Hepatic, Metabolic, and Toxicity Evaluation of Repeated Oral Administration of SnS2 Nanoflowers in Mice

Hepatic, Metabolic, and Toxicity Evaluation of Repeated Oral Administration of SnS2 Nanoflowers... Abstract Tin sulfide (SnS2) nanoflowers (NFs) with highly photocatalytic activity for wastewater treatment may lead to potential health hazards via oral routes of human exposure. No studies have reported the hepatic effects of SnS2 NFs on the metabolic function and hepatotoxicity. In this study, we examined the hepatic effects of the oral administration of SnS2 NFs (250–1000 mg/kg) to ICR mice for 14 days, with the particle size ranging from 50 to 200 nm. Serum and liver tissue samples were assayed using biochemical analysis, liver histopathology and metabolic gene expression. The different sizes of SnS2 NFs (250 mg/kg dose), such as 50, 80, and 200 nm, did not induce any adverse hepatic effect related to biochemical parameters or histopathology in the treated mice compared with controls. The oral administration of 50-nm SnS2 NFs at doses of 250, 500, and 1000 mg/kg for 14 days produced dose-dependent hepatotoxicity and inflammatory responses in treated mice. Furthermore, the expression of metabolic genes in the liver tissues was altered, supporting the SnS2 NF-related hepatotoxic phenotype. The oral administration of SnS2 NFs also produced abnormal microstructures in the livers of the treated mice. Taken together, these data indicate that the increased risk of hepatotoxicity in SnS2 NF-treated mice was independent of the particle size but was dependent on their dose. The no-observed-adverse effect level was <250 mg/kg for the 50-nm SnS2 NFs. Our study provides an experimental basis for the safe application of SnS2 NFs. tin sulfide nanoflowers, liver metabolism, Inflammatory responses Nanomaterials, at least 1 dimension ranging 1–100 nm in size, have diverse applications, eg, as drug carriers, industrial fillers, opacifiers and catalysts, in addition to the production of semiconductors, cosmetics and microelectronics (Nel et al., 2006). The dissemination of nanoparticles (NPs) may have negative environmental and ecological effects, as well as adverse effects in humans (Borm et al., 2006; Holsapple et al., 2005; Kipen et al., 2005). Experimental evidence has confirmed the toxic effects of NPs at the tissue, cellular, subcellular and molecular levels (Lam et al., 2004; Lin et al., 2006; Wang et al., 2007a,b). Tin sulfide (SnS2) is a II–IV semiconductor with photoelectric properties within the visible spectrum (Ge et al., 2011; Liang et al., 2016; Oliveira et al., 2014; Wang et al., 2016; Yan et al., 2009, 2011). SnS2 nanomaterials have electrical and nonlinear optical properties that are different from those of SnS2 blocks or thin films. Hexagonal nanosheets, in addition to being nontoxic, have advantageous uses as photocatalysts and possess high efficiency, chemical stability in acidic and neutral pH aqueous solutions and thermal stability in air (Du et al., 2011; Zhang et al., 2013). Similarly, SnS2 nanoflowers (NFs) are novel nanomaterials with excellent photocatalytic properties, but their potential public health effects remain unclear. We have previously shown that the overdose of intraperitoneally injected SnS2 NFs can cause damage and increase the permeability within the blood-testis barrier in mouse testicular tissues. In addition, nanosized SnS2 particles (50 and 80 nm) exhibit greater reactivity than microsized SnS2 particles (200 nm) (Bai et al., 2017). SnS2 NFs are widely used in consumer products, including paints, textiles and sunscreens, and particularly for photocatalytic and antibacterial applications (Wallach et al., 2015). Alongside this, SnS2 NFs can play an important role in waste water treatment, and it may create a risk for the pollution of soil and water resources. Therefore, the gastrointestinal tract becomes an important absorption route for SnS2 NFs, and disturbances in the amino acid metabolism and gut microflora environment results in liver injury (Bu et al., 2010). Furthermore, existing information on the relationship between SnS2 NFs and liver toxicity is very limited, particularly in relation to in vivo studies. Therefore, in this study, 3 different sized SnS2 NFs (50, 80, and 200 nm) were prepared and repeatedly orally administered to mice at doses of 250, 500, and 1000 mg/kg for 14 days to evaluate hepatotoxicity. The resulting biochemical reactions, oxidative damage, metabolic changes and microstructures of the liver tissues, as well as inflammatory responses and histopathological effects, were studied to evaluate the hazardous effects of SnS2 NFs. MATERIALS AND METHODS Chemicals and characterization of SnS2 NFs 3 different sizes of SnS2 NFs (the diameter were 50, 80, and 200 nm) with high purity were provided by the Department of Applied Physics, Tianjin Key Laboratory of low-dimensional materials physics and preparing technology, Faculty of Science, Tianjin University. SnS2 NFs were synthesized by a 1-step hydrothermal growth reaction. All the chemicals used in this experiment were of analytical grade without further purification. The method of synthesis and characterization of of SnS2 flowers has been introduced in our recent article (Bai et al., 2017). To understand how SnS2 NF behave and where it translocated across the digestive tract and then to liver, the hydrodynamic sizes and zeta potential of SnS2 NFs were examined using a Zetasizer (Malvern Nano-ZS90, Britain) to examine the aggregate or distributed status of SnS2 NFs in acidic solution with BSA (bovine serum albumin) or not at various pH values (Fed: stomach pH2.98 and duodenum pH4.04; Fasted: stomach pH4.04 and duodenum pH4.74 in mice) (McConnell et al., 2008). The mean particle diameter is calculated by the software from the particle distributions measured. Pure SnCl4٠5H2O was purchased from Tianjin Superstar st source Chemistry Technological Co., Ltd. (Tianjin, China). Triton X-100 was purchased from Shanghai Yiteng Biological Science and Technology Co., Ltd. (Shanghai, China). Pure ethanol amine was purchased from Shanghai Mindray Chemistry Technology Co., Ltd. (Shanghai, China). Chemicals were all guaranteed reagents. Animal rearing and treatment As the main aim was to test whether SnS2 NFs could induce hepatic toxicology but not concerned about gender differences, male mice were employed in this study. Adult 70 male specific-pathogen-free Institute of Cancer Research (ICR) mice, body weight (BW) 29–33 g, bought from the Laboratory Animal Center of North China University of Science and Technology and conducted in full accordance with the PHS Policy on Humane Care and Use of Laboratory Animals. The experimental protocol was approved by Animal Care Welfare Committee. The mice were kept in plastic cages with a controlled environment at 22°C–26°C, with 55%–60% humidity and a 12-h light/dark cycle. Standardized granular food and sterile water were provided ad libitum. After 1-week feeding, mice were assigned randomly into 7 groups as follows: mice were intragastric administrated with SnS2 flowers of 50, 80, and 200 nm in a 250 mg/kg dose for 14 days (10 mice per group), respectively for size-different toxicity tests. Mice were also treated with SnS2 NFs (size: 50 nm, dose: 250, 500, and 1000 mg/kg) by intragastric administration for 14 days (10 mice per group) for repeated-dose toxicity test. The control group was treated with de-ionized water without SnS2 NFs, which was prepared by the same process to prepare SnS2 NFs suspension. After the last time, the weight of mice was recorded and then each mouse was killed with collection of 1 ml blood and total liver tissues. The specimens were stored in −80°C and the liver tissues were fixed in formaldehyde fluid prepared for histopathologic examination. The general situation and the coefficient of the liver We observed mice eating and drinking of water, fur luster and mental state and compared the mouse’ BW. After the mice were sacrificed, the liver tissue of each mouse was weighed in electronic scale. Then the formula (liver coefficient = total liver wet weight/BW × 100%) was used to calculate the viscera coefficient. The content of tin in whole blood and various parts of the body Tissue samples including liver, kidney, spleen, heart, brain, testicle (each for 0.1 g) and 1.0 ml whole blood were taken from SnS2 NF-treated mice and control in each group, then digested and analyzed for tin content by 7500 type inductively coupled plasma-mass spectrometry (ICP-MS, Agilent, USA). The working conditions of ICP-MS were as follows: emission power, 1420 w; frequency, 27.12; atomization pressure, 32Ibf/in2; auxiliary gas flow, 1.08 l/min; injection speed, 1.85 ml/min; dilute nitricacid (2%) flushing time, 1 min; ultrapure water flushing time, 1 min. Determination of liver function Mouse blood samples were processed for alanine aminotransferase (ALT) and aspartate aminotransferase (AST) using Dimension@ clinical chemistry system (Dimension AR, Delaware) kits and blood serum biochemical analysis were obtained from biomerieux, Laboratory of Reagents and Products (Marcy Letoile, France). The determination of hematologic indexes Blood counts were measured by assaying 1 specimen from every mouse for red blood cells (RBCs), average red blood cell volume (MCV), mean red blood cell hemoglobin concentration (MCHC), and white blood cells (WBCs) on the Advia 120 (Bayer Diagnostics) automated hematology analyzer. Histopathology and ultrastructure analysis A liver slice was cut from the middle of the biggest lobe in SnS2 NF-treated mice and control. The liver tissues were taken out of 4% formaldehyde, following with regular dehydration, transparent, paraffin embedding, sectioning and dewaxing. After hematoxylin-eosin (HE) staining, again with dehydration, transparent and sealing, liver histopathology was observed in light microscope and photos were taken. Liver tissues were prefixed in 2.5% glutaraldehyde, washed in a cacodylate buffer and post fixed in 1% osmium tetroxide. Tissues were then dehydrated in ascending grades of alcohols and embedded in an eponaraldite mixture. Ultrathin sections stained with uranylacetate and lead citrate were examined under a transmission electron microscope (FEI Tecnai G212, Phillips, Holland). Livers from 3 mice of each experimental group were randomly collected for these analyses. Three blocks of each group and 10 electron micrographs for each block were examined. RNA isolation and RT-PCR The primer sequences listed in Table 1. Total RNA was extracted from liver tissues using RNA Easy kit (Qiagen, Germany), according to the manufacturer’s protocol. 1 μg of RNA was subjected to reverse transcription using first-strand cDNA synthesis kit (Invitrogen) according to the manufacturer's instructions. qRT-PCR of mRNAs was performed using Platinum SYBR Green qPCR Super Mix UDG Kit (Invitrogen), and real-time PCR experiments were carried on a ABI 7500 FAST system (Life Technologies). Relative amount of transcripts was normalized with β-Actin and calculated using the 2−ΔΔCt formula as previously described in Ma et al. (2017). Table 1. List of Primers Used for Real Time RT-PCR Function  Gene Name  Sequence (5’-3’)  Product (bp)  Bile acid synthetic enzymes  Cyp27a1  F: GGGCACTAGCCAGATTCACA  107  R: CTATGTGCTGCACTTGCCC  Cyp7a1  F: GTCCGGATATTCAAGGATGC  107  R: GGGAATGCCATTTACTTGGA  Cyp7b1  F: TGGTCTGCCTGGAAAGCAC  107  R: ACTCTTACTCTCTAAGCTGAGATTC  Cyp8b1  F: GATAGGGGAAGAGAGCCACC  96  R: TCCTCAGGGTGGTACAGGAG  Cholesterol efflux  Abca1  F: CAGAGCCCACTTCTCTCCG  200  R: TGTGGCTGGTCATTAACTGT  Abcg5  F: GTCCTGCTGAGGCGAGTAAC  136  R: CGCCCTTTAGCGTGTTGTTC  Abcg8  F: CCTGTGGATAGTGCCTGCAT  181  R: CGCATAGAGTGGATGCGAGT  Bile transporters  Bsep  F: AAGGACAGCCACACCAACTC  100  R: CCAGAACATGACAAACGGAA  Ntcp  F: TCCGTCGTAGATTCCTTTGC  96  R: AGGGGGACATGAACCTCAG  Oatp1  F: TAATCGGGCCAACAATCTTC  109  R: ACTCCCATAATGCCCTTGG  Mrp2  F: GCAGGTGTTCGTTGTGTGTC  139  R: CACCAGGAGCCAAGTGCATA  Hepatotoxicity  Aldoa  F: GCGCCCTGGCCAACA  190  R: GGAAAGAGCCTGAAGACCCC  Cyp1a2  F: GGAGCTGGCTTTGACACAGT  77  R: CTCTGCACGTTAGGCCATGT  Fmo1  F: CCACTCTGCCAGAAGCTACA  196  R: TCCCTTCTTCAACATGTTCCGTG  Inflammation  TNF-α  F: CATGGATCTCAAAGACAACCAA  103  R: CTCCTGGTATGAAATGGCAAAT  IL-10  F: TGTCAAATTCATTCATGGCCT  108  R: ATCGATTTCTCCCCTGTGAA  Apoptosis  Bax  F: GATCAGCTCGGGCACTTTAG  120  R: TTGCTGATGGCAACTTCAAC  Bcl-2  F: GGTCTTCAGAGACAGCCAGG  113  R: GATCCAGGATAACGGAGGCT  Reference gene  β-Actin  F: CGTAAAGACCTCTATGCCAACA  117  R: GGACTCATCGTACTCCTGCTT  Function  Gene Name  Sequence (5’-3’)  Product (bp)  Bile acid synthetic enzymes  Cyp27a1  F: GGGCACTAGCCAGATTCACA  107  R: CTATGTGCTGCACTTGCCC  Cyp7a1  F: GTCCGGATATTCAAGGATGC  107  R: GGGAATGCCATTTACTTGGA  Cyp7b1  F: TGGTCTGCCTGGAAAGCAC  107  R: ACTCTTACTCTCTAAGCTGAGATTC  Cyp8b1  F: GATAGGGGAAGAGAGCCACC  96  R: TCCTCAGGGTGGTACAGGAG  Cholesterol efflux  Abca1  F: CAGAGCCCACTTCTCTCCG  200  R: TGTGGCTGGTCATTAACTGT  Abcg5  F: GTCCTGCTGAGGCGAGTAAC  136  R: CGCCCTTTAGCGTGTTGTTC  Abcg8  F: CCTGTGGATAGTGCCTGCAT  181  R: CGCATAGAGTGGATGCGAGT  Bile transporters  Bsep  F: AAGGACAGCCACACCAACTC  100  R: CCAGAACATGACAAACGGAA  Ntcp  F: TCCGTCGTAGATTCCTTTGC  96  R: AGGGGGACATGAACCTCAG  Oatp1  F: TAATCGGGCCAACAATCTTC  109  R: ACTCCCATAATGCCCTTGG  Mrp2  F: GCAGGTGTTCGTTGTGTGTC  139  R: CACCAGGAGCCAAGTGCATA  Hepatotoxicity  Aldoa  F: GCGCCCTGGCCAACA  190  R: GGAAAGAGCCTGAAGACCCC  Cyp1a2  F: GGAGCTGGCTTTGACACAGT  77  R: CTCTGCACGTTAGGCCATGT  Fmo1  F: CCACTCTGCCAGAAGCTACA  196  R: TCCCTTCTTCAACATGTTCCGTG  Inflammation  TNF-α  F: CATGGATCTCAAAGACAACCAA  103  R: CTCCTGGTATGAAATGGCAAAT  IL-10  F: TGTCAAATTCATTCATGGCCT  108  R: ATCGATTTCTCCCCTGTGAA  Apoptosis  Bax  F: GATCAGCTCGGGCACTTTAG  120  R: TTGCTGATGGCAACTTCAAC  Bcl-2  F: GGTCTTCAGAGACAGCCAGG  113  R: GATCCAGGATAACGGAGGCT  Reference gene  β-Actin  F: CGTAAAGACCTCTATGCCAACA  117  R: GGACTCATCGTACTCCTGCTT  Table 1. List of Primers Used for Real Time RT-PCR Function  Gene Name  Sequence (5’-3’)  Product (bp)  Bile acid synthetic enzymes  Cyp27a1  F: GGGCACTAGCCAGATTCACA  107  R: CTATGTGCTGCACTTGCCC  Cyp7a1  F: GTCCGGATATTCAAGGATGC  107  R: GGGAATGCCATTTACTTGGA  Cyp7b1  F: TGGTCTGCCTGGAAAGCAC  107  R: ACTCTTACTCTCTAAGCTGAGATTC  Cyp8b1  F: GATAGGGGAAGAGAGCCACC  96  R: TCCTCAGGGTGGTACAGGAG  Cholesterol efflux  Abca1  F: CAGAGCCCACTTCTCTCCG  200  R: TGTGGCTGGTCATTAACTGT  Abcg5  F: GTCCTGCTGAGGCGAGTAAC  136  R: CGCCCTTTAGCGTGTTGTTC  Abcg8  F: CCTGTGGATAGTGCCTGCAT  181  R: CGCATAGAGTGGATGCGAGT  Bile transporters  Bsep  F: AAGGACAGCCACACCAACTC  100  R: CCAGAACATGACAAACGGAA  Ntcp  F: TCCGTCGTAGATTCCTTTGC  96  R: AGGGGGACATGAACCTCAG  Oatp1  F: TAATCGGGCCAACAATCTTC  109  R: ACTCCCATAATGCCCTTGG  Mrp2  F: GCAGGTGTTCGTTGTGTGTC  139  R: CACCAGGAGCCAAGTGCATA  Hepatotoxicity  Aldoa  F: GCGCCCTGGCCAACA  190  R: GGAAAGAGCCTGAAGACCCC  Cyp1a2  F: GGAGCTGGCTTTGACACAGT  77  R: CTCTGCACGTTAGGCCATGT  Fmo1  F: CCACTCTGCCAGAAGCTACA  196  R: TCCCTTCTTCAACATGTTCCGTG  Inflammation  TNF-α  F: CATGGATCTCAAAGACAACCAA  103  R: CTCCTGGTATGAAATGGCAAAT  IL-10  F: TGTCAAATTCATTCATGGCCT  108  R: ATCGATTTCTCCCCTGTGAA  Apoptosis  Bax  F: GATCAGCTCGGGCACTTTAG  120  R: TTGCTGATGGCAACTTCAAC  Bcl-2  F: GGTCTTCAGAGACAGCCAGG  113  R: GATCCAGGATAACGGAGGCT  Reference gene  β-Actin  F: CGTAAAGACCTCTATGCCAACA  117  R: GGACTCATCGTACTCCTGCTT  Function  Gene Name  Sequence (5’-3’)  Product (bp)  Bile acid synthetic enzymes  Cyp27a1  F: GGGCACTAGCCAGATTCACA  107  R: CTATGTGCTGCACTTGCCC  Cyp7a1  F: GTCCGGATATTCAAGGATGC  107  R: GGGAATGCCATTTACTTGGA  Cyp7b1  F: TGGTCTGCCTGGAAAGCAC  107  R: ACTCTTACTCTCTAAGCTGAGATTC  Cyp8b1  F: GATAGGGGAAGAGAGCCACC  96  R: TCCTCAGGGTGGTACAGGAG  Cholesterol efflux  Abca1  F: CAGAGCCCACTTCTCTCCG  200  R: TGTGGCTGGTCATTAACTGT  Abcg5  F: GTCCTGCTGAGGCGAGTAAC  136  R: CGCCCTTTAGCGTGTTGTTC  Abcg8  F: CCTGTGGATAGTGCCTGCAT  181  R: CGCATAGAGTGGATGCGAGT  Bile transporters  Bsep  F: AAGGACAGCCACACCAACTC  100  R: CCAGAACATGACAAACGGAA  Ntcp  F: TCCGTCGTAGATTCCTTTGC  96  R: AGGGGGACATGAACCTCAG  Oatp1  F: TAATCGGGCCAACAATCTTC  109  R: ACTCCCATAATGCCCTTGG  Mrp2  F: GCAGGTGTTCGTTGTGTGTC  139  R: CACCAGGAGCCAAGTGCATA  Hepatotoxicity  Aldoa  F: GCGCCCTGGCCAACA  190  R: GGAAAGAGCCTGAAGACCCC  Cyp1a2  F: GGAGCTGGCTTTGACACAGT  77  R: CTCTGCACGTTAGGCCATGT  Fmo1  F: CCACTCTGCCAGAAGCTACA  196  R: TCCCTTCTTCAACATGTTCCGTG  Inflammation  TNF-α  F: CATGGATCTCAAAGACAACCAA  103  R: CTCCTGGTATGAAATGGCAAAT  IL-10  F: TGTCAAATTCATTCATGGCCT  108  R: ATCGATTTCTCCCCTGTGAA  Apoptosis  Bax  F: GATCAGCTCGGGCACTTTAG  120  R: TTGCTGATGGCAACTTCAAC  Bcl-2  F: GGTCTTCAGAGACAGCCAGG  113  R: GATCCAGGATAACGGAGGCT  Reference gene  β-Actin  F: CGTAAAGACCTCTATGCCAACA  117  R: GGACTCATCGTACTCCTGCTT  Western blot analysis Expression of Cyp27a1, Cyp7a1, Cyp7b1, Cyp8b1, Abca1, Abcg5, Abcg8, Bsep, Ntcp, Oatp1, Mrp2, Aldoa, Cyp1a2, Fmo1 was assayed by western blotting. Liver tissue extracts were separated by SDS-PAGE, and transferred onto PVDF membrane (Millipore). Membranes were blocked with 5%milk in TTBS for 2 h at 37°C and incubated overnight at 4°C with the following primary antibodies: rabbit antiCyp27a1(1:1000, 19195-1-AP, Proteintech), rabbit antiCyp7a1 (1:1000, 18054-1-AP, Proteintech), rabbit antiCyp7b1 (1:1000, 24889-1-AP, Proteintech), rabbit antiCyp8b1 (1:1000, 63-644, ProSci), rabbit antiAbca1 (1:1000, PA132129, thermo), rabbit antiAbcg5 (1:1000, 27722-1-AP, Proteintech), rabbit antiAbcg8 (1:1000,PA116792, thermo), rabbit antiBsep (1:1000, 18990-1-AP, Proteintech), rabbit antiNtcp (1:1000, GTX11902, GeneTex), rabbit antiOatp1 (1:1000, 17163-1-AP, Proteintech), rabbit antiMrp2 (1:1000, 24893-1-AP, Proteintech), rabbit antiAldoa (1:1000, 11217-1-AP, Proteintech), rabbit antiCyp1a2 (1:5000, 19936-1-AP, Proteintech), rabbit antiFmo1 (1:1000, ab225910, Abcam), and rabbit anti b-actin (1:5000, Proteintech). Membranes were washed and incubated with the appropriate horseradish peroxidase-conjugated secondary antibody (Cell Signaling Technology). Protein bands were detected by ECL plus (Thermo Scientific) and b-actin was served as an internal control for protein loading. Quantity One software version 4.6.2 was used to quantify each band area and density in blots. Quantified band intensities are presented as fold of control. Three repeat experiments were performed independently. Immunohistochemical staining Immunohistochemical staining was performed with 5 μm paraffin cross-sections from the liver. After deparaffinized with xylene and rehydrated. Endogenous peroxidase activity was quenched with 3% hydrogen peroxide in methanol for 10 min, and then the slides were preincubated with 10% normal goat serum and then incubated with primary antibodies antiCD68 (25747-1-AP, Proteintech), antiNF-κB (14220-1-AP, Proteintech), antiBax (50599-2-Ig, Proteintech). Next, sections were washed in phosphate-buffered saline (PBS), incubated with an appropriate biotinylated secondary antibody, washed and incubated with streptavidin–peroxidase. Staining was visualized by adding 3, 3′-Diaminobenzidine (DAB Substrate, Roche, Mannheim, Germany) with subsequent counterstaining using hematoxylin. Sections were rinsed in tap water, dehydrated through 70%–100% graded alcohol, cleared in xylene and finally mounted in permanent mounting medium. Immunohistochemical micrographs were taken with the FSX-100 microscope camera system (Olympus, Tokyo, Japan). Three sections were analyzed for each sample. Statistical analysis All data were analyzed using 1-way univariate analysis of variance followed by LSD (equal variances assumed or homogeneity of variance after the variable transformation) or Dunnett’s T3 (equal variances not assumed after the variable transformation justification) for posthoc test between groups using Statistical Package for Social Sciences (SPSS package version 16.0) software (SPSS, Chicago, Illinois). The results were represented as mean ± SD. All tests were 2-sided, and p < .05 was considered statistically significant. RESULTS Characterization of SnS2 NFs The characterization of SnS2 NFs has been reported in our recent article (Bai et al., 2017). Simply, SnS2 NFs exhibits flowerlike structures with diameters of 50, 80, and 200 nm. Each flowerlike structure consists of tens of nanosheets, which act as building blocks. These nanosheets are connected to each other to bulid 3D flowerlike structure. To investigate the disperse state of the 50-nm SnS2 NFs in deionized water (DI H2O) or PBS Dynamic light scattering (DLS) and laser doppler velocimetry (LDV) were performed to detect that. DLS results showed agglomeration of the 50-nm SnS2 NFs 2 times greater than their primary particle size at 116 nm in DI H2O and 4 times nearly their primary size at 192 nm in PBS (Bai et al., 2017). To further understand how SnS2 NF behave and where it translocated across the digestive tract and then to liver, the hydrodynamic sizes and zeta potential of SnS2 NFs were examined using a Zetasizer (Malvern Nano-ZS90, Britain) to examine the aggregate or distributed status of SnS2 NFs in acidic solution with BSA or not at various pH values (Fed: stomach pH2.98 and duodenum pH4.04; Fasted: stomach pH4.04 and duodenum pH4.74 in mice). The results showed that agglomeration of the SnS2 NFs (50, 80, and 200 nm) at nearly 630 nm in pH2.98, nearly 480 nm in pH4.04, and nearly 380 nm in pH4.74 without BSA (Table 2, Figs. 1A–C). The agglomeration of the SnS2 NFs (50, 80, and 200 nm) at nearly 930 nm in pH2.98, nearly 800 nm in pH4.04, and nearly 750 nm in pH4.74 with BSA (Table 3, Figs. 1D–F). The results showed that there was no size dependent difference in accumulation could be due to aggregation of SnS2 NFs, they accumulate to different size in different pH values solution and could bind to protein. More importantly, the agglomeration of the SnS2 NFs is increased in the same pH environment with BSA addition than that without BSA. Thus, although there is different size, the 50 and 200 nm material would have same size of agglomeration and lead to same toxic potential effects in vivo. Table 2. Characteristics of SnS2 NFs in the Different pH Values Solutions Without BSA Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  614.7  0.322  –32.5  –2.74  4.04  415.3  0.268  –31.1  –1.28  4.74  375.9  0.473  –34.8  –2.19  80 nm  2.98  613.1  0.207  –35.4  –1.33  4.04  475.1  0.391  –33.7  –1.66  4.74  374.4  0.346  –31.9  –1.47  200 nm  2.98  664.6  0.449  –37.0  –1.85  4.04  568.4  0.503  –32.6  –2.32  4.74  397.6  0.358  –34.3  –1.53  Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  614.7  0.322  –32.5  –2.74  4.04  415.3  0.268  –31.1  –1.28  4.74  375.9  0.473  –34.8  –2.19  80 nm  2.98  613.1  0.207  –35.4  –1.33  4.04  475.1  0.391  –33.7  –1.66  4.74  374.4  0.346  –31.9  –1.47  200 nm  2.98  664.6  0.449  –37.0  –1.85  4.04  568.4  0.503  –32.6  –2.32  4.74  397.6  0.358  –34.3  –1.53  PdI, polydispersity index Table 2. Characteristics of SnS2 NFs in the Different pH Values Solutions Without BSA Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  614.7  0.322  –32.5  –2.74  4.04  415.3  0.268  –31.1  –1.28  4.74  375.9  0.473  –34.8  –2.19  80 nm  2.98  613.1  0.207  –35.4  –1.33  4.04  475.1  0.391  –33.7  –1.66  4.74  374.4  0.346  –31.9  –1.47  200 nm  2.98  664.6  0.449  –37.0  –1.85  4.04  568.4  0.503  –32.6  –2.32  4.74  397.6  0.358  –34.3  –1.53  Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  614.7  0.322  –32.5  –2.74  4.04  415.3  0.268  –31.1  –1.28  4.74  375.9  0.473  –34.8  –2.19  80 nm  2.98  613.1  0.207  –35.4  –1.33  4.04  475.1  0.391  –33.7  –1.66  4.74  374.4  0.346  –31.9  –1.47  200 nm  2.98  664.6  0.449  –37.0  –1.85  4.04  568.4  0.503  –32.6  –2.32  4.74  397.6  0.358  –34.3  –1.53  PdI, polydispersity index Table 3. Characteristics of SnS2 NFs in the Different pH Values Solutions With BSA Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  908.4  0.226  –35.2  –1.73  4.04  812.9  0.413  –36.4  –1.52  4.74  777.2  0.159  –32.8  –2.05  80 nm  2.98  916.8  0.338  –34.1  –2.16  4.04  814.0  0.521  –33.0  –1.95  4.74  773.6  0.154  –37.3  –1.34  200 nm  2.98  959.5  0.487  –34.5  –2.03  4.04  800.2  0.306  –33.9  –1.68  4.74  713.0  0.271  –32.6  –1.79  Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  908.4  0.226  –35.2  –1.73  4.04  812.9  0.413  –36.4  –1.52  4.74  777.2  0.159  –32.8  –2.05  80 nm  2.98  916.8  0.338  –34.1  –2.16  4.04  814.0  0.521  –33.0  –1.95  4.74  773.6  0.154  –37.3  –1.34  200 nm  2.98  959.5  0.487  –34.5  –2.03  4.04  800.2  0.306  –33.9  –1.68  4.74  713.0  0.271  –32.6  –1.79  Table 3. Characteristics of SnS2 NFs in the Different pH Values Solutions With BSA Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  908.4  0.226  –35.2  –1.73  4.04  812.9  0.413  –36.4  –1.52  4.74  777.2  0.159  –32.8  –2.05  80 nm  2.98  916.8  0.338  –34.1  –2.16  4.04  814.0  0.521  –33.0  –1.95  4.74  773.6  0.154  –37.3  –1.34  200 nm  2.98  959.5  0.487  –34.5  –2.03  4.04  800.2  0.306  –33.9  –1.68  4.74  713.0  0.271  –32.6  –1.79  Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  908.4  0.226  –35.2  –1.73  4.04  812.9  0.413  –36.4  –1.52  4.74  777.2  0.159  –32.8  –2.05  80 nm  2.98  916.8  0.338  –34.1  –2.16  4.04  814.0  0.521  –33.0  –1.95  4.74  773.6  0.154  –37.3  –1.34  200 nm  2.98  959.5  0.487  –34.5  –2.03  4.04  800.2  0.306  –33.9  –1.68  4.74  713.0  0.271  –32.6  –1.79  Figure 1. View largeDownload slide Characterization of SnS2 NFs. A–C, Size distribution of SnS2 NFs (50, 80, and 200 nm) in pH2.98, pH4.04, and pH4.74 without proteins. SnS2 NFs exhibited good monodispersity and showed approximately normal distribution. D–F, Size distribution of SnS2 NFs (50, 80, and 200 nm) in pH2.98, pH4.04, and pH4.74 with proteins. SnS2 NFs exhibited good monodispersity and showed approximately normal distribution. Figure 1. View largeDownload slide Characterization of SnS2 NFs. A–C, Size distribution of SnS2 NFs (50, 80, and 200 nm) in pH2.98, pH4.04, and pH4.74 without proteins. SnS2 NFs exhibited good monodispersity and showed approximately normal distribution. D–F, Size distribution of SnS2 NFs (50, 80, and 200 nm) in pH2.98, pH4.04, and pH4.74 with proteins. SnS2 NFs exhibited good monodispersity and showed approximately normal distribution. The General Condition and the Liver Coefficient The BWs, liver coefficients, mental station, food and water consumption, coat condition, and paw skin surface appearance of mice after intragastric administration of SnS2 NFs (dose: 250 mg/kg; size: 50, 80, and 200 nm) were not significantly different (p > .05, Table 4). Similarly, intragastric administration of 50-nm SnS2 NFs at doses of 250, 500, or 1000 mg/kg for 14 days also showed no significant changes in all groups (p > .05, Table 4). Table 4. Effects of Different Sizes and Doses of SnS2 NFs on BW Increasement and Coefficients of Liver Group  n  BW Increasement (g)  Liver (mg/g)  Control  10  11.47 ± 0.45  45.38 ± 1.11  50 nm  10  11.68 ± 0.42  48.72 ± 1.27  80 nm  10  10.65 ± 0.68  49.22 ± 2.42  200 nm  10  10.76 ± 0.72  45.12 ± 1.15  250 mg/kg  10  11.22 ± 0.66  45.72 ± 1.83  500 mg/kg  10  11.89 ± 0.49  46.69 ± 2.15  1000 mg/kg  10  10.20 ± 0.78  45.12 ± 1.15  Group  n  BW Increasement (g)  Liver (mg/g)  Control  10  11.47 ± 0.45  45.38 ± 1.11  50 nm  10  11.68 ± 0.42  48.72 ± 1.27  80 nm  10  10.65 ± 0.68  49.22 ± 2.42  200 nm  10  10.76 ± 0.72  45.12 ± 1.15  250 mg/kg  10  11.22 ± 0.66  45.72 ± 1.83  500 mg/kg  10  11.89 ± 0.49  46.69 ± 2.15  1000 mg/kg  10  10.20 ± 0.78  45.12 ± 1.15  Table 4. Effects of Different Sizes and Doses of SnS2 NFs on BW Increasement and Coefficients of Liver Group  n  BW Increasement (g)  Liver (mg/g)  Control  10  11.47 ± 0.45  45.38 ± 1.11  50 nm  10  11.68 ± 0.42  48.72 ± 1.27  80 nm  10  10.65 ± 0.68  49.22 ± 2.42  200 nm  10  10.76 ± 0.72  45.12 ± 1.15  250 mg/kg  10  11.22 ± 0.66  45.72 ± 1.83  500 mg/kg  10  11.89 ± 0.49  46.69 ± 2.15  1000 mg/kg  10  10.20 ± 0.78  45.12 ± 1.15  Group  n  BW Increasement (g)  Liver (mg/g)  Control  10  11.47 ± 0.45  45.38 ± 1.11  50 nm  10  11.68 ± 0.42  48.72 ± 1.27  80 nm  10  10.65 ± 0.68  49.22 ± 2.42  200 nm  10  10.76 ± 0.72  45.12 ± 1.15  250 mg/kg  10  11.22 ± 0.66  45.72 ± 1.83  500 mg/kg  10  11.89 ± 0.49  46.69 ± 2.15  1000 mg/kg  10  10.20 ± 0.78  45.12 ± 1.15  The Tin Contents in Whole Blood and Liver Tissues After intragastric administrated of 3 different sized SnS2 NFs (dose: 250 mg/kg, sizes: 50, 80, and 200 nm) and 3 different doses of SnS2 NFs (size: 50 nm, doses: 250, 500, and 1000 mg/kg) for 14 consecutive days, organs (liver, kidney, spleen, heart, brain, and testis) especially in the liver and the whole blood were extracted and lysed with nitric acid for tin measurement by ICP-MS. As shown in Table 5, the tin concentrations were not significantly modified in the mice administrated with different sized SnS2 NFs than in controls (p > .05). The blood and liver tissue tin concentrations after administration of 250, 500, and 1000 mg/kg doses of 50-nm SnS2 NFs were significantly higher in the blood and liver tissues of the 500 and 1000 mg/kg SnS2 NFs-treated groups (p < .01) than in controls. Table 5. Tin Levels in Each Organ of ICR Mice Treated With Different Sizes and Doses of SnS2 NFs Indexes  50-nm SnS2 NFs (mg/kg BW)   80-nm SnS2 NFs (mg/kg BW)  200-nm SnS2 NFs (mg/kg BW)  0  250  500  1000  250  250  Liver (µg/g)  2.236 ± 0.089  2.418 ± 0.220  3.633 ± 0.286*  5.596 ± 0.415*  2.209 ± 0.238  2.542 ± 0.078  Kidney (µg/g)  2.078 ± 0.097  2.164 ± 0.192  3.388 ± 0.327*  4.975 ± 0.234*  1.826 ± 0.356  1.592 ± 0.133  Spleen (µg/g)  1.693 ± 0.130  1.925 ± 0.253  2.936 ± 0.192*  4.079 ± 0.147*  1.972 ± 0.269  1.891 ± 0.240  Testicle (µg/g)  1.186 ± 0.089  1.392 ± 0.117  2.546 ± 0.241**  3.277 ± 0.132*  1.501 ± 0.260  1.320 ± 0.175  Brain (µg/g)  0.914 ± 0.122  0.896 ± 0.138  1.958 ± 0.126*  2.531 ± 0.130*  1.096 ± 0.088  1.067 ± 0.169  Heart (µg/g)  0.705 ± 0.161  0.934 ± 0.112  1.878 ± 0.235*  2.592 ± 0.257*  0.699 ± 0.142  0.862 ± 0.148  Blood (µg/ml)  3.608 ± 0.083  4.125 ± 0.242  6.254 ± 0.338*  7.642 ± 0.543*  4.350 ± 0.450  3.461 ± 0.227  Indexes  50-nm SnS2 NFs (mg/kg BW)   80-nm SnS2 NFs (mg/kg BW)  200-nm SnS2 NFs (mg/kg BW)  0  250  500  1000  250  250  Liver (µg/g)  2.236 ± 0.089  2.418 ± 0.220  3.633 ± 0.286*  5.596 ± 0.415*  2.209 ± 0.238  2.542 ± 0.078  Kidney (µg/g)  2.078 ± 0.097  2.164 ± 0.192  3.388 ± 0.327*  4.975 ± 0.234*  1.826 ± 0.356  1.592 ± 0.133  Spleen (µg/g)  1.693 ± 0.130  1.925 ± 0.253  2.936 ± 0.192*  4.079 ± 0.147*  1.972 ± 0.269  1.891 ± 0.240  Testicle (µg/g)  1.186 ± 0.089  1.392 ± 0.117  2.546 ± 0.241**  3.277 ± 0.132*  1.501 ± 0.260  1.320 ± 0.175  Brain (µg/g)  0.914 ± 0.122  0.896 ± 0.138  1.958 ± 0.126*  2.531 ± 0.130*  1.096 ± 0.088  1.067 ± 0.169  Heart (µg/g)  0.705 ± 0.161  0.934 ± 0.112  1.878 ± 0.235*  2.592 ± 0.257*  0.699 ± 0.142  0.862 ± 0.148  Blood (µg/ml)  3.608 ± 0.083  4.125 ± 0.242  6.254 ± 0.338*  7.642 ± 0.543*  4.350 ± 0.450  3.461 ± 0.227  Mean ± SD, *p < .05 versus control group; **p < .01 versus control group. Table 5. Tin Levels in Each Organ of ICR Mice Treated With Different Sizes and Doses of SnS2 NFs Indexes  50-nm SnS2 NFs (mg/kg BW)   80-nm SnS2 NFs (mg/kg BW)  200-nm SnS2 NFs (mg/kg BW)  0  250  500  1000  250  250  Liver (µg/g)  2.236 ± 0.089  2.418 ± 0.220  3.633 ± 0.286*  5.596 ± 0.415*  2.209 ± 0.238  2.542 ± 0.078  Kidney (µg/g)  2.078 ± 0.097  2.164 ± 0.192  3.388 ± 0.327*  4.975 ± 0.234*  1.826 ± 0.356  1.592 ± 0.133  Spleen (µg/g)  1.693 ± 0.130  1.925 ± 0.253  2.936 ± 0.192*  4.079 ± 0.147*  1.972 ± 0.269  1.891 ± 0.240  Testicle (µg/g)  1.186 ± 0.089  1.392 ± 0.117  2.546 ± 0.241**  3.277 ± 0.132*  1.501 ± 0.260  1.320 ± 0.175  Brain (µg/g)  0.914 ± 0.122  0.896 ± 0.138  1.958 ± 0.126*  2.531 ± 0.130*  1.096 ± 0.088  1.067 ± 0.169  Heart (µg/g)  0.705 ± 0.161  0.934 ± 0.112  1.878 ± 0.235*  2.592 ± 0.257*  0.699 ± 0.142  0.862 ± 0.148  Blood (µg/ml)  3.608 ± 0.083  4.125 ± 0.242  6.254 ± 0.338*  7.642 ± 0.543*  4.350 ± 0.450  3.461 ± 0.227  Indexes  50-nm SnS2 NFs (mg/kg BW)   80-nm SnS2 NFs (mg/kg BW)  200-nm SnS2 NFs (mg/kg BW)  0  250  500  1000  250  250  Liver (µg/g)  2.236 ± 0.089  2.418 ± 0.220  3.633 ± 0.286*  5.596 ± 0.415*  2.209 ± 0.238  2.542 ± 0.078  Kidney (µg/g)  2.078 ± 0.097  2.164 ± 0.192  3.388 ± 0.327*  4.975 ± 0.234*  1.826 ± 0.356  1.592 ± 0.133  Spleen (µg/g)  1.693 ± 0.130  1.925 ± 0.253  2.936 ± 0.192*  4.079 ± 0.147*  1.972 ± 0.269  1.891 ± 0.240  Testicle (µg/g)  1.186 ± 0.089  1.392 ± 0.117  2.546 ± 0.241**  3.277 ± 0.132*  1.501 ± 0.260  1.320 ± 0.175  Brain (µg/g)  0.914 ± 0.122  0.896 ± 0.138  1.958 ± 0.126*  2.531 ± 0.130*  1.096 ± 0.088  1.067 ± 0.169  Heart (µg/g)  0.705 ± 0.161  0.934 ± 0.112  1.878 ± 0.235*  2.592 ± 0.257*  0.699 ± 0.142  0.862 ± 0.148  Blood (µg/ml)  3.608 ± 0.083  4.125 ± 0.242  6.254 ± 0.338*  7.642 ± 0.543*  4.350 ± 0.450  3.461 ± 0.227  Mean ± SD, *p < .05 versus control group; **p < .01 versus control group. Effects of SnS2 NFs on RBC, WBC, MCV, and MCHC The RBC and WBC counts, MCHC and MCV values after intragastric administration of a 250 mg/kg dose of 50-, 80-, and 200-nm SnS2 NFs for 14 days (Table 6) were not significantly different from the control group results (p > .05). The corresponding values following treatment with 250, 500, and 1000 