Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/ou_press/hepatic-production-of-fibroblast-growth-factor-23-in-autosomal-mesRwlwuce
- Publisher
- Oxford University Press
- Copyright
- Copyright © 2018 Endocrine Society
- ISSN
- 0021-972X
- eISSN
- 1945-7197
- DOI
- 10.1210/jc.2018-00123
- Publisher site
- See Article on Publisher Site
Abstract
Abstract Context The bone-derived hormone fibroblast growth factor (FGF) 23 controls phosphate homeostasis and urinary phosphate excretion. FGF23 plasma levels increase in the early stage of renal insufficiency to prevent hyperphosphatemia. Recent evidence suggests that this increase has effects on cardiac and immune cells that compromise patients’ health. Patients with autosomal dominant polycystic kidney disease (ADPKD) have been reported to have higher FGF23 concentrations than other patients with similar renal function. The significance of this finding has remained unknown. Methods and Results Analyzing the FGF23 plasma levels in 434 patients with ADPKD and 355 control subjects with a measured glomerular filtration rate (mGFR) between 60 and 120 mL/min per 1.73 m2, we confirmed that patients with ADPKD had higher FGF23 plasma concentrations than controls. Remarkably, this difference did not translate into renal phosphate leakage. Using different assays for FGF23, we found that this discrepancy was explained by a predominant increase in the cleaved C-terminal fragment of FGF23, which lacks phosphaturic activity. We found that FGF23 plasma concentration independently correlated with the severity of cystic liver disease in ADPKD. We observed that, in contrast to control liver tissues, the cystic liver from patients with ADPKD markedly expressed FGF23 messenger RNA and protein. In line with this finding, the surgical reduction of polycystic liver mass was associated with a decrease in FGF23 plasma levels independently of any modification in mGFR, phosphate, or iron status. Conclusion Our findings demonstrate that severely polycystic livers produce FGF23 and increase levels of circulating FGF23 in patients with ADPKD. In the past decade, fibroblast growth factor (FGF) 23 has emerged as a major hormonal regulator of mineral homeostasis (1). Produced principally by osteocytes, FGF23 acts on the kidney to induce phosphaturia by reducing the expression of the phosphate-sodium cotransporters NPT2a and NPT2c in the brush border of proximal tubular cells. FGF23 also reduces the net production of calcitriol from 25-hydroxy-vitamin D [25(OH)D] by proximal tubular cells. The physiological effects of FGF23 depend on its binding to a receptor complex composed of an FGF receptor (FGF-R) and the single-pass transmembrane coreceptor α-Klotho. Indeed, invalidation of the genes encoding either FGF23 or α-Klotho produces similar phenotypes in mice including hyperphosphatemia, hypercalcitriolemia, and bone demineralization (2, 3). FGF23 is secreted as a 226-amino-acid polypeptide, which represents the active form of the hormone. FGF23 is also secreted as C-terminal and N-terminal fragments, derived from its cleavage between Arg179 and Ser180 by furin protease (4, 5). These fragments lack phosphaturic activity (6). Both cleaved and full-length FGF23 can be found in human plasma. Notably, while increased circulating C-terminal fragment of FGF23 (Cterm-FGF23) is associated with an increase in the intact protein in some conditions such as a reduction in kidney function, in others, such as iron deficiency, FGF23 increase reflects mostly an increase in the circulating amount of the cleaved C-terminal peptide, which is the consequence of a simultaneous increase in FGF23 expression and cleavage (7). Importantly, most epidemiologic studies published to date on FGF23 rely on an assay that recognizes Cterm-FGF23 and does not discriminate between the full-length hormone and its cleaved C-terminal fragment. Assays specifically recognizing the intact full-length hormone (intact FGF23) have also been developed, allowing discrimination between cleaved and intact FGF23 (8). FGF23 concentration rises in the early stage of chronic kidney disease (CKD). Data obtained from animal models suggest that this FGF23 elevation prevents plasma phosphate concentrations from increasing while the glomerular filtration rate (GFR) declines (9, 10). Clinical studies have consistently reported an association between high FGF23 plasma concentrations and cardiac hypertrophy, infection-related hospitalization, and the risk of death in patients with renal insufficiency or hepatic cirrhosis (11–13). Recent data suggest that this epidemiological association reflects a causal link. Indeed, studies in animals and cultured cells have shown that, at high concentrations, FGF23 has direct off-target effects on cardiomyocytes, resulting in cardiac hypertrophy and dysfunction (14, 15); on neutrophils, impairing their recruitment at the site of infection (16); and on hepatocytes, stimulating the secretion of inflammatory molecules (17). Autosomal dominant polycystic kidney disease (ADPKD) is the most common cause of genetic CKD (18), with a prevalence of 1 in 2000 births. The disease, which is caused by loss of function mutations in either the PKD1 or PKD2 gene, is characterized by gradual cystic enlargement in the kidney that results in a progressive loss of kidney function, leading to end-stage renal disease around the sixth decade (19). In addition to the kidney, patients with ADPKD may develop cysts in other organs. In particular, the disease may lead to a massive liver enlargement, necessitating the reduction of liver mass or liver transplantation. Comparing 100 patients with ADPKD with 20 non-ADPKD nondiabetic subjects with stage 1 or 2 renal insufficiency, Pavik et al. (20) found higher plasma FGF23 concentrations and lower serum phosphate concentrations in the ADPKD group. The mechanisms leading to the extra increase in FGF23 concentration in patients with ADPKD and the pathophysiologic aftermath of this increase remain to be established. The goals of this study were to investigate FGF23 plasma concentrations in a large cohort of patients with ADPKD and controls and to determine the mechanism that could contribute to the additional increase in FGF23. Methods Study population Between 2007 and 2016, all patients aged ≥18 years diagnosed with ADPKD were referred to our department for a measured GFR (mGFR), and those who were found to have an mGFR between 60 and 120 mL/min per 1.73 m2 were subsequently analyzed in this study. All patients without ADPKD but with an mGFR in the same range, who underwent the same investigation during the same time period, were included in the control group, with the exception of patients who were a priori referred for diseases associated with renal phosphate leakage [kidney stone formers (21), patients with bone demineralization, renal transplant recipients (22), and patients with primary hyperparathyroidism or proximal tubulopathy] or a condition associated with elevated FGF23 plasma levels [patients with sickle cell disease (23) or liver cirrhosis (11)]. Patients who were referred for a