Glutamine alleviates heat stress-induced impairment of intestinal morphology, intestinal inflammatory response, and barrier integrity in broilers

Glutamine alleviates heat stress-induced impairment of intestinal morphology, intestinal... Abstract The aim of this study was to investigate the protective effect of glutamine (Gln) on the intestinal morphology, intestinal inflammatory response, and barrier integrity in broilers exposed to high ambient temperature. Three-hundred-sixty 21-d-old Arbor Acres broilers (half male and half female) were randomly allocated to 4 treatment groups in a completely randomized design, each of which included 6 replicates with 15 birds per replicate, for 21 d. The 4 treatment groups were as follows: the control group, in which birds were kept in a thermoneutral room at 22 ± 1°C (no stress, NS; fed a basal diet); the heat stress group (36 ± 1°C for 10 h/d from 08:00 to 18:00 h and 22 ± 1°C for the remaining time, heat stress (HT); fed a basal diet); and heat stress + Gln group (0.5 and 1.0% Gln, respectively). Compared to the NS group, broilers in the HT group had lower villus height (P < 0.05), higher crypt depth (P < 0.05), higher D-lactic acid and diamine oxidase (DAO) activity (P < 0.05), higher soluble intercellular adhesion molecule-1 (sICAM-1) concentration (P < 0.05), higher tumor necrosis factor (TNF)-α/interleukin (IL)-10 (P < 0.05), and lower tight junction protein expression levels (P < 0.05). Compared with birds in the HT, birds in the HT + Gln group exhibited increased villus height (P < 0.05), decreased D-lactate and DAO activity (P < 0.05), decreased sICAM-1 concentration (P < 0.05), and mediate the secretion of cytokines (P < 0.05), as well as increased zonula occludens-1 (ZO-1), claudin-1, and occludin mRNA expression levels (P < 0.05). In conclusion, these results indicate that supplementation with Gln was effective in partially ameliorating the adverse effects of heat stress on intestinal barrier function in broilers by promoting epithelial cell proliferation and renewal, modifying the function of the intestinal mucosa barrier, and regulating the secretion of cytokines. INTRODUCTION Poultry can maintain their body temperature during the hottest and driest weather by changing their normal physiological equilibrium or via behavioral changes. Notably, certain internal body organs such as the intestines, liver, and kidneys have been cited for their role in heat stress of the bird. However, birds have limited ability to regulate heat loss through behavioral and physiological means. High ambient temperatures can result in lost production, death, and reduced profits in the immediate future for commercial broiler producers. Current studies suggest that these critical consequences in broilers with heatstroke are the result of multiple organ dysfunction syndrome (MODS) secondary to heat injury (Lin et al., 2011). It is currently believed that multiple pathophysiological alterations, such as immune dysregulation, intestinal dysfunction, and cellular oxidative stress in severe heatstroke are the initiating factors that cause MODS (Quinteiro-Filho et al., 2010; Varasteh et al., 2015). It is well known that the intestine, one of the most vital organs in the body, plays a critical role in digestion, absorption of nutrients, and immune defense; hence, it is highly sensitive to heat stress during acute heat exposure in broiler chickens. Recent studies have shown that a variety of changes can be observed, including those associated with intestinal development, such as reduction in the small intestinal weight and the number of villi (Uni et al., 2000), intestinal histopathological changes, reduction in the proliferation rate of intestinal epithelial cells, gut barrier dysfunction, and cellular oxidative stress, in cases of severe heatstroke (Marchini et al., 2016). These results indicate that intestinal barrier function and integrity play an important role in severe heatstroke. However, the underlying mechanisms responsible for increased intestinal permeability and reduced integrity remain unclear. In recent years, studies have found that tight junction proteins (TJP) are induced in the epithelial cell of the jejunum and ileum and are necessary for guaranteeing the intestinal barrier function and regulating paracellular permeability (Nasu et al., 2013). Some results have shown that increased intestinal permeability contributes to intestinal inflammation and compromised barrier function (Moeser et al., 2007; Zuo et al., 2014). However, to the best of our knowledge, very few studies have been performed to determine the relationship between TJP (zonula occludens-1 (ZO-1) and occludin) activity and intestinal structure and barrier function in poultry under heat stress conditions. Glutamine (Gln), a conditionally essential amino acid for the gut, has been reported to enhance gut development and protect the intestinal epithelium in multiple animal models, especially during stresses (Nan et al., 2004). Protective effects of Gln may be a result of increased TJP expression in the small intestine and decreased intestinal permeability during stresses (Li and Neu, 2009). The mechanism for these protective effects may be through Gln activation of occludin, claudin-1, zonula occludens-2 (ZO-2), zonula occludens-3 (ZO-3), and corticotrophin-releasing factor (Wang et al., 2015). This demonstrates that Gln supplementation may regulate TJP expression, which has a beneficial effect on mucosal barrier function and health under heat stress conditions. However, very few studies have been performed to determine the effects of Gln supplementation on the expression of occludin and ZO-1 in broilers. The aim of the present study was to assess the effects of Gln on the small intestine morphology and intestinal barrier function with histopathology and RT-PCR analysis during heat stress in broiler chickens. In addition, the effects of Gln on the inflammatory response of the small intestine were also investigated during our trial. MATERIALS AND METHODS Materials and Reagents Glutamine was purchased from Henan Honda Biological Medicine Co., Ltd., China. The product is pharmaceutical-grade, 99% purity. Experimental Design and Diets Arbor Acres broilers (half male and half female) were weighed and randomly allocated to 4 treatment groups in a completely randomized design, each of which included 6 replicates with 15 birds per replicate, for 21 d. The 4 treatment groups were as follows: the control group, in which birds were kept in a thermoneutral room at 22 ± 1°C (no stress, NS; fed a basal diet); the heat stress group (33 ± 1°C for 10 h/d from 08:00 to 18:00 h and 22 ± 1°C for the remaining time, heat stress (HT); fed a basal diet); and heat stress + Gln group (0.5 and 1.0% Gln, respectively). The room was provided with electric heaters to adjust the environmental temperature. From 22 to 41 d, the heat treatment lasted for 20 consecutive days. The broiler chicks were fed diets with the same component composition and the only difference was their Gln supplementation. The basal diets were of the maize–soybean type. The diets were formulated based on the NRC (1994) to meet or slightly exceed the nutrient requirements of broilers (Table 1). Table 1. Ingredients and nutrient composition of experimental diets. Ingredients (%) 22 to 42 d Maize 