mg/kg doses of 50-nm SnS2 NFs were shown in Table 7, the SnS2 NFs groups were not significantly different from controls (p > .05). Table 6. Effects of Different Sizes of SnS2 NFs on the RBC, MCV, MCHC, and WBC of mice Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  50 nm  10  6.04 ± 0.23  314.22 ± 2.44  44.31 ± 3.21  4.87 ± 0.74  80 nm  10  6.07 ± 0.31  306.00 ± 3.17  42.98 ± 1.18  5.09 ± 0.84  200 nm  10  5.58 ± 0.26  312.56 ± 5.05  42.90 ± 2.64  4.96 ± 0.63  Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  50 nm  10  6.04 ± 0.23  314.22 ± 2.44  44.31 ± 3.21  4.87 ± 0.74  80 nm  10  6.07 ± 0.31  306.00 ± 3.17  42.98 ± 1.18  5.09 ± 0.84  200 nm  10  5.58 ± 0.26  312.56 ± 5.05  42.90 ± 2.64  4.96 ± 0.63  Mean ± SD. Table 6. Effects of Different Sizes of SnS2 NFs on the RBC, MCV, MCHC, and WBC of mice Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  50 nm  10  6.04 ± 0.23  314.22 ± 2.44  44.31 ± 3.21  4.87 ± 0.74  80 nm  10  6.07 ± 0.31  306.00 ± 3.17  42.98 ± 1.18  5.09 ± 0.84  200 nm  10  5.58 ± 0.26  312.56 ± 5.05  42.90 ± 2.64  4.96 ± 0.63  Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  50 nm  10  6.04 ± 0.23  314.22 ± 2.44  44.31 ± 3.21  4.87 ± 0.74  80 nm  10  6.07 ± 0.31  306.00 ± 3.17  42.98 ± 1.18  5.09 ± 0.84  200 nm  10  5.58 ± 0.26  312.56 ± 5.05  42.90 ± 2.64  4.96 ± 0.63  Mean ± SD. Table 7. Effects of Different Doses of SnS2 NFs on the RBC, MCV, MCHC, and WBC of mice Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  250 mg/kg  10  5.94 ± 0.46  305.47 ± 2.04  44.83 ± 3.56  4.84 ± 1.25  500 mg/kg  10  6.22 ± 0.38  312.00 ± 5.22  43.91 ± 2.85  4.99 ± 1.14  1000 mg/kg  10  6.58 ± 0.45  328.58 ± 9.13  46.52 ± 3.73  5.37 ± 0.95  Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  250 mg/kg  10  5.94 ± 0.46  305.47 ± 2.04  44.83 ± 3.56  4.84 ± 1.25  500 mg/kg  10  6.22 ± 0.38  312.00 ± 5.22  43.91 ± 2.85  4.99 ± 1.14  1000 mg/kg  10  6.58 ± 0.45  328.58 ± 9.13  46.52 ± 3.73  5.37 ± 0.95  Mean ± SD. Table 7. Effects of Different Doses of SnS2 NFs on the RBC, MCV, MCHC, and WBC of mice Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  250 mg/kg  10  5.94 ± 0.46  305.47 ± 2.04  44.83 ± 3.56  4.84 ± 1.25  500 mg/kg  10  6.22 ± 0.38  312.00 ± 5.22  43.91 ± 2.85  4.99 ± 1.14  1000 mg/kg  10  6.58 ± 0.45  328.58 ± 9.13  46.52 ± 3.73  5.37 ± 0.95  Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  250 mg/kg  10  5.94 ± 0.46  305.47 ± 2.04  44.83 ± 3.56  4.84 ± 1.25  500 mg/kg  10  6.22 ± 0.38  312.00 ± 5.22  43.91 ± 2.85  4.99 ± 1.14  1000 mg/kg  10  6.58 ± 0.45  328.58 ± 9.13  46.52 ± 3.73  5.37 ± 0.95  Mean ± SD. Effects of SnS2 NFs on the ALT and AST The hepatic injury markers ALT and AST concentrations after intragastric administration of 250 mg/kg of 50, 80, and 200-nm SnS2 NFs for 14 days (Table 8) were not significantly different from the control group results (p > .05), indicating the liver injury was not evident. The corresponding values following treatment with 250, 500, and 1000 mg/kg doses of 50-nm SnS2 NFs (Table 9) in the 250, and 500 mg/kg groups were not significantly different, but ALT and AST values in the 1000 mg/kg group were higher than in the control group (58.45 ± 3.31* and 152.46 ± 8.13*, respectively, p < .05). Table 8. Effects of Different Sizes of SnS2 NFs on the ALT and AST of Mice Groups  n  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  50 nm  10  52.44 ± 3.78  140.78 ± 7.80  80 nm  10  46.83 ± 4.06  145.22 ± 9.06  200 nm  10  49.67 ± 3.54  135.33 ± 9.54  Groups  n  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  50 nm  10  52.44 ± 3.78  140.78 ± 7.80  80 nm  10  46.83 ± 4.06  145.22 ± 9.06  200 nm  10  49.67 ± 3.54  135.33 ± 9.54  Mean ± SD, *p < .05 and **p < .01 versus control group. Table 8. Effects of Different Sizes of SnS2 NFs on the ALT and AST of Mice Groups  n  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  50 nm  10  52.44 ± 3.78  140.78 ± 7.80  80 nm  10  46.83 ± 4.06  145.22 ± 9.06  200 nm  10  49.67 ± 3.54  135.33 ± 9.54  Groups  n  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  50 nm  10  52.44 ± 3.78  140.78 ± 7.80  80 nm  10  46.83 ± 4.06  145.22 ± 9.06  200 nm  10  49.67 ± 3.54  135.33 ± 9.54  Mean ± SD, *p < .05 and **p < .01 versus control group. Table 9. Effects of Different Doses of SnS2 NFs on the ALT and AST of Mice Groups  N  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  250 mg/kg  10  46.12 ± 4.12  133.21 ± 11.46  500 mg/kg  10  48.33 ± 6.77  140.42 ± 10.34  1000 mg/kg  10  58.45 ± 3.31*  152.46 ± 8.13*  Groups  N  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  250 mg/kg  10  46.12 ± 4.12  133.21 ± 11.46  500 mg/kg  10  48.33 ± 6.77  140.42 ± 10.34  1000 mg/kg  10  58.45 ± 3.31*  152.46 ± 8.13*  Mean ± SD, *p < .05 and **p < .01 versus control group. Table 9. Effects of Different Doses of SnS2 NFs on the ALT and AST of Mice Groups  N  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  250 mg/kg  10  46.12 ± 4.12  133.21 ± 11.46  500 mg/kg  10  48.33 ± 6.77  140.42 ± 10.34  1000 mg/kg  10  58.45 ± 3.31*  152.46 ± 8.13*  Groups  N  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  250 mg/kg  10  46.12 ± 4.12  133.21 ± 11.46  500 mg/kg  10  48.33 ± 6.77  140.42 ± 10.34  1000 mg/kg  10  58.45 ± 3.31*  152.46 ± 8.13*  Mean ± SD, *p < .05 and **p < .01 versus control group. Effects of SnS2 NFs on Liver Histopathology Results of the pathological evaluation of HE-stained liver tissue are shown in Figure 2. The control tissue included radially arranged lobules surrounding an axial central vein and polygonal hepatocytes with clear contours (Figure 2Aa). Tissue exposed to 50, 80, and 200-nm SnS2 NFs revealed no modification under microscope (Figs. 2Ab–d). Immunohistochemical staining showed weak expression of CD68 among 50, 80, and 200 nm groups and control (Figs. 2B and 2C). Figure 2. View largeDownload slide Effect of SnS2 NFs on liver histopathology. A, Liver cross sections from control and SnS2 NFs-exposed mice via intragastric administration of 50, 80, and 200 nm were conducted by HE staining. B, Immunohistochemical staining of CD68 (brown) in liver tissue at ×400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus and liver parenchyma. C, Histogram showing percentages of the number of liver tissues containing CD68 cells. The data are presented as the mean ± SD for 10 mice per group. *p < .05 as compared with control mice. D, Liver cross sections from control and SnS2 NF-exposed mice via intragastric administration of 250, 500, and 1000 mg/kg were conducted by HE staining. E, Immunohistochemical staining of CD68 (brown) in liver tissue at ×400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus and liver parenchyma. F, Histogram showing percentages of the number of liver tissues containing CD68 cells. The data are presented as the mean ± SD for 10 mice per group. *p < .05 as compared with control mice. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) Figure 2. View largeDownload slide Effect of SnS2 NFs on liver histopathology. A, Liver cross sections from control and SnS2 NFs-exposed mice via intragastric administration of 50, 80, and 200 nm were conducted by HE staining. B, Immunohistochemical staining of CD68 (brown) in liver tissue at ×400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus and liver parenchyma. C, Histogram showing percentages of the number of liver tissues containing CD68 cells. The data are presented as the mean ± SD for 10 mice per group. *p < .05 as compared with control mice. D, Liver cross sections from control and SnS2 NF-exposed mice via intragastric administration of 250, 500, and 1000 mg/kg were conducted by HE staining. E, Immunohistochemical staining of CD68 (brown) in liver tissue at ×400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus and liver parenchyma. F, Histogram showing percentages of the number of liver tissues containing CD68 cells. The data are presented as the mean ± SD for 10 mice per group. *p < .05 as compared with control mice. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) HE staining result of liver tissues from mice treated with 250, 500, and 1000 mg/kg doses of 50-nm SnS2 NFs were shown in Figure 2D. When compared with the control, which had the appearance of normal liver (Figure 2Da), tissues exposed to 250, and 500 mg/kg SnS2 NFs also had no gross morphological changes (Figs. 2Db and 2Dc). However, tissues exposed to 1000 mg/kg SnS2 NFs had slightly disrupted cellular arrangements, moderate interstitial hyperemia, and sporadic and focal infiltration of inflammatory cells (Figure 2Dd). Immunohistochemical staining showed weak CD68 expression in the livers of the control and 250 mg/kg group. However, immunohistochemical CD68 expression progressively increased with the exposed doses after administration of SnS2 NFs (Figs. 2E and 2F). Effects of SnS2 NFs on Metabolic Function and Hepatotoxicity A recent study shows that oral administration of NPs in mice affects the expression of metabolic genes and liver metabolism (Yang et al., 2017). We therefore examined the effects of SnS2 NFs on a panel of genes involved in the bile acid metabolism, cholesterol efflux, transporters, and hepatotoxicity (Lokman et al., 2017; Miao et al., 2015). Affected liver tissues were harvested for RNA extraction and western blot after the intragastric administration of the SnS2 NFs. In these experiments, 4 of the 14 genes showed significant differences correlating with SnS2 NF-induced hepatotoxicity (Figure 3A). Among genes encoding uptake transporters, Oapt1 increased significantly in the high dose group, which could contribute to the elimination of metabolite in the blood circulation including bilirubin. Aldoa mainly catalyzed the transformation among dihydroxyacetone phosphate, glyceraldehyde-3-phosphate and fructose 1, 6-bisphosphate in glycolytic pathway, involved in carbohydrate metabolism, cell glucose homeostasis, lipids and fatty acids metabolism. Cyp1a2 is a member of the cytochrome P450 superfamily of enzymes involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The flavin-containing monooxygenases 1 (FMO1) is crucial for the efficient flavoenzyme involved in the metabolism of drugs and other foreign chemicals. The liver tissues of repeated oral administration of SnS2 NFs in mice exhibited potential hepatotoxicity as indicated by the increased expression of Oapt1 and Aldoa, and reduced expression of Cypla2 and Fmo1. These results indicate that mRNA expression of Oapt1, Aldoa, Cypla2, and Fmo1 in mouse blood may offer useful predictors of SnS2 NF-induced glycolysis, synthesis of cholesterol, and metabolism of toxicants. Figure 3. View largeDownload slide Effects of SnS2 NFs on the mRNA expression of genes involved in bile acid metabolism, cholesterol efflux, transporters, and hepatotoxicity in the liver. Mice were treated with SnS2 NFs (size: 50 nm; dose: 1000 mg/kg BW) by intragastric administration for 14 days. A, The genes involved in bile acid metabolism, cholesterol efflux, transporters, and hepatotoxicity were analyzed by qRT-PCR in SnS2 NFs-treated and control liver samples (n = 10). *p < .05 versus control. B, The protein levels of the relative genes that have no change in mRNA levels by Western blot analysis. β-actin was used as the internal control. *p < .05 versus control. C, The protein levels of the relative genes that have changes in mRNA levels by Western blot analysis. β-actin was used as the internal control. *p < .05 versus control. Figure 3. View largeDownload slide Effects of SnS2 NFs on the mRNA expression of genes involved in bile acid metabolism, cholesterol efflux, transporters, and hepatotoxicity in the liver. Mice were treated with SnS2 NFs (size: 50 nm; dose: 1000 mg/kg BW) by intragastric administration for 14 days. A, The genes involved in bile acid metabolism, cholesterol efflux, transporters, and hepatotoxicity were analyzed by qRT-PCR in SnS2 NFs-treated and control liver samples (n = 10). *p < .05 versus control. B, The protein levels of the relative genes that have no change in mRNA levels by Western blot analysis. β-actin was used as the internal control. *p < .05 versus control. C, The protein levels of the relative genes that have changes in mRNA levels by Western blot analysis. β-actin was used as the internal control. *p < .05 versus control. Moreover, we detected the protein levels of the relative genes that have no change in mRNA levels by Western blot analysis, as shown in Figure 3B, there was no difference in the modifications of Cyp27a1, Cyp7a1, Cyp7b1, Cyp8b1, Abca1, Abcg5, Abcg8, Bsep, Ntcp, and Mrp2 proteins in liver tissues of SnS2 NF-administrated mice and control. The modifications of Oapt1, Aldoa, Cypla2, and Fmo1 were further validated by Western blot analysis shown in (Figure 3C). In this study, Oapt1 and Aldoa were increased by 1.38- and 1.26-fold, respectively, and Cypla2 and Fmo1 were decreased by 0.72- and 0.65-fold, respectively, the results are consistent with PCR results, indicating SnS2 NFs had no effect on bile acid and cholesterol metabolism. However, SnS2 NF-applied liver tissues mainly contributed to defects in hepatotoxicity. Effects of SnS2 NFs on Liver Ultrastructure Alteration In control and 250 mg/kg groups, all the nuclei were round and no breakage of organelles were observed, indicating the right procedures of the sample preparation (Figs. 4A and 4B). In mice treated with SnS2 NFs 500 mg/kg/day, the number of mitochondria increased in endoplasmic reticulum (Figure 4C). Furthermore, the number of mitochondria increased more severe in mice treated with SnS2 NFs 1000 mg/kg/day than that in control (Figure 4D). Figure 4. View largeDownload slide Microstructures by TEM in liver tissue. A and B, Structures showing the nucleus, endoplasm, mitochondria in the control group and 250 mg/kg group. C,. Structures showing the increase of mitochondria number in endoplasmic reticulum in group 500 mg/kg. D,. Structures showing the increased mitochondria number. Arrows in panels (C and D) indicated the increase of mitochondria number. Figure 4. View largeDownload slide Microstructures by TEM in liver tissue. A and B, Structures showing the nucleus, endoplasm, mitochondria in the control group and 250 mg/kg group. C,. Structures showing the increase of mitochondria number in endoplasmic reticulum in group 500 mg/kg. D,. Structures showing the increased mitochondria number. Arrows in panels (C and D) indicated the increase of mitochondria number. Effects of SnS2 NFs on Liver Inflammation and Apoptosis The effects of SnS2 NFs on inflammation and apoptosis were evaluated by assay of the mRNA expression of genes regulating inflammation and apoptosis. None of the 4 genes transcription was modified after oral administration of 50-, 80-, and 200-nm SnS2 NFs, compared with control (p > .05, Figure 5A). Although the corresponding values following treatment with 250, 500, and 1000 mg/kg doses of 50-nm SnS2 NFs in the 250, 500 mg/kg groups and controls were not significantly different, expression of TNF-α, IL-10, Bax, and Bcl-2 in the 1000 mg/kg group were higher than in control group (p < .05, Figure 5B). Furthermore, weak immunohistochemical staining of NF-κB was seen in cytoplasm, and stronger staining in the nuclei of liver cells in mice after treatment with 1000 mg/kg SnS2 NFs (Figs. 5C, 5D, 5G, and 5H). This was consistent with the presence of inflammation as a consequence of NF-κB activation. In addition, apoptotic cells were identified in liver tissues by immunohistochemical Bax staining of, which revealed only a few positive cells in control mice, indicating a basal level of apoptosis. The numbers of apoptotic cells was increased in liver tissue of mice treated with 1000 mg/kg SnS2 NFs compared with control (Figs. 5E, 5F, 5I, and 5J). Figure 5. View largeDownload slide Effect of SnS2 NFs on liver inflammation and apoptosis. A, mRNA expression levels of TNF-α, IL-10, Bax and Bcl-2 in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm. B, mRNA expression levels of TNF-α, IL-10, Bax, and Bcl-2 in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg. C, Immunohistochemical staining of NF-κB (brown) in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm at × 400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus. D, Histogram showing percentages of the number containing NF-κB positive cells in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. E, Immunohistochemical staining of Bax (brown) in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm at ×400 magnification. All data are presented as the mean ± SD for 10 mice per group. Quantified band intensities are presented as fold of control. F, Histogram showing percentages of the number containing Bax cells in liver tissues of mice exposed to SnS2 NFs via intraperitoneal injection of 50, 80, and 200 nm. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. G, Immunohistochemical staining of NF- κB (brown) in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg at × 400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus. H, Histogram showing percentages of the number containing NF-κB positive cells in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. I, Immunohistochemical staining of Bax (brown) in liver tissues of mice exposed to SnS2 flowers via intraperitoneal injection of 250, 500, and 1000 mg/kg at ×400 magnification. All data are presented as the mean ± SD for 10 mice per group. Quantified band intensities are presented as fold of control. J, Histogram showing percentages of the number containing Bax cells in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) Figure 5. View largeDownload slide Effect of SnS2 NFs on liver inflammation and apoptosis. A, mRNA expression levels of TNF-α, IL-10, Bax and Bcl-2 in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm. B, mRNA expression levels of TNF-α, IL-10, Bax, and Bcl-2 in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg. C, Immunohistochemical staining of NF-κB (brown) in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm at × 400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus. D, Histogram showing percentages of the number containing NF-κB positive cells in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. E, Immunohistochemical staining of Bax (brown) in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm at ×400 magnification. All data are presented as the mean ± SD for 10 mice per group. Quantified band intensities are presented as fold of control. F, Histogram showing percentages of the number containing Bax cells in liver tissues of mice exposed to SnS2 NFs via intraperitoneal injection of 50, 80, and 200 nm. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. G, Immunohistochemical staining of NF- κB (brown) in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg at × 400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus. H, Histogram showing percentages of the number containing NF-κB positive cells in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. I, Immunohistochemical staining of Bax (brown) in liver tissues of mice exposed to SnS2 flowers via intraperitoneal injection of 250, 500, and 1000 mg/kg at ×400 magnification. All data are presented as the mean ± SD for 10 mice per group. Quantified band intensities are presented as fold of control. J, Histogram showing percentages of the number containing Bax cells in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) DISCUSSION The biological effects of metal-containing NPs are influenced by their properties such as shape, size, dose, material components and dissolution. Both decreasing particle size and increasing concentration increase the toxicity of copper NPs (Prabhu et al., 2010), and Polytetrafluoroethylene toxicity decreases with aggregation and increases with grain size of >100 nm (Johnston et al., 2000). Wang et al. (2006) have reported that 58-nm zinc NPs cause less liver injury than microsized zinc particles (1.08 μm) (Wang et al., 2006). Warheit et al. (2006) have shown that nano- and microsized TiO2 particles induce the same degree of inflammation and cell damage in rat lungs and that their toxicity does not significantly correlate with the particle size (Warheit et al., 2006). Overall, the relationship between the particle size and tissue damage by nanomaterials is unclear, and the evidence is contradictory. Although SnS2 as a compound has low toxicity, its toxicity may differ as NPs. In this study, we compared the toxicity of different sizes of SnS2 NFs in mice and found that the oral administration of 50-, 80-, and 200-nm SnS2 NFs at 250 mg/kg had no effect on liver injury, whereas the repeated oral administration of 50-nm SnS2 NFs in distilled water at 1000 mg/kg induced hepatotoxicity and these mice were asymptomatic, which gave an important clue regarding the no-observed-adverse-effect level. Tin levels in the mouse liver significantly increased after the oral administration of SnS2 NFs at different doses and became the material basis for subsequent hepatic injury. Although different sizes of SnS2 NFs (50, 80, and 200 nm) at 250 mg/kg did not influence hepatotoxicity, pathological evaluation revealed moderate interstitial hyperemia along with sporadic and focal inflammatory cell infiltration in the liver tissue of the mice treated with a high dose (1000 mg/kg) of 50-nm SnS2 NFs. This result is consistent with that of a previous study by oral administration of TiO2 NPs in mice (Wang et al, 2007a). The AST/ALT ratio did not change in the 50-, 80-, and 200-nm groups but increased in a dose-dependent manner in the 250, 500, and 1000 mg/kg groups and became significant for the 1000 mg/kg group. From these findings, we can deduce that SnS2 NFs showed no obvious acute toxicity in 2 weeks and SnS2 NFs could be transported to liver tissues after uptake by gastrointestinal tract. In this experiment, after oral ingestion of massive SnS2 particles (1000 mg/kg) once, the difficult clearance of 50-nm SnS2in vivo may directly result in the particle deposition in the liver. Similarily, after oral exposure to low dose of SnS2 NFs (even <250 mg/kg) for long term, the mice could also exhibit a significantly increased hepatotoxicity because of the particle accumulation in the liver and lead to the hepatic lesion. Hepatic transporters are crucial for the efflux of bile acid and the elimination of metabolites such as bilirubin. Transporter regulation is an adaptive mechanism that minimizes the toxic effects (Yang et al., 2017). In this study, among various transporters, the uptake transporter gene Oapt1 was upregulated in the high-dose group, and several hepatotoxicity genes, including Aldoa, Cyp1a2, and Fmo1, were modified as the concentration of SnS2 NFs administered to the mice increased. The bile acid synthesis enzyme Cyp8b1, which determines the bile salt profile, as well as other bile acid enzymes such as Cyp27a1, Cyp7a1, and Cyp7b1 did not show consistent or considerable change following the administration of SnS2 NFs. Although the levels of cholesterol and bile transporters (Abca1, Abcg5, Abcg8, Ntcp, Mrp2, and Bsep) increased following the administration of SnS2 NFs, the increase was not significant. These results suggested that the repeated exposure to SnS2 NFs in the high-dose group altered the expression of several metabolic genes in the liver, supporting the above biochemical phenotype, was a physiological response and adapting mechanism for alien invasion. Both inflammation and apoptosis are responses to the exposure to toxic materials (Roberts et al., 2009). The exposure to 50-nm SnS2 NFs induced NF-κB-mediated inflammation and apoptosis in the liver. NF-κB activation in the liver may have been directly or indirectly involved in the reduced cell growth during generalized oxidative stress, with the simultaneous presence of inflammation, given that TNF-α and IL-10 are inflammatory mediators of oxidative damage that are induced by toxic materials and carcinogens (Hussain and Harris, 2007) that ROS can stimulate NF-κB activation (Morgan and Liu, 2011). The apoptotic status can be checked by examining the expression of several apoptotic genes. As shown in Figure 4, inflammatory factors and apoptotic genes remained unaffected for the different-sized groups and in low-dose groups but were modified in the high-dose group (50 nm; 1000 mg/kg), which is consistent with the results of biological analysis and pathological examination. CONCLUSIONS Repeated oral administration of high-dose (1000 mg/kg) SnS2 NFs (50 nm) resulted in mitochondria increased, inflammatory responses and moderate apoptosis in liver tissue. Modification of hepatic metabolism by SnS2 NFs might pose risk of metabolic disease. These data provided useful information for risk analysis and the regulation of nano-sized materials by administrative agencies. FUNDING This work is supported by the National Natural Science Foundation of China (No. 51572190). REFERENCES Bai D., Li Q., Xiong Y., Zhao J., Bai L., Shen P., Yuan L., Wu P. ( 2017). Effects of intraperitoneal injection of SnS2 flowers on mouse testicle. Toxicol. Sci . 161, 388– 400. Google Scholar CrossRef Search ADS   Borm P. J., Robbins D., Haubold S., Kuhlbusch T., Fissan H., Donaldson K., Schins R., Stone V., Kreyling W., Lademann J.et al.  , . ( 2006). The potential risks of nanomaterials: a review carried out for ECETOC. Particle Fibre Toxicol . 3, 11– 46. Google Scholar CrossRef Search ADS   Bu Q., Yan G., Deng P., Peng F., Lin H., Xu Y., Cao Z., Zhou T., Xue A., Wang Y.et al.  , . ( 2010). Nmr-based metabonomic study of the sub-acute toxicity of titanium dioxide nanoparticles in rats after oral administration. Nanotechnology  21, 125105. Google Scholar CrossRef Search ADS PubMed  Du W., Deng D., Han Z., Xiao W., Bian C., Qian X. ( 2011). Hexagonal tin disulfide nanoplatelets: a new photocatalyst driven by solar light. Crystengcomm  13, 2071– 2076. Google Scholar CrossRef Search ADS   Ge S., Zhang L. ( 2011). Efficient visible light driven photocatalytic removal of RhB and NO with low temperature synthesized In(OH)xSy hollow nanocubes: A comparative study. Environ. Sci. Technol . 45, 3027– 3033. Google Scholar CrossRef Search ADS PubMed  Holsapple M. P., Farland W. H., Landry T. D., Monteiro-Riviere N. A., Carter J. M., Walker N. J., Thomas K. V. ( 2005). Research strategies for safety evaluation of nanomaterials, part ii: Toxicological and safety evaluation of nanomaterials, current challenges and data needs. Toxicol. Sci . 88, 12– 17. Google Scholar CrossRef Search ADS PubMed  Hussain S. P., Harris C. C. ( 2007). Inflammation and cancer: An ancient link with novel potentials. Int. J. Cancer  121, 2373– 2380. Google Scholar CrossRef Search ADS PubMed  Johnston C. J., Finkelstein J. N., Mercer P., Corson N., Gelein R., Oberdörster G. ( 2000). Pulmonary effects induced by ultrafine PTFE particles. Toxicol. Appl. Pharmacol . 168, 208– 215. Google Scholar CrossRef Search ADS PubMed  Kipen H. M., Laskin D. L. ( 2005). Smaller is not always better: nanotechnology yields nanotoxicology. Ajp Lung Cell. Mol. Physiol . 289, L696– L707. Google Scholar CrossRef Search ADS   Lam C. W., James J. T., McCluskey R., Hunter R. L. ( 2003). Pulmonary toxicity of single-wall carbon nanotubes in mice 7 and 90 days after intratracheal instillation. Toxicol. Sci . 77, 126– 134. Google Scholar CrossRef Search ADS PubMed  Liang S., Zhou Z., Wu X., Zhu S., Bi J., Zhou L., Liu M., Wu L. ( 2016). Constructing a MoS2 QDs/CdS core/shell flowerlike nanosphere hierarchical heterostructure for the enhanced stability and photocatalytic activity. Molecules  21, 213– 226. Google Scholar CrossRef Search ADS   Lin W., Huang Y. W., Zhou X. D., Ma Y. ( 2006). In vitro toxicity of silica nanoparticles in human lung cancer cells. Toxicol. Appl. Pharmacol . 217, 252– 259. Google Scholar CrossRef Search ADS PubMed  Lokman E. F., Muhammad H., Awang N., Omar M. H., Mansor F., Saparuddin F. ( 2017). Gene expression profiling associated with hepatoxicity in pregnant rats treated with ubi gadong (dioscorea hispida) extract. Int. J. Biomed. Sci.  13, 26– 34. PMID: 28533734 Google Scholar PubMed  Ma D., Zhang R. N., Wen Y., Yin W. N., Bai D. S., Zheng G. Y., Li J. S., Zheng B., Wen J. K. ( 2017). 1, 25(OH)2D3-induced interaction of vitamin D receptor with p50 subunit of NF-κB suppresses the interaction between KLF5 and p50, contributing to inhibition of LPS-induced macrophage proliferation. Biochem. Biophys. Res. Commun . 482, 366– 374. Google Scholar CrossRef Search ADS PubMed  Mcconnell E. L., Basit A. W., Murdan S. ( 2008). Measurements of rat and mouse gastrointestinal ph, fluid and lymphoid tissue, and implications for in-vivo experiments. J. Pharm. Pharmacol . 60, 63– 70. Google Scholar CrossRef Search ADS PubMed  Miao J., Ling A. V., Manthena P. V., Gearing M. E., Graham M. J., Crooke R. M., Croce K. J., Esquejo R. M., Clish C. B. Morbid Obesity Study Group Vicent D., Biddinger S. B. ( 2015). Flavin-containing monooxygenase 3 as a potential player in diabetes-associated atherosclerosis. Nat. Commun . 6, 6498– 6507. Google Scholar CrossRef Search ADS PubMed  Morgan M. J., Liu Z. G. ( 2011). Crosstalk of reactive oxygen species and NF-κB signaling. Cell Res . 21, 103– 115. Google Scholar CrossRef Search ADS PubMed  Nel A., Xia T., Mädler L., Li N. ( 2006). Toxic potential of materials at the nanolevel. Science  311, 622– 627. Google Scholar CrossRef Search ADS PubMed  Oliveira L. C. A., Oliveira H. S., Mayrink G., Mansur H. S., Mansur A. A. P., Moreira R. L. ( 2014). One-pot synthesis of CdS@Nb2O5, core–shell nanostructures with enhanced photocatalytic activity. Appl. Cataly. B Environ . 152–153, 403– 412. Google Scholar CrossRef Search ADS   Prabhu B. M., Ali S. F., Murdock R. C., Hussain S. M., Srivatsan M. ( 2010). Copper nanoparticles exert size and concentration dependent toxicity on somatosensory neurons of rat. Nanotoxicology  4, 150– 160. Google Scholar CrossRef Search ADS PubMed  Roberts R. A., Laskin D. L., Smith C. V., Robertson F. M., Allen E. M., Doorn J. A., Slikker W. ( 2009). Nitrative and oxidative stress in toxicology and disease. Toxicol. Sci . 112, 4– 16. Google Scholar CrossRef Search ADS PubMed  Wallach D., Bar-Nun S., Ohad I. ( 2015). Assessment of SnS2 nanoparticles properties for photocatalytic and antibacterial applications. Solar Energy  117, 187– 191. Google Scholar CrossRef Search ADS   Wang B., Feng W. Y., Wang T. C., Jia G., Wang M., Shi J. W., Zhang F., Zhao Y. L., Chai Z. F. ( 2006). Acute toxicity of nano- and micro-scale zinc powder in healthy adult mice. Toxicol. Lett . 161, 115– 123. Google Scholar CrossRef Search ADS PubMed  Wang C., Wang L., Jin J., Liu J., Li Y., Wu M., Chen L. H., Wang B. J., Yang X. Y., Su B. L. ( 2016). Probing effective photocorrosion inhibition and highly improved photocatalytic hydrogen production on monodisperse PANI@CdS core-shell nanospheres. Appl. Cataly B Environ . 188, 351– 359. Google Scholar CrossRef Search ADS   Wang J., Zhou G., Chen C., Yu H., Wang T., Ma Y., Jia G., Gao Y., Li B., Sun J.et al.  , . ( 2007a). Acute toxicity and biodistribution of different sized titanium dioxide particles in mice after oral administration. Toxicol. Lett . 168, 176– 185. Google Scholar CrossRef Search ADS   Wang J. J., Sanderson B. J., Wang H. ( 2007b). Cyto- and genotoxicity of ultrafine TiO2 particles in cultured human lymphoblastoid cells. Mut. Res . 628, 99– 106. Google Scholar CrossRef Search ADS   Warheit D. B., Webb T. R., Sayes C. M., Colvin V. L., Reed K. L. ( 2006). Pulmonary instillation studies with nanoscale TiO2 rods and dots in rats: Toxicity is not dependent upon particle size and surface area. Toxicol. Sci . 91, 227– 236. Google Scholar CrossRef Search ADS PubMed  Yan S. C., Li Z. S., Zou Z. G. ( 2009). Photodegradation performance of g-C3N4 fabricated by directly heating melamine. Langmuir  25, 10397– 10401. Google Scholar CrossRef Search ADS PubMed  Yan T., Li L., Li G., Wang Y., Hu W., Guan X. ( 2011). Porous SnIn4S8, microspheres in a new polymorph that promotes dyes degradation under visible light irradiation. J. Hazard. Mater . 186, 272– 279. Google Scholar CrossRef Search ADS PubMed  Yang J., Luo M., Tan Z., Dai M., Xie M., Lin J., Hua H., Ma Q., Zhao J., Liu A. ( 2017). Oral administration of nano-titanium dioxide particle disrupts hepatic metabolic functions in a mouse model. Environ. Toxicol. Pharmacol . 49, 112– 118. Google Scholar CrossRef Search ADS PubMed  Zhang Z., Shao C., Li X., Sun Y., Zhang M., Mu J., Zhang P., Guo Z., Liu Y. ( 2013). Hierarchical assembly of ultrathin hexagonal SnS2 nanosheets onto electrospun TiO2 nanofibers: Enhanced photocatalytic activity based on photoinduced interfacial charge transfer. Nanoscale  5, 606– 618. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2018. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Toxicological Sciences Oxford University Press

Hepatic, Metabolic, and Toxicity Evaluation of Repeated Oral Administration of SnS2 Nanoflowers in Mice

Loading next page...
 
/lp/ou_press/hepatic-metabolic-and-toxicity-evaluation-of-repeated-oral-9K2M0jnW0n
Publisher
Oxford University Press
Copyright
© The Author(s) 2018. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
1096-6080
eISSN
1096-0929
D.O.I.