disorder not known to be associated with renal phosphate leakage or elevated FGF23 levels were included in the control group even when further exploration revealed renal phosphate leakage or elevated FGF23 levels. Blood phosphate, calcium, parathyroid hormone (PTH), Cterm-FGF23, and 25(OH)D were prospectively measured in all patients. Ferritin levels were prospectively measured in all patients with ADPKD but in only a subgroup of controls, based on medical prescription. Intact FGF23 was prospectively measured in patients who were referred after 2013. Abdominal magnetic resonance imaging was performed for clinical care (disease stratification or monitoring), based on the decision of the nephrologist in charge of the patient. For analysis of the ratios of intact FGF23 to Cterm-FGF23, we included all patients examined at our institution who had available concomitant measurements of mGFR, ferritin, Cterm-FGF23, and intact FGF23. As in our previous analysis, patients who were a priori referred for disorders associated with renal phosphate leakage or elevated FGF23 plasma levels were excluded from this analysis. The study groups were a priori defined: controls (patients without ADPKD with mGFR >60 mL/min per 1.73 m2 and ferritin >20 µg/mL), CKD (patients without ADPKD with mGFR <60 mL/min per 1.73 m2 and ferritin >20 µg/mL), ADPKD (patients with ADPKD with mGFR >60 mL/min per 1.73 m2 and ferritin >20 µg/mL), and iron deficiency (patients without ADPKD with mGFR >60 mL/min per 1.73 m2 and ferritin <20 µg/mL). Human samples The study was conducted on samples from patients undergoing liver surgery for severe polycystic kidney disease in the surgery department of Beaujon Hospital. Peritumoral liver samples were used as controls. All patients gave written informed consent, and the study protocol was approved by the ethics committee of Beaujon Hospital (declaration DC-2009-938). Biochemistry GFR was measured by iohexol clearance or inulin clearance when allergy to iohexol was suspected on the basis of patient history. Patients were infused with iohexol (Omnipaque 360; GE Healthcare) or inulin (Inutest 25%; Fresenius Kabi) as previously described (24). Blood and urine samples were collected every hour for 5 hours, and iohexol (or inulin), sodium, potassium, calcium, phosphorus, creatinine, urea, glucose, and uric acid concentrations were measured. Iohexol and inulin concentrations were determined by high-performance liquid phase chromatography and an enzymatic method, respectively, as previously described (24). FGF23 plasma concentration was measured via an enzyme-linked immunosorbent assay (ELISA) Immutopics C-terminal ELISA kits (Human FGF23 C-terminal ELISA kit, Immutopics International) that recognizes the C-terminal part of the peptide. Intact FGF23 concentration was measured with an Immutopics Human intact FGF23 ELISA kit (Immutopics International). Soluble α-Klotho plasma concentrations were measured with a human soluble α-Klotho Assay Kit (Immuno-Biologic Laboratories). 25(OH)D concentrations were measured by radioimmunoassay (DiaSorin). Serum PTH concentration was measured with an immunochemiluminescent assay performed on the Elecsys analyzer (Roche Diagnostics). Total calcium, ionized calcium, phosphate, and creatinine concentrations were measured with standard methods. Magnetic resonance imaging Kidney and liver volume measurements were conducted with the same method. The T2-weighted acquisition in the coronal plane with fat saturation suppression was selected. Each organ was manually contoured slice by slice with the Reformat software available in the General Electric Workstation Advantage Windows (GE Healthcare) by a clinician with >10 years of experience in three-dimensional abdominal imaging. The volume was then automatically calculated in milliliters. This time-consuming approach (10 minutes per organ) provides the highest accuracy because it is based on true anatomic limits and not on automatic pixel recognition or pixel intensity (25). All volumes were normalized for patient height. RNA extraction Fifteen milligrams of human liver samples was homogenized in Qiazol lysis reagent (miRNeasy mini Kit, Qiagen) and extracted according to the manufacturer’s directions. Real-time quantitative reverse transcription polymerase chain reaction The complementary DNA synthesis was performed with SuperScript II Reverse Transcriptase (Invitrogen) according to the manufacturer’s directions. FGF23 messenger RNA (mRNA) was detected in human livers with SYBR Green PCR Master Mix (Thermofisher) and real-time reverse transcription polymerase chain reaction with the Viia7 qPCR System (Applied Biosystems). Measurements were standardized to the expression of three housekeeping genes (GAPDH, HPRT, and SDHA). Primers (Eurogentec) were as follows: FGF23 forward, 5′-CTCCTCAGTGAAAGATCCCAAA-3′ and reverse, 5′-GCCACATGACGAGGGATATAAG-3′; GAPDH forward, 5′-CAACCCATGGCAAATTCC-3′ and reverse, 5′- TGATGGGATTTCCATTGATGA C-3′; SDHA forward, 5′-GCCGTGGTCGAGCTAGAAAA-3′ and reverse, 5′-CACGCTGATAAATCTTCCCATCTC-3′; HPRT forward, 5′-TGGGAGGCCATCACATTGTA-3′ and reverse, 5′-TCCAGCAGGTCAGCAAAGAAC-3′. Immunohistochemistry For human samples, 4-µm sections of paraffin-embedded livers were first retrieved at 95°C for 20 minutes in citrate buffer (pH 6.0) (Dako) and then incubated overnight at 4°C with a rabbit anti-FGF23 antibody (produced in our laboratory) at 1:100. The antibody was detected with a horseradish peroxidase–conjugated anti-rabbit antibody (GE Healthcare) at 1:200. The sections were developed by 3-3′-diamino-benzidine-tetrahydrochloride (Dako) staining and counterstained with hematoxylin. Statistical analysis Statistical analysis was performed with JMP software (SAS Institute). Results are expressed as numbers and percentages for categorical variables and as mean (± standard deviation) or median (range) for continuous variables. Skewed variables were transformed with decimal logarithms. For continuous variables, comparisons between two groups were assessed via Student t test or Mann-Whitney test as appropriate. For categorical variables, group differences were identified with the Fisher’s exact test. Independent predictive factors of Cterm-FGF23 were assessed via multivariable linear regression modeling. Results Association of ADPKD with elevated FGF23 concentration Over a 6-year period at our institution, 434 patients with ADPKD had mGFR values between 60 and 120 mL/min per 1.73 m2 along with measurements of Cterm-FGF23 concentration and phosphate renal handling parameters. As controls we selected 355 patients who were referred over the same time period as patients with ADPKD for CKD (n = 94), isolated reduction of estimated GFR (n = 83), kidney donation (n = 74), dyskalemia (n = 37), chronic nephrotoxic treatment (n = 25), solitary kidney (n = 9), mastocytosis (n = 7), renal glycosuria (n = 6), glycogenosis (n = 4), metabolic acidosis (n = 4), hyponatremia (n = 3), hypercalciuria (n = 2), polyuria (n = 2), hypertension (n = 2), chondrocalcinosis (n = 1), hypomagnesemia (n = 1), and bone pain (n = 1). The characteristics of patients