersed with a 1-minute period of relative rest at base speed, and then a final 1-minute accelerating interval (from sprint to dash speed; Figure 1A). Mice that discontinued running were motivated to continue by prodding with a tongue depressor. Mice that were not able to complete the exercise program despite prodding were assigned to lower-intensity groups on the next session, whereas mice that did not require any prodding in two consecutive sessions were assigned to higher-intensity groups. Exercise sessions were performed 3 days a week. At baseline and end point, mice were assessed on the initial baseline program as the percent of the program complete before receiving five total shocks. Table 1. HIIT Intensity Groups Intensity Group  Baseline Uphill Sprint Score (m/min)  Starting in Group  Ending in Group  Baseline Exercise Speeds (m/min)  Base  Sprint  Dash  Group A  0–16  5  3  5  10  15  Group B  17–25  4  8  8  13  18  Group C  >25  3  1  11  16  21  Intensity Group  Baseline Uphill Sprint Score (m/min)  Starting in Group  Ending in Group  Baseline Exercise Speeds (m/min)  Base  Sprint  Dash  Group A  0–16  5  3  5  10  15  Group B  17–25  4  8  8  13  18  Group C  >25  3  1  11  16  21  Note: HIIT = high intensity interval training. Mice were divided into intensity groups depending on baseline uphill sprint data (see Methods). Mice were moved up intensity groups if there was no difficulty in two consecutive sessions and down if unable to complete a session. Five such changes occurred in the first 2 weeks and only one thereafter. Base, sprint, and dash speeds increase 1 m/min every 2 weeks. View Large Figure 1. View largeDownload slide High intensity interval training program in aged mice. Exercise was performed 3 days a week using a 10-minute exercise scheme (A). The scheme features a 3-minute warm-up period at a base speed, followed by three intervals of 1 minute at a constant sprint speed alternatively with 1 minute at base speed, finishing with a final 1-minute interval that accelerates from sprint to dash speeds. Base, sprint, and dash speeds are detailed in Table 1 and increment 1 m/min higher every 2 weeks. (B) Percent completion of training program at baseline and at end point in those mice that initially failed to complete at least 95% of their baseline program, N = 7. Figure 1. View largeDownload slide High intensity interval training program in aged mice. Exercise was performed 3 days a week using a 10-minute exercise scheme (A). The scheme features a 3-minute warm-up period at a base speed, followed by three intervals of 1 minute at a constant sprint speed alternatively with 1 minute at base speed, finishing with a final 1-minute interval that accelerates from sprint to dash speeds. Base, sprint, and dash speeds are detailed in Table 1 and increment 1 m/min higher every 2 weeks. (B) Percent completion of training program at baseline and at end point in those mice that initially failed to complete at least 95% of their baseline program, N = 7. Muscle Histology NADH staining was performed on 10-µm frozen muscle sections. Sections were submerged in a solution containing 1 mg/mL NADH (Sigma, St Louis, MO), 1 mg/mL Nitro Blue Tetrazolium (VWR #TCD0844), and 0.2 M Tris–HCl buffer at pH 7.4 for 45 minutes at 37°C. Sections were then immersed in a series of acetone baths (30%, 60%, 90%, 60%, 30% v/v), rinsed in distilled water for 1 minute, and dehydrated by immersing in ethanol (95%, 100%, 100% v/v) and xylene (2 × 100% v/v) for 1 minute each, before finally mounting a cover slip with Cytoseal (Fisher #23-244257). A blinded investigator identified and tallied fiber types and also measured cross-sectional area of the fibers using Motic software (Motic, Hong Kong). Mitochondrial Biomass Total DNA was isolated from soleus and anterior tibialis muscle using a Qiagen Tissue Quick mini-prep kit (Qiagen, Germantown, MD). Primers were designed to amplify mitochondrial DNA (forward: CCGCAAGGGAAAGATGAAAGA, reverse: TCGTTTGGTTTCGGGGTTTC) and nuclear DNA (hexokinase gene, forward: CCCTGTCATGTCCCTTTGTT, reverse: GCCACCAGCTCAGTTAAAGG) and amplified using quantitative PCR (LightCycler 2.0, Roche). Mitochondrial Activity To isolate mitochondria, soleus muscle was homogenized using a conical glass homogenizer in 10 mL of Chappel-Perry isolation medium (100 mM KCL, 50 mM Tris–HCl, 5 mM MgCl2, 1 mM ATP, 1 mM EGTA, pH 7.5). Homogenate was then filtered through gauze and centrifuged 10 minutes at 900g. Supernatant was next centrifuged for 10 minutes at 9,000g, and the pellet was washed once with 15 mL of SHE medium (250 mM sucrose, 10 mM Hepes, 1 mM EGTA, pH 7.2). Finally, the supernatant was centrifuged for 10 minutes at 9,000g, and the resultant pellet was suspended in 100 μL of SHE medium. Protein concentration was determined using a Bradford assay. Complex IV activity was determined by adding 1 μg of mitochondria into a cuvette containing 1 mL of reaction buffer (10 mM KH2PO4, 250 mM sucrose, 1 mg/mL bovine serum albumin, 10 µM reduced cytochrome C [reduced using sodium hydrosulfite], 2.5 mM lauryl maltoside, pH 6.5). Activity was determined as the rate of decline in absorbance at 412 nM. Citrate activity was determined by adding 1 μg of mitochondria extract into a cuvette containing 500 μL of reaction buffer (100 mM Tris, 2 mM DTNB [5,5-dithio-bis-2-nitrobenzoic acid], 4 mM oxaloacetic acid, 1 mM acetyl Co-A, pH 8.0). Activity was determined as the rate of increase in absorbance at 412 nM. Total activity was complex IV activity normalized to citrate activity as the average of two to three trials of each per sample. Frailty and Frailty Intervention Assessment Value Determination Assessment of frailty in mice involves five parameters that are designed to mirror parameters used in