10.1093/toxsci/kfy104
Publisher site
See Article on Publisher Site

Abstract

Abstract Tin sulfide (SnS2) nanoflowers (NFs) with highly photocatalytic activity for wastewater treatment may lead to potential health hazards via oral routes of human exposure. No studies have reported the hepatic effects of SnS2 NFs on the metabolic function and hepatotoxicity. In this study, we examined the hepatic effects of the oral administration of SnS2 NFs (250–1000 mg/kg) to ICR mice for 14 days, with the particle size ranging from 50 to 200 nm. Serum and liver tissue samples were assayed using biochemical analysis, liver histopathology and metabolic gene expression. The different sizes of SnS2 NFs (250 mg/kg dose), such as 50, 80, and 200 nm, did not induce any adverse hepatic effect related to biochemical parameters or histopathology in the treated mice compared with controls. The oral administration of 50-nm SnS2 NFs at doses of 250, 500, and 1000 mg/kg for 14 days produced dose-dependent hepatotoxicity and inflammatory responses in treated mice. Furthermore, the expression of metabolic genes in the liver tissues was altered, supporting the SnS2 NF-related hepatotoxic phenotype. The oral administration of SnS2 NFs also produced abnormal microstructures in the livers of the treated mice. Taken together, these data indicate that the increased risk of hepatotoxicity in SnS2 NF-treated mice was independent of the particle size but was dependent on their dose. The no-observed-adverse effect level was <250 mg/kg for the 50-nm SnS2 NFs. Our study provides an experimental basis for the safe application of SnS2 NFs. tin sulfide nanoflowers, liver metabolism, Inflammatory responses Nanomaterials, at least 1 dimension ranging 1–100 nm in size, have diverse applications, eg, as drug carriers, industrial fillers, opacifiers and catalysts, in addition to the production of semiconductors, cosmetics and microelectronics (Nel et al., 2006). The dissemination of nanoparticles (NPs) may have negative environmental and ecological effects, as well as adverse effects in humans (Borm et al., 2006; Holsapple et al., 2005; Kipen et al., 2005). Experimental evidence has confirmed the toxic effects of NPs at the tissue, cellular, subcellular and molecular levels (Lam et al., 2004; Lin et al., 2006; Wang et al., 2007a,b). Tin sulfide (SnS2) is a II–IV semiconductor with photoelectric properties within the visible spectrum (Ge et al., 2011; Liang et al., 2016; Oliveira et al., 2014; Wang et al., 2016; Yan et al., 2009, 2011). SnS2 nanomaterials have electrical and nonlinear optical properties that are different from those of SnS2 blocks or thin films. Hexagonal nanosheets, in addition to being nontoxic, have advantageous uses as photocatalysts and possess high efficiency, chemical stability in acidic and neutral pH aqueous solutions and thermal stability in air (Du et al., 2011; Zhang et al., 2013). Similarly, SnS2 nanoflowers (NFs) are novel nanomaterials with excellent photocatalytic properties, but their potential public health effects remain unclear. We have previously shown that the overdose of intraperitoneally injected SnS2 NFs can cause damage and increase the permeability within the blood-testis barrier in mouse testicular tissues. In addition, nanosized SnS2 particles (50 and 80 nm) exhibit greater reactivity than microsized SnS2 particles (200 nm) (Bai et al., 2017). SnS2 NFs are widely used in consumer products, including paints, textiles and sunscreens, and particularly for photocatalytic and antibacterial applications (Wallach et al., 2015). Alongside this, SnS2 NFs can play an important role in waste water treatment, and it may create a risk for the pollution of soil and water resources. Therefore, the gastrointestinal tract becomes an important absorption route for SnS2 NFs, and disturbances in the amino acid metabolism and gut microflora environment results in liver injury (Bu et al., 2010). Furthermore, existing information on the relationship between SnS2 NFs and liver toxicity is very limited, particularly in relation to in vivo studies. Therefore, in this study, 3 different sized SnS2 NFs (50, 80, and 200 nm) were prepared and repeatedly orally administered to mice at doses of 250, 500, and 1000 mg/kg for 14 days to evaluate hepatotoxicity. The resulting biochemical reactions, oxidative damage, metabolic changes and microstructures of the liver tissues, as well as inflammatory responses and histopathological effects, were studied to evaluate the hazardous effects of SnS2 NFs. MATERIALS AND METHODS Chemicals and characterization of SnS2 NFs 3 different sizes of SnS2 NFs (the diameter were 50, 80, and 200 nm) with high purity were provided by the Department of Applied Physics, Tianjin Key Laboratory of low-dimensional materials physics and preparing technology, Faculty of Science, Tianjin University. SnS2 NFs were synthesized by a 1-step hydrothermal growth reaction. All the chemicals used in this experiment were of analytical grade without further purification. The method of synthesis and characterization of of SnS2 flowers has been introduced in our recent article (Bai et al., 2017). To understand how SnS2 NF behave and where it translocated across the digestive tract and then to liver, the hydrodynamic sizes and zeta potential of SnS2 NFs were examined using a Zetasizer (Malvern Nano-ZS90, Britain) to examine the aggregate or distributed status of SnS2 NFs in acidic solution with BSA (bovine serum albumin) or not at various pH values (Fed: stomach pH2.98 and duodenum pH4.04; Fasted: stomach pH4.04 and duodenum pH4.74 in mice) (McConnell et al., 2008). The mean particle diameter is calculated by the software from the particle distributions measured. Pure SnCl4٠5H2O was purchased from Tianjin Superstar st source Chemistry Technological Co., Ltd. (Tianjin, China). Triton X-100 was purchased from Shanghai Yiteng Biological Science and Technology Co., Ltd. (Shanghai, China). Pure ethanol amine was purchased from Shanghai Mindray Chemistry Technology Co., Ltd. (Shanghai, China). Chemicals were all guaranteed reagents. Animal rearing and treatment As the main aim was to test whether SnS2 NFs could induce hepatic toxicology but not concerned about gender differences, male mice were employed in this study. Adult 70 male specific-pathogen-free Institute of Cancer Research (ICR) mice, body weight (BW) 29–33 g, bought from the Laboratory Animal Center of North China University of Science and Technology and conducted in full accordance with the PHS Policy on Humane Care and Use of Laboratory Animals. The experimental protocol was approved by Animal Care Welfare Committee. The mice were kept in plastic cages with a controlled environment at 22°C–26°C, with 55%–60% humidity and a 12-h light/dark cycle. Standardized granular food and sterile water were provided ad libitum. After 1-week feeding, mice were assigned randomly into 7 groups as follows: mice were intragastric administrated with SnS2 flowers of 50, 80, and 200 nm in a 250 mg/kg dose for 14 days (10 mice per group), respectively for size-different toxicity tests. Mice were also treated with SnS2 NFs (size: 50 nm, dose: 250, 500, and 1000 mg/kg) by intragastric administration for 14 days (10 mice per group) for repeated-dose toxicity test. The control group was treated with de-ionized water without SnS2 NFs, which was prepared by the same process to prepare SnS2 NFs suspension. After the last time, the weight of mice was recorded and then each mouse was killed with collection of 1 ml blood and total liver tissues. The specimens were stored in −80°C and the liver tissues were fixed in formaldehyde fluid prepared for histopathologic examination. The general situation and the coefficient of the liver We observed mice eating and drinking of water, fur luster and mental state and compared the mouse’ BW. After the mice were sacrificed, the liver tissue of each mouse was weighed in electronic scale. Then the formula (liver coefficient = total liver wet weight/BW × 100%) was used to calculate the viscera coefficient. The content of tin in whole blood and various parts of the body Tissue samples including liver, kidney, spleen, heart, brain, testicle (each for 0.1 g) and 1.0 ml whole blood were taken from SnS2 NF-treated mice and control in each group, then digested and analyzed for tin content by 7500 type inductively coupled plasma-mass spectrometry (ICP-MS, Agilent, USA). The working conditions of ICP-MS were as follows: emission power, 1420 w; frequency, 27.12; atomization pressure, 32Ibf/in2; auxiliary gas flow, 1.08 l/min; injection speed, 1.85 ml/min; dilute nitricacid (2%) flushing time, 1 min; ultrapure water flushing time, 1 min. Determination of liver function Mouse blood samples were processed for alanine aminotransferase (ALT) and aspartate aminotransferase (AST) using Dimension@ clinical chemistry system (Dimension AR, Delaware) kits and blood serum biochemical analysis were obtained from biomerieux, Laboratory of Reagents and Products (Marcy Letoile, France). The determination of hematologic indexes Blood counts were measured by assaying 1 specimen from every mouse for red blood cells (RBCs), average red blood cell volume (MCV), mean red blood cell hemoglobin concentration (MCHC), and white blood cells (WBCs) on the Advia 120 (Bayer Diagnostics) automated hematology analyzer. Histopathology and ultrastructure analysis A liver slice was cut from the middle of the biggest lobe in SnS2 NF-treated mice and control. The liver tissues were taken out of 4% formaldehyde, following with regular dehydration, transparent, paraffin embedding, sectioning and dewaxing. After hematoxylin-eosin (HE) staining, again with dehydration, transparent and sealing, liver histopathology was observed in light microscope and photos were taken. Liver tissues were prefixed in 2.5% glutaraldehyde, washed in a cacodylate buffer and post fixed in 1% osmium tetroxide. Tissues were then dehydrated in ascending grades of alcohols and embedded in an eponaraldite mixture. Ultrathin sections stained with uranylacetate and lead citrate were examined under a transmission electron microscope (FEI Tecnai G212, Phillips, Holland). Livers from 3 mice of each experimental group were randomly collected for these analyses. Three blocks of each group and 10 electron micrographs for each block were examined. RNA isolation and RT-PCR The primer sequences listed in Table 1. Total RNA was extracted from liver tissues using RNA Easy kit (Qiagen, Germany), according to the manufacturer’s protocol. 1 μg of RNA was subjected to reverse transcription using first-strand cDNA synthesis kit (Invitrogen) according to the manufacturer's instructions. qRT-PCR of mRNAs was performed using Platinum SYBR Green qPCR Super Mix UDG Kit (Invitrogen), and real-time PCR experiments were carried on a ABI 7500 FAST system (Life Technologies). Relative amount of transcripts was normalized with β-Actin and calculated using the 2−ΔΔCt formula as previously described in Ma et al. (2017). Table 1. List of Primers Used for Real Time RT-PCR Function  Gene Name  Sequence (5’-3’)  Product (bp)  Bile acid synthetic enzymes  Cyp27a1  F: GGGCACTAGCCAGATTCACA  107  R: CTATGTGCTGCACTTGCCC  Cyp7a1  F: GTCCGGATATTCAAGGATGC  107  R: GGGAATGCCATTTACTTGGA  Cyp7b1  F: TGGTCTGCCTGGAAAGCAC  107  R: ACTCTTACTCTCTAAGCTGAGATTC  Cyp8b1  F: GATAGGGGAAGAGAGCCACC  96  R: TCCTCAGGGTGGTACAGGAG  Cholesterol efflux  Abca1  F: CAGAGCCCACTTCTCTCCG  200  R: TGTGGCTGGTCATTAACTGT  Abcg5  F: GTCCTGCTGAGGCGAGTAAC  136  R: CGCCCTTTAGCGTGTTGTTC  Abcg8  F: CCTGTGGATAGTGCCTGCAT  181  R: CGCATAGAGTGGATGCGAGT  Bile transporters  Bsep  F: AAGGACAGCCACACCAACTC  100  R: CCAGAACATGACAAACGGAA  Ntcp  F: TCCGTCGTAGATTCCTTTGC  96  R: AGGGGGACATGAACCTCAG  Oatp1  F: TAATCGGGCCAACAATCTTC  109  R: ACTCCCATAATGCCCTTGG  Mrp2  F: GCAGGTGTTCGTTGTGTGTC  139  R: CACCAGGAGCCAAGTGCATA  Hepatotoxicity  Aldoa  F: GCGCCCTGGCCAACA  190  R: GGAAAGAGCCTGAAGACCCC  Cyp1a2  F: GGAGCTGGCTTTGACACAGT  77  R: CTCTGCACGTTAGGCCATGT  Fmo1  F: CCACTCTGCCAGAAGCTACA  196  R: TCCCTTCTTCAACATGTTCCGTG  Inflammation  TNF-α  F: CATGGATCTCAAAGACAACCAA  103  R: CTCCTGGTATGAAATGGCAAAT  IL-10  F: TGTCAAATTCATTCATGGCCT  108  R: ATCGATTTCTCCCCTGTGAA  Apoptosis  Bax  F: GATCAGCTCGGGCACTTTAG  120  R: TTGCTGATGGCAACTTCAAC  Bcl-2  F: GGTCTTCAGAGACAGCCAGG  113  R: GATCCAGGATAACGGAGGCT  Reference gene  β-Actin  F: CGTAAAGACCTCTATGCCAACA  117  R: GGACTCATCGTACTCCTGCTT  Function  Gene Name  Sequence (5’-3’)  Product (bp)  Bile acid synthetic enzymes  Cyp27a1  F: GGGCACTAGCCAGATTCACA  107  R: CTATGTGCTGCACTTGCCC  Cyp7a1  F: GTCCGGATATTCAAGGATGC  107  R: GGGAATGCCATTTACTTGGA  Cyp7b1  F: TGGTCTGCCTGGAAAGCAC  107  R: ACTCTTACTCTCTAAGCTGAGATTC  Cyp8b1  F: GATAGGGGAAGAGAGCCACC  96  R: TCCTCAGGGTGGTACAGGAG  Cholesterol efflux  Abca1  F: CAGAGCCCACTTCTCTCCG  200  R: TGTGGCTGGTCATTAACTGT  Abcg5  F: GTCCTGCTGAGGCGAGTAAC  136  R: CGCCCTTTAGCGTGTTGTTC  Abcg8  F: CCTGTGGATAGTGCCTGCAT  181  R: CGCATAGAGTGGATGCGAGT  Bile transporters  Bsep  F: AAGGACAGCCACACCAACTC  100  R: CCAGAACATGACAAACGGAA  Ntcp  F: TCCGTCGTAGATTCCTTTGC  96  R: AGGGGGACATGAACCTCAG  Oatp1  F: TAATCGGGCCAACAATCTTC  109  R: ACTCCCATAATGCCCTTGG  Mrp2  F: GCAGGTGTTCGTTGTGTGTC  139  R: CACCAGGAGCCAAGTGCATA  Hepatotoxicity  Aldoa  F: GCGCCCTGGCCAACA  190  R: GGAAAGAGCCTGAAGACCCC  Cyp1a2  F: GGAGCTGGCTTTGACACAGT  77  R: CTCTGCACGTTAGGCCATGT  Fmo1  F: CCACTCTGCCAGAAGCTACA  196  R: TCCCTTCTTCAACATGTTCCGTG  Inflammation  TNF-α  F: CATGGATCTCAAAGACAACCAA  103  R: CTCCTGGTATGAAATGGCAAAT  IL-10  F: TGTCAAATTCATTCATGGCCT  108  R: ATCGATTTCTCCCCTGTGAA  Apoptosis  Bax  F: GATCAGCTCGGGCACTTTAG  120  R: TTGCTGATGGCAACTTCAAC  Bcl-2  F: GGTCTTCAGAGACAGCCAGG  113  R: GATCCAGGATAACGGAGGCT  Reference gene  β-Actin  F: CGTAAAGACCTCTATGCCAACA  117  R: GGACTCATCGTACTCCTGCTT  Table 1. List of Primers Used for Real Time RT-PCR Function  Gene Name  Sequence (5’-3’)  Product (bp)  Bile acid synthetic enzymes  Cyp27a1  F: GGGCACTAGCCAGATTCACA  107  R: CTATGTGCTGCACTTGCCC  Cyp7a1  F: GTCCGGATATTCAAGGATGC  107  R: GGGAATGCCATTTACTTGGA  Cyp7b1  F: TGGTCTGCCTGGAAAGCAC  107  R: ACTCTTACTCTCTAAGCTGAGATTC  Cyp8b1  F: GATAGGGGAAGAGAGCCACC  96  R: TCCTCAGGGTGGTACAGGAG  Cholesterol efflux  Abca1  F: CAGAGCCCACTTCTCTCCG  200  R: TGTGGCTGGTCATTAACTGT  Abcg5  F: GTCCTGCTGAGGCGAGTAAC  136  R: CGCCCTTTAGCGTGTTGTTC  Abcg8  F: CCTGTGGATAGTGCCTGCAT  181  R: CGCATAGAGTGGATGCGAGT  Bile transporters  Bsep  F: AAGGACAGCCACACCAACTC  100  R: CCAGAACATGACAAACGGAA  Ntcp  F: TCCGTCGTAGATTCCTTTGC  96  R: AGGGGGACATGAACCTCAG  Oatp1  F: TAATCGGGCCAACAATCTTC  109  R: ACTCCCATAATGCCCTTGG  Mrp2  F: GCAGGTGTTCGTTGTGTGTC  139  R: CACCAGGAGCCAAGTGCATA  Hepatotoxicity  Aldoa  F: GCGCCCTGGCCAACA  190  R: GGAAAGAGCCTGAAGACCCC  Cyp1a2  F: GGAGCTGGCTTTGACACAGT  77  R: CTCTGCACGTTAGGCCATGT  Fmo1  F: CCACTCTGCCAGAAGCTACA  196  R: TCCCTTCTTCAACATGTTCCGTG  Inflammation  TNF-α  F: CATGGATCTCAAAGACAACCAA  103  R: CTCCTGGTATGAAATGGCAAAT  IL-10  F: TGTCAAATTCATTCATGGCCT  108  R: ATCGATTTCTCCCCTGTGAA  Apoptosis  Bax  F: GATCAGCTCGGGCACTTTAG  120  R: TTGCTGATGGCAACTTCAAC  Bcl-2  F: GGTCTTCAGAGACAGCCAGG  113  R: GATCCAGGATAACGGAGGCT  Reference gene  β-Actin  F: CGTAAAGACCTCTATGCCAACA  117  R: GGACTCATCGTACTCCTGCTT  Function  Gene Name  Sequence (5’-3’)  Product (bp)  Bile acid synthetic enzymes  Cyp27a1  F: GGGCACTAGCCAGATTCACA  107  R: CTATGTGCTGCACTTGCCC  Cyp7a1  F: GTCCGGATATTCAAGGATGC  107  R: GGGAATGCCATTTACTTGGA  Cyp7b1  F: TGGTCTGCCTGGAAAGCAC  107  R: ACTCTTACTCTCTAAGCTGAGATTC  Cyp8b1  F: GATAGGGGAAGAGAGCCACC  96  R: TCCTCAGGGTGGTACAGGAG  Cholesterol efflux  Abca1  F: CAGAGCCCACTTCTCTCCG  200  R: TGTGGCTGGTCATTAACTGT  Abcg5  F: GTCCTGCTGAGGCGAGTAAC  136  R: CGCCCTTTAGCGTGTTGTTC  Abcg8  F: CCTGTGGATAGTGCCTGCAT  181  R: CGCATAGAGTGGATGCGAGT  Bile transporters  Bsep  F: AAGGACAGCCACACCAACTC  100  R: CCAGAACATGACAAACGGAA  Ntcp  F: TCCGTCGTAGATTCCTTTGC  96  R: AGGGGGACATGAACCTCAG  Oatp1  F: TAATCGGGCCAACAATCTTC  109  R: ACTCCCATAATGCCCTTGG  Mrp2  F: GCAGGTGTTCGTTGTGTGTC  139  R: CACCAGGAGCCAAGTGCATA  Hepatotoxicity  Aldoa  F: GCGCCCTGGCCAACA  190  R: GGAAAGAGCCTGAAGACCCC  Cyp1a2  F: GGAGCTGGCTTTGACACAGT  77  R: CTCTGCACGTTAGGCCATGT  Fmo1  F: CCACTCTGCCAGAAGCTACA  196  R: TCCCTTCTTCAACATGTTCCGTG  Inflammation  TNF-α  F: CATGGATCTCAAAGACAACCAA  103  R: CTCCTGGTATGAAATGGCAAAT  IL-10  F: TGTCAAATTCATTCATGGCCT  108  R: ATCGATTTCTCCCCTGTGAA  Apoptosis  Bax  F: GATCAGCTCGGGCACTTTAG  120  R: TTGCTGATGGCAACTTCAAC  Bcl-2  F: GGTCTTCAGAGACAGCCAGG  113  R: GATCCAGGATAACGGAGGCT  Reference gene  β-Actin  F: CGTAAAGACCTCTATGCCAACA  117  R: GGACTCATCGTACTCCTGCTT  Western blot analysis Expression of