with ADPKD and control patients are summarized in Table 1. The two populations had similar sex distribution and mGFR, but patients with ADPKD had higher Cterm-FGF23 levels than controls. Patients with ADPKD were also significantly younger than controls. Importantly, the elevation in Cterm-FGF23 levels in patients with ADPKD was not associated with renal phosphate leakage. Indeed, controls and patients with ADPKD displayed similar plasma phosphate concentrations and renal phosphate transport [tubular maximum reabsorption of phosphate (TmP) to GFR] (Table 1). Serum PTH and 25(OH)D concentration did not differ between patients with ADPKD and controls. Multivariable analysis revealed that belonging to the ADPKD group was an independent risk factor for Cterm-FGF23 elevation (Table 2). Table 1. Comparison of Demographic and Biologic Characteristics of Patients With ADPKD and Controls Characteristics ADPKD Controls P Patients, no. 434 355 — Age, y 39 ± 11 46 ± 15 <0.0001 Female sex 59% (255) 53% (199) 0.12 Body mass index, kg/m2 24 ± 4 25 ± 5 0.035 Systolic blood pressure, mm Hg 125 ± 13 122 ± 16 0.0078 mGFR, mL/min per 1.73 m2 85 ± 16 87 ± 16 0.32 Plasma phosphate, mmol/L 0.95 ± 0.15 0.96 ± 0.16 0.69 TmP/GFR, mmol/L 0.85 ± 0.19 0.86 ± 0.22 0.20 25(OH)D, µg/L 25 ± 10 26 ± 12 0.13 PTH, ng/L 39 (31–52) 39 (30–52) 0.67 Cterm-FGF23, RU/mL 82 (62–107) 71 (53–97) <0.0001 Characteristics ADPKD Controls P Patients, no. 434 355 — Age, y 39 ± 11 46 ± 15 <0.0001 Female sex 59% (255) 53% (199) 0.12 Body mass index, kg/m2 24 ± 4 25 ± 5 0.035 Systolic blood pressure, mm Hg 125 ± 13 122 ± 16 0.0078 mGFR, mL/min per 1.73 m2 85 ± 16 87 ± 16 0.32 Plasma phosphate, mmol/L 0.95 ± 0.15 0.96 ± 0.16 0.69 TmP/GFR, mmol/L 0.85 ± 0.19 0.86 ± 0.22 0.20 25(OH)D, µg/L 25 ± 10 26 ± 12 0.13 PTH, ng/L 39 (31–52) 39 (30–52) 0.67 Cterm-FGF23, RU/mL 82 (62–107) 71 (53–97) <0.0001 Values are expressed as % (number), mean ± standard deviation, or median (interquartile range) as appropriate. P represents tests of significance from Student t test, Mann-Whitney test, or Fisher exact test as appropriate. View Large Table 1. Comparison of Demographic and Biologic Characteristics of Patients With ADPKD and Controls Characteristics ADPKD Controls P Patients, no. 434 355 — Age, y 39 ± 11 46 ± 15 <0.0001 Female sex 59% (255) 53% (199) 0.12 Body mass index, kg/m2 24 ± 4 25 ± 5 0.035 Systolic blood pressure, mm Hg 125 ± 13 122 ± 16 0.0078 mGFR, mL/min per 1.73 m2 85 ± 16 87 ± 16 0.32 Plasma phosphate, mmol/L 0.95 ± 0.15 0.96 ± 0.16 0.69 TmP/GFR, mmol/L 0.85 ± 0.19 0.86 ± 0.22 0.20 25(OH)D, µg/L 25 ± 10 26 ± 12 0.13 PTH, ng/L 39 (31–52) 39 (30–52) 0.67 Cterm-FGF23, RU/mL 82 (62–107) 71 (53–97) <0.0001 Characteristics ADPKD Controls P Patients, no. 434 355 — Age, y 39 ± 11 46 ± 15 <0.0001 Female sex 59% (255) 53% (199) 0.12 Body mass index, kg/m2 24 ± 4 25 ± 5 0.035 Systolic blood pressure, mm Hg 125 ± 13 122 ± 16 0.0078 mGFR, mL/min per 1.73 m2 85 ± 16 87 ± 16 0.32 Plasma phosphate, mmol/L 0.95 ± 0.15 0.96 ± 0.16 0.69 TmP/GFR, mmol/L 0.85 ± 0.19 0.86 ± 0.22 0.20 25(OH)D, µg/L 25 ± 10 26 ± 12 0.13 PTH, ng/L 39 (31–52) 39 (30–52) 0.67 Cterm-FGF23, RU/mL 82 (62–107) 71 (53–97) <0.0001 Values are expressed as % (number), mean ± standard deviation, or median (interquartile range) as appropriate. P represents tests of significance from Student t test, Mann-Whitney test, or Fisher exact test as appropriate. View Large Table 2. Factors Associated With Plasma Cterm-FGF23: Multivariable Regression Analysis With Log Transformed Cterm-FGF23 as the Dependent Variable Standardized β Coefficient 95% Confidence Interval P ADPKD vs control 0.134 0.063 to 0.205 0.0002 Female vs male 0.191 0.121 to 0.262 <0.0001 Age, y −0.11 −0.189 to −0.032 0.006 Systolic blood pressure, mm Hg 0.007 −0.064 to 0.079 0.84 Body mass index, kg/m2 0.164 0.093 to 0.235 <0.0001 mGFR, mL/min per 1.73 m2 −0.141 −0.215 to −0.067 0.0002 Blood phosphate, mmol/L 0.096 0.024 to 0.167 0.008 Log 25(OH)D, log ng/mL 0.05 −0.023 to 0.123 0.18 Log PTH, log pg/mL 0.038 −0.039 to 0.114 0.33 Standardized β Coefficient 95% Confidence Interval P ADPKD vs control 0.134 0.063 to 0.205 0.0002 Female vs male 0.191 0.121 to 0.262 <0.0001 Age, y −0.11 −0.189 to −0.032 0.006 Systolic blood pressure, mm Hg 0.007 −0.064 to 0.079 0.84 Body mass index, kg/m2 0.164 0.093 to 0.235 <0.0001 mGFR, mL/min per 1.73 m2 −0.141 −0.215 to −0.067 0.0002 Blood phosphate, mmol/L 0.096 0.024 to 0.167 0.008 Log 25(OH)D, log ng/mL 0.05 −0.023 to 0.123 0.18 Log PTH, log pg/mL 0.038 −0.039 to 0.114 0.33 View Large Table 2. Factors Associated With Plasma Cterm-FGF23: Multivariable Regression Analysis With Log Transformed Cterm-FGF23 as the Dependent Variable Standardized β Coefficient 95% Confidence Interval P ADPKD vs control 0.134 0.063 to 0.205 0.0002 Female vs male 0.191 0.121 to 0.262 <0.0001 Age, y −0.11 −0.189 to −0.032 0.006 Systolic blood pressure, mm Hg 0.007 −0.064 to 0.079 0.84 Body mass index, kg/m2 0.164 0.093 to 0.235 <0.0001 mGFR, mL/min per 1.73 m2 −0.141 −0.215 to −0.067 0.0002 Blood phosphate, mmol/L 0.096 0.024 to 0.167 0.008 Log 25(OH)D, log ng/mL 0.05 −0.023 to 0.123 0.18 Log PTH, log pg/mL 0.038 −0.039 to 0.114 0.33 Standardized β Coefficient 95% Confidence Interval P ADPKD vs control 0.134 0.063 to 0.205 0.0002 Female vs male 0.191 0.121 to 0.262 <0.0001 Age, y −0.11 −0.189 to −0.032 0.006 Systolic blood pressure, mm Hg 0.007 −0.064 to 0.079 0.84 Body mass index, kg/m2 0.164 0.093 to 0.235 <0.0001 mGFR, mL/min per 1.73 m2 −0.141 −0.215 to −0.067 0.0002 Blood phosphate, mmol/L 0.096 0.024 to 0.167 0.008 Log 25(OH)D, log ng/mL 0.05 −0.023 to 0.123 0.18 Log PTH, log pg/mL 0.038 −0.039 to 0.114 0.33 View Large Cterm-FGF23 increase in patients with ADPKD and preserved renal function is associated with an increase in FGF23 cleavage The absence of renal phosphate leakage in the ADPKD group prompted us to assess whether α-Klotho concentration was decreased in patients with ADPKD. Resistance to FGF23 action due to a downregulation of its coreceptor, α-Klotho, in the kidney has been proposed as a mechanism of FGF23 elevation in ADPKD on the basis of low circulating α-Klotho levels (26). In our cohort, serum α-Klotho measurements were performed in patients who were investigated after 2015. The α-Klotho concentration was not significantly different between patients with ADPKD and controls (Supplemental Table 1). Multivariable analysis of the factors associated with Cterm-FGF23 levels revealed that belonging to the ADPKD group was associated with a higher Cterm-FGF23 concentration independently of serum α-Klotho levels (Supplemental Table 2). We then investigated whether the increase in FGF23 level was caused by increased C-terminal peptide only or the full-length protein. The Cterm-FGF23 assay did not discriminate between the intact phosphaturic hormone and the cleaved C-terminal part of the protein; therefore, we used an assay that specifically measured intact FGF23 in a subgroup of patients who were investigated after 2013. The characteristics of this subgroup, consisting of 246 patients with ADPKD and 136 controls, are presented