human Fried frailty assessment (21). Similarly, we defined frailty in mice as those that fall below a cutoff in three or more parameters and prefrailty below a cutoff in one or two parameters. The first parameter is weight loss, with a cutoff of losing >5% body weight during a 1-week period. The next four parameters include cutoffs greater than 1.5 SD below the control group mean (15). These parameters include grip strength, activity levels, gait speed, and endurance, which are derived from the grip force meter, quadrant crossings in the activity monitor, gait speed analysis, and treadmill endurance, respectively. The frailty intervention assessment value (FIAV) was determined as described previously (23). The score of the baseline assessment for each mouse (body weight change, grip force meter, quadrant crossings, gait speed analysis, and treadmill endurance) is converted to a Z score, which is the sample measurement minus the mean from all mice divided by the SD from all mice. The collective Z scores are summed to establish the baseline FIAV (FIAV1). End point FIAV (FIAV2) is similarly calculated from end point assessments, but calculated using the baseline mean and SD. Total FIAV score is thus the difference between FIAV2 and FIAV1. Statistics Statistical validation of comparisons between HIIT and sedentary groups was performed using a student’s t test (XLStat software, Addinsoft, New York, NY) with significance levels defined as (*) < .05, (**) < .01, (***) < .001, and (****) < .0001. Two-way analysis of variance, followed by post hoc Tukey’s multiple comparisons test, was applied to analyze differences between young sedentary, old sedentary, and old HIIT, where applicable. All data were screened for potential outliers using a Grubb’s test with a significance cutoff of 0.05. Data are provided with SD where applicable. Results Exercise Model for High Intensity Interval Training The HIIT program was carried out on an inclined treadmill (25°). Initially, baseline uphill sprint assessments were used to assign mice to one of three intensity groups for training (Table 1). The HIIT program consists of a warm-up period followed by four alternating intensity intervals (Figure 1A). The 10-minute program was administered to mice 3 days a week over 16 weeks with an increase in intensity every 2 weeks. Over the course of the experiment, three mice were reassigned to greater-intensity groups and three to lesser-intensity groups based on performance (see Materials and Methods), with all but one doing so within the first 2 weeks. Initially, 7 of the 12 mice in the HIIT group were not able to complete the baseline exercise program before reaching exhaustion (completing on average 30.4% ± 12.6%). Following 16 weeks of HIIT exercise, these seven mice were retested on the baseline exercise program and completed 79.3% ± 26.9%, p = .0064 (Figure 1B). Body Weight and Composition Analysis As there is a natural decline in body weight as mice reach advanced ages (24,25), we set out to understand how HIIT might alter this natural progression. Interestingly, we did identify a deviation in the pattern of decline, as HIIT mice exhibited greater body weight at two time points (Week 10: HIIT 33.3 ± 4.0 g vs SED 30.3 ± 1.9 g, p = .0283, and Week 12: HIIT 32.8 ± 3.3 g vs SED 29.9 ± 1.3 g, p = .0097). Yet after 16 weeks of HIIT, our data reveal a similar decline in overall body weight in both HIIT and SED groups (HIIT 5.3 ± 3.7 g vs SED 5.4 ± 3.0 g; Figure 2A). Despite no difference in body weight change, HIIT exercised mice consumed more food than did mice in the SED group (HIIT 9.9 ± 0.5 kcal/mouse/day vs 9.3 ± 0.6 kcal/mouse/day, p = .0155; Figure 2B). We also performed dual X-ray absorptiometry at baseline and end point (DEXA; Figure 2C and D) to assess changes in bone mineral density, body fat percentage, and lean mass. We did not detect a significant difference in end point bone mineral density between HIIT and SED mice (Supplementary Figure S1); however, p values for greater bone mineral density after 16 weeks were 0.06 and 0.12 in HIIT mice and SED mice, respectively. Surprisingly, we observed a decline in body fat % in SED mice (Week 0: 21.7 ± 3.3% vs Week 16: 16.5 ± 3.1%, p = .0020), yet we did not observe such a decline in body fat % in HIIT mice (Week 0: 20.9 ± 7.1% vs Week 16: 17.8 ± 3.8%, p = .13). Both SED and HIIT mice exhibited a decline in total lean mass (SED Week 0: 26.8 ± 1.6 g vs Week 16: 23.9 ± 1.7 g, p = .0003 and HIIT Week 0: 27.0 ± 1.8 g vs Week 16: 24.2 ± 2.8 g, p = .0071). Figure 2. View largeDownload slide High intensity interval training (HIIT) exercise increases muscle mass in aged mice. Measurement of bodyweight (A) and average daily caloric intake (B) in sedentary and HIIT training mice over 16 weeks. At baseline and end point, body fat % (C) and total lean mass (D) were determined using DEXA. Following sacrifice, soleus and extensor digitorum longus (EDL) muscles were isolated and weighed (E). Heart weight was also determined from experimental cohorts and 10-month-old young sedentary mice (F). Figure 2. View largeDownload slide High intensity interval training (HIIT) exercise increases muscle mass in aged mice. Measurement of bodyweight (A) and average daily caloric intake (B) in sedentary and HIIT training mice over 16 weeks. At baseline and end point, body fat % (C) and total lean mass (D) were determined using DEXA. Following sacrifice, soleus and extensor digitorum longus (EDL) muscles were isolated and weighed (E). Heart weight was also determined from experimental cohorts and 10-month-old young sedentary mice (F). Despite the similar declines in total lean mass, tissue analysis following sacrifice revealed that HIIT mice exhibit greater soleus muscle mass (HIIT 