29.50 Soybean meal (48%, crude protein) 31.5 Wheat 24.56 Soybean oil 9.43 Limestone 1.55 Dicalcium phosphate 1.13 Salt 0.2 Premix1 2.13 Calculated chemical composition Apparent metabolism energy (MJ/kg) 30.2 Crude protein (%) 21.50 Calcium (%) 0.90 Available phosphorus (%) 0.68 Lysine 1.36 Methionine 0.63 Methionine + cysteine 0.98 Ingredients (%) 22 to 42 d Maize 29.50 Soybean meal (48%, crude protein) 31.5 Wheat 24.56 Soybean oil 9.43 Limestone 1.55 Dicalcium phosphate 1.13 Salt 0.2 Premix1 2.13 Calculated chemical composition Apparent metabolism energy (MJ/kg) 30.2 Crude protein (%) 21.50 Calcium (%) 0.90 Available phosphorus (%) 0.68 Lysine 1.36 Methionine 0.63 Methionine + cysteine 0.98 1Premix provided per kg of diet: Chromium oxide 0.5 g, L-Lysine·HCl 0.25 g; DL-Methionine 0.3 g; Vitamin A (retinyl acetate) 5,000 IU; Vitamin D3 (cholecalciferol) 2.5 IU; Vitamin E (α-tocopherolacetate) 80 IU; menadione 3 mg; thiamine 2.5 mg; riboflavin 2.5 mg; nicotinamide 25 mg; choline chloride 800 mg; calcium pantothenate 10 mg; pyridoxine·HCl 0.3 mg; biotin 0.04 mg; folic acid 1 mg; vitamin B1 18 mg; vitamin B2 6.6 mg; vitamin B6 3 mg; vitamin B12 (cobalamine) 0.02 mg; Fe (from ferrous sulfate) 80 mg; Cu (from copper sulfate) 8 mg; Mn (from manganese sulfate) 110 mg; Zn (Bacitracin Zn) 65 mg; iodine (from calcium iodate) 1.1 mg; Se (from sodium selenite) 0.3 mg; Na (sodium chloride) 1.3 g; Mg (magnesium oxide) 0.55 g; Co [cobalt-(II)-sulfate-heptahydrate] 0.30 mg. View Large Table 1. Ingredients and nutrient composition of experimental diets. Ingredients (%) 22 to 42 d Maize 29.50 Soybean meal (48%, crude protein) 31.5 Wheat 24.56 Soybean oil 9.43 Limestone 1.55 Dicalcium phosphate 1.13 Salt 0.2 Premix1 2.13 Calculated chemical composition Apparent metabolism energy (MJ/kg) 30.2 Crude protein (%) 21.50 Calcium (%) 0.90 Available phosphorus (%) 0.68 Lysine 1.36 Methionine 0.63 Methionine + cysteine 0.98 Ingredients (%) 22 to 42 d Maize 29.50 Soybean meal (48%, crude protein) 31.5 Wheat 24.56 Soybean oil 9.43 Limestone 1.55 Dicalcium phosphate 1.13 Salt 0.2 Premix1 2.13 Calculated chemical composition Apparent metabolism energy (MJ/kg) 30.2 Crude protein (%) 21.50 Calcium (%) 0.90 Available phosphorus (%) 0.68 Lysine 1.36 Methionine 0.63 Methionine + cysteine 0.98 1Premix provided per kg of diet: Chromium oxide 0.5 g, L-Lysine·HCl 0.25 g; DL-Methionine 0.3 g; Vitamin A (retinyl acetate) 5,000 IU; Vitamin D3 (cholecalciferol) 2.5 IU; Vitamin E (α-tocopherolacetate) 80 IU; menadione 3 mg; thiamine 2.5 mg; riboflavin 2.5 mg; nicotinamide 25 mg; choline chloride 800 mg; calcium pantothenate 10 mg; pyridoxine·HCl 0.3 mg; biotin 0.04 mg; folic acid 1 mg; vitamin B1 18 mg; vitamin B2 6.6 mg; vitamin B6 3 mg; vitamin B12 (cobalamine) 0.02 mg; Fe (from ferrous sulfate) 80 mg; Cu (from copper sulfate) 8 mg; Mn (from manganese sulfate) 110 mg; Zn (Bacitracin Zn) 65 mg; iodine (from calcium iodate) 1.1 mg; Se (from sodium selenite) 0.3 mg; Na (sodium chloride) 1.3 g; Mg (magnesium oxide) 0.55 g; Co [cobalt-(II)-sulfate-heptahydrate] 0.30 mg. View Large Bird management, Sample collection, and procedures The protocol was approved by the Institutional Animal Care and Use Committee of Henan University of Science and Technology. All husbandry practices and euthanasia were performed with full consideration of animal welfare. A total of 360 healthy Arbor Acres broiler chicks (21 d), obtained from a commercial hatchery, were housed in wire-floored cages (cage size was 140 cm × 70 cm × 28 cm) in an environmentally controlled room with continuous light. From 22 to 41 d, the light regimen lasted for 24 h. During the 20 consecutive days of heat treatment, the mean relative humidity of the room was monitored daily by a digital hygrometer and ranged from 50 to 60%. The birds had access to feed and water ad libitum. Glutamine was added to the basal diet. There were just 4 dead broilers out of 360, which is within the normal range of mortality. At the end of each experimental period (42 d), 6 broilers (one bird per replicate) from each treatment group were randomly selected. Blood samples were obtained as quickly as possible from the wing vein, carefully moved into EDTA tubes, then immediately transferred to the laboratory, and separated by centrifugation at 4,000 × g for 15 min at 4°C. Serum samples were stored at −80°C for further analysis. After collection of blood samples, all birds were sacrificed by cervical dislocation followed by exsanguination. The abdominal and thoracic cavities were then opened and the jejunum (from the end of the pancreatic loop to Meckel's diverticulum) and ileum (from Meckel's diverticulum to the cecal junction) were collected and emptied using gentle pressure. Approximately 2-cm sections of the proximal jejunum and proximal ileum were removed, flushed with ice-cold phosphate buffer solution at pH 7.4 and immediately fixed with formalin solution for gut morphological measurements. The remaining portion of the jejunum and ileum were excised, mucosa samples were collected using glass slides, and the jejunal and ileal sections were then washed with ice-cold sterilized saline and stored at −80°C for the analysis of cytokine concentration and gene expression. Morphology Analyses of the Jejunal and Ileal Mucosa Three cross-sections for each intestinal segment (jejunum and ileum) were processed for paraffin embedding; 6-μm thicknesses were cut, placed on glass slides, and stained with hematoxylin and eosin following standard procedures. A total of 15 intact, well-oriented crypt-villus units were selected in triplicate for each intestinal cross-section. Villus height and crypt depth were determined using an image processing and analysis system (version 6.0, Image-Pro Plus) and were expressed as micrometers (μm). Villus height was measured from the tip of the villus to the villus-crypt junction; crypt depth was defined as the depth of the invagination between adjacent villi. D-Lactic Acid and Diamine Oxidase (DAO) Activity in Serum The levels of d-lactic acid and DAO in the serum were measured by an enzyme-linked immunosorbent antibody assay (ELISA) kit (Cusabio Biotech, Wuhan, China) with a microplate reader. sICAM-1 and Cytokine Assay The intestinal mucosal concentrations of soluble intercellular adhesion molecule-1 (sICAM-1) were assayed by dual antibody solid phase enzyme-linked immunoassay according to the manufacturer's instructions (monoclonal antibody against mouse sICAM-1: Blue Gene, Shanghai, and People's Republic of China). The intestinal mucosal concentrations of TNF-α (monoclonal antibody against chicken TNF-α: Adlitteram Diagnostic Laboratories, San Diego, CA, USA) and IL-10 (monoclonal antibody against chicken IL-10: BlueGene, Shanghai, People's Republic of China) were evaluated by ELISA kits according to the manufacturer's instructions. Messenger RNA Quantification Real-time quantitative PCR (qPCR) was used to verify intestinal tissue proteins of differing abundance at the mRNA level. Total RNA from samples of jejunum and ileum were isolated using Trizol Reagent (TaKaRa Biotechnology. Dalian, Liaoning, PR China) according to the instructions of the manufacturer, and RNA quantity was determined by a spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Subsequently, 1 μg of extracted total RNA was reverse-transcribed with the Prime