in Supplemental Table 1. Both groups had similar mGFR, blood phosphate, and TmP/GFR. As in the whole cohort, patients with ADPKD displayed a significantly higher Cterm-FGF23 concentration than controls. In contrast, intact FGF23 plasma levels were similar in the two groups. This finding suggests that patients with ADPKD displayed a specific elevation of Cterm-FGF23. Furthermore, multivariable analyses showed that belonging to the ADPKD group was a risk factor for Cterm-FGF23 elevation independently of intact FGF23 and other potential confounding factors (Supplemental Table 1). To support this observation, we considered the ratio of intact FGF23 to Cterm-FGF23 concentration in the subgroup of patients with ADPKD who had an elevation in Cterm-FGF23 that was not explained by iron deficiency (n = 81). We compared this ratio with the ratio measured in healthy controls (n = 23), patients with CKD with reduced mGFR (n = 20), and patients with iron deficiency but normal mGFR (n = 8). We observed that both patients with ADPKD and patients with iron deficiency exhibited a significantly lower intact FGF23 to Cterm-FGF23 ratio than controls or patients with CKD (Supplemental Fig. 1). Collectively these results demonstrate that the Cterm-FGF23 elevation in patients with ADPKD reflects predominantly an increase in cleaved FGF23. FGF23 levels independently correlate with liver volume in patients with ADPKD We then investigated the potential mechanisms underlying Cterm-FGF23 elevation in patients with ADPKD. Although iron deficiency and inflammation have been associated with elevated Cterm-FGF23 concentrations, ectopic production of FGF23 by damaged kidney or liver cells has also been proposed (7, 11, 27, 28). Among the 434 patients with ADPKD included in our study, 154 underwent abdominal magnetic resonance imaging that allowed assessment of kidney and liver volume. These patients also underwent plasma C-reactive protein and ferritin measurement to assess inflammatory and iron status, respectively. We, therefore, analyzed the association of these parameters with Cterm-FGF23 levels in this population. After a simple regression analysis, only the ferritin level and height-adjusted liver volume (HtLV) significantly correlated with Cterm-FGF23 levels (Supplemental Table 3). Multivariable analysis showed that HtLV had the strongest independent association with Cterm-FGF23 (Table 3). This finding suggested that the Cterm-FGF23 elevation in ADPKD was related to the severity of cystic liver disease. Table 3. Factors Associated With Plasma Cterm-FGF23 in the Patients of the ADPKD Groups With Available Magnetic Resonance Imaging–Based Measurement of Kidney and Liver Volume: Regression Analysis With Log Transformed Cterm-FGF23 as the Dependent Variable Standardized β Coefficient 95% Confidence Interval P Sex −0.058 −0.265 to 0.148 0.58 Age, per y −0.044 −0.244 to 0.157 0.67 Body mass index, per kg/m2 −0.002 −0.158 to 0.153 0.97 mGFR, per mL/min per 1.73 m2 −0.147 −0.323 to 0.027 0.10 Log ferritin, per log µg/L −0.256 −0.469 to −0.043 0.02 Log C-reactive protein, per log mg/L 0.04 −0.117 to 0.197 0.62 Log HtKV, per log L/m 0.07 −0.106 to 0.247 0.43 Log HtLV, per log L/m 0.247 0.081 to 0.414 0.004 Standardized β Coefficient 95% Confidence Interval P Sex −0.058 −0.265 to 0.148 0.58 Age, per y −0.044 −0.244 to 0.157 0.67 Body mass index, per kg/m2 −0.002 −0.158 to 0.153 0.97 mGFR, per mL/min per 1.73 m2 −0.147 −0.323 to 0.027 0.10 Log ferritin, per log µg/L −0.256 −0.469 to −0.043 0.02 Log C-reactive protein, per log mg/L 0.04 −0.117 to 0.197 0.62 Log HtKV, per log L/m 0.07 −0.106 to 0.247 0.43 Log HtLV, per log L/m 0.247 0.081 to 0.414 0.004 Abbreviation: HtKV, height-adjusted kidney volume. View Large Table 3. Factors Associated With Plasma Cterm-FGF23 in the Patients of the ADPKD Groups With Available Magnetic Resonance Imaging–Based Measurement of Kidney and Liver Volume: Regression Analysis With Log Transformed Cterm-FGF23 as the Dependent Variable Standardized β Coefficient 95% Confidence Interval P Sex −0.058 −0.265 to 0.148 0.58 Age, per y −0.044 −0.244 to 0.157 0.67 Body mass index, per kg/m2 −0.002 −0.158 to 0.153 0.97 mGFR, per mL/min per 1.73 m2 −0.147 −0.323 to 0.027 0.10 Log ferritin, per log µg/L −0.256 −0.469 to −0.043 0.02 Log C-reactive protein, per log mg/L 0.04 −0.117 to 0.197 0.62 Log HtKV, per log L/m 0.07 −0.106 to 0.247 0.43 Log HtLV, per log L/m 0.247 0.081 to 0.414 0.004 Standardized β Coefficient 95% Confidence Interval P Sex −0.058 −0.265 to 0.148 0.58 Age, per y −0.044 −0.244 to 0.157 0.67 Body mass index, per kg/m2 −0.002 −0.158 to 0.153 0.97 mGFR, per mL/min per 1.73 m2 −0.147 −0.323 to 0.027 0.10 Log ferritin, per log µg/L −0.256 −0.469 to −0.043 0.02 Log C-reactive protein, per log mg/L 0.04 −0.117 to 0.197 0.62 Log HtKV, per log L/m 0.07 −0.106 to 0.247 0.43 Log HtLV, per log L/m 0.247 0.081 to 0.414 0.004 Abbreviation: HtKV, height-adjusted kidney volume. View Large Severely polycystic livers have elevated FGF23 mRNA and protein expression Having established that the Cterm-FGF23 elevation in patients with ADPKD was associated with the size of the liver and caused mainly by cleaved FGF23 protein, we aimed to identify the mechanisms responsible for FGF23 elevation in this context. To explore the possibility that the cystic liver could produce FGF23, we measured FGF23 mRNA expression in hepatic tissues from 10 patients with ADPKD who underwent partial hepatectomy because of symptomatic polycystic liver disease. Healthy peritumoral liver tissues served as controls (Fig. 1A). Remarkably, whereas FGF23 mRNA was barely detectable in control liver fragments, it was markedly expressed in the cystic liver samples from patients with ADPKD (Fig. 1A). In two patients for whom plasma samples and liver tissues were collected on the same day, we observed a marked concordance between hepatic FGF23 mRNA expression and circulating Cterm-FGF23 levels (Supplemental Fig. 2A). To determine whether FGF23 could accumulate in liver cysts, we measured Cterm-FGF23 concentrations in the cystic fluid of 18 liver cysts recovered from these two patients. Although Cterm-FGF23 could be detected in some cysts, Cterm-FGF23 concentrations in the cyst fluid were constantly lower than the plasma values, demonstrating that FGF23 did not accumulate in the cyst fluid (Supplemental Fig. 2B). We localized the FGF23 protein in the liver of patients with ADPKD with an FGF23-specific antibody (Fig. 1B). This antibody successfully labeled human osteoblasts, indicating its ability to recognize endogenous human FGF23 (Fig. 1B). FGF23 protein was not detected in the normal parts of liver sections from patients with liver cancer or in the noncystic liver sections from patients with ADPKD (Fig. 1B). By contrast, we found a strong focal FGF23 expression in hepatocytes adjacent to liver cysts. Collectively these results demonstrate expression of FGF23 mRNA and protein by cystic liver cells (Fig. 1B). Figure 1. View largeDownload slide (A) Measurement of FGF23 mRNA levels in cystic tissue fragments from patients with ADPKD (n = 10) and normal