9.4 ± 1.7 mg vs SED 7.3 ± 1.0 mg, n = 12, p = .0013) and extensor digitorum longus muscle mass (HIIT 12.2 ± 1.2 mg vs SED 10.8 ± 1.0 mg, n = 9 and 6, p = .0334; Figure 2E). Heart size was not significantly different between SED and HIIT exercised mice (p = .40; Figure 2F). However, relative to sedentary young mice, old SED mice exhibit significantly greater heart size (young 143.6 ± 20.9 mg vs old SED 170.8 ± 12.7 mg, n = 7 and 6, p = .0150), whereas HIIT exercised older mice do not (young 143.6 ± 20.9 mg vs HIIT 158.6 ± 15.4 mg, n = 7 and 11, p = .19). Physical Performance Assessments HIIT results in physical performance gains in human studies yet the nature of the improvement (i.e. maximal strength, anaerobic/aerobic capacity, balance and coordination, etc.) is not entirely understood. To capture a physical performance profile, we undertook a battery of assessments at baseline and end point following 16 weeks of HIIT (Figure 3). Our data reveal marked improvement in grip strength (HIIT 10.9 ± 7.7% vs SED −3.9 ± 10.8%, p = .0016), gait speed (HIIT 107.0 ± 51.5% vs SED 39.0 ± 29.0%, p = .0009), and treadmill endurance (HIIT 32.6 ± 24.8% vs SED −2.0 ± 14.4%, p = .0004). We also developed an uphill sprint assessment protocol to further elucidate changes in anaerobic capacity and found that HIIT-trained mice also improved (HIIT 29.3 ± 34.0% vs −15.6 ± 37.0%, p = .0052). In addition, the end point grip strength, treadmill endurance, uphill sprint, and gait speed performance in HIIT equaled or exceeded the performance of younger sedentary mice (Supplementary Table S1). However, benefits were not observed across all domains of physical performance as we did not observe improvement in rotarod performance (HIIT −4.8 ± 16.4% vs SED 12.4 ± 33.4%, p = .12) or open field crossings between quadrants (HIIT −20.9 ± 33.8% vs SED −5.9 ± 39.4%, p = .33). Figure 3. View largeDownload slide Improvement of physical performance in high intensity interval training (HIIT) exercised mice. At baseline and end point, mice were assessed in several domains of physical performance, including grip strength meter (best three of five trials), gait speed (top two of three times to move 1 m), treadmill endurance, uphill sprint, rotarod (best two of three trials), and quadrant crossings during 30 minutes of open field activity. Figure 3. View largeDownload slide Improvement of physical performance in high intensity interval training (HIIT) exercised mice. At baseline and end point, mice were assessed in several domains of physical performance, including grip strength meter (best three of five trials), gait speed (top two of three times to move 1 m), treadmill endurance, uphill sprint, rotarod (best two of three trials), and quadrant crossings during 30 minutes of open field activity. Analysis of Muscle Cell and Mitochondrial Quality To characterize the underlying physiology driving physical performance phenotypes, we performed NADH histological analysis of anterior tibialis muscle (Figure 4A). Darker stained fibers correspond to increased amounts of NADH and corresponding greater aerobic capacity. First, we compared the cross-sectional area in the muscle fibers (Figure 4B) and found HIIT mice exhibited larger light stained muscle fibers than SED mice (HIIT 5,043.5 ± 717.2 μm2 vs SED 4,282.9 ± 606.5 μm2, n = 11 and 12, p = .0119). However, we did not identify a statistically significant difference in the size of the dark-stained fibers in these mice (HIIT 2,222.4 ± 444.5 μm2 vs SED 2,077.4 ± 237.1 μm2, n = 11 and 12, p = .33). Next, we determined the relative percentage of dark, intermediate, and light stained fibers (Figure 4C) and found that muscles from HIIT mice exhibited a greater number of dark fibers than did SED mice (HIIT 17.1 ± 4.4% vs SED 12.3 ± 3.4%, p = .0081) and fewer light stained fibers (HIIT 30.2 ± 9.7% vs SED 38.5 ± 7.7%, p = .0322), which is indicative of greater aerobic capacity. Figure 4. View largeDownload slide High intensity interval training (HIIT) alters muscle fiber type and mitochondrial biomass. Cross-sectional slices of tibialis anterior muscle from sedentary (SED) and HIIT mice were analyzed histologically using NADH staining (A). Images were analyzed with Motic software to determine fiber cross-sectional area (B) and distribution of light, intermediate, and dark-stained fibers (C). Mitochondrial biomass was determined via quantitative PCR analysis of whole DNA purified from either soleus or tibialis anterior muscle (D). In addition, mitochondria were isolated from soleus muscle allowing for determination of complex IV activity as normalized to citrate synthase activity (E). Figure 4. View largeDownload slide High intensity interval training (HIIT) alters muscle fiber type and mitochondrial biomass. Cross-sectional slices of tibialis anterior muscle from sedentary (SED) and HIIT mice were analyzed histologically using NADH staining (A). Images were analyzed with Motic software to determine fiber cross-sectional area (B) and distribution of light, intermediate, and dark-stained fibers (C). Mitochondrial biomass was determined via quantitative PCR analysis of whole DNA purified from either soleus or tibialis anterior muscle (D). In addition, mitochondria were isolated from soleus muscle allowing for determination of complex IV activity as normalized to citrate synthase activity (E). To further explore potential changes in aerobic capacity, we assessed changes in mitochondrial biomass due to HIIT by analyzing whole DNA extracts from both soleus and anterior tibialis muscles using qPCR (Figure 4D). As expected, we found greater amounts of mitochondrial DNA (normalized to nuclear DNA) in both soleus and anterior tibialis muscles of HIIT exercised mice (soleus, HIIT 1.32 ± 0.07 vs