Script RT Reagent Kit (TaKaRa Biotechnology, Dalian, Liaoning, and PR China). The obtained first-strand complementary DNA (cDNA) was diluted to a final concentration of 10 g/L. In detail, cDNA was synthesized from 5 μg of total RNA using oligo dT primers and superscript II reverse transcriptase according to the manufacturer's instructions (Roche, USA), then diluted with sterile water; 1 μL of each diluted sample was added to a 20 μL reaction, also containing 10 μL of 2× SYBR Green I PCR Master Mix (TaKaRa, China), 2 μL of diluted cDNA, 0.4 μL of each primer (10 μM), 0.4 μL of 50× ROX reference Dye II, and 6.8 μL of PCR-grade water. The primer sequences were commercially produced (TaKaRa Biotechnology, Dalian, Liaoning, PR China) and are shown in Table 2. Real-time PCR was performed using the ABI StepOnePlus Real-Time PCR system (Applied Biosystems, Grand island, NY, USA). Each sample was processed in triplicate. Cycling parameters were as follows: 1 cycle at 95°C for 30 s, 40 cycles of 95°C for 10 s, annealing temperature for 30 s, and 72°C for 30 s, and extension for 2 min at 72°C. The melting curve analysis showed only one peak for each PCR product. Electrophoresis was performed with the PCR products to verify the primer specificity and product purity. The relative fold-change was calculated according to the 2−ΔΔCT method, which accounts for gene-specific efficiencies and was normalized to the mean expression of the abovementioned index. Furthermore, mRNA expression of the TJP (occludin, claudin-1 and ZO-1) in sections from the jejunum and ileum were measured. Table 2. Gene-specific sequences primers used in real-time quantitative PCR. Primer Sequence (5΄ → 3΄) Length ZO-11 TGTAACCACAGCATGAGGTG 98 CTGGGATGGCTCCATGTGGT Occludin CCGTAAGCCCTAGTTGGAT 214 ATTGAGCCGGGCGTTGATG Claudin-1 CCTGATCACCCTCTTGGGAG 145 GCTGCACTCACTCATTGGCT β-actin TTGGTTCGTCAAGCAAGTGG 100 CCCCCATATACTGGCACCTT Primer Sequence (5΄ → 3΄) Length ZO-11 TGTAACCACAGCATGAGGTG 98 CTGGGATGGCTCCATGTGGT Occludin CCGTAAGCCCTAGTTGGAT 214 ATTGAGCCGGGCGTTGATG Claudin-1 CCTGATCACCCTCTTGGGAG 145 GCTGCACTCACTCATTGGCT β-actin TTGGTTCGTCAAGCAAGTGG 100 CCCCCATATACTGGCACCTT 1ZO-1, zonula occludens-1. View Large Table 2. Gene-specific sequences primers used in real-time quantitative PCR. Primer Sequence (5΄ → 3΄) Length ZO-11 TGTAACCACAGCATGAGGTG 98 CTGGGATGGCTCCATGTGGT Occludin CCGTAAGCCCTAGTTGGAT 214 ATTGAGCCGGGCGTTGATG Claudin-1 CCTGATCACCCTCTTGGGAG 145 GCTGCACTCACTCATTGGCT β-actin TTGGTTCGTCAAGCAAGTGG 100 CCCCCATATACTGGCACCTT Primer Sequence (5΄ → 3΄) Length ZO-11 TGTAACCACAGCATGAGGTG 98 CTGGGATGGCTCCATGTGGT Occludin CCGTAAGCCCTAGTTGGAT 214 ATTGAGCCGGGCGTTGATG Claudin-1 CCTGATCACCCTCTTGGGAG 145 GCTGCACTCACTCATTGGCT β-actin TTGGTTCGTCAAGCAAGTGG 100 CCCCCATATACTGGCACCTT 1ZO-1, zonula occludens-1. View Large Statistical Analysis The statistical analyses of all data were performed by one-way analysis of variance using SPSS for Windows (version 20.0, SPSS Inc., Chicago, IL, USA). Differences among groups were evaluated by Tukey's multiple range tests. Statistical significance (P-value) was considered at 0.05. RESULTS The Morphology of the Small Intestine The results regarding the effects of Gln on the morphology of the intestinal tissues of broilers under heat stress are presented in Table 3. Compared to the NS group, broilers in the HT group had lower villus height of the jejunum and ileum (P < 0.05) and higher crypt depth of the ileum (P < 0.05). Dietary Gln supplementation (0.5 and 1.0%) increased the villus height of the jejunum and the ileum (P < 0.05) and decreased the crypt depth (P < 0.05) in the ileum of broilers compared to that of the HT group. The villus height:crypt depth ratio in the HT group was decreased by 15.3% compared to that in the NS group (P < 0.05). Dietary Gln supplementation (0.5 and 1.0%) increased the villus height:crypt depth ratio of the jejunum and the ileum (P < 0.05). However, no differences in villus height, crypt depth, or villus height:crypt depth ratio was observed between the NS, Gln1, and Gln2 groups (P > 0.05). Moreover, no significant differences were detected in crypt depth of the jejunum among all groups (P > 0.05). Table 3. Effects of Gln on the morphology of the intestinal tissues of broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Villus height (μm)  Jejunum 1545.68b 1314.12a 1498.97b 1526.30b 45.36 0.037  Ileum 900.31b 762.13a 854.35b 898.69b 25.37 0.020 Crypt depth (μm)  Jejunum 181.82 200.34 183.27 180.37 5.87 0.219  Ileum 153.78a 178.92b 160.49a 154.03a 6.60 0.042 Villus height:crypt depth  Jejunum 8.50b 6.56a 8.18b 8.46b 0.27 0.047  Ileum 5.85b 4.26a 5.32b 5.83b 0.17 0.031 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Villus height (μm)  Jejunum 1545.68b 1314.12a 1498.97b 1526.30b 45.36 0.037  Ileum 900.31b 762.13a 854.35b 898.69b 25.37 0.020 Crypt depth (μm)  Jejunum 181.82 200.34 183.27 180.37 5.87 0.219  Ileum 153.78a 178.92b 160.49a 154.03a 6.60 0.042 Villus height:crypt depth  Jejunum 8.50b 6.56a 8.18b 8.46b 0.27 0.047  Ileum 5.85b 4.26a 5.32b 5.83b 0.17 0.031 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a,bMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large Table 3. Effects of Gln on the morphology of the intestinal tissues of broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Villus height (μm)  Jejunum 1545.68b 1314.12a 1498.97b 1526.30b 45.36 0.037  Ileum 900.31b 762.13a 854.35b 898.69b 25.37 0.020 Crypt depth (μm)  Jejunum 181.82 200.34 183.27 180.37 5.87 0.219  Ileum 153.78a 178.92b 160.49a 154.03a 6.60 0.042 Villus height:crypt depth  Jejunum 8.50b 6.56a 8.18b 8.46b 0.27 0.047  Ileum 5.85b 4.26a 5.32b 5.83b 0.17 0.031 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Villus height (μm)  Jejunum 1545.68b 1314.12a 1498.97b 1526.30b 45.36 0.037  Ileum 900.31b 762.13a 854.35b 898.69b 25.37 0.020 Crypt depth (μm)  Jejunum 181.82 200.34 183.27 180.37 5.87 0.219  Ileum 153.78a 178.92b 160.49a 154.03a 6.60 0.042 Villus height:crypt depth  Jejunum 8.50b 6.56a 8.18b 8.46b 0.27 0.047  Ileum 5.85b 4.26a 5.32b 5.83b 0.17 0.031 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a,bMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large D-Lactic Acid and Diamine Oxidase (DAO) Activity in Serum The results regarding the effects of Gln on the serum DAO activity of broilers under heat stress are presented in Table 4. D-lactate and DAO activity in serum was higher (P < 0.05) in the HT group than in that of the NS and Gln groups. Diets supplemented with Gln significantly decreased the serum D-lactic acid and DAO activity (P < 0.05) of broilers exposed to heat stress. However, no differences were observed between the Gln groups and NS group (P > 0.05). Table 4. Effects of Gln on the serum DAO activity of broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 D-Lac (μmol/mL) 1.95a 3.73c 3.04b 2.91b 0.37 0.031 DAO (ng/mL) 43.15a 76.28c 60.37b 59.20b 6.01 0.042 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 D-Lac (μmol/mL) 1.95a 3.73c 3.04b 2.91b 0.37 0.031 DAO (ng/mL) 43.15a 76.28c 60.37b 59.20b 6.01 0.042 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large Table 4. Effects of Gln on the serum DAO activity of broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 D-Lac (μmol/mL) 1.95a 3.73c 3.04b 2.91b 0.37 0.031 DAO (ng/mL) 43.15a 76.28c 60.37b 59.20b 6.01 0.042 