peritumoral hepatic tissues from controls (n = 10). Each dot indicates a single patient. P values represent tests of significance from Mann-Whitney tests. (B) Representative FGF23 immunostaining of cystic or noncystic liver sections from patients with ADPKD (n = 4 subjects) or normal peritumoral livers (n = 4 subjects). Osteoblasts from normal bone section served as positive controls for FGF23 staining. The insert shows the staining obtained by omitting the primary antibody. Scale bars: 100 µm. Figure 1. View largeDownload slide (A) Measurement of FGF23 mRNA levels in cystic tissue fragments from patients with ADPKD (n = 10) and normal peritumoral hepatic tissues from controls (n = 10). Each dot indicates a single patient. P values represent tests of significance from Mann-Whitney tests. (B) Representative FGF23 immunostaining of cystic or noncystic liver sections from patients with ADPKD (n = 4 subjects) or normal peritumoral livers (n = 4 subjects). Osteoblasts from normal bone section served as positive controls for FGF23 staining. The insert shows the staining obtained by omitting the primary antibody. Scale bars: 100 µm. Reduction of cystic liver mass is associated with a decrease in Cterm-FGF23 To determine whether hepatic FGF23 production could significantly contribute to the elevation of plasma Cterm-FGF23 in patients with ADPKD with severe cystic liver disease, we assessed the impact of a surgical reduction of cystic liver mass on Cterm-FGF23 levels. We therefore focused on the rare patients with ADPKD who were investigated both before and after liver mass reduction. In our group as in others, only a limited number of patients with ADPKD were treated with partial hepatectomy or liver transplantation because of severe polycystic liver (29). Most patients with ADPKD with an even modestly reduced GFR undergo liver transplantation in concert with renal transplantation (29). For these reasons we identified in our cohort only 12 patients who underwent a total of 13 hepatic surgeries and were explored before and after surgery. The characteristics of these patients are presented in Supplemental Table 4 and Fig. 2A. All but two patients displayed an elevated Cterm-FGF23 concentration before the surgery. After the surgery, Cterm-FGF23 concentrations significantly decreased, whereas the mGFR did not significantly improve (Fig. 2A). We also compared the variation of Cterm-FGF23 observed after liver surgery with its spontaneous variation observed in 65 patients with ADPKD who had repeated measurements of mGFR and Cterm-FGF23 levels and did not undergo liver surgery. Patients who had a reduction of cystic liver mass presented a significant decrease in Cterm-FGF23 concentration compared to controls (Fig. 2B). The association between hepatic surgery and Cterm-FGF23 level reduction remained significant after we adjusted for potential confounding variables (Table 4). The intact FGF23 measurement was available before and after liver transplantation for two patients. In line with our previous findings, we observed a marked dissociation between intact FGF23 and Cterm-FGF23 levels before surgery. Indeed, whereas after liver transplantation Cterm-FGF23 levels decreased and intact FGF23 levels did not change (Fig. 2C). Figure 2. View largeDownload slide (A) Cterm-FGF23 plasma levels and mGFR measured in patients with ADPKD before and after surgical reduction of cystic liver mass. Each dot represents an individual patient. P values represent tests of significance from paired Student t tests. (B) Variation of Cterm-FGF23 plasma level and mGFR before and after surgical reduction of cystic liver mass (n = 13) compared with the spontaneous variation of FGF23 and mGFR observed in patients with ADPKD without liver surgery (controls n = 65); bars indicate means. P values represent tests of significance from Student t test. (C) Cterm-FGF23 and intact FGF23 measured before and after surgical reduction of cystic liver mass in patients P4 (upper panel) and P1.2 (lower panel). Figure 2. View largeDownload slide (A) Cterm-FGF23 plasma levels and mGFR measured in patients with ADPKD before and after surgical reduction of cystic liver mass. Each dot represents an individual patient. P values represent tests of significance from paired Student t tests. (B) Variation of Cterm-FGF23 plasma level and mGFR before and after surgical reduction of cystic liver mass (n = 13) compared with the spontaneous variation of FGF23 and mGFR observed in patients with ADPKD without liver surgery (controls n = 65); bars indicate means. P values represent tests of significance from Student t test. (C) Cterm-FGF23 and intact FGF23 measured before and after surgical reduction of cystic liver mass in patients P4 (upper panel) and P1.2 (lower panel). Table 4. Association Between Cystic Liver Mass Reduction and Modification of Cterm-FGF23 Plasma Levels: Multivariable Analysis β Coefficient 95% Confidence Interval P Model 1 −95 −120 to −70 <0.0001 Model 2 −85 −110 to −60 <0.0001 Model 3 −99 −128 to −70 <0.0001 β Coefficient 95% Confidence Interval P Model 1 −95 −120 to −70 <0.0001 Model 2 −85 −110 to −60 <0.0001 Model 3 −99 −128 to −70 <0.0001 Model 1: adjustment for Δage and ΔmGFR. Model 2: model 1 + adjustment for Δphosphate and ΔPTH. Model 3: model 2 + adjustment for Δferritin. View Large Table 4. Association Between Cystic Liver Mass Reduction and Modification of Cterm-FGF23 Plasma Levels: Multivariable Analysis β Coefficient 95% Confidence Interval P Model 1 −95 −120 to −70 <0.0001 Model 2 −85 −110 to −60 <0.0001 Model 3 −99 −128 to −70 <0.0001 β Coefficient 95% Confidence Interval P Model 1 −95 −120 to −70 <0.0001 Model 2 −85 −110 to −60 <0.0001 Model 3 −99 −128 to −70 <0.0001 Model 1: adjustment for Δage and ΔmGFR. Model 2: model 1 + adjustment for Δphosphate and ΔPTH. Model 3: model 2 + adjustment for Δferritin. View Large Discussion The intriguing observation that patients with ADPKD with preserved kidney function displayed higher Cterm-FGF23 concentrations than other patients with CKD was made in a single study of 100 subjects with ADPKD who were compared with a limited number of controls (20). These patients presented a slightly lower serum phosphate concentration and a lower TmP/GFR than the control group. This finding was initially interpreted as FGF23-dependent renal phosphate leakage. However, a subsequent comparison of renal phosphate handling and Cterm-FGF23 plasma concentration between the same patients with ADPKD and patients with X-linked hypophosphatemic rickets, a genetic cause of FGF23-dependent renal phosphate leakage, showed that most of the patients with ADPKD had normal renal phosphate handling, compared with patients with X-linked hypophosphatemic rickets with similar levels of FGF23 (26). The reason for this discrepancy between elevated Cterm-FGF23 levels and nearly normal phosphate renal handling in this cohort remains unclear. Resistance to the phosphaturic action of FGF23 caused by a reduction in renal Klotho abundance has been proposed but not formally proven (26). In a recent study in 99 children with ADPKD, the phosphate level