SED 1.21 ± 0.10, p = .0048; TA, HIIT 1.35 ± 0.10 vs SED 1.22 ± 0.10, p = .0110). Biochemical analysis of complex IV activity and citrate activity revealed no statistically significant differences in normalized activity (complex IV activity/citrate activity: HIIT 1.93 ± 0.78 vs SED 1.48 ± 0.45, p = .11); Figure 4E. Reduction of Frailty The Fried scale characterizes frailty in humans using the following five parameters: weight loss (>5% in 1 year), weakness (grip strength), slow walking speed, self-reported exhaustion, and low physical activity (21). Individuals identified as possessing three or more of these parameters were considered frail, whereas having one or two is prefrail, and both frail and prefrail individuals showed greater risk of worsening mobility, risk of hospitalization, disability, and death (21). We utilized mouse equivalents of these parameters in the assessment of frailty in aged mice. Frailty cutoff parameters included weight loss (>5% weight loss over 1 week), grip strength (grip force meter, <1.5 SD below group mean), gait speed (<1.5 SD below group mean), exhaustion (treadmill endurance, <1.5 SD below group mean), and low activity (open field crossing activity, <1.5 SD below group mean). Using this mouse frailty assessment tool, we detected three prefrail (below cutoff on one or two parameters) mice in the sedentary group (Figure 5A), and we detected one frail mouse (below cutoff on greater than three parameters) and five prefrail mice in the HIIT exercise group (Figure 5B) at baseline. Of the eight mice that were frail or prefrail, six were below cutoff in grip strength, four in activity, two in endurance, and two in gait speed (Supplementary Tables S2 and S3). After 16 weeks, five of the six frail or prefrail mice in the HIIT group markedly improved, with four mice improving to a robust state (exhibiting no frailty parameters below cutoff). Several mice that were previously robust declined in both groups, and at the end point, there were three sedentary and four HIIT mice that were prefrail with no mice in either group being frail. Figure 5. View largeDownload slide High intensity interval training (HIIT) improves frailty status. Frailty status for sedentary (A) and HIIT (B) mice was determined at baseline and end point as falling below cutoff on three or more of the following parameters: weight loss, poor grip strength, poor endurance, slow gait speed, and low activity. Letters denote individual mice that either improve (solid line) or worsen (dashed line) over 16 weeks, and only mice with frailty scores greater than 0 are shown in this analysis. Frailty intervention assessment value (FIAV) was also determined as the difference of end point (FIAV2) minus baseline (FIAV1) performance scores (C). We found baseline frailty scores correlated with FIAV1 (p = .016; D), but not end point frailty scores with FIAV2 (p = .06; E). Figure 5. View largeDownload slide High intensity interval training (HIIT) improves frailty status. Frailty status for sedentary (A) and HIIT (B) mice was determined at baseline and end point as falling below cutoff on three or more of the following parameters: weight loss, poor grip strength, poor endurance, slow gait speed, and low activity. Letters denote individual mice that either improve (solid line) or worsen (dashed line) over 16 weeks, and only mice with frailty scores greater than 0 are shown in this analysis. Frailty intervention assessment value (FIAV) was also determined as the difference of end point (FIAV2) minus baseline (FIAV1) performance scores (C). We found baseline frailty scores correlated with FIAV1 (p = .016; D), but not end point frailty scores with FIAV2 (p = .06; E). The frailty intervention assessment value (FIAV) is a composite score designed to provide objective determination of the benefits of an intervention (23). Total FIAV represents the difference between baseline (FIAV1) and end point (FIAV2) scores, which are separately calculated as the sum of the differences between an individual animal’s aggregate performance score and the mean, divided by the SD. Using FIAV analyses, we found HIIT-trained mice had a larger increase in FIAV relative to sedentary controls (7.3 ± 4.4 vs 1.7 ± 3.9, p = .0031; Figure 5C). To further understand the relationship between frailty and FIAV scores, we analyzed whether the two scores correlated at either baseline (Figure 5D) or end point (Figure 5E) and found frailty and FIAV were correlated at baseline (R2 = .24, p = .0161), but not at end point (R2 = .15, p = .06). Discussion Frailty is a condition associated with greater vulnerability to adverse outcomes, for which sarcopenia and declines in physical performance are significant contributors (2). Exercise is increasingly being looked at as an intervention for frailty (8,26–29), and a systematic review of eight clinical trials involving exercise in frail cohorts identified benefits, although the specific form (resistance training, endurance, etc.) that was most beneficial was unclear (28). Here we demonstrate that 10-minute-long HIIT sessions, involving 4 minutes of intense running and administered only 3 days a week, significantly enhanced physical performance and reduced markers of frailty in aged mice. Parameters chosen for the characterization of frailty in mice mirrored the human parameters utilized in Fried and colleagues (21). Baseline assessment of the 24-month-old mice (age equivalent of a 65- to 70-year-old human (30)) identified one frail mouse (4.1% of total) and eight prefrail (33.3%) mice, which is consistent with the percentage of frailty (~3.7%) and prefrailty (~41.5%) in 65- to 74-year-old participants in the Cardiovascular Health Study (21). The most common parameters identified in our study were low