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 D-Lac (μmol/mL) 1.95a 3.73c 3.04b 2.91b 0.37 0.031 DAO (ng/mL) 43.15a 76.28c 60.37b 59.20b 6.01 0.042 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large sICAM-1 Concentration in Serum and Intestinal Mucosa The results regarding the effects of Gln on the sICAM-1 concentration of broilers under heat stress are presented in Table 5. Heat stress significantly increased the sICAM-1 concentrations in the jejunum, ileum, and serum of broilers in the HT group as compared to those in the NS group (P < 0.05). Broilers fed with Gln had lower sICAM-1 concentrations in the jejunum, ileum, and serum than those in the heat-stressed broilers (P < 0.05). However, no differences were observed between the Gln groups and NS group (P > 0.05). Table 5. Effects of Gln on the sICAM-1 activity of the intestinal mucosa in broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Serum (μg/mL) 106.32a 207.75c 146.34b 140.12b 62.13 0.034 Jejunum (ng/g prot) 1.32a 1.67b 1.38a 1.31a 0.24 0.041 Ileum (ng/g prot) 1.25a 1.51b 1.28a 1.26a 0.20 0.039 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Serum (μg/mL) 106.32a 207.75c 146.34b 140.12b 62.13 0.034 Jejunum (ng/g prot) 1.32a 1.67b 1.38a 1.31a 0.24 0.041 Ileum (ng/g prot) 1.25a 1.51b 1.28a 1.26a 0.20 0.039 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large Table 5. Effects of Gln on the sICAM-1 activity of the intestinal mucosa in broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Serum (μg/mL) 106.32a 207.75c 146.34b 140.12b 62.13 0.034 Jejunum (ng/g prot) 1.32a 1.67b 1.38a 1.31a 0.24 0.041 Ileum (ng/g prot) 1.25a 1.51b 1.28a 1.26a 0.20 0.039 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Serum (μg/mL) 106.32a 207.75c 146.34b 140.12b 62.13 0.034 Jejunum (ng/g prot) 1.32a 1.67b 1.38a 1.31a 0.24 0.041 Ileum (ng/g prot) 1.25a 1.51b 1.28a 1.26a 0.20 0.039 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large Cytokine Levels The results regarding the effects of Gln on the intestinal cytokine levels of broilers under heat stress are presented in Table 6. The broilers in the HT group exhibited significantly higher intestinal mucosal TNF-α and TNF-α/IL-10 levels, but lower IL-10 levels than those of the NS group (P < 0.05). Dietary supplementation of Gln ameliorated the decrease of TNF-α and TNF-α/IL-10 levels, as well as the increase of IL-10 levels in the intestinal mucosa of the heat-stressed broilers (P < 0.05). No differences were found in the TNF-α, TNF-α/IL-10, and IL-10 levels in the intestinal mucosa among treatments (P > 0.05). Table 6. Effects of Gln on the intestinal cytokines levels in broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum TNF-α (ng/mg prot) 100.17a 201.43b 112.75a 104.61a 42.75 0.034 IL-10 (ng/mg prot) 280.34b 215.67a 309.12c 324.75c 20.01 0.039 TNF-α/IL-10 0.36a 0.93b 0.36a 0.32a 0.11 0.010 Ileum TNF-α (ng/L) 87.61a 162.59b 96.19a 90.47a 31.08 0.021 IL-10 (ng/mg prot) 239.61b 210.46a 309.07c 321.42c 22.34 0.028 TNF-α/IL-10 0.26a 0.77b 0.31a 0.28a 0.09 0.014 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum TNF-α (ng/mg prot) 100.17a 201.43b 112.75a 104.61a 42.75 0.034 IL-10 (ng/mg prot) 280.34b 215.67a 309.12c 324.75c 20.01 0.039 TNF-α/IL-10 0.36a 0.93b 0.36a 0.32a 0.11 0.010 Ileum TNF-α (ng/L) 87.61a 162.59b 96.19a 90.47a 31.08 0.021 IL-10 (ng/mg prot) 239.61b 210.46a 309.07c 321.42c 22.34 0.028 TNF-α/IL-10 0.26a 0.77b 0.31a 0.28a 0.09 0.014 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large Table 6. Effects of Gln on the intestinal cytokines levels in broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum TNF-α (ng/mg prot) 100.17a 201.43b 112.75a 104.61a 42.75 0.034 IL-10 (ng/mg prot) 280.34b 215.67a 309.12c 324.75c 20.01 0.039 TNF-α/IL-10 0.36a 0.93b 0.36a 0.32a 0.11 0.010 Ileum TNF-α (ng/L) 87.61a 162.59b 96.19a 90.47a 31.08 0.021 IL-10 (ng/mg prot) 239.61b 210.46a 309.07c 321.42c 22.34 0.028 TNF-α/IL-10 0.26a 0.77b 0.31a 0.28a 0.09 0.014 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum TNF-α (ng/mg prot) 100.17a 201.43b 112.75a 104.61a 42.75 0.034 IL-10 (ng/mg prot) 280.34b 215.67a 309.12c 324.75c 20.01 0.039 TNF-α/IL-10 0.36a 0.93b 0.36a 0.32a 0.11 0.010 Ileum TNF-α (ng/L) 87.61a 162.59b 96.19a 90.47a 31.08 0.021 IL-10 (ng/mg prot) 239.61b 210.46a 309.07c 321.42c 22.34 0.028 TNF-α/IL-10 0.26a 0.77b 0.31a 0.28a 0.09 0.014 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large TJP mRNA Expression Levels in Jejunum and Ileum The results regarding the effects of Gln on the TJP of broilers under heat stress are presented in Table 7. Heat stress resulted in significant mRNA down-regulation of occludin, claudin-1, and ZO-1 in both jejunum and ileum as compared to those in the control chickens (P < 0.05). Broilers in the Gln group had higher ZO-1, claudin-1, and occludin mRNA expression levels in the jejunum and ileum as compared to the HT group (P < 0.05). However, no differences were observed in the Gln1 and Gln2 groups compared with the NS group (P > 0.05). Additionally, in general, the induction of the heat stress response observed by the expression of ZO-1, claudin-1, and occludin was lower in the chicken ileum in comparison with the jejunum. Table 7. Effects of Gln on the mRNA expression of the tight junction protein in intestinal tissue of broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum  ZO-1 1.92b 1.25a 1.83b 1.88b 0.32 0.021  Claudin-1 1.27b 0.68a 1.21b 1.26b 0.28 0.034  Occludin 1.35a 0.45b 1.27a 1.34a 0.47 0.017 Ileum  ZO-1 0.71c 0.12a 0.39b 0.40b 0.20 0.025  Claudin-1 0.94b 0.35a 0.82b 0.88b 0.37 0.037  Occludin 1.23c 0.37a 0.75b 0.80b 0.25 0.013 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum  ZO-1 1.92b 1.25a 1.83b 1.88b 0.32 0.021  Claudin-1 1.27b 0.68a 1.21b 1.26b 0.28 0.034  Occludin 1.35a 0.45b 1.27a 1.34a 0.47 0.017 Ileum  ZO-1 0.71c 0.12a 0.39b 0.40b 0.20 0.025  Claudin-1 0.94b 0.35a 0.82b 0.88b 0.37 0.037  Occludin 1.23c 0.37a 0.75b 0.80b 0.25 0.013 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); values are expressed in arbitrary units. The mRNA level of each target gene for the NS group is assigned a value of 1 and normalized against β-actin. n = 8. View Large Table 7. Effects of Gln on the mRNA expression of the tight junction protein in intestinal tissue of broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum  ZO-1 1.92b 1.25a 1.83b 1.88b 0.32 0.021  Claudin-1 1.27b 0.68a 1.21b 1.26b 0.28 0.034  Occludin 1.35a 0.45b 1.27a 1.34a 0.47 0.017 Ileum  ZO-1 0.71c 0.12a 0.39b 0.40b 0.20 0.025  Claudin-1 0.94b 0.35a 0.82b 0.88b 0.37 0.037  Occludin 1.23c 0.37a 0.75b 0.80b 0.25 0.013 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum  ZO-1 1.92b 1.25a 1.83b 1.88b 0.32 0.021  Claudin-1 1.27b 0.68a 1.21b 1.26b 0.28 0.034  Occludin 1.35a 0.45b 1.27a 1.34a 0.47 0.017 Ileum  ZO-1 0.71c 0.12a 0.39b 0.40b 0.20 0.025  Claudin-1 0.94b 0.35a 0.82b 0.88b 0.37 0.037  Occludin 1.23c 0.37a 0.75b 0.80b 0.25 0.013 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); values are expressed in arbitrary units. The mRNA level of each target gene for the NS group is assigned a value of 1 and normalized against β-actin. n = 8. View Large DISCUSSION The intestinal tract is considered one of the main target organs and is particularly susceptible to stressors. Heat stress can imitate epithelial surface receptors for pathogen binding and result in reduction in villus