was slightly lower compared with healthy age-matched controls (30). This decrease was not caused by impaired renal phosphate reabsorption because TmP/GFR and Cterm-FGF23 were not lower than in controls (31). Intact FGF23 was not measured in this study, making it impossible to confirm a dissociation between intact FGF23 and Cterm-FGF23 concentrations in children with ADPKD. In this context, our study provides important insights. First, we confirmed in a large cohort that the Cterm-FGF23, but not intact FGF23, concentration is higher in adults with ADPKD than in control patients with similar GFR. Although we used the same assay as Pavik et al. (26) to measure Cterm-FGF23, the plasma concentration we found in our ADPKD cohort was half as much as in the Suisse ADPKD cohort. The reason for this difference is unclear. None of the slight differences in the composition of the cohort could provide a satisfying explanation for this discrepancy. Systemic inflammation and iron deficiency were not reported in the Suisse ADPKD cohort; therefore, these confounding factors may have contributed to the high Cterm-FGF23 levels observed in this cohort. Although the average increase in Cterm-FGF23 concentration in the patients with ADPKD appears modest in our cohort, a restricted subset of patients displays a marked elevation of Cterm-FGF23 concentration, as exemplified by the majority of patients needing liver surgery. Our results also revealed a lower intact FGF23 to Cterm-FGF23 ratio in patients with ADPKD with elevated Cterm-FGF23 than in controls with CKD, suggesting a preferential secretion of cleaved FGF23 in ADPKD. Cleaved FGF23 peptides lack phosphaturic activity. Therefore, the preferential elevation in cleaved FGF23 plasma levels in patients with ADPKD provides a simple explanation for the absence of renal phosphate leak observed in this disease. The mechanism responsible for elevated FGF23 plasma levels in ADPKD remains unclear. In two rodent models of polycystic kidney disease, FGF23 synthesis by polycystic kidneys has been reported (27). However, the production of FGF23 by kidney cells is not a specific feature of polycystic kidney diseases. Indeed, renal FGF23 mRNA expression parallels the development of lesions in Zucker diabetic fatty rats or in the obstructed kidney after unilateral obstruction in mice (31, 32). Thus, renal expression of FGF23 is probably a corollary to kidney injury and may not explain the additional increase in FGF23 levels in patients with ADPKD compared with subjects with similar GFR. In our study, plasma FGF23 concentrations did not correlate independently with kidney volume. We hypothesized that another ectopic source of FGF23 could be involved in ADPKD. We have previously reported that patients with cirrhosis and normal renal function have elevated FGF23 plasma concentrations and that experimental induction of liver damage in mice induced the hepatic expression of FGF23 mRNA (11). The current study further expands ectopic production of FGF23 by diseased liver cells to ADPKD. Three independent lines of evidence support this hypothesis: the Cterm-FGF23 plasma level independently correlated with liver volume in patients with ADPKD, FGF23 mRNA was increased in the polycystic liver and FGF23 protein was detected in pericystic hepatocytes, and surgical reduction of cystic liver mass was associated with a reduction of the Cterm-FGF23 plasma level that was independent of mGFR, plasma phosphate, PTH, or ferritin variations. However, our results do not demonstrate that the increase in Cterm-FGF23 observed in patients with ADPKD with severe polycystic liver disease is the sole consequence of an ectopic production of FGF23 by liver cells. Indeed, the polycystic liver cells may also deliver endocrine signals, causing increased production of cleaved FGF23 by osteoblastic cells. The mechanisms responsible for the increase in Cterm-FGF23 synthesis by pericystic hepatocytes remain to be established. Interestingly, inflammatory cytokines such as interleukin 1β or oncostatin M have been shown to promote FGF23 transcription in osteoblasts (33) and cardiomyocytes (34), respectively. Cyst progression in polycystic kidney disease is associated with the recruitment of macrophages, which is thought to be driven by the upregulation of the chemokine CCL2. Notably, transgenic expression of CCL2 in the heart has been shown to drive the secretion of cleaved FGF23 by cardiomyocytes via a paracrine pathway. Whether similar mechanisms account for the synthesis of cleaved FGF23 by hepatocytes in ADPKD has not been explored. A critical question raised by our study is the pathophysiologic significance of Cterm-FGF23 fragment production by the cystic liver in ADPKD. The Cterm-FGF23 binds to the α-Klotho–FGFR receptor complex but does not elicit classic FGF23–α-Klotho dependent signaling and lacks phosphaturic activity (6). It has even been suggested that the Cterm-FGF23 fragment could oppose FGF23 phosphaturic effects (35). Such opposition does not seem to be the case in patients with ADPKD at the concentrations of Cterm-FGF23 observed in our study, because their serum phosphate concentrations and TmP/GFR were not higher than in controls. However, this absence of α-Klotho–dependent signaling does not imply that the cleaved Cterm-FGF23 lacks biological activity. Emerging evidence supports the view that the deleterious effects of FGF23 on cardiomyocytes, leukocytes, and hepatocytes are mediated through α-Klotho–independent signaling (16, 17, 36). In this context, we have recently reported that the Cterm-FGF23 induces cardiomyocyte hypertrophy in vitro in an α-Klotho–independent manner via FGF-R activation (23). This observation supports the ability of FGF23 fragments to elicit signaling in humans. This point is of primary interest because in addition to ADPKD, a growing number of conditions, including iron deficiency (33), systemic inflammation (33), sickle cell disease (23), heart failure (34), and cardiac bypass (37), are reported to induce a preferential increase in the abundance of cleaved FGF23 fragments. Whether FGF23 fragments exert some biologic function in vivo remains to be established. Another question raised by our study is the potential role of locally produced FGF23 on the progression of liver cysts. Murine hepatocytes express the FGF-R4 receptor, and its activation by FGF23 promotes the expression of inflammatory cytokines in an α-Klotho–independent way (17). Local inflammation plays a central role in the progression of kidney cysts in ADPKD (38, 39). It is therefore plausible that locally produced FGF23 could induce a local inflammatory response, which, in turn, would stimulate cyst growth. Determining whether FGF23 represents a valid therapeutic target or a pertinent biomarker for liver or kidney cyst progression warrants further evaluation. In conclusion, this study, which assessed both Cterm-FGF23 and intact FGF23 circulating levels in the largest cohort of patients with ADPKD studied so far, sheds light on unexpected aspects regarding the production and the potential pathophysiologic function of