grip strength (25%) and low activity (16.7%), whereas low grip strength (20%) and low endurance (24%) were identified in a clinical study of prefrail older individuals (31). The 16 weeks of HIIT reduced frailty parameters in five of the six HIIT mice that were frail or prefrail at baseline, demonstrating both the ability to conduct frailty analysis in aged mice and to detect the benefits of HIIT for frailty. The utility of HIIT for maintaining or improving functional capacity in healthy older individuals is increasingly being examined (32,33), as is the possibility that HIIT is beneficial in those with comorbidities (34). The present study raises the possibility that HIIT administered in a progressive manner and that is tailored to the individual may be beneficial as part of a therapeutic strategy in frailty in humans. Interestingly, 3 of the 12 (25%) HIIT mice failed to improve or worsened to a prefrail state, yet none of these mice exhibited more than one parameter below cutoff. This may be a reflection of the dynamic state of frailty. Interestingly there existed a natural fluctuation between robust and prefrail states in a community-dwelling elderly adults (35). This notion also partially explains the improvement of two prefrail SED mice to robust. Frailty status did not substantially decline in the SED mice as they aged; however, this may be due to the relatively limited time span of the study. Future studies to monitor frailty status until death may be necessary to better understand frailty progression in mice. Two studies have demonstrated that individualized high intensity exercises improved Barthel activities of daily-living (36) index scores (37,38). Here we demonstrate that HIIT increases FIAV scores in aged mice, which has been described as a mouse equivalent to the Barthel ADL index (23). Interestingly, although HIIT mice exhibited statistically significantly greater FIAV improvement than SED mice, our data show both HIIT and SED mice had greater FIAV scores at end point. These unexpected gains in the SED mice may be due to a learning effect in gait speed performance. We also found that the baseline FIAV score correlated with baseline frailty assessment, but the end point FIAV score narrowly missed attaining a statistically significant correlation with the end point frailty assessment. This finding suggests a close relationship between the two tools, yet our understanding of the utility and predictive power of mouse frailty or FIAV analysis would be strengthened by additional studies that identify correlations with survival and/or underlying pathology (14). The use of low time commitment exercise regimens is gaining traction as an alternative to traditional exercise since “lack of time” is a significant contributor to poor participation (6). Short exercise strategies that have improved health outcomes include single 4-minute bouts at 90% of maximal heart rate three times a week (7), three to six bouts of 30 seconds at max intensity (39), and even just three bouts of 20 seconds three times a week (40). Similarly, our exercise program yielded cellular, tissue, and functional benefits with only 4 minutes of high intensity exercise three times a week. Others have demonstrated benefits of HIIT in rats and mice (36,41–43), yet to our knowledge, our protocol is the first to use HIIT with aged animals. Importantly, this study adds to the growing body of literature that suggests aged organisms respond well to exercise. Despite the short exercise times, we identified benefits that are consistent with other studies involving regular exercise in aged animals including increases in muscle mass and strength (44), grip strength (45), and mitochondrial biomass (46). We also identified increases in muscle cross-sectional area that are observed in human trials using HIIT (47). Open field activity did not improve in HIIT mice, which is surprising given the improvements in gait speed and treadmill performance. However, this finding is similar to two other studies involving forced exercise protocols (48,49). Although the possibility that forced exercise is not beneficial to exploratory behavior in mice exists, examination of other forms of voluntary physical activity would aid understanding of this phenomenon. The lack of significant differences in body fat is also surprising in light of reported benefits of HIIT as reviewed by Boutcher (50). However, HIIT may not always reduce body fat (51), and the loss of body fat in our study may have been masked by the natural decline that occurs in mice during middle and advanced ages (52). The benefits of HIIT in humans is well reviewed (1,53), yet there is some concern whether HIIT is safe during advanced ages (51) and whether HIIT might induce physiological strain (54). Likewise, strength training also increases strength in frail older persons (55), but such exercise may raise the concern for risk of fracture or other injury (56). Injury concerns and overestimation of the effort to get involved in exercise programs are common barriers to exercise for older individuals, which might lead to inactivity and contribute to frailty progression (57). Thus, to avoid potential injury and increase participation, a successful exercise regimen should be tailored to the individual and be adapted as the individual improves. Therefore, for our exercise protocol, we assigned mice to one of the three groups with increasing intensity depending on the baseline exercise capacity of each mouse. We also increased or decreased training intensity based on the ongoing performance of the mouse. Following the 4-month exercise protocol, mouse mortality rates were comparable to sedentary animals, and no animals died or were injured during the exercise protocol. These