Cyp27a1, Cyp7a1, Cyp7b1, Cyp8b1, Abca1, Abcg5, Abcg8, Bsep, Ntcp, Oatp1, Mrp2, Aldoa, Cyp1a2, Fmo1 was assayed by western blotting. Liver tissue extracts were separated by SDS-PAGE, and transferred onto PVDF membrane (Millipore). Membranes were blocked with 5%milk in TTBS for 2 h at 37°C and incubated overnight at 4°C with the following primary antibodies: rabbit antiCyp27a1(1:1000, 19195-1-AP, Proteintech), rabbit antiCyp7a1 (1:1000, 18054-1-AP, Proteintech), rabbit antiCyp7b1 (1:1000, 24889-1-AP, Proteintech), rabbit antiCyp8b1 (1:1000, 63-644, ProSci), rabbit antiAbca1 (1:1000, PA132129, thermo), rabbit antiAbcg5 (1:1000, 27722-1-AP, Proteintech), rabbit antiAbcg8 (1:1000,PA116792, thermo), rabbit antiBsep (1:1000, 18990-1-AP, Proteintech), rabbit antiNtcp (1:1000, GTX11902, GeneTex), rabbit antiOatp1 (1:1000, 17163-1-AP, Proteintech), rabbit antiMrp2 (1:1000, 24893-1-AP, Proteintech), rabbit antiAldoa (1:1000, 11217-1-AP, Proteintech), rabbit antiCyp1a2 (1:5000, 19936-1-AP, Proteintech), rabbit antiFmo1 (1:1000, ab225910, Abcam), and rabbit anti b-actin (1:5000, Proteintech). Membranes were washed and incubated with the appropriate horseradish peroxidase-conjugated secondary antibody (Cell Signaling Technology). Protein bands were detected by ECL plus (Thermo Scientific) and b-actin was served as an internal control for protein loading. Quantity One software version 4.6.2 was used to quantify each band area and density in blots. Quantified band intensities are presented as fold of control. Three repeat experiments were performed independently. Immunohistochemical staining Immunohistochemical staining was performed with 5 μm paraffin cross-sections from the liver. After deparaffinized with xylene and rehydrated. Endogenous peroxidase activity was quenched with 3% hydrogen peroxide in methanol for 10 min, and then the slides were preincubated with 10% normal goat serum and then incubated with primary antibodies antiCD68 (25747-1-AP, Proteintech), antiNF-κB (14220-1-AP, Proteintech), antiBax (50599-2-Ig, Proteintech). Next, sections were washed in phosphate-buffered saline (PBS), incubated with an appropriate biotinylated secondary antibody, washed and incubated with streptavidin–peroxidase. Staining was visualized by adding 3, 3′-Diaminobenzidine (DAB Substrate, Roche, Mannheim, Germany) with subsequent counterstaining using hematoxylin. Sections were rinsed in tap water, dehydrated through 70%–100% graded alcohol, cleared in xylene and finally mounted in permanent mounting medium. Immunohistochemical micrographs were taken with the FSX-100 microscope camera system (Olympus, Tokyo, Japan). Three sections were analyzed for each sample. Statistical analysis All data were analyzed using 1-way univariate analysis of variance followed by LSD (equal variances assumed or homogeneity of variance after the variable transformation) or Dunnett’s T3 (equal variances not assumed after the variable transformation justification) for posthoc test between groups using Statistical Package for Social Sciences (SPSS package version 16.0) software (SPSS, Chicago, Illinois). The results were represented as mean ± SD. All tests were 2-sided, and p < .05 was considered statistically significant. RESULTS Characterization of SnS2 NFs The characterization of SnS2 NFs has been reported in our recent article (Bai et al., 2017). Simply, SnS2 NFs exhibits flowerlike structures with diameters of 50, 80, and 200 nm. Each flowerlike structure consists of tens of nanosheets, which act as building blocks. These nanosheets are connected to each other to bulid 3D flowerlike structure. To investigate the disperse state of the 50-nm SnS2 NFs in deionized water (DI H2O) or PBS Dynamic light scattering (DLS) and laser doppler velocimetry (LDV) were performed to detect that. DLS results showed agglomeration of the 50-nm SnS2 NFs 2 times greater than their primary particle size at 116 nm in DI H2O and 4 times nearly their primary size at 192 nm in PBS (Bai et al., 2017). To further understand how SnS2 NF behave and where it translocated across the digestive tract and then to liver, the hydrodynamic sizes and zeta potential of SnS2 NFs were examined using a Zetasizer (Malvern Nano-ZS90, Britain) to examine the aggregate or distributed status of SnS2 NFs in acidic solution with BSA or not at various pH values (Fed: stomach pH2.98 and duodenum pH4.04; Fasted: stomach pH4.04 and duodenum pH4.74 in mice). The results showed that agglomeration of the SnS2 NFs (50, 80, and 200 nm) at nearly 630 nm in pH2.98, nearly 480 nm in pH4.04, and nearly 380 nm in pH4.74 without BSA (Table 2, Figs. 1A–C). The agglomeration of the SnS2 NFs (50, 80, and 200 nm) at nearly 930 nm in pH2.98, nearly 800 nm in pH4.04, and nearly 750 nm in pH4.74 with BSA (Table 3, Figs. 1D–F). The results showed that there was no size dependent difference in accumulation could be due to aggregation of SnS2 NFs, they accumulate to different size in different pH values solution and could bind to protein. More importantly, the agglomeration of the SnS2 NFs is increased in the same pH environment with BSA addition than that without BSA. Thus, although there is different size, the 50 and 200 nm material would have same size of agglomeration and lead to same toxic potential effects in vivo. Table 2. Characteristics of SnS2 NFs in the Different pH Values Solutions Without BSA Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  614.7  0.322  –32.5  –2.74  4.04  415.3  0.268  –31.1  –1.28  4.74  375.9  0.473  –34.8  –2.19  80 nm  2.98  613.1  0.207  –35.4  –1.33  4.04  475.1  0.391  –33.7  –1.66  4.74  374.4  0.346  –31.9  –1.47  200 nm  2.98  664.6  0.449  –37.0  –1.85  4.04  568.4  0.503  –32.6  –2.32  4.74  397.6  0.358  –34.3  –1.53  Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  614.7  0.322  –32.5  –2.74  4.04  415.3  0.268  –31.1  –1.28  4.74  375.9  0.473  –34.8  –2.19  80 nm  2.98  613.1  0.207  –35.4  –1.33  4.04  475.1  0.391  –33.7  –1.66  4.74  374.4  0.346  –31.9  –1.47  200 nm  2.98  664.6  0.449  –37.0  –1.85  4.04  568.4  0.503  –32.6  –2.32  4.74  397.6  0.358  –34.3  –1.53  PdI, polydispersity index Table 2. Characteristics of SnS2 NFs in the Different pH Values Solutions Without BSA Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  614.7  0.322  –32.5  –2.74  4.04  415.3  0.268  –31.1  –1.28  4.74  375.9  0.473  –34.8  –2.19  80 nm  2.98  613.1  0.207  –35.4  –1.33  4.04  475.1  0.391  –33.7  –1.66  4.74  374.4  0.346  –31.9  –1.47  200 nm  2.98  664.6  0.449  –37.0  –1.85  4.04  568.4  0.503  –32.6  –2.32  4.74  397.6  0.358  –34.3  –1.53  Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  614.7  0.322  –32.5  –2.74  4.04  415.3  0.268  –31.1  –1.28  4.74  375.9  0.473  –34.8  –2.19  80 nm  2.98  613.1  0.207  –35.4  –1.33  4.04  475.1  0.391  –33.7  –1.66  4.74  374.4  0.346  –31.9  –1.47  200 nm  2.98  664.6  0.449  –37.0  –1.85  4.04  568.4  0.503  –32.6  –2.32  4.74  397.6  0.358  –34.3  –1.53  PdI, polydispersity index Table 3. Characteristics of SnS2 NFs in the Different pH Values Solutions With BSA Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  908.4  0.226  –35.2  –1.73  4.04  812.9  0.413  –36.4  –1.52  4.74  777.2  0.159  –32.8  –2.05  80 nm  2.98  916.8  0.338  –34.1  –2.16  4.04  814.0  0.521  –33.0  –1.95  4.74  773.6  0.154  –37.3  –1.34  200 nm  2.98  959.5  0.487  –34.5  –2.03  4.04  800.2  0.306  –33.9  –1.68  4.74  713.0  0.271  –32.6  –1.79  Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  908.4  0.226  –35.2  –1.73  4.04  812.9  0.413  –36.4  –1.52  4.74  777.2  0.159  –32.8  –2.05  80 nm  2.98  916.8  0.338  –34.1  –2.16  4.04  814.0  0.521  –33.0  –1.95  4.74  773.6  0.154  –37.3  –1.34  200 nm  2.98  959.5  0.487  –34.5  –2.03  4.04  800.2  0.306  –33.9  –1.68  4.74  713.0  0.271  –32.6  –1.79  Table 3. Characteristics of SnS2 NFs in the Different pH Values Solutions With BSA Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  908.4  0.226  –35.2  –1.73  4.04  812.9  0.413  –36.4  –1.52  4.74  777.2  0.159  –32.8  –2.05  80 nm  2.98  916.8  0.338  –34.1  –2.16  4.04  814.0  0.521  –33.0  –1.95  4.74  773.6  0.154  –37.3  –1.34  200 nm  2.98  959.5  0.487  –34.5  –2.03  4.04  800.2  0.306  –33.9  –1.68  4.74  713.0  0.271  –32.6  –1.79  Particle  pH    LDV   Average Diameter (nm)  PdI  Zeta Potential (mV)  Electrophoretic Mobility (µmcm/Vs)  50 nm  2.98  908.4  0.226  –35.2  –1.73  4.04  812.9  0.413  –36.4  –1.52  4.74  777.2  0.159  –32.8  –2.05  80 nm  2.98  916.8  0.338  –34.1  –2.16  4.04  814.0  0.521  –33.0  –1.95  4.74  773.6  0.154  –37.3  –1.34  200 nm  2.98  959.5  0.487  –34.5  –2.03  4.04  800.2  0.306  –33.9  –1.68  4.74  713.0  0.271  –32.6  –1.79  Figure 1. View largeDownload slide Characterization of SnS2 NFs. A–C, Size distribution of SnS2 NFs (50, 80, and 200 nm) in pH2.98, pH4.04, and pH4.74 without proteins. SnS2 NFs exhibited good monodispersity and showed approximately normal distribution. D–F, Size distribution of SnS2 NFs (50, 80, and 200 nm) in pH2.98, pH4.04, and pH4.74 with proteins. SnS2 NFs exhibited good monodispersity and showed approximately normal distribution. Figure 1. View largeDownload slide Characterization of SnS2 NFs. A–C, Size distribution of SnS2 NFs (50, 80, and 200 nm) in pH2.98, pH4.04, and pH4.74 without proteins. SnS2 NFs exhibited good monodispersity and showed approximately normal distribution. D–F, Size distribution of SnS2 NFs (50, 80, and 200 nm) in pH2.98, pH4.04, and pH4.74 with proteins. SnS2 NFs exhibited good monodispersity and showed approximately normal distribution. The General Condition and the Liver Coefficient The BWs, liver coefficients, mental station, food and water consumption, coat condition, and paw skin surface appearance of mice after intragastric administration of SnS2 NFs (dose: 250 mg/kg; size: 50, 80, and 200 nm) were not significantly different (p > .05, Table 4). Similarly, intragastric administration of 50-nm SnS2 NFs at doses of 250, 500, or 1000 mg/kg for 14 days also showed no significant changes in all groups (p > .05, Table 4). Table 4. Effects of Different Sizes and Doses of SnS2 NFs on BW Increasement and Coefficients of Liver Group  n  BW Increasement (g)  Liver (mg/g)  Control  10  11.47 ± 0.45  45.38 ± 1.11  50 nm  10  11.68 ± 0.42  48.72 ± 1.27  80 nm  10  10.65 ± 0.68  49.22 ± 2.42  200 nm  10  10.76 ± 0.72  45.12 ± 1.15  250 mg/kg  10  11.22 ± 0.66  45.72 ± 1.83  500 mg/kg  10  11.89 ± 0.49  46.69 ± 2.15  1000 mg/kg  10  10.20 ± 0.78  45.12 ± 1.15  Group  n  BW Increasement (g)  Liver (mg/g)  Control  10  11.47 ± 0.45  45.38 ± 1.11  50 nm  10  11.68 ± 0.42  48.72 ± 1.27  80 nm  10  10.65 ± 0.68  49.22 ± 2.42  200 nm  10  10.76 ± 0.72  45.12 ± 1.15  250 mg/kg  10  11.22 ± 0.66  45.72 ± 1.83  500 mg/kg  10  11.89 ± 0.49  46.69 ± 2.15  1000 mg/kg  10  10.20 ± 0.78  45.12 ± 1.15  Table 4. Effects of Different Sizes and Doses of SnS2 NFs on BW Increasement and Coefficients of Liver Group  n  BW Increasement (g)  Liver (mg/g)  Control  10  11.47 ± 0.45  45.38 ± 1.11  50 nm  10  11.68 ± 0.42  48.72 ± 1.27  80 nm  10  10.65 ± 0.68  49.22 ± 2.42  200 nm  10  10.76 ± 0.72  45.12 ± 1.15  250 mg/kg  10  11.22 ± 0.66  45.72 ± 1.83  500 mg/kg  10  11.89 ± 0.49  46.69 ± 2.15  1000 mg/kg  10  10.20 ± 0.78  45.12 ± 1.15  Group  n  BW Increasement (g)  Liver (mg/g)  Control  10  11.47 ± 0.45  45.38 ± 1.11  50 nm  10  11.68 ± 0.42  48.72 ± 1.27  80 nm  10  10.65 ± 0.68  49.22 ± 2.42  200 nm  10  10.76 ± 0.72  45.12 ± 1.15  250 mg/kg  10  11.22 ± 0.66  45.72 ± 1.83  500 mg/kg  10  11.89 ± 0.49  46.69 ± 2.15  1000 mg/kg  10  10.20 ± 0.78  45.12 ± 1.15  The Tin Contents in Whole Blood and Liver Tissues After intragastric administrated of 3 different sized SnS2 NFs (dose: 250 mg/kg, sizes: 50, 80, and 200 nm) and 3 different doses of SnS2 NFs (size: 50 nm, doses: 250, 500, and 1000 mg/kg) for 14 consecutive days, organs (liver, kidney, spleen, heart, brain, and testis) especially in the liver and the whole blood were extracted and lysed with nitric acid for tin measurement by ICP-MS. As shown in Table 5, the tin concentrations were not significantly modified in the mice administrated with different sized SnS2 NFs than in controls (p > .05). The blood and liver tissue tin concentrations after administration of 250, 500, and 1000 mg/kg doses of 50-nm SnS2 NFs were significantly higher in the blood and liver tissues of the 500 and 1000 mg/kg SnS2 NFs-treated groups (p < .01) than in controls. Table 5. Tin Levels in Each Organ of ICR Mice Treated With Different Sizes and Doses of SnS2 NFs Indexes  50-nm SnS2 NFs (mg/kg BW)   80-nm SnS2 NFs (mg/kg BW)  200-nm SnS2 NFs (mg/kg BW)  0  250  500  1000  250  250  Liver (µg/g)  2.236 ± 0.089  2.418 ± 0.220  3.633 ± 0.286*  5.596 ± 0.415*  2.209 ± 0.238  2.542 ± 0.078  Kidney (µg/g)  2.078 ± 0.097  2.164 ± 0.192  3.388 ± 0.327*  4.975 ± 0.234*  1.826 ± 0.356  1.592 ± 0.133  Spleen (µg/g)  1.693 ± 0.130  1.925 ± 0.253  2.936 ± 0.192*  4.079 ± 0.147*  1.972 ± 0.269  1.891 ± 0.240  Testicle (µg/g)  1.186 ± 0.089  1.392 ± 0.117  2.546 ± 0.241**  3.277 ± 0.132*  1.501 ± 0.260  1.320 ± 0.175  Brain (µg/g)  0.914 ± 0.122  0.896 ± 0.138  1.958 ± 0.126*  2.531 ± 0.130*  1.096 ± 0.088  1.067 ± 0.169  Heart (µg/g)  0.705 ± 0.161  0.934 ± 0.112  1.878 ± 0.235*  2.592 ± 0.257*  0.699 ± 0.142  0.862 ± 0.148  Blood (µg/ml)  3.608 ± 0.083  4.125 ± 0.242  6.254 ± 0.338*  7.642 ± 0.543*  4.350 ± 0.450  3.461 ± 0.227  Indexes  50-nm SnS2 NFs (mg/kg BW)   80-nm SnS2 NFs (mg/kg BW)  200-nm SnS2 NFs (mg/kg BW)  0  250  500  1000  250  250  Liver (µg/g)  2.236 ± 0.089  2.418 ± 0.220  3.633 ± 0.286*  5.596 ± 0.415*  2.209 ± 0.238  2.542 ± 0.078  Kidney (µg/g)  2.078 ± 0.097  2.164 ± 0.192  3.388 ± 0.327*  4.975 ± 0.234*  1.826 ± 0.356  1.592 ± 0.133  Spleen (µg/g)  1.693 ± 0.130  1.925 ± 0.253  2.936 ± 0.192*  4.079 ± 0.147*  1.972 ± 0.269  1.891 ± 0.240  Testicle (µg/g)  1.186 ± 0.089  1.392 ± 0.117  2.546 ± 0.241**  3.277 ± 0.132*  1.501 ± 0.260  1.320 ± 0.175  Brain (µg/g)  0.914 ± 0.122  0.896 ± 0.138  1.958 ± 0.126*  2.531 ± 0.130*  1.096 ± 0.088  1.067 ± 0.169  Heart (µg/g)  0.705 ± 0.161  0.934 ± 0.112  1.878 ± 0.235*  2.592 ± 0.257*  0.699 ± 0.142  0.862 ± 0.148  Blood (µg/ml)  3.608 ± 0.083  4.125 ± 0.242  6.254 ± 0.338*  7.642 ± 0.543*  4.350 ± 0.450  3.461 ± 0.227  Mean ± SD, *p < .05 versus control group; **p < .01 versus control group. Table 5. Tin Levels in Each Organ of ICR Mice Treated With Different Sizes and Doses of SnS2 NFs Indexes  50-nm SnS2 NFs (mg/kg BW)   80-nm SnS2 NFs (mg/kg BW)  200-nm SnS2 NFs (mg/kg BW)  0  250  500  1000  250  250  Liver (µg/g)  2.236 ± 0.089  2.418 ± 0.220  3.633 ± 0.286*  5.596 ± 0.415*  2.209 ± 0.238  2.542 ± 0.078  Kidney (µg/g)  2.078 ± 0.097  2.164 ± 0.192  3.388 ± 0.327*  4.975 ± 0.234*  1.826 ± 0.356  1.592 ± 0.133  Spleen (µg/g)  1.693 ± 0.130  1.925 ± 0.253  2.936 ± 0.192*  4.079 ± 0.147*  1.972 ± 0.269  1.891 ± 0.240  Testicle (µg/g)  1.186 ± 0.089  1.392 ± 0.117  2.546 ± 0.241**  3.277 ± 0.132*  1.501 ± 0.260  1.320 ± 0.175  Brain (µg/g)  0.914 ± 0.122  0.896 ± 0.138  1.958 ± 0.126*  2.531 ± 0.130*  1.096 ± 0.088  1.067 ± 0.169  Heart (µg/g)  0.705 ± 0.161  0.934 ± 0.112  1.878 ± 0.235*  2.592 ± 0.257*  0.699 ± 0.142  0.862 ± 0.148  Blood (µg/ml)  3.608 ± 0.083  4.125 ± 0.242  6.254 ± 0.338*  7.642 ± 0.543*  4.350 ± 0.450  3.461 ± 0.227  Indexes  50-nm SnS2 NFs (mg/kg BW)   80-nm SnS2 NFs (mg/kg BW)  200-nm SnS2 NFs (mg/kg BW)  0  250  500  1000  250  250  Liver (µg/g)  2.236 ± 0.089  2.418 ± 0.220  3.633 ± 0.286*  5.596 ± 0.415*  2.209 ± 0.238  2.542 ± 0.078  Kidney (µg/g)  2.078 ± 0.097  2.164 ± 0.192  3.388 ± 0.327*  4.975 ± 0.234*  1.826 ± 0.356  1.592 ± 0.133  Spleen (µg/g)  1.693 ± 0.130  1.925 ± 0.253  2.936 ± 0.192*  4.079 ± 0.147*  1.972 ± 0.269  1.891 ± 0.240  Testicle (µg/g)  1.186 ± 0.089  1.392 ± 0.117  2.546 ± 0.241**  3.277 ± 0.132*  1.501 ± 0.260  1.320 ± 0.175  Brain (µg/g)  0.914 ± 0.122  0.896 ± 0.138  1.958 ± 0.126*  2.531 ± 0.130*  1.096 ± 0.088  1.067 ± 0.169  Heart (µg/g)  0.705 ± 0.161  0.934 ± 0.112  1.878 ± 0.235*  2.592 ± 0.257*  0.699 ± 0.142  0.862 ± 0.148  Blood (µg/ml)  3.608 ± 0.083  4.125 ± 0.242  6.254 ± 0.338*  7.642 ± 0.543*  4.350 ± 0.450  3.461 ± 0.227  Mean ± SD, *p < .05 versus control group; **p < .01 versus control group. Effects of SnS2 NFs on RBC, WBC, MCV, and MCHC The RBC and WBC counts, MCHC and MCV values after intragastric administration of a 250 mg/kg dose of 50-, 80-, and 200-nm SnS2 NFs for 14 days (Table 6) were not significantly different from the control group results (p > .05). The corresponding values following treatment with 250, 500, and 1000 mg/kg doses of 50-nm SnS2 NFs were shown in Table 7, the