FGF23 in ADPKD. The identification of the cystic liver as a source of FGF23 opens an area of research in the field of FGF23 and ADPKD and raises essential pathophysiologic questions about the functions of ectopically produced FGF23 in renal and liver cystic disease. Abbreviations: Abbreviations: 25(OH)D 25-hydroxy-vitamin D ADPKD autosomal dominant polycystic kidney disease CKD chronic kidney disease Cterm-FGF23 C-terminal fragment of fibroblast growth factor 23 ELISA enzyme-linked immunosorbent assay FGF fibroblast growth factor FGF-R fibroblast growth factor receptor GFR glomerular filtration rate HtLV height-adjusted liver volume mGFR measured glomerular filtration rate mRNA messenger RNA PTH parathyroid hormone TmP tubular maximum reabsorption of phosphate Acknowledgments The authors thank Dr. Khalil El Karoui, Dr. Marie Courbebaisse, Dr. Dominique Eladari, and Dr. Ghania Daoud for their help in collecting patient data and determining mGFR and the staff members of the human tissue bank of Beaujon Hospital. The authors are grateful to Nicolas Kupperwasser for his help in editing the manuscript. Financial Support: This work was supported by the Institut National de la Santé et de la Recherche Médicale, Université Paris Descartes, and Assistance Publique–Hôpitaux de Paris. Disclosure Summary: The authors have nothing to disclose. References 1. Han X , Quarles LD . Multiple faces of fibroblast growth factor-23 . Curr Opin Nephrol Hypertens . 2016 ; 25 ( 4 ): 333 – 342 . Google Scholar CrossRef Search ADS PubMed 2. Kuro-o M , Matsumura Y , Aizawa H , Kawaguchi H , Suga T , Utsugi T , Ohyama Y , Kurabayashi M , Kaname T , Kume E , Iwasaki H , Iida A , Shiraki-Iida T , Nishikawa S , Nagai R , Nabeshima YI . Mutation of the mouse klotho gene leads to a syndrome resembling ageing . Nature . 1997 ; 390 ( 6655 ): 45 – 51 . Google Scholar CrossRef Search ADS PubMed 3. Nakatani T , Sarraj B , Ohnishi M , Densmore MJ , Taguchi T , Goetz R , Mohammadi M , Lanske B , Razzaque MS . In vivo genetic evidence for klotho-dependent, fibroblast growth factor 23 (Fgf23)-mediated regulation of systemic phosphate homeostasis . FASEB J . 2009 ; 23 ( 2 ): 433 – 441 . Google Scholar CrossRef Search ADS PubMed 4. Komaba H , Fukagawa M . The role of FGF23 in CKD--with or without Klotho . Nat Rev Nephrol . 2012 ; 8 ( 8 ): 484 – 490 . Google Scholar CrossRef Search ADS PubMed 5. Tagliabracci VS , Engel JL , Wiley SE , Xiao J , Gonzalez DJ , Nidumanda Appaiah H , Koller A , Nizet V , White KE , Dixon JE . Dynamic regulation of FGF23 by Fam20C phosphorylation, GalNAc-T3 glycosylation, and furin proteolysis . Proc Natl Acad Sci USA . 2014 ; 111 ( 15 ): 5520 – 5525 . Google Scholar CrossRef Search ADS PubMed 6. Goetz R , Nakada Y , Hu MC , Kurosu H , Wang L , Nakatani T , Shi M , Eliseenkova AV , Razzaque MS , Moe OW , Kuro-o M , Mohammadi M . Isolated C-terminal tail of FGF23 alleviates hypophosphatemia by inhibiting FGF23-FGFR-Klotho complex formation . Proc Natl Acad Sci USA . 2010 ; 107 ( 1 ): 407 – 412 . Google Scholar CrossRef Search ADS PubMed 7. Wolf M , Koch TA , Bregman DB . Effects of iron deficiency anemia and its treatment on fibroblast growth factor 23 and phosphate homeostasis in women . J Bone Miner Res . 2013 ; 28 ( 8 ): 1793 – 1803 . Google Scholar CrossRef Search ADS PubMed 8. Smith ER . The use of fibroblast growth factor 23 testing in patients with kidney disease . Clin J Am Soc Nephrol . 2014 ; 9 ( 7 ): 1283 – 1303 . Google Scholar CrossRef Search ADS PubMed 9. Shalhoub V , Shatzen EM , Ward SC , Davis J , Stevens J , Bi V , Renshaw L , Hawkins N , Wang W , Chen C , Tsai MM , Cattley RC , Wronski TJ , Xia X , Li X , Henley C , Eschenberg M , Richards WG . FGF23 neutralization improves chronic kidney disease–associated hyperparathyroidism yet increases mortality . J Clin Invest . 2012 ; 122 ( 7 ): 2543 – 2553 . Google Scholar CrossRef Search ADS PubMed 10. Hasegawa H , Nagano N , Urakawa I , Yamazaki Y , Iijima K , Fujita T , Yamashita T , Fukumoto S , Shimada T . Direct evidence for a causative role of FGF23 in the abnormal renal phosphate handling and vitamin D metabolism in rats with early-stage chronic kidney disease . Kidney Int . 2010 ; 78 ( 10 ): 975 – 980 . Google Scholar CrossRef Search ADS PubMed 11. Prié D , Forand A , Francoz C , Elie C , Cohen I , Courbebaisse M , Eladari D , Lebrec D , Durand F , Friedlander G . Plasma fibroblast growth factor 23 concentration is increased and predicts mortality in patients on the liver-transplant waiting list . PLoS One . 2013 ; 8 ( 6 ): e66182 . Google Scholar CrossRef Search ADS PubMed 12. Grabner A , Faul C . The role of fibroblast growth factor 23 and Klotho in uremic cardiomyopathy . Curr Opin Nephrol Hypertens . 2016 ; 25 ( 4 ): 314 – 324 . Google Scholar CrossRef Search ADS PubMed 13. Chonchol M , Greene T , Zhang Y , Hoofnagle AN , Cheung AK . Low vitamin D and high fibroblast growth factor 23 serum levels associate with infectious and cardiac deaths in the HEMO study . J Am Soc Nephrol . 2016 ; 27 ( 1 ): 227 – 237 . Google Scholar CrossRef Search ADS PubMed 14. Faul C , Amaral AP , Oskouei B , Hu MC , Sloan A , Isakova T , Gutiérrez OM , Aguillon-Prada R , Lincoln J , Hare JM , Mundel P , Morales A , Scialla J , Fischer M , Soliman EZ , Chen J , Go AS , Rosas SE , Nessel L , Townsend RR , Feldman HI , St John Sutton M , Ojo A , Gadegbeku C , Di Marco GS , Reuter S , Kentrup D , Tiemann K , Brand M , Hill JA , Moe OW , Kuro-O M , Kusek JW , Keane MG , Wolf M . FGF23 induces left ventricular hypertrophy . J Clin Invest . 2011 ; 121 ( 11 ): 4393 – 4408 . Google Scholar CrossRef Search ADS PubMed 15. Grabner A , Amaral AP , Schramm K , Singh S , Sloan A , Yanucil C , Li J , Shehadeh LA , Hare JM , David V , Martin A , Fornoni A , Di Marco GS , Kentrup D , Reuter S , Mayer AB , Pavenstädt H , Stypmann J , Kuhn C , Hille S , Frey N , Leifheit-Nestler M , Richter B , Haffner D , Abraham R , Bange J , Sperl B , Ullrich A , Brand M , Wolf M , Faul C . Activation of cardiac fibroblast growth factor receptor 4 causes left ventricular hypertrophy . Cell Metab . 2015 ; 22 ( 6 ): 1020 – 1032 . Google Scholar CrossRef Search ADS PubMed 16. Rossaint J , Oehmichen J , Van Aken H , Reuter S , Pavenstädt HJ , Meersch M , Unruh M , Zarbock A . FGF23 signaling impairs neutrophil recruitment and host defense during CKD . J Clin Invest . 2016 ; 126 ( 3 ): 962 – 974 . Google Scholar CrossRef Search ADS PubMed 17. Singh S , Grabner A , Yanucil C , Schramm K , Czaya B , Krick S , Czaja MJ , Bartz R , Abraham R , Di Marco GS , Brand M , Wolf M , Faul C . Fibroblast growth factor 23 directly targets hepatocytes to promote inflammation in chronic kidney disease . Kidney Int . 2016 ; 90 ( 5 ): 985 – 996 . Google Scholar CrossRef Search ADS PubMed 18. Willey CJ , Blais JD , Hall AK , Krasa HB , Makin AJ , Czerwiec FS . Prevalence of autosomal dominant polycystic kidney disease in the European Union . Nephrol Dial Transplant . 