findings are consistent with the evidence that HIIT is safe for both healthy and frail older adults (8,9,27) and also supports individually tailoring exercise programs (58). Conclusions Our study demonstrates that a 10-minute, three times a week, 4-month progressive HIIT protocol improves frailty status in aged mice. Physical performance improved across multiple domains (strength, endurance, gait speed), but not all (balance and coordination and spontaneous activity). HIIT also improved underlying physiology including greater muscle mass, fiber cross-sectional area, and mitochondrial biomass. Our study demonstrates the feasibility and benefits of HIIT during aging and provides a framework to examine combinatorial therapeutic strategies that might further enhance these benefits. Furthermore, these findings suggest that tailoring progressive exercise protocols to the individual may offer a strategy for the safe improvement of health span in frail older adults. Supplementary Material Supplementary data is available at The Journals of Gerontology, Series A: Biological Sciences and Medical Sciences online. Funding This work was funded by Veteran Affairs Rehabilitation Research and Development Grant RX001066 and the Indian Trail Foundation. Acknowledgments We thank Claudia Recinos, Reema Sutton, and Jessica Reynolds for editorial and administrative support. We also thank Kathleen Thaler and the veterinary and animal facility staff at the Buffalo Laboratory Animal Facility and the Buffalo CTRC. Conflict of Interest None reported. References 1. Zembroń-Łacny A, Dziubek W, Rogowski Ł, Skorupka E, Dąbrowska G. Sarcopenia: monitoring, molecular mechanisms, and physical intervention. Physiol Res . 2014; 63: 683– 691. Google Scholar PubMed  2. Fried LP. Interventions for human frailty: physical activity as a model. Cold Spring Harb Perspect Med . 2016; 6:a025916. doi: 10.1101/cshperspect.a025916 3. Centers for Disease Control and Prevention. Adult participation in aerobic and muscle-strengthening physical activities – United States, 2011. MMWR Morb Mortal Wkly Rep . 2013; 62: 326– 330. PubMed  4. Centers for Disease Control and Prevention. Strength training among adults aged >/=65 years – United States, 2001. MMWR Morb Mortal Wkly Rep . 2004; 53: 25– 28. PubMed  5. Justine M, Azizan A, Hassan V, Salleh Z, Manaf H. Barriers to participation in physical activity and exercise among middle-aged and elderly individuals. Singapore Med J . 2013; 54: 581– 586. doi:10.11622/smedj.2013203 Google Scholar CrossRef Search ADS PubMed  6. Gillen JB, Gibala MJ. Is high-intensity interval training a time-efficient exercise strategy to improve health and fitness? Appl Physiol Nutr Metab . 2014; 39: 409– 412. doi: 10.1139/apnm-2013-0187 Google Scholar CrossRef Search ADS PubMed  7. Tjønna AE, Leinan IM, Bartnes ATet al.   Low- and high-volume of intensive endurance training significantly improves maximal oxygen uptake after 10-weeks of training in healthy men. PLoS One . 2013; 8: e65382. doi: 10.1371/journal.pone.0065382 Google Scholar CrossRef Search ADS PubMed  8. Fiatarone MA, Marks EC, Ryan ND, Meredith CN, Lipsitz LA, Evans WJ. High-intensity strength training in nonagenarians. Effects on skeletal muscle. JAMA . 1990; 263: 3029– 3034. doi:10.1001/jama.1990.03440220053029 Google Scholar CrossRef Search ADS PubMed  9. Verney J, Kadi F, Saafi MA, Piehl-Aulin K, Denis C. Combined lower body endurance and upper body resistance training improves performance and health parameters in healthy active elderly. Eur J Appl Physiol . 2006; 97: 288– 297. doi: 10.1007/s00421-006-0175-z Google Scholar CrossRef Search ADS PubMed  10. Bruseghini P, Calabria E, Tam Eet al.   Effects of eight weeks of aerobic interval training and of isoinertial resistance training on risk factors of cardiometabolic diseases and exercise capacity in healthy elderly subjects. Oncotarget . 2015; 6: 16998– 17015. doi: 10.18632/oncotarget.4031 Google Scholar CrossRef Search ADS PubMed  11. Bell KE, Séguin C, Parise G, Baker SK, Phillips SM. Day-to-day changes in muscle protein synthesis in recovery from resistance, aerobic, and high-intensity interval exercise in older men. J Gerontol A Biol Sci Med Sci . 2015; 70: 1024– 1029. doi: 10.1093/gerona/glu313 Google Scholar CrossRef Search ADS PubMed  12. Sculthorpe N, Herbert P, Grace FM. Low-frequency high-intensity interval training is an effective method to improve muscle power in lifelong sedentary aging men: a randomized controlled trial. J Am Geriatr Soc . 2015; 63: 2412– 2413. doi: 10.1111/jgs.13863 Google Scholar CrossRef Search ADS PubMed  13. Knowles AM, Herbert P, Easton C, Sculthorpe N, Grace FM. Impact of low-volume, high-intensity interval training on maximal aerobic capacity, health-related quality of life and motivation to exercise in ageing men. Age . 2015; 37: 25. doi: 10.1007/s11357-015-9763-3 Google Scholar CrossRef Search ADS PubMed  14. Seldeen KL, Pang M, Troen BR. Mouse Models of Frailty: an Emerging Field. Curr Osteoporos Rep . 2015; 13: 280– 286. doi: 10.1007/s11914-015-0283-y Google Scholar CrossRef Search ADS PubMed  15. Liu H, Graber TG, Ferguson-Stegall L, Thompson LV. Clinically relevant frailty index for mice. J Gerontol A Biol Sci Med Sci . 2014; 69: 1485– 1491. doi: 10.1093/gerona/glt188 Google Scholar CrossRef Search ADS PubMed  16. Whitehead JC, Hildebrand BA, Sun Met al.   A clinical frailty index in aging mice: comparisons with frailty index data in humans. J Gerontol A Biol Sci Med Sci . 2014; 69: 621– 632. doi: 10.1093/gerona/glt136 Google Scholar CrossRef Search ADS PubMed  17. Gomez-Cabrera MC, Garcia-Valles R, Rodriguez-Mañas Let al.   A new frailty score for experimental animals based on the clinical phenotype: inactivity as a model of frailty. J Gerontol A Biol Sci Med Sci . 