SnS2 NFs groups were not significantly different from controls (p > .05). Table 6. Effects of Different Sizes of SnS2 NFs on the RBC, MCV, MCHC, and WBC of mice Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  50 nm  10  6.04 ± 0.23  314.22 ± 2.44  44.31 ± 3.21  4.87 ± 0.74  80 nm  10  6.07 ± 0.31  306.00 ± 3.17  42.98 ± 1.18  5.09 ± 0.84  200 nm  10  5.58 ± 0.26  312.56 ± 5.05  42.90 ± 2.64  4.96 ± 0.63  Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  50 nm  10  6.04 ± 0.23  314.22 ± 2.44  44.31 ± 3.21  4.87 ± 0.74  80 nm  10  6.07 ± 0.31  306.00 ± 3.17  42.98 ± 1.18  5.09 ± 0.84  200 nm  10  5.58 ± 0.26  312.56 ± 5.05  42.90 ± 2.64  4.96 ± 0.63  Mean ± SD. Table 6. Effects of Different Sizes of SnS2 NFs on the RBC, MCV, MCHC, and WBC of mice Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  50 nm  10  6.04 ± 0.23  314.22 ± 2.44  44.31 ± 3.21  4.87 ± 0.74  80 nm  10  6.07 ± 0.31  306.00 ± 3.17  42.98 ± 1.18  5.09 ± 0.84  200 nm  10  5.58 ± 0.26  312.56 ± 5.05  42.90 ± 2.64  4.96 ± 0.63  Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  50 nm  10  6.04 ± 0.23  314.22 ± 2.44  44.31 ± 3.21  4.87 ± 0.74  80 nm  10  6.07 ± 0.31  306.00 ± 3.17  42.98 ± 1.18  5.09 ± 0.84  200 nm  10  5.58 ± 0.26  312.56 ± 5.05  42.90 ± 2.64  4.96 ± 0.63  Mean ± SD. Table 7. Effects of Different Doses of SnS2 NFs on the RBC, MCV, MCHC, and WBC of mice Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  250 mg/kg  10  5.94 ± 0.46  305.47 ± 2.04  44.83 ± 3.56  4.84 ± 1.25  500 mg/kg  10  6.22 ± 0.38  312.00 ± 5.22  43.91 ± 2.85  4.99 ± 1.14  1000 mg/kg  10  6.58 ± 0.45  328.58 ± 9.13  46.52 ± 3.73  5.37 ± 0.95  Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  250 mg/kg  10  5.94 ± 0.46  305.47 ± 2.04  44.83 ± 3.56  4.84 ± 1.25  500 mg/kg  10  6.22 ± 0.38  312.00 ± 5.22  43.91 ± 2.85  4.99 ± 1.14  1000 mg/kg  10  6.58 ± 0.45  328.58 ± 9.13  46.52 ± 3.73  5.37 ± 0.95  Mean ± SD. Table 7. Effects of Different Doses of SnS2 NFs on the RBC, MCV, MCHC, and WBC of mice Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  250 mg/kg  10  5.94 ± 0.46  305.47 ± 2.04  44.83 ± 3.56  4.84 ± 1.25  500 mg/kg  10  6.22 ± 0.38  312.00 ± 5.22  43.91 ± 2.85  4.99 ± 1.14  1000 mg/kg  10  6.58 ± 0.45  328.58 ± 9.13  46.52 ± 3.73  5.37 ± 0.95  Groups  n  RBC (1012/l)  MCHC (g/l)  MCV (FL)  WBC (109/l)  Control  10  5.46 ± 0.33  309.44 ± 2.06  42.39 ± 1.66  4.44 ± 0.65  250 mg/kg  10  5.94 ± 0.46  305.47 ± 2.04  44.83 ± 3.56  4.84 ± 1.25  500 mg/kg  10  6.22 ± 0.38  312.00 ± 5.22  43.91 ± 2.85  4.99 ± 1.14  1000 mg/kg  10  6.58 ± 0.45  328.58 ± 9.13  46.52 ± 3.73  5.37 ± 0.95  Mean ± SD. Effects of SnS2 NFs on the ALT and AST The hepatic injury markers ALT and AST concentrations after intragastric administration of 250 mg/kg of 50, 80, and 200-nm SnS2 NFs for 14 days (Table 8) were not significantly different from the control group results (p > .05), indicating the liver injury was not evident. The corresponding values following treatment with 250, 500, and 1000 mg/kg doses of 50-nm SnS2 NFs (Table 9) in the 250, and 500 mg/kg groups were not significantly different, but ALT and AST values in the 1000 mg/kg group were higher than in the control group (58.45 ± 3.31* and 152.46 ± 8.13*, respectively, p < .05). Table 8. Effects of Different Sizes of SnS2 NFs on the ALT and AST of Mice Groups  n  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  50 nm  10  52.44 ± 3.78  140.78 ± 7.80  80 nm  10  46.83 ± 4.06  145.22 ± 9.06  200 nm  10  49.67 ± 3.54  135.33 ± 9.54  Groups  n  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  50 nm  10  52.44 ± 3.78  140.78 ± 7.80  80 nm  10  46.83 ± 4.06  145.22 ± 9.06  200 nm  10  49.67 ± 3.54  135.33 ± 9.54  Mean ± SD, *p < .05 and **p < .01 versus control group. Table 8. Effects of Different Sizes of SnS2 NFs on the ALT and AST of Mice Groups  n  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  50 nm  10  52.44 ± 3.78  140.78 ± 7.80  80 nm  10  46.83 ± 4.06  145.22 ± 9.06  200 nm  10  49.67 ± 3.54  135.33 ± 9.54  Groups  n  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  50 nm  10  52.44 ± 3.78  140.78 ± 7.80  80 nm  10  46.83 ± 4.06  145.22 ± 9.06  200 nm  10  49.67 ± 3.54  135.33 ± 9.54  Mean ± SD, *p < .05 and **p < .01 versus control group. Table 9. Effects of Different Doses of SnS2 NFs on the ALT and AST of Mice Groups  N  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  250 mg/kg  10  46.12 ± 4.12  133.21 ± 11.46  500 mg/kg  10  48.33 ± 6.77  140.42 ± 10.34  1000 mg/kg  10  58.45 ± 3.31*  152.46 ± 8.13*  Groups  N  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  250 mg/kg  10  46.12 ± 4.12  133.21 ± 11.46  500 mg/kg  10  48.33 ± 6.77  140.42 ± 10.34  1000 mg/kg  10  58.45 ± 3.31*  152.46 ± 8.13*  Mean ± SD, *p < .05 and **p < .01 versus control group. Table 9. Effects of Different Doses of SnS2 NFs on the ALT and AST of Mice Groups  N  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  250 mg/kg  10  46.12 ± 4.12  133.21 ± 11.46  500 mg/kg  10  48.33 ± 6.77  140.42 ± 10.34  1000 mg/kg  10  58.45 ± 3.31*  152.46 ± 8.13*  Groups  N  ALT (U/l)  AST (U/l)  Control  10  45.22 ± 2.60  131.56 ± 8.17  250 mg/kg  10  46.12 ± 4.12  133.21 ± 11.46  500 mg/kg  10  48.33 ± 6.77  140.42 ± 10.34  1000 mg/kg  10  58.45 ± 3.31*  152.46 ± 8.13*  Mean ± SD, *p < .05 and **p < .01 versus control group. Effects of SnS2 NFs on Liver Histopathology Results of the pathological evaluation of HE-stained liver tissue are shown in Figure 2. The control tissue included radially arranged lobules surrounding an axial central vein and polygonal hepatocytes with clear contours (Figure 2Aa). Tissue exposed to 50, 80, and 200-nm SnS2 NFs revealed no modification under microscope (Figs. 2Ab–d). Immunohistochemical staining showed weak expression of CD68 among 50, 80, and 200 nm groups and control (Figs. 2B and 2C). Figure 2. View largeDownload slide Effect of SnS2 NFs on liver histopathology. A, Liver cross sections from control and SnS2 NFs-exposed mice via intragastric administration of 50, 80, and 200 nm were conducted by HE staining. B, Immunohistochemical staining of CD68 (brown) in liver tissue at ×400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus and liver parenchyma. C, Histogram showing percentages of the number of liver tissues containing CD68 cells. The data are presented as the mean ± SD for 10 mice per group. *p < .05 as compared with control mice. D, Liver cross sections from control and SnS2 NF-exposed mice via intragastric administration of 250, 500, and 1000 mg/kg were conducted by HE staining. E, Immunohistochemical staining of CD68 (brown) in liver tissue at ×400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus and liver parenchyma. F, Histogram showing percentages of the number of liver tissues containing CD68 cells. The data are presented as the mean ± SD for 10 mice per group. *p < .05 as compared with control mice. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) Figure 2. View largeDownload slide Effect of SnS2 NFs on liver histopathology. A, Liver cross sections from control and SnS2 NFs-exposed mice via intragastric administration of 50, 80, and 200 nm were conducted by HE staining. B, Immunohistochemical staining of CD68 (brown) in liver tissue at ×400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus and liver parenchyma. C, Histogram showing percentages of the number of liver tissues containing CD68 cells. The data are presented as the mean ± SD for 10 mice per group. *p < .05 as compared with control mice. D, Liver cross sections from control and SnS2 NF-exposed mice via intragastric administration of 250, 500, and 1000 mg/kg were conducted by HE staining. E, Immunohistochemical staining of CD68 (brown) in liver tissue at ×400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus and liver parenchyma. F, Histogram showing percentages of the number of liver tissues containing CD68 cells. The data are presented as the mean ± SD for 10 mice per group. *p < .05 as compared with control mice. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) HE staining result of liver tissues from mice treated with 250, 500, and 1000 mg/kg doses of 50-nm SnS2 NFs were shown in Figure 2D. When compared with the control, which had the appearance of normal liver (Figure 2Da), tissues exposed to 250, and 500 mg/kg SnS2 NFs also had no gross morphological changes (Figs. 2Db and 2Dc). However, tissues exposed to 1000 mg/kg SnS2 NFs had slightly disrupted cellular arrangements, moderate interstitial hyperemia, and sporadic and focal infiltration of inflammatory cells (Figure 2Dd). Immunohistochemical staining showed weak CD68 expression in the livers of the control and 250 mg/kg group. However, immunohistochemical CD68 expression progressively increased with the exposed doses after administration of SnS2 NFs (Figs. 2E and 2F). Effects of SnS2 NFs on Metabolic Function and Hepatotoxicity A recent study shows that oral administration of NPs in mice affects the expression of metabolic genes and liver metabolism (Yang et al., 2017). We therefore examined the effects of SnS2 NFs on a panel of genes involved in the bile acid metabolism, cholesterol efflux, transporters, and hepatotoxicity (Lokman et al., 2017; Miao et al., 2015). Affected liver tissues were harvested for RNA extraction and western blot after the intragastric administration of the SnS2 NFs. In these experiments, 4 of the 14 genes showed significant differences correlating with SnS2 NF-induced hepatotoxicity (Figure 3A). Among genes encoding uptake transporters, Oapt1 increased significantly in the high dose group, which could contribute to the elimination of metabolite in the blood circulation including bilirubin. Aldoa mainly catalyzed the transformation among dihydroxyacetone phosphate, glyceraldehyde-3-phosphate and fructose 1, 6-bisphosphate in glycolytic pathway, involved in carbohydrate metabolism, cell glucose homeostasis, lipids and fatty acids metabolism. Cyp1a2 is a member of the cytochrome P450 superfamily of enzymes involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The flavin-containing monooxygenases 1 (FMO1) is crucial for the efficient flavoenzyme involved in the metabolism of drugs and other foreign chemicals. The liver tissues of repeated oral administration of SnS2 NFs in mice exhibited potential hepatotoxicity as indicated by the increased expression of Oapt1 and Aldoa, and reduced expression of Cypla2 and Fmo1. These results indicate that mRNA expression of Oapt1, Aldoa, Cypla2, and Fmo1 in mouse blood may offer useful predictors of SnS2 NF-induced glycolysis, synthesis of cholesterol, and metabolism of toxicants. Figure 3. View largeDownload slide Effects of SnS2 NFs on the mRNA expression of genes involved in bile acid metabolism, cholesterol efflux, transporters, and hepatotoxicity in the liver. Mice were treated with SnS2 NFs (size: 50 nm; dose: 1000 mg/kg BW) by intragastric administration for 14 days. A, The genes involved in bile acid metabolism, cholesterol efflux, transporters, and hepatotoxicity were analyzed by qRT-PCR in SnS2 NFs-treated and control liver samples (n = 10). *p < .05 versus control. B, The protein levels of the relative genes that have no change in mRNA levels by Western blot analysis. β-actin was used as the internal control. *p < .05 versus control. C, The protein levels of the relative genes that have changes in mRNA levels by Western blot analysis. β-actin was used as the internal control. *p < .05 versus control. Figure 3. View largeDownload slide Effects of SnS2 NFs on the mRNA expression of genes involved in bile acid metabolism, cholesterol efflux, transporters, and hepatotoxicity in the liver. Mice were treated with SnS2 NFs (size: 50 nm; dose: 1000 mg/kg BW) by intragastric administration for 14 days. A, The genes involved in bile acid metabolism, cholesterol efflux, transporters, and hepatotoxicity were analyzed by qRT-PCR in SnS2 NFs-treated and control liver samples (n = 10). *p < .05 versus control. B, The protein levels of the relative genes that have no change in mRNA levels by Western blot analysis. β-actin was used as the internal control. *p < .05 versus control. C, The protein levels of the relative genes that have changes in mRNA levels by Western blot analysis. β-actin was used as the internal control. *p < .05 versus control. Moreover, we detected the protein levels of the relative genes that have no change in mRNA levels by Western blot analysis, as shown in Figure 3B, there was no difference in the modifications of Cyp27a1, Cyp7a1, Cyp7b1, Cyp8b1, Abca1, Abcg5, Abcg8, Bsep, Ntcp, and Mrp2 proteins in liver tissues of SnS2 NF-administrated mice and control. The modifications of Oapt1, Aldoa, Cypla2, and Fmo1 were further validated by Western blot analysis shown in (Figure 3C). In this study, Oapt1 and Aldoa were increased by 1.38- and 1.26-fold, respectively, and Cypla2 and Fmo1 were decreased by 0.72- and 0.65-fold, respectively, the results are consistent with PCR results, indicating SnS2 NFs had no effect on bile acid and cholesterol metabolism. However, SnS2 NF-applied liver tissues mainly contributed to defects in hepatotoxicity. Effects of SnS2 NFs on Liver Ultrastructure Alteration In control and 250 mg/kg groups, all the nuclei were round and no breakage of organelles were observed, indicating the right procedures of the sample preparation (Figs. 4A and 4B). In mice treated with SnS2 NFs 500 mg/kg/day, the number of mitochondria increased in endoplasmic reticulum (Figure 4C). Furthermore, the number of mitochondria increased more severe in mice treated with SnS2 NFs 1000 mg/kg/day than that in control (Figure 4D). Figure 4. View largeDownload slide Microstructures by TEM in liver tissue. A and B, Structures showing the nucleus, endoplasm, mitochondria in the control group and 250 mg/kg group. C,. Structures showing the increase of mitochondria number in endoplasmic reticulum in group 500 mg/kg. D,. Structures showing the increased mitochondria number. Arrows in panels (C and D) indicated the increase of mitochondria number. Figure 4. View largeDownload slide Microstructures by TEM in liver tissue. A and B, Structures showing the nucleus, endoplasm, mitochondria in the control group and 250 mg/kg group. C,. Structures showing the increase of mitochondria number in endoplasmic reticulum in group 500 mg/kg. D,. Structures showing the increased mitochondria number. Arrows in panels (C and D) indicated the increase of mitochondria number. Effects of SnS2 NFs on Liver Inflammation and Apoptosis The effects of SnS2 NFs on inflammation and apoptosis were evaluated by assay of the mRNA expression of genes regulating inflammation and apoptosis. None of the 4 genes transcription was modified after oral administration of 50-, 80-, and 200-nm SnS2 NFs, compared with control (p > .05, Figure 5A). Although the corresponding values following treatment with 250, 500, and 1000 mg/kg doses of 50-nm SnS2 NFs in the 250, 500 mg/kg groups and controls were not significantly different, expression of TNF-α, IL-10, Bax, and Bcl-2 in the 1000 mg/kg group were higher than in control group (p < .05, Figure 5B). Furthermore, weak immunohistochemical staining of NF-κB was seen in cytoplasm, and stronger staining in the nuclei of liver cells in mice after treatment with 1000 mg/kg SnS2 NFs (Figs. 5C, 5D, 5G, and 5H). This was consistent with the presence of inflammation as a consequence of NF-κB activation. In addition, apoptotic cells were identified in liver tissues by immunohistochemical Bax staining of, which revealed only a few positive cells in control mice, indicating a basal level of apoptosis. The numbers of apoptotic cells was increased in liver tissue of mice treated with 1000 mg/kg SnS2 NFs compared with control (Figs. 5E, 5F, 5I, and 5J). Figure 5. View largeDownload slide Effect of SnS2 NFs on liver inflammation and apoptosis. A, mRNA expression levels of TNF-α, IL-10, Bax and Bcl-2 in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm. B, mRNA expression levels of TNF-α, IL-10, Bax, and Bcl-2 in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg. C, Immunohistochemical staining of NF-κB (brown) in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm at × 400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus. D, Histogram showing percentages of the number containing NF-κB positive cells in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. E, Immunohistochemical staining of Bax (brown) in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm at ×400 magnification. All data are presented as the mean ± SD for 10 mice per group. Quantified band intensities are presented as fold of control. F, Histogram showing percentages of the number containing Bax cells in liver tissues of mice exposed to SnS2 NFs via intraperitoneal injection of 50, 80, and 200 nm. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. G, Immunohistochemical staining of NF- κB (brown) in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg at × 400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus. H, Histogram showing percentages of the number containing NF-κB positive cells in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. I, Immunohistochemical staining of Bax (brown) in liver tissues of mice exposed to SnS2 flowers via intraperitoneal injection of 250, 500, and 1000 mg/kg at ×400 magnification. All data are presented as the mean ± SD for 10 mice per group. Quantified band intensities are presented as fold of control. J, Histogram showing percentages of the number containing Bax cells in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) Figure 5. View largeDownload slide Effect of SnS2 NFs on liver inflammation and apoptosis. A, mRNA expression levels of TNF-α, IL-10, Bax and Bcl-2 in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm. B, mRNA expression levels of TNF-α, IL-10, Bax, and Bcl-2 in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg. C, Immunohistochemical staining of NF-κB (brown) in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm at × 400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus. D, Histogram showing percentages of the number containing NF-κB positive cells in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. E, Immunohistochemical staining of Bax (brown) in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 50, 80, and 200 nm at ×400 magnification. All data are presented as the mean ± SD for 10 mice per group. Quantified band intensities are presented as fold of control. F, Histogram showing percentages of the number containing Bax cells in liver tissues of mice exposed to SnS2 NFs via intraperitoneal injection of 50, 80, and 200 nm. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. G, Immunohistochemical staining of NF- κB (brown) in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg at × 400 magnification. The staining cells were located in the region along the periphery of the hepatic sinus. H, Histogram showing percentages of the number containing NF-κB positive cells in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. I, Immunohistochemical staining of Bax (brown) in liver tissues of mice exposed to SnS2 flowers via intraperitoneal injection of 250, 500, and 1000 mg/kg at ×400 magnification. All data are presented as the mean ± SD for 10 mice per group. Quantified band intensities are presented as fold of control. J, Histogram showing percentages of the number containing Bax cells in liver tissues of mice exposed to SnS2 NFs via intragastric administration of 250, 500, and 1000 mg/kg. The data are presented as the mean ± SD for 10 mice per group. *p < .05 versus control. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) DISCUSSION The biological effects of metal-containing NPs are influenced by their properties such as shape, size, dose, material components and dissolution. Both decreasing particle size and increasing concentration increase the toxicity of copper NPs (Prabhu et al., 2010), and Polytetrafluoroethylene toxicity decreases with aggregation and increases with grain size of >100 nm (Johnston et al., 2000). Wang et al. (2006) have reported that 58-nm zinc NPs cause less liver injury than microsized zinc particles (1.08 μm) (Wang et al., 2006). Warheit et al. (2006) have shown that nano- and microsized TiO2 particles induce the same degree of inflammation and cell damage in rat lungs and that their toxicity does not significantly correlate with the particle size (Warheit et al., 2006). Overall, the relationship between the particle size and tissue damage by nanomaterials is unclear, and the evidence is contradictory. Although SnS2 as a compound has low toxicity, its toxicity may differ as NPs. In this study, we compared the toxicity of different sizes of SnS2 NFs in mice and found that the oral administration of 50-, 80-, and 200-nm SnS2 NFs at 250 mg/kg had no effect on liver injury, whereas the repeated oral administration of 50-nm SnS2 NFs in distilled water at 1000 mg/kg induced hepatotoxicity and these mice were asymptomatic, which gave an important clue regarding the no-observed-adverse-effect level. Tin levels in the mouse liver significantly increased after the oral administration of SnS2 NFs at different doses and became the material basis for subsequent hepatic injury. Although different sizes of SnS2 NFs (50, 80, and 200 nm) at 250 mg/kg did not influence hepatotoxicity, pathological evaluation revealed moderate interstitial hyperemia along with sporadic and focal inflammatory cell infiltration in the liver tissue of the mice treated with a high dose (1000 mg/kg) of 50-nm SnS2 NFs. This result is consistent with that of a previous study by oral administration of TiO2 NPs in mice (Wang et al, 2007a). The AST/ALT ratio did not change in the 50-, 80-, and 200-nm groups but increased in a dose-dependent manner in the 250, 500, and 1000 mg/kg groups and became significant for the 1000 mg/kg group. From these findings, we can deduce that SnS2 NFs showed no obvious acute toxicity in 2 weeks and SnS2 NFs could be transported to liver tissues after uptake by gastrointestinal tract. In this experiment, after oral ingestion of massive SnS2 particles (1000 mg/kg) once, the difficult clearance of 50-nm SnS2in vivo may directly result in the particle deposition in the liver. Similarily, after oral exposure to low dose of SnS2 NFs (even <250 mg/kg) for long term, the mice could also exhibit a significantly increased hepatotoxicity because of the particle accumulation in the liver and lead to the hepatic lesion. Hepatic transporters are crucial for the efflux of bile acid and the elimination of metabolites such as bilirubin. Transporter regulation is an adaptive mechanism that minimizes the toxic effects (Yang et al., 2017). In this study, among various transporters, the uptake transporter gene Oapt1 was upregulated in the high-dose group, and several hepatotoxicity genes, including Aldoa, Cyp1a2, and Fmo1, were modified as the concentration of SnS2 NFs administered to the mice increased. The bile acid synthesis enzyme Cyp8b1, which determines the bile salt profile, as well as other bile acid enzymes such as Cyp27a1, Cyp7a1, and Cyp7b1 did not show consistent or considerable change following the administration of SnS2 NFs. Although the levels of cholesterol and bile transporters (Abca1, Abcg5, Abcg8, Ntcp, Mrp2, and Bsep) increased following the administration of SnS2 NFs, the increase was not significant. These results suggested that the repeated exposure to SnS2 NFs in the high-dose group altered the expression of several metabolic genes in the liver, supporting the above biochemical phenotype, was a physiological response and adapting mechanism for alien invasion. Both inflammation and apoptosis are responses to the exposure to toxic materials (Roberts et al., 2009). The exposure to 50-nm SnS2 NFs induced NF-κB-mediated inflammation and apoptosis in the liver. NF-κB activation in the liver may have been directly or indirectly involved in the reduced cell growth during generalized oxidative stress, with the simultaneous presence of inflammation, given that TNF-α and IL-10 are inflammatory mediators of oxidative damage that are induced by toxic materials and carcinogens (Hussain and Harris, 2007) that ROS can stimulate NF-κB activation (Morgan and Liu, 2011). The apoptotic status can be checked by examining the expression of several apoptotic genes. As shown in Figure 4, inflammatory factors and apoptotic genes remained unaffected for the different-sized groups and in low-dose groups but were modified in the high-dose group (50 nm; 1000 mg/kg), which is consistent with the results of biological analysis and pathological examination. CONCLUSIONS Repeated oral administration of high-dose (1000 mg/kg) SnS2 NFs (50 nm) resulted in mitochondria increased, inflammatory responses and moderate apoptosis in liver tissue. Modification of hepatic metabolism by SnS2 NFs might pose risk of metabolic disease. These data provided useful information for risk analysis and the regulation of nano-sized materials by administrative agencies. FUNDING This work is supported by the National Natural Science Foundation of China (No. 51572190). REFERENCES Bai D., Li Q., Xiong Y., Zhao J., Bai L., Shen P., Yuan L., Wu P. ( 2017). Effects of intraperitoneal injection of SnS2 flowers on mouse testicle. Toxicol. Sci . 161, 388– 400. Google Scholar CrossRef Search ADS   Borm P. J., Robbins D., Haubold S., Kuhlbusch T., Fissan H., Donaldson K., Schins R., Stone V., Kreyling W., Lademann J.et al.  , . ( 2006). The potential risks of nanomaterials: a review carried out for ECETOC. Particle Fibre Toxicol . 3, 11– 46. Google Scholar CrossRef Search ADS   Bu Q., Yan G., Deng P., Peng F., Lin H., Xu Y., Cao Z., Zhou T., Xue A., Wang Y.et al.  , . ( 2010). Nmr-based metabonomic study of the sub-acute toxicity of titanium dioxide nanoparticles in rats after oral administration. Nanotechnology  21, 125105. Google Scholar CrossRef Search ADS PubMed  Du W., Deng D., Han Z., Xiao W., Bian C., Qian X. ( 2011). Hexagonal tin disulfide nanoplatelets: a new photocatalyst driven by solar light. Crystengcomm  13, 2071– 2076. Google Scholar CrossRef Search ADS   Ge S., Zhang L. ( 2011). Efficient visible light driven photocatalytic removal of RhB and NO with low temperature synthesized In(OH)xSy hollow nanocubes: A comparative study. Environ. Sci. Technol . 45, 3027– 3033. Google Scholar CrossRef Search ADS PubMed  Holsapple M. P., Farland W. H., Landry T. D., Monteiro-Riviere N. A., Carter J. M., Walker N. J., Thomas K. V. ( 2005). Research strategies for safety evaluation of nanomaterials, part ii: Toxicological and safety evaluation of nanomaterials, current challenges and data needs. Toxicol. Sci . 88, 12– 17. Google Scholar CrossRef Search ADS PubMed  Hussain S. P., Harris C. C. ( 2007). Inflammation and cancer: An ancient link with novel potentials. Int. J. Cancer  121, 2373– 2380. Google Scholar CrossRef Search ADS PubMed  Johnston C. J., Finkelstein J. N., Mercer P., Corson N., Gelein R., Oberdörster G. ( 2000). Pulmonary effects induced by ultrafine PTFE particles. Toxicol. Appl. Pharmacol . 168, 208– 215. Google Scholar CrossRef Search ADS PubMed  Kipen H. M., Laskin D. L. ( 2005). Smaller is not always better: nanotechnology yields nanotoxicology. Ajp Lung Cell. Mol. Physiol . 289, L696– L707. Google Scholar CrossRef Search ADS   Lam C. W., James J. T., McCluskey R., Hunter R. L. ( 2003). Pulmonary toxicity of single-wall carbon nanotubes in mice 7 and 90 days after intratracheal instillation. Toxicol. Sci . 77, 126– 134. Google Scholar CrossRef Search ADS PubMed  Liang S., Zhou Z., Wu X., Zhu S., Bi J., Zhou L., Liu M., Wu L. ( 2016). Constructing a MoS2 QDs/CdS core/shell flowerlike nanosphere hierarchical heterostructure for the enhanced stability and photocatalytic activity. Molecules  21, 213– 226. Google Scholar CrossRef Search ADS   Lin W., Huang Y. W., Zhou X. D., Ma Y. ( 2006). In vitro toxicity of silica nanoparticles in human lung cancer cells. Toxicol. Appl. Pharmacol . 217, 252– 259. Google Scholar CrossRef Search ADS PubMed  Lokman E. F., Muhammad H., Awang N., Omar M. H., Mansor F., Saparuddin F. ( 2017). Gene expression profiling associated with hepatoxicity in pregnant rats treated with ubi gadong (dioscorea hispida) extract. Int. J. Biomed. Sci.  13, 26– 34. PMID: 28533734 Google Scholar PubMed  Ma D., Zhang R. N., Wen Y., Yin W. N., Bai D. S., Zheng G. Y., Li J. S., Zheng B., Wen J. K. ( 2017). 1, 25(OH)2D3-induced interaction of vitamin D receptor with p50 subunit of NF-κB suppresses the interaction between KLF5 and p50, contributing to inhibition of LPS-induced macrophage proliferation. Biochem. Biophys. Res. Commun . 482, 366– 374. Google Scholar CrossRef Search ADS PubMed  Mcconnell E. L., Basit A. W., Murdan S. ( 2008). Measurements of rat and mouse gastrointestinal ph, fluid and lymphoid tissue, and implications for in-vivo experiments. J. Pharm. Pharmacol . 60, 63– 70. Google Scholar CrossRef Search ADS PubMed  Miao J., Ling A. V., Manthena P. V., Gearing M. E., Graham M. J., Crooke R. M., Croce K. J., Esquejo R. M., Clish C. B. Morbid Obesity Study Group Vicent D., Biddinger S. B. ( 2015). Flavin-containing monooxygenase 3 as a potential player in diabetes-associated atherosclerosis. Nat. Commun . 6, 6498– 6507. Google Scholar CrossRef Search ADS PubMed  Morgan M. J., Liu Z. G. ( 2011). Crosstalk of reactive oxygen species and NF-κB signaling. Cell Res . 21, 103– 115. Google Scholar CrossRef Search ADS PubMed  Nel A., Xia T., Mädler L., Li N. ( 2006). Toxic potential of materials at the nanolevel. Science  311, 622– 627. Google Scholar CrossRef Search ADS PubMed  Oliveira L. C. A., Oliveira H. S., Mayrink G., Mansur H. S., Mansur A. A. P., Moreira R. L. ( 2014). One-pot synthesis of CdS@Nb2O5, core–shell nanostructures with enhanced photocatalytic activity. Appl. Cataly. B Environ . 152–153, 403– 412. Google Scholar CrossRef Search ADS   Prabhu B. M., Ali S. F., Murdock R. C., Hussain S. M., Srivatsan M. ( 2010). Copper nanoparticles exert size and concentration dependent toxicity on somatosensory neurons of rat. Nanotoxicology  4, 150– 160. Google Scholar CrossRef Search ADS PubMed  Roberts R. A., Laskin D. L., Smith C. V., Robertson F. M., Allen E. M., Doorn J. A., Slikker W. ( 2009). Nitrative and oxidative stress in toxicology and disease. Toxicol. Sci . 112, 4– 16. Google Scholar CrossRef Search ADS PubMed  Wallach D., Bar-Nun S., Ohad I. ( 2015). Assessment of SnS2 nanoparticles properties for photocatalytic and antibacterial applications. Solar Energy  117, 187– 191. Google Scholar CrossRef Search ADS   Wang B., Feng W. Y., Wang T. C., Jia G., Wang M., Shi J. W., Zhang F., Zhao Y. L., Chai Z. F. ( 2006). Acute toxicity of nano- and micro-scale zinc powder in healthy adult mice. Toxicol. Lett . 161, 115– 123. Google Scholar CrossRef Search ADS PubMed  Wang C., Wang L., Jin J., Liu J., Li Y., Wu M., Chen L. H., Wang B. J., Yang X. Y., Su B. L. ( 2016). Probing effective photocorrosion inhibition and highly improved photocatalytic hydrogen production on monodisperse PANI@CdS core-shell nanospheres. Appl. Cataly B Environ . 188, 351– 359. Google Scholar CrossRef Search ADS   Wang J., Zhou G., Chen C., Yu H., Wang T., Ma Y., Jia G., Gao Y., Li B., Sun J.et al.  , . ( 2007a). Acute toxicity and biodistribution of different sized titanium dioxide particles in mice after oral administration. Toxicol. Lett . 168, 176– 185. Google Scholar CrossRef Search ADS   Wang J. J., Sanderson B. J., Wang H. ( 2007b). Cyto- and genotoxicity of ultrafine TiO2 particles in cultured human lymphoblastoid cells. Mut. Res . 628, 99– 106. Google Scholar CrossRef Search ADS   Warheit D. B., Webb T. R., Sayes C. M., Colvin V. L., Reed K. L. ( 2006). Pulmonary instillation studies with nanoscale TiO2 rods and dots in rats: Toxicity is not dependent upon particle size and surface area. Toxicol. Sci . 91, 227– 236. Google Scholar CrossRef Search ADS PubMed  Yan S. C., Li Z. S., Zou Z. G. ( 2009). Photodegradation performance of g-C3N4 fabricated by directly heating melamine. Langmuir  25, 10397– 10401. Google Scholar CrossRef Search ADS PubMed  Yan T., Li L., Li G., Wang Y., Hu W., Guan X. ( 2011). Porous SnIn4S8, microspheres in a new polymorph that promotes dyes degradation under visible light irradiation. J. Hazard. Mater . 186, 272– 279. Google Scholar CrossRef Search ADS PubMed  Yang J., Luo M., Tan Z., Dai M., Xie M., Lin J., Hua H., Ma Q., Zhao J., Liu A. ( 2017). Oral administration of nano-titanium dioxide particle disrupts hepatic metabolic functions in a mouse model. Environ. Toxicol. Pharmacol . 49, 112– 118. Google Scholar CrossRef Search ADS PubMed  Zhang Z., Shao C., Li X., Sun Y., Zhang M., Mu J., Zhang P., Guo Z., Liu Y. ( 2013). Hierarchical assembly of ultrathin hexagonal SnS2 nanosheets onto electrospun TiO2 nanofibers: Enhanced photocatalytic activity based on photoinduced interfacial charge transfer. Nanoscale  5, 606– 618. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2018. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Toxicological SciencesOxford University Press

Published: May 2, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off