height and crypt depth, thus damaging the integrity of the gut epithelial tissue (Burkholder et al., 2008). In the present study, apparent damage to villi, shortened villus height, deeper crypt depth, and a lower villus height:crypt depth ratio were observed in heat-stressed broilers, which is consistent with the findings of Song et al. (2013) in heat stress. It is likely that high environmental temperature reduces the feed intake of the birds, thus greatly reducing the amounts of energy delivered to the gastrointestinal tract cells during periods of heat stress. Moreover, low feed intake will reduce the absorptive area of the intestinal mucosa and limit the secretion of digestive enzymes (Porto et al., 2015). These factors may delay intestinal mucosal development, resulting in the observation of shorter villi, lower villus height:crypt depth ratio and greater crypt depth. Some studies showed that Gln has important functional roles in the promotion of mucosal growth and protein synthesis in the intestine (Porto et al., 2015). Glutamine provides sufficient energy for cell proliferation and differentiation. It should be noted that we observed an increase in villus height and villus height:crypt depth ratio in heat-stressed broilers supplemented with Gln in the present study. This result agrees with Porto et al. (2015), who reported that supplementation of Gln promotes epithelial cell proliferation and renewal, increases villus height, and limits the damage to the intestinal epithelium elicited by heat stress in broilers. It has been shown that addition of 1% Gln to broiler diets presented positive effect on villus height, crypt depth, and the villus:crypt in different segments of the small intestine under normal temperature conditions (Murakami et al., 2007). The benefit of Gln is associated with its involvement in increasing intestinal cell proliferation, as it is the main energy source of small intestinal enterocytes (Akiba et al., 2009). On the other hand, these results could be attributed to better nutrient absorption and its nutritive importance for villus growth. Because Gln is an important amino acid for utilization as an energy source for the development of the mucosa and maintains the normal intestinal structure and increases transcellular transport (Farhad, et al., 2014), these may increase the absorptive surface of the gastrointestinal mucosa, and improve the digestion and absorption of nutrients during stress (Murakami et al., 2007; Xiao et al., 2014). Even though Gln increases the villus lengths, it did not increase the BWG (d 22 to 41) of broilers in our unpublished study; these results are in agreement with Maiorka et al. (2000). The present study is probably related to the role of Gln in ammoniagenesis and the production of high ammonium ions in Gln-fed birds (Farhad, et al., 2014). The activity of the plasma D-lactic acid and DAO might serve as a marker of intestinal mucosal barrier integrity and injury (Gordon et al., 1983). Plasma D-lactic acid and DAO activity increase in the broiler when the intestinal mucosa is injured (Wu et al., 2013). Our present results also confirm the results of other investigators (Wu et al., 2013; Song et al., 2017). These results showed that damage to a certain degree existed in the intestinal mucosa of the HT broiler, and the intestinal permeability increased. Our intestinal morphology findings further verified that the vascular release of D-lactic acid and DAO as a result of heat stress must involve the villus tip cells or the mucosal surface as these are the prime sources of the enzyme. Therefore, levels of plasma D-lactic acid and DAO activity may be one factor associated with the severity and extent of the intestinal mucosa injury in broilers. It was observed in our present study that feeding Gln decreased D-lactic acid and DAO activity in the plasma of heat-stressed birds. These results indicated that the intestinal mucosal permeability had somewhat improved. Therefore, Gln may attenuate enzyme release from the villus tip cells or the intestinal mucosa, and result in improvement in intestinal permeability under heat stress conditions. These results indicate that Gln could abate the degree of intestinal injury, lessen intestinal mucosal permeability, and increase intestinal mucosa protection. Soluble intercellular adhesion molecule-1 belongs to the immunoglobulin superfamily, is a biomarker for the degree of systemic inflammatory responses and is a target on intestinal epithelial cells (Zhang et al., 2015). Soluble intercellular adhesion molecule-1 levels have been reported to increase significantly after experiencing physiological stress in a normal setting (Vonkänel et al., 2007). In our study, heat stress-induced sICAM-1 increase was achieved in the inflammatory intestinal mucosa of broilers with HT and was related to the concentration of sICAM-1 in the serum; this outcome agrees with previous studies showing increased sICAM-1 levels after other physiological stress (Wu et al., 2013). This corroboration verified that the sICAM-1 level was clearly related to the condition of the animal body. This result may indicate that greater physiological stress and subsequent pro-inflammatory cytokines lead to increased release of sICAM-1 from endothelial cells. These results were also supported in the cytokine levels of broilers in our study. In the present heat stress broiler study, Gln treatment has been shown to inhibit sICAM-1 release when compared to HT alone, which may be due to the inhibition of pro-inflammatory cytokines, such as TNF-α. Data from this study suggest that the anti-inflammatory effects are, at least in part, due to the inhibition of TNF-α release. T-helper cells can be divided into T helper 1 (Th1) and T helper 2 (Th2) subsets according to their cytokine production. Th1 cells induce the secretion of the pro-inflammatory cytokine TNF-α (Huang et al., 2015), whereas Th2 cells induce the secretion of the anti-inflammatory cytokine IL-10 (Lv et al., 2015). Tumor necrosis factor-α is an important inflammatory factor that plays important roles in various inflammatory reactions. It is well known that IL-10, a potent anti-inflammatory cytokine, inhibits the production of the major pro-inflammatory cytokines, and attenuates cell-mediated immune reactions (Moore et al., 1993). Our findings showed that stimulated cells in the inflamed mucosa markedly decreased the concentrations of Th2 cytokines (IL-10) but elevated the levels of Th1 cytokines (TNF-α) under heat stress. Thus, the effect on Th1 cells is opposite that on Th2 cells. This result likely increases the susceptibility of broilers to heat stress. Stress-induced bowel inflammation might have released pro-inflammatory mediators from the gut mucosa, such as IL-1, TNF-α, and IL-6, as has been reported elsewhere in a different experimental context (Gautier et al., 2012). Increased inflammatory cytokines in broilers subjected to heat stress has been reported (Quinteiro-Filho et al., 2010). Our result also showed that heat stress increased inflammatory cytokines, specifically, the release of TNF-α in the jejunum and ileum of broilers; this result agrees with previous reports (DeNardo and Coussens, 2007). Moreover, in our study, the levels of the anti-inflammatory cytokine IL-10 were also significantly different. These results