2017; 72: 885– 891. doi: 10.1093/gerona/glw337 Google Scholar CrossRef Search ADS PubMed  18. Kane AE, Howlett SE. Advances in preclinical models of frailty. J Gerontol A Biol Sci Med Sci . 2017; 72: 867– 869. doi: 10.1093/gerona/glx072 Google Scholar CrossRef Search ADS PubMed  19. Kane AE, Huizer-Pajkos A, Mach Jet al.   A comparison of two mouse frailty assessment tools. J Gerontol A Biol Sci Med Sci . 2017; 72: 904– 909. doi: 10.1093/gerona/glx009 Google Scholar CrossRef Search ADS PubMed  20. Miller MG, Thangthaeng N, Shukitt-Hale B. A clinically relevant frailty index for aging rats. J Gerontol A Biol Sci Med Sci . 2017; 72: 892– 896. doi: 10.1093/gerona/glw338 Google Scholar CrossRef Search ADS PubMed  21. Fried LP, Tangen CM, Walston Jet al.  ; Cardiovascular Health Study Collaborative Research Group. Frailty in older adults: evidence for a phenotype. J Gerontol A Biol Sci Med Sci . 2001; 56: M146– M156. doi:10.1093/gerona/56.3.M146 Google Scholar CrossRef Search ADS PubMed  22. Justice JN, Carter CS, Beck HJet al.   Battery of behavioral tests in mice that models age-associated changes in human motor function. Age . 2014; 36: 583– 592. doi: 10.1007/s11357-013-9589-9 Google Scholar CrossRef Search ADS PubMed  23. Graber TG, Ferguson-Stegall L, Liu H, Thompson LV. Voluntary aerobic exercise reverses frailty in old mice. J Gerontol A Biol Sci Med Sci . 2015; 70: 1045– 1058. doi: 10.1093/gerona/glu163 Google Scholar CrossRef Search ADS PubMed  24. Anisimov VN, Piskunova TS, Popovich IGet al.   Gender differences in metformin effect on aging, life span and spontaneous tumorigenesis in 129/Sv mice. Aging . 2010; 2: 945– 958. doi: 10.18632/aging.100245 Google Scholar CrossRef Search ADS PubMed  25. Dubrovsky YV, Samsa WE, Kondratov RV. Deficiency of circadian protein CLOCK reduces lifespan and increases age-related cataract development in mice. Aging . 2010; 2: 936– 944. doi: 10.18632/aging.100241 Google Scholar CrossRef Search ADS PubMed  26. Cesari M, Vellas B, Hsu FCet al.  ; LIFE Study Group. A physical activity intervention to treat the frailty syndrome in older persons-results from the LIFE-P study. J Gerontol A Biol Sci Med Sci . 2015; 70: 216– 222. doi: 10.1093/gerona/glu099 Google Scholar CrossRef Search ADS PubMed  27. Fiatarone MA, O’Neill EF, Ryan NDet al.   Exercise training and nutritional supplementation for physical frailty in very elderly people. N Engl J Med . 1994; 330: 1769– 1775. doi: 10.1056/NEJM199406233302501 Google Scholar CrossRef Search ADS PubMed  28. Giné-Garriga M, Roqué-Fíguls M, Coll-Planas L, Sitjà-Rabert M, Salvà A. Physical exercise interventions for improving performance-based measures of physical function in community-dwelling, frail older adults: a systematic review and meta-analysis. Arch Phys Med Rehabil . 2014; 95: 753– 769.e3. doi: 10.1016/j.apmr.2013.11.007 Google Scholar CrossRef Search ADS PubMed  29. Pahor M, Guralnik JM, Ambrosius WTet al.  ; LIFE Study Investigators. Effect of structured physical activity on prevention of major mobility disability in older adults: the LIFE study randomized clinical trial. JAMA . 2014; 311: 2387– 2396. doi: 10.1001/jama.2014.5616 Google Scholar CrossRef Search ADS PubMed  30. Flurkey KCJ, Harrison DE. The mouse in aging research. In: Fox JG, Barthold S, Davisson M, Newcomer CE, Quimby FW, Smith A, eds. The Mouse in Biomedical Research . Burlington, MA: Elsevier; 2007: 637– 672. 31. Drey M, Pfeifer K, Sieber CC, Bauer JM. The Fried frailty criteria as inclusion criteria for a randomized controlled trial: personal experience and literature review. Gerontology . 2011; 57: 11– 18. doi: 10.1159/000313433 Google Scholar CrossRef Search ADS PubMed  32. Herbert P, Hayes LD, Sculthorpe Net al.   High-intensity interval training (HIIT) increases insulin-like growth factor-I (IGF-I) in sedentary aging men but not masters’ athletes: an observational study. Aging Male . 2016: 20: 54– 59. doi: 10.1080/13685538.2016.1260108 Google Scholar CrossRef Search ADS PubMed  33. Hwang CL, Yoo JK, Kim HKet al.   Novel all-extremity high-intensity interval training improves aerobic fitness, cardiac function and insulin resistance in healthy older adults. Exp Gerontol . 2016; 82: 112– 119. doi: 10.1016/j.exger.2016.06.009 Google Scholar CrossRef Search ADS PubMed  34. Guadalupe-Grau A, Aznar-Laín S, Mañas Aet al.   Short- and long-term effects of concurrent strength and HIIT training in octogenarians with COPD. J Aging Phys Act . 2017; 25: 105– 115. doi: 10.1123/japa.2015-0307 Google Scholar CrossRef Search ADS PubMed  35. Gill TM, Gahbauer EA, Allore HG, Han L. Transitions between frailty states among community-living older persons. Arch Intern Med . 2006; 166: 418– 423. doi: 10.1001/archinte.166.4.418 Google Scholar CrossRef Search ADS PubMed  36. Hafstad AD, Lund J, Hadler-Olsen E, Höper AC, Larsen TS, Aasum E. High- and moderate-intensity training normalizes ventricular function and mechanoenergetics in mice with diet-induced obesity. Diabetes . 2013; 62: 2287– 2294. doi: 10.2337/db12-1580 Google Scholar CrossRef Search ADS PubMed  37. Lindelöf N, Rosendahl E, Gustafsson S, Nygaard J, Gustafson Y, Nyberg L. Perceptions of participating in high-intensity functional exercise among older people dependent in activities of daily living (ADL). Arch Gerontol Geriatr . 2013; 57: 369– 376. doi: 10.1016/j.archger.2013.05.003 Google Scholar CrossRef Search ADS PubMed  38. Toots A, Littbrand H, Lindelöf Net al.   Effects of a high-intensity functional exercise program on dependence in activities of daily living and balance in older adults with dementia. J Am Geriatr Soc . 2016; 64: 55– 64. doi: 10.1111/jgs.13880 Google Scholar CrossRef Search ADS PubMed  39. Place N, Ivarsson N, Venckunas Tet al.   