2017 ; 32 ( 8 ): 1356 – 1363 . Google Scholar PubMed 19. Cornec-Le Gall E , Audrézet MP , Chen JM , Hourmant M , Morin MP , Perrichot R , Charasse C , Whebe B , Renaudineau E , Jousset P , Guillodo MP , Grall-Jezequel A , Saliou P , Férec C , Le Meur Y . Type of PKD1 mutation influences renal outcome in ADPKD . J Am Soc Nephrol . 2013 ; 24 ( 6 ): 1006 – 1013 . Google Scholar CrossRef Search ADS PubMed 20. Pavik I , Jaeger P , Kistler AD , Poster D , Krauer F , Cavelti-Weder C , Rentsch KM , Wüthrich RP , Serra AL . Patients with autosomal dominant polycystic kidney disease have elevated fibroblast growth factor 23 levels and a renal leak of phosphate . Kidney Int . 2011 ; 79 ( 2 ): 234 – 240 . Google Scholar CrossRef Search ADS PubMed 21. Prié D , Beck L , Silve C , Friedlander G . Hypophosphatemia and calcium nephrolithiasis . Nephron, Exp Nephrol . 2004 ; 98 ( 2 ): e50 – e54 . Google Scholar CrossRef Search ADS 22. Seeherunvong W , Wolf M . Tertiary excess of fibroblast growth factor 23 and hypophosphatemia following kidney transplantation . Pediatr Transplant . 2011 ; 15 ( 1 ): 37 – 46 . Google Scholar CrossRef Search ADS PubMed 23. Courbebaisse M , Mehel H , Petit-Hoang C , Ribeil J-AJ-A , Sabbah L , Tuloup-Minguez V , Bergerat D , Arlet J-BJ-B , Stanislas A , Souberbielle J-CJ-C , Le Clésiau H , Fischmeister R , Friedlander G , Prié D . Carboxy-terminal fragment of fibroblast growth factor 23 induces heart hypertrophy in sickle cell disease . Haematologica . 2017 ; 102 ( 2 ): e33 – e35 . Google Scholar CrossRef Search ADS PubMed 24. Courbebaisse M , Thervet E , Souberbielle JC , Zuber J , Eladari D , Martinez F , Mamzer-Bruneel MF , Urena P , Legendre C , Friedlander G , Prié D . Effects of vitamin D supplementation on the calcium-phosphate balance in renal transplant patients . Kidney Int . 2009 ; 75 ( 6 ): 646 – 651 . Google Scholar CrossRef Search ADS PubMed 25. Kim Y , Ge Y , Tao C , Zhu J , Chapman AB , Torres VE , Yu ASL , Mrug M , Bennett WM , Flessner MF , Landsittel DP , Bae KT ; Consortium for Radiologic Imaging Studies of Polycystic Kidney Disease (CRISP) . Automated segmentation of kidneys from MR images in patients with autosomal dominant polycystic kidney disease . Clin J Am Soc Nephrol . 2016 ; 11 ( 4 ): 576 – 584 . Google Scholar CrossRef Search ADS PubMed 26. Pavik I , Jaeger P , Ebner L , Poster D , Krauer F , Kistler AD , Rentsch K , Andreisek G , Wagner CA , Devuyst O , Wüthrich RP , Schmid C , Serra AL . Soluble klotho and autosomal dominant polycystic kidney disease . Clin J Am Soc Nephrol . 2012 ; 7 ( 2 ): 248 – 257 . Google Scholar CrossRef Search ADS PubMed 27. Spichtig D , Zhang H , Mohebbi N , Pavik I , Petzold K , Stange G , Saleh L , Edenhofer I , Segerer S , Biber J , Jaeger P , Serra AL , Wagner CA . Renal expression of FGF23 and peripheral resistance to elevated FGF23 in rodent models of polycystic kidney disease . Kidney Int . 2014 ; 85 ( 6 ): 1340 – 1350 . Google Scholar CrossRef Search ADS PubMed 28. Isakova T , Wahl P , Vargas GS , Gutiérrez OM , Scialla J , Xie H , Appleby D , Nessel L , Bellovich K , Chen J , Hamm L , Gadegbeku C , Horwitz E , Townsend RR , Anderson CA , Lash JP , Hsu CY , Leonard MB , Wolf M . Fibroblast growth factor 23 is elevated before parathyroid hormone and phosphate in chronic kidney disease . Kidney Int . 2011 ; 79 ( 12 ): 1370 – 1378 . Google Scholar CrossRef Search ADS PubMed 29. Aussilhou B , Douflé G , Hubert C , Francoz C , Paugam C , Paradis V , Farges O , Vilgrain V , Durand F , Belghiti J . Extended liver resection for polycystic liver disease can challenge liver transplantation . Ann Surg . 2010 ; 252 ( 5 ): 735 – 743 . Google Scholar CrossRef Search ADS PubMed 30. De Rechter S , Bacchetta J , Godefroid N , Dubourg L , Cochat P , Maquet J , Raes A , De Schepper J , Vermeersch P , Van Dyck M , Levtchenko E , D’Haese P , Evenepoel P , Mekahli D . Evidence for bone and mineral metabolism alterations in children with autosomal dominant polycystic kidney disease . J Clin Endocrinol Metab . 2017 ; 102 ( 11 ): 4210 – 4217 . Google Scholar CrossRef Search ADS PubMed 31. Zanchi C , Locatelli M , Benigni A , Corna D , Tomasoni S , Rottoli D , Gaspari F , Remuzzi G , Zoja C . Renal expression of FGF23 in progressive renal disease of diabetes and the effect of ACE inhibitor . PLoS One . 2013 ; 8 ( 8 ): e70775 . Google Scholar CrossRef Search ADS PubMed 32. Mace ML , Gravesen E , Nordholm A , Hofman-Bang J , Secher T , Olgaard K , Lewin E . Kidney fibroblast growth factor 23 does not contribute to elevation of its circulating levels in uremia . Kidney Int . 2017 ; 92 ( 1 ): 165 – 178 . Google Scholar CrossRef Search ADS PubMed 33. David V , Martin A , Isakova T , Spaulding C , Qi L , Ramirez V , Zumbrennen-Bullough KB , Sun CC , Lin HY , Babitt JL , Wolf M . Inflammation and functional iron deficiency regulate fibroblast growth factor 23 production . Kidney Int . 2016 ; 89 ( 1 ): 135 – 146 . Google Scholar CrossRef Search ADS PubMed 34. Richter M , Lautze H-JJ , Walther T , Braun T , Kostin S , Kubin T . The failing heart is a major source of circulating FGF23 via oncostatin M receptor activation . J Heart Lung Transplant . 2015 ; 34 ( 9 ): 1211 – 1214 . Google Scholar CrossRef Search ADS PubMed 35. Johnson K , Levine K , Sergi J , Chamoun J , Roach R , Vekich J , Favis M , Horn M , Cao X , Miller B , Snyder W , Aivazian D , Reagan W , Berryman E , Colangelo J , Markiewicz V , Bagi CM , Brown TP , Coyle A , Mohammadi M , Magram J . Therapeutic effects of FGF23 c-tail Fc in a murine preclinical model of X-linked hypophosphatemia via the selective modulation of phosphate reabsorption . J Bone Miner Res . 2017 ; 32 ( 10 ): 2062 – 2073 . Google Scholar CrossRef Search ADS PubMed 36. Faul C , Amaral AP , Oskouei B , Hu M , Sloan A , Isakova T , Gutiérrez OM , Aguillon-prada R , Lincoln J , Hare JM , Mundel P , Morales A , Scialla J , Fischer M , Soliman EZ , Feldman HI , St M , Sutton J , Ojo A , Gadegbeku C , Seno G , Marco D , Reuter S , Kentrup D , Tiemann K , Brand M , Hill JA , Moe OW , Kuro-o M , Kusek JW , Keane MG , Wolf M . FGF23 induces left ventricular hypertrophy . J Clin Invest . 2011 ; 121 ( 11 ): 4393 – 4408 . Google Scholar CrossRef Search ADS PubMed 37. Leaf DE , Christov M , Jüppner H , Siew E , Ikizler TA , Bian A , Chen G , Sabbisetti VS , Bonventre JV , Cai X , Wolf M , Waikar SS . Fibroblast growth factor 23 levels are elevated and associated with severe acute kidney injury and death following cardiac surgery . Kidney Int . 2016 ; 89 ( 4 ): 939 – 948 . Google Scholar CrossRef Search ADS PubMed 38. Karihaloo A , Koraishy F , Huen SC , Lee Y , Merrick D , Caplan MJ , Somlo S , Cantley LG . Macrophages promote cyst growth in polycystic kidney disease . J Am Soc Nephrol . 2011 ; 22 ( 10 ): 1809 – 1814 . Google Scholar CrossRef Search ADS PubMed 39. Chen L , Zhou X , Fan LX , Yao Y , Swenson-Fields KI , Gadjeva M , Wallace DP , Peters DJM , Yu A , Grantham JJ , Li X . Macrophage migration inhibitory factor promotes cyst growth in polycystic kidney disease . J Clin Invest . 2015 ; 125 ( 6 ): 2399 – 2412 . Google Scholar CrossRef Search ADS PubMed Copyright © 2018 Endocrine Society
Journal
Journal of Clinical Endocrinology and Metabolism – Oxford University Press
Published: Mar 29, 2018