suggest that HT can regulate the activation of inflammatory cells and cytokine production. This data showed that the intestinal mucosa and villi of the broilers were seriously injured by the HT, which was verified in the findings regarding the villus height, deeper crypt depth, and villus height:crypt depth ratio. A previous study reported that Gln reduced the concentration of various pro-inflammatory cytokines, and increased the concentration of various anti-inflammatory cytokines, in the intestinal mucosa of broilers challenged with stress (Zhong et al., 2014). Our results were consistent with the above reports. The findings suggest that both Th1 and Th2 responses were inhibited by Gln and that Gln plays a beneficial role in alleviating the intestinal inflammatory response. We conclude that it is conceivable that Gln may contribute to preventing the development of inflammatory responses. Bartell and Batal (2007) reported decreased cytokine production in broilers fed 1% Gln and had better gut barrier function under normal temperature conditions. In the normal conditions, Lai et al. (2004) showed that Gln administration reduced the production of inflammatory mediators systemically, and enhanced cellular immunity in rats. Moreover, normal intestinal structure and immune function may be helpful for maintaining normal cytokine levels (Deng et al., 2012). Some reports have shown that Gln is an important factor in maintaining intestinal mucosal structure (Xu et al., 2014). In the current study, supplementation with Gln may be effective in protecting the intestinal mucosa of broilers and increasing the villus height of the intestine. Thus, we conclude that Gln can simultaneously inhibit cellular immunity. The underlying mechanism involved in the beneficial influence of Gln on the intestinal inflammatory response needs to be further investigated. Intestinal TJP, such as claudin, ZO, and occludin, were directly related to the normal function of the intestinal mucosa barrier. The abnormal expression of TJP is closely related to the inflammatory responses of the intestine (Xu et al., 2016). Many cytokines are involved in the regulation of TJP. According to the results of this study, the expression of ZO-1, claudin-1, and occludin for broilers in the HT group were all significantly lower than those in the control group, which indicated that the abnormal expression of TJP was the main mechanism causing reduced function of the intestinal mucosal barrier, as well as increased intestinal permeability. These results agreed with previous findings, in which HT decreased protein levels of ZO-1, claudin-1, and occludin in the small intestine (Song et al., 2017). After treatment with Gln, the expression of TJP in the epithelium was increased, which indicated that the TJP played an important role in the pathogenesis of inflammatory responses under heat stress. Similarly, Wang et al. (2015) also observed that Gln improved intestinal barrier integrity, leading to enhanced transepithelial electrical resistance in weanling piglets. These results were attributed to Gln as a truly functional amino acid in nutrition, and broilers have dietary requirements of this nutrient to support intestinal health and development (Wu 2013). Our results indicate that Gln supplementation can regulate TJP expression in the small intestine of broilers, thereby conferring a beneficial effect on mucosal barrier function, and can be a promising approach for protecting the intestinal barrier in broilers. Moreover, in the present study, the induction of heat stress response observed by the expression of ZO-1, claudin-1, and occludin was lower in the chicken ileum in comparison with the jejunum. The mechanisms of the differences are not clarified in the present study. However, 4 explanations may account for the differences. One possibility is different characteristics of jejunum and ileum (Kitazawa et al., 1997), a second is different susceptibility to heat stress treatment between the jejunum and ileum (Varasteh et al., 2015), and a third is the different contractile mechanism coupled to motilin receptors between the jejunum and ileum (Van der Hoeven-Hangoor et al., 2013), and a fourth is the different microbiota composition between the jejunum and ileum (Sohail et al., 2012). These findings are consistent with a study result Varasteh et al. (2015), in which differences in the mRNA expression of the TJ proteins claudin and ZO-1 between tissue-specific differences during heat stress treatment are described. However, it is unknown how heat stress and Gln regulate the expression or function of the ZO-1, claudin-1, and occludin proteins. Therefore, to further examine the regulation of TJP by Gln, further studies will be needed to clarify the molecular mechanisms regulating Gln-induced intestinal cell migration via alteration of the organization of TJP using genetic manipulation technologies. CONCLUSION In summary, heat stress may delay intestinal mucosa and barrier development, adjust the functions of cell cytokine factor mRNA expression, and reduce the mRNA expression of ZO-1, claudin-1, and occludin proteins. Intestinal epithelial barrier function and the cytokines secretion are regulated by TJP, and Gln plays an important role in inflammatory responses in the intestinal mucosa. Therefore, study of the role of Gln in regulating TJP will be of continuing value in efforts to understand the mechanisms of the repair of injured intestinal mucosa. Acknowledgements The authors express special thanks to Shao Yang Zhi, Sai Wu Zhang, Ping Ping Han, and Sheng Nan Ren for skillful technical assistance with this research. Notes This research was supported by a project supported by the National Natural Science Foundation of China (Grant No. 31601971). REFERENCES Akiba Y. , Watanabe C. , Mizumori M. , Kaunitz J. D. . 2009 . Luminal L-glutamate enhances duodenal mucosal defense mechanisms via multiple glutamate receptors in rats . Am. J. Physiol. Gastrointest. Liver. Physiol . 297 : G781 – G791 . Google Scholar CrossRef Search ADS PubMed Bartell S. M. , Batal A. B. . 2007 . The effect of supplemental glutamine on growth performance, development of the gastrointestinal tract, and humoral immune response of broilers . Poult. Sci. 86 : 1940 – 1947 . Google Scholar CrossRef Search ADS PubMed Burkholder K. M. , Thompson K. L. , Einstein M. E. , Applegate T. J. , Patterson J. A. . 2008 . Influence of stressors on normal intestinal microbiota, intestinal morphology, and susceptibility to salmonella enteritidis colonization in broilers . Poult. Sci. 87 : 1734 – 1741 . Google Scholar CrossRef Search ADS PubMed DeNardo D. G. , Coussens L. M. . 2007 . Inflammation and breast cancer. Balancing immune response: Crosstalk between adaptive and innate immune cells during breast cancer progression . Breast. Cancer. Res . 9 : 212 . Google Scholar CrossRef Search ADS PubMed Deng W. , Dong X. F. , Tong J. M. , Zhang Q. . 2012 . The probiotic Bacillus licheniformis ameliorates heat stress-induced impairment of egg production, gut morphology, and intestinal mucosal immunity in laying hens . Poult. Sci. 91 : 575 – 582 . Google Scholar CrossRef Search ADS PubMed Farhad J. , Parviz F. , Mohsen D. , Gholamreza N. . 2014 . The effects of dietary glutamine supplementation on growth performance and intestinal morphology of broiler chickens reared under hot conditions . Turk. J. Vet. Anim. Sci . 