Ryanodine receptor fragmentation and sarcoplasmic reticulum Ca2+ leak after one session of high-intensity interval exercise. Proc Natl Acad Sci USA . 2015; 112: 15492– 15497. doi: 10.1073/pnas.1507176112 Google Scholar CrossRef Search ADS PubMed  40. Gillen JB, Martin BJ, MacInnis MJ, Skelly LE, Tarnopolsky MA, Gibala MJ. Twelve weeks of sprint interval training improves indices of cardiometabolic health similar to traditional endurance training despite a five-fold lower exercise volume and time commitment. PLoS One . 2016; 11: e0154075. doi: 10.1371/journal.pone.0154075 Google Scholar CrossRef Search ADS PubMed  41. Hafstad AD, Boardman NT, Lund Jet al.   High intensity interval training alters substrate utilization and reduces oxygen consumption in the heart. J Appl Physiol . 2011; 111: 1235– 1241. doi: 10.1152/japplphysiol.00594.2011 Google Scholar CrossRef Search ADS PubMed  42. Perry CG, Heigenhauser GJ, Bonen A, Spriet LL. High-intensity aerobic interval training increases fat and carbohydrate metabolic capacities in human skeletal muscle. Appl Physiol Nutr Metab . 2008; 33: 1112– 1123. doi: 10.1139/H08-097 Google Scholar CrossRef Search ADS PubMed  43. Cho J, Kim S, Lee Set al.   Effect of training intensity on nonalcoholic fatty liver disease. Med Sci Sports Exerc . 2015; 47: 1624– 1634. doi: 10.1249/MSS.0000000000000595 Google Scholar CrossRef Search ADS PubMed  44. Ko IG, Jeong JW, Kim YHet al.   Aerobic exercise affects myostatin expression in aged rat skeletal muscles: a possibility of antiaging effects of aerobic exercise related with pelvic floor muscle and urethral rhabdosphincter. Int Neurourol J . 2014; 18: 77– 85. doi: 10.5213/inj.2014.18.2.77 Google Scholar CrossRef Search ADS PubMed  45. Garcia-Valles R, Gomez-Cabrera MC, Rodriguez-Mañas Let al.   Life-long spontaneous exercise does not prolong lifespan but improves health span in mice. Longev Healthspan . 2013; 2: 14. doi: 10.1186/2046-2395-2-14 Google Scholar CrossRef Search ADS PubMed  46. Kang C, Chung E, Diffee G, Ji LL. Exercise training attenuates aging-associated mitochondrial dysfunction in rat skeletal muscle: role of PGC-1α. Exp Gerontol . 2013; 48: 1343– 1350. doi: 10.1016/j.exger.2013.08.004 Google Scholar CrossRef Search ADS PubMed  47. Osawa Y, Azuma K, Tabata Set al.   Effects of 16-week high-intensity interval training using upper and lower body ergometers on aerobic fitness and morphological changes in healthy men: a preliminary study. Open Access J Sports Med . 2014; 5: 257– 265. doi: 10.2147/OAJSM.S68932 Google Scholar CrossRef Search ADS PubMed  48. Fabene PF, Mariotti R, Navarro Mora G, Chakir A, Zancanaro C. Forced mild physical training-induced effects on cognitive and locomotory behavior in old mice. J Nutr Health Aging . 2008; 12: 388– 390. doi:10.1007/BF02982671 Google Scholar CrossRef Search ADS PubMed  49. Viidik A, Skalicky M. Influence of physical exercise on old rats: changes in patterns of spontaneous activity and connective tissues. Aging . 1997; 9: 64– 72. doi:10.1007/BF03340129 Google Scholar PubMed  50. Boutcher SH. High-intensity intermittent exercise and fat loss. J Obes . 2011; 2011: 868305. doi: 10.1155/2011/868305 Google Scholar CrossRef Search ADS PubMed  51. Keating SE, Machan EA, O’Connor HTet al.   Continuous exercise but not high intensity interval training improves fat distribution in overweight adults. J Obes . 2014; 2014: 834865. doi: 10.1155/2014/834865 Google Scholar CrossRef Search ADS PubMed  52. Hamrick MW, Ding KH, Pennington Cet al.   Age-related loss of muscle mass and bone strength in mice is associated with a decline in physical activity and serum leptin. Bone . 2006; 39: 845– 853. doi: 10.1016/j.bone.2006.04.011 Google Scholar CrossRef Search ADS PubMed  53. Raymond MJ, Bramley-Tzerefos RE, Jeffs KJ, Winter A, Holland AE. Systematic review of high-intensity progressive resistance strength training of the lower limb compared with other intensities of strength training in older adults. Arch Phys Med Rehabil . 2013; 94: 1458– 1472. doi: 10.1016/j.apmr.2013.02.022 Google Scholar CrossRef Search ADS PubMed  54. Buchheit M, Kuitunen S, Voss SC, Williams BK, Mendez-Villanueva A, Bourdon PC. Physiological strain associated with high-intensity hypoxic intervals in highly trained young runners. J Strength Cond Res . 2012; 26: 94– 105. doi: 10.1519/JSC.0b013e3182184fcb Google Scholar CrossRef Search ADS PubMed  55. Dirks ML, Tieland M, Verdijk LBet al.   Protein supplementation augments muscle fiber hypertrophy but does not modulate satellite cell content during prolonged resistance-type exercise training in frail elderly. J Am Med Dir Assoc . 2017;18(7):608–615. doi: 10.1016/j.jamda.2017.02.006 56. Taunton JE, Martin AD, Rhodes EC, Wolski LA, Donelly M, Elliot J. Exercise for the older woman: choosing the right prescription. Br J Sports Med . 1997; 31: 5– 10. doi:10.1136/bjsm.31.1.5 Google Scholar CrossRef Search ADS PubMed  57. Freiberger E, Kemmler W, Siegrist M, Sieber C. Frailty and exercise interventions: evidence and barriers for exercise programs. Z Gerontol Geriatr . 2016; 49: 606– 611. doi: 10.1007/s00391-016-1134-x Google Scholar CrossRef Search ADS PubMed  58. Mair JL, Nevill AM, De Vito G, Boreham CA. Personalised prescription of scalable high intensity interval training to inactive female adults of different ages. PLoS One . 2016; 11: e0148702. doi: 10.1371/journal.pone.0148702 Google Scholar CrossRef Search ADS PubMed  Published by Oxford University Press on behalf of The Gerontological Society of America 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Journal

The Journals of Gerontology Series A: Biomedical Sciences and Medical SciencesOxford University Press

Published: Apr 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off