38 : 264 – 270 . Google Scholar CrossRef Search ADS Gautier E. L. , Shay T. , Miller J. . 2012 . Gene-expression profiles and transcriptional regulatory pathways that underlie the identity and diversity of mouse tissue macrophages . Nat. Immunol . 13 : 1118 – 1128 . Google Scholar CrossRef Search ADS PubMed Gordon D. L. , Theodore M. B. , Stephen B. . 1983 . Plasma postheparin diamine oxidase. Sensitive provocative test for quantitating length of acute intestinal mucosal injury in the rat. J. Clin. Invest. 71 : 1308 – 1315 . Google Scholar CrossRef Search ADS PubMed Huang B. X. , Xu S. Y. , Yang D. X. , Zeng Y. L. , Liu D. F. , Wang W. . 2015 . Mycophenolate mofetil modulates differentiation of Th1/Th2 and the secretion of cytokines in an active Crohn's disease mouse model . Int. J. Mol. Sci . 16 : 26654 – 26666 . Google Scholar CrossRef Search ADS PubMed Kitazawa T. , Taneike T. , Ohga A. . 1997 . Functional characterization of neural and smooth muscle motilin receptors in the chicken proventriculus and ileum . Regul. Pept. 71 : 87 – 95 . Google Scholar CrossRef Search ADS PubMed Lai Y. N. , Yeh S. L. , Lin M. T. , Shang H. F. , Yeh C. L. , Chen W. J. . 2004 . Glutamine supplementation enhances mucosal immunity in rats with gut-derived sepsis . Nutrition 20 : 286 – 291 . Google Scholar CrossRef Search ADS PubMed Li N. , Neu J. . 2009 . Glutamine deprivation alters intestinal tight junctions via a PI3-K/Akt mediated pathway in Caco-2 cells/Akt mediated pathway in Caco-2 cells . J. Nutr . 139 : 710 – 714 . Google Scholar CrossRef Search ADS PubMed Lin X. J. , Mei G. P. , Liu J. , Li Y. L. , Zuo D. , Liu S. J. , Zhao T. B. , Lin M. T. . 2011 . Therapeutic effects of melatonin on heatstroke-induced multiple organ dysfunction syndrome in rats . J. Pineal. Res . 50 : 436 – 444 . Google Scholar CrossRef Search ADS PubMed Marchini C. F. P. , Café M. B. , Araùjo E. G. , Nascimento M. R. B. M. . 2016 . Physiology, cell dynamics of small intestinal mucosa, and performance of broiler chickens under heat stress: A review . Rev. Colomb Cienc. Pecu . 29 : 159 – 168 . Google Scholar CrossRef Search ADS Maiorka A. , Silva A. V. F. , Santin E. , Borges S. A. , Boleli I. C. , Macari M. . 2000 . Influência da suplementação de glutamina sobre o desempenho e o desenvolvimento de vilos e criptas do intestino delgado de frangos . Arq. Bras. Med. Vet. Zootec. 52 : 487 – 490 ( in Portuguese ). Google Scholar CrossRef Search ADS Murakami A. E. , Sakamoto M. I. , Natali M. R. M. , Souza L. M. G. , Franco J. R. G. . 2007 . Supplementation of glutamine and vitamin E on the morphometry of the intestinal mucosa in broiler chickens . Poult. Sci. 86 : 488 – 495 . Google Scholar CrossRef Search ADS PubMed Moeser A. J. , Ryan K. A. , Nighot P. K. , Blikslager A. T. . 2007 . Gastrointestinal dysfunction induced by early weaning is attenuated by delayed weaning and mast cell blockade in pigs . Am. J. Physiol . 293 : 413 – 421 . Moore K. W. , O’Garra A. , Malefyt R. W. , Vieira A. P. , Mosmann T. R. . 1993 . Interleukin-10 . Annu. Rev. Immunol. 11 : 165 – 190 . Google Scholar CrossRef Search ADS PubMed Nan L. , Patricia L. , Don S. , Kellym L. , Josef N. . 2004 . Glutamine regulates Caco-2 cell tight junction proteins . Am. J. Physiol-Gastr. L . 287 : G726 – G733 . Nasu Y , Ido A. , Tanoue S. , Hashimoto S. , Sasaki F. , Kanmura S. , Setoyama H. , Numata M. , Funakawa K. , Moriuchi A. , Fujita H. , Sakiyama T. , Uto H. , Oketani M. , Tsubouchi H. . 2013 . Hepatocyte growth factor stimulates the migration of gastric epithelial cells by altering the subcellular localization of the tight junction protein ZO-1 . J. Gastroenterol. 48 : 193 – 202 . Google Scholar CrossRef Search ADS PubMed National Research Council . 1994 . Nutrient Requirements of Poultry . Acad. Press , Washington, DC . Lv H. , Ren H. , Wang L. , Chen W. , Ci X. . 2015 . Lico A enhances Nrf2-Mediated defense mechanisms against t-BHP-induced oxidative stress and cell death via Akt and ERK activation in RAW 264.7 cells . Oxid. Med. Cell. Longev. 2015 : 709 – 845 . Google Scholar CrossRef Search ADS Porto M. L. , Givisiez P. E. N. , Saraiva E. P. , Costa F. G. P. , Filho A. L. B. M. , Andrade M. F. S. , Brandão P. A. , Guerra R. R. . 2015 . Glutamic acid improves body weight gain and intestinal morphology of broiler chickens submitted to heat stress . Braz. J. of Poultry. Sci . 17 : 355 – 362 . Google Scholar CrossRef Search ADS Quinteiro-Filho W. M. , Ribeiro A. , Ferraz-de-Paula V. , Pinheiro M. L. , Sakai M. , Sá L. R. M. . 2010 . Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens . Poult. Sci. 89 : 1905 – 1914 . Google Scholar CrossRef Search ADS PubMed Sohail M. U. , Hume M. E. , Byrd J. A. , Nisbet D. J. , Ijaz A. , Sohail A. , Shabbir M. Z. , Rehman H. . 2012 . Effect of supplementation of prebiotic mannan-oligosaccharides and probiotic mixture on growth performance of broilers subjected to chronic heat stress . Poult. Sci. 91 : 2235 – 2240 . Google Scholar CrossRef Search ADS PubMed Song J. , Jiao L. F. , Xiao K. , Luan Z. S. , Hu C. H. , Shi B. , Zhan X. A. . 2013 . Cello-oligosaccharide ameliorates heat stress-induced impairment of intestinal microflora, morphology and barrier integrity in broilers . Anim. Feed Sci. Technol. 185 : 175 – 181 . Google Scholar CrossRef Search ADS Song Z. H. , Cheng K. , Zhang L. L. , T. Wang . 2017 . Dietary supplementation of enzymatically treated Artemisia annua could alleviate the intestinal inflammatory response in heat-stressed broilers . J. Therm. Biol . 69 : 184 – 190 . Google Scholar CrossRef Search ADS PubMed Uni Z. , Geyra A. , Ben-Hur H. . 2000 . Small intestinal development in the young chick: Crypt formation and enterocyte proliferation and migration . Br. Poult. Sci. 41 : 544 – 551 . Google Scholar CrossRef Search ADS PubMed Van der Hoeven-Hangoor E. , van der Vossen J. M. B. M. , Schuren F. H. J. , Verstegen M. W. A. , de Oliveira J. E. , Montijn R. C. , Hendriks W. H. . 2013 . Ileal microbiota composition of broilers fed various commercial diet compositions . Poult. Sci. 92 : 2713 – 2723 . Google Scholar CrossRef Search ADS PubMed Varasteh S. , Braber S. , Akbari P. , Garssen J. , Fink-Gremmels J. . 2015 . Differences in susceptibility to heat stress along the chicken intestine and the protective effects of galacto-oligosaccharides . PLoS. One. 10 : e0138975 . Google Scholar CrossRef Search ADS PubMed Vonkänel R. , Preckel D. , Kudielka B. M. , Fischer J. E. . 2007 . Responsiveness and habituation of soluble ICAM-1 to acute psychosocial stress in men: Determinants and effect of stress-hemoconcentration . Physiol. Res . 56 : 627 – 639 . Google Scholar PubMed Wang H. , Zhang C. , Wu G. Y. , Sun Y. L. , Wang B. , He B. B. , Dai Z. L. , Wu Z. L. . 2015 . Glutamine enhances tight junction protein expression and modulates corticotropin-releasing factor signaling in the jejunum of weanling piglets . J. Nutr . 145 : 25 – 31 . Google Scholar CrossRef Search ADS PubMed Wu G. 2013 . Functional amino acids in nutrition and health . Amino Acids . 45 : 407 – 411 . Google Scholar CrossRef Search ADS PubMed Wu Q. J. , Zhou Y. M. , Wu Y. N. , Zhang L. L. , Wang T. . 2013 . The effects of natural and modified clinoptilolite on intestinal barrier function and immune response to LPS in broiler chickens . Vet. Immunol. Immunopathol. 153 : 70 – 76 . Google Scholar CrossRef Search ADS PubMed Xiao W. , Feng Y. , Holst J. J. , Hartmann B. , Yang H. , Teitelbaum D. H. . 2014 . Glutamate prevents intestinal atrophy via luminal nutrient sensing in a mouse model of total parenteral nutrition . FASEB J. 28 : 2073 – 2087 . Google Scholar CrossRef Search ADS PubMed Xu C. L. , Sun R. , Qiao X. J. , Xu C. C. , Shang X. Y. , Niu W. N. . 2014 . Protective effect of glutamine on intestinal injury and bacterial community in rats exposed to hypobaric hypoxia environment . World. J. Gastroenterol . 20 : 4662 – 4674 . Google Scholar CrossRef Search ADS PubMed Xu C. M. , Li X. M. , Qin B. Z. , Liu B. . 2016 . Effect of tight junction protein of intestinal epithelium and permeability of colonic mucosa in pathogenesis of injured colonic barrier during chronic recovery stage of rats with inflammatory bowel disease . Asian. Pac. J. Trop. Med . 9 : 148 – 152 . Google Scholar CrossRef Search ADS PubMed Zhang S. Y. , Kuang Z. Z. , Zhang X. K. . 2015 . Effects of simulated heat waves with strong sudden cooling weather on ApoE Knockout Mice . Inter. J. Env. Res. Pub. Heal . 12 : 5743 – 5757 . Google Scholar CrossRef Search ADS Zhong L. , Zhang X. , Covasa M. . 2014 . Emerging roles of lactic acid bacteria in protection against colorectal cancer . World. J. Gastroenterol . 20 : 7878 – 7886 . Google Scholar CrossRef Search ADS PubMed Zuo J. J. , Guo A. H. , Yan X. Y. , Xu M. , Xia W. G. , Feng D. Y. . 2014 . Supplementation of β-mannanase in diet with energy adjustmention affect performance, intestinal morphology and tight junction proteins mRNA expression in broiler chickens . J. Anim. American Control Conference-acc. 2014 : 4810 – 4815 . © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Glutamine alleviates heat stress-induced impairment of intestinal morphology, intestinal inflammatory response, and barrier integrity in broilers

Poultry Science , Volume Advance Article (8) – Jul 11, 2018

Loading next page...
 
/lp/ou_press/glutamine-alleviates-heat-stress-induced-impairment-of-intestinal-cUnILts0H8
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pey123
Publisher site
See Article on Publisher Site

Abstract

Abstract The aim of this study was to investigate the protective effect of glutamine (Gln) on the intestinal morphology, intestinal inflammatory response, and barrier integrity in broilers exposed to high ambient temperature. Three-hundred-sixty 21-d-old Arbor Acres broilers (half male and half female) were randomly allocated to 4 treatment groups in a completely randomized design, each of which included 6 replicates with 15 birds per replicate, for 21 d. The 4 treatment groups were as follows: the control group, in which birds were kept in a thermoneutral room at 22 ± 1°C (no stress, NS; fed a basal diet); the heat stress group (36 ± 1°C for 10 h/d from 08:00 to 18:00 h and 22 ± 1°C for the remaining time, heat stress (HT); fed a basal diet); and heat stress + Gln group (0.5 and 1.0% Gln, respectively). Compared to the NS group, broilers in the HT group had lower villus height (P < 0.05), higher crypt depth (P < 0.05), higher D-lactic acid and diamine oxidase (DAO) activity (P < 0.05), higher soluble intercellular adhesion molecule-1 (sICAM-1) concentration (P < 0.05), higher tumor necrosis factor (TNF)-α/interleukin (IL)-10 (P < 0.05), and lower tight junction protein expression levels (P < 0.05). Compared with birds in the HT, birds in the HT + Gln group exhibited increased villus height (P < 0.05), decreased D-lactate and DAO activity (P < 0.05), decreased sICAM-1 concentration (P < 0.05), and mediate the secretion of cytokines (P < 0.05), as well as increased zonula occludens-1 (ZO-1), claudin-1, and occludin mRNA expression levels (P < 0.05). In conclusion, these results indicate that supplementation with Gln was effective in partially ameliorating the adverse effects of heat stress on intestinal barrier function in broilers by promoting epithelial cell proliferation and renewal, modifying the function of the intestinal mucosa barrier, and regulating the secretion of cytokines. INTRODUCTION Poultry can maintain their body temperature during the hottest and driest weather by changing their normal physiological equilibrium or via behavioral changes. Notably, certain internal body organs such as the intestines, liver, and kidneys have been cited for their role in heat stress of the bird. However, birds have limited ability to regulate heat loss through behavioral and physiological means. High ambient temperatures can result in lost production, death, and reduced profits in the immediate future for commercial broiler producers. Current studies suggest that these critical consequences in broilers with heatstroke are the result of multiple organ dysfunction syndrome (MODS) secondary to heat injury (Lin et al., 2011). It is currently believed that multiple pathophysiological alterations, such as immune dysregulation, intestinal dysfunction, and cellular oxidative stress in severe heatstroke are the initiating factors that cause MODS (Quinteiro-Filho et al., 2010; Varasteh et al., 2015). It is well known that the intestine, one of the most vital organs in the body, plays a critical role in digestion, absorption of nutrients, and immune defense; hence, it is highly sensitive to heat stress during acute heat exposure in broiler chickens. Recent studies have shown that a variety of changes can be observed, including those associated with intestinal development, such as reduction in the small intestinal weight and the number of villi (Uni et al., 2000), intestinal histopathological changes, reduction in the proliferation rate of intestinal epithelial cells, gut barrier dysfunction, and cellular oxidative stress, in cases of severe heatstroke (Marchini et al., 2016). These results indicate that intestinal barrier function and integrity play an important role in severe heatstroke. However, the underlying mechanisms responsible for increased intestinal permeability and reduced integrity remain unclear. In recent years, studies have found that tight junction proteins (TJP) are induced in the epithelial cell of the jejunum and ileum and are necessary for guaranteeing the intestinal barrier function and regulating paracellular permeability (Nasu et al., 2013). Some results have shown that increased intestinal permeability contributes to intestinal inflammation and compromised barrier function (Moeser et al., 2007; Zuo et al., 2014). However, to the best of our knowledge, very few studies have been performed to determine the relationship between TJP (zonula occludens-1 (ZO-1) and occludin) activity and intestinal structure and barrier function in poultry under heat stress conditions. Glutamine (Gln), a conditionally essential amino acid for the gut, has been reported to enhance gut development and protect the intestinal epithelium in multiple animal models, especially during stresses (Nan et al., 2004). Protective effects of Gln may be a result of increased TJP expression in the small intestine and decreased intestinal permeability during stresses (Li and Neu, 2009). The mechanism for these protective effects may be through Gln activation of occludin, claudin-1, zonula occludens-2 (ZO-2), zonula occludens-3 (ZO-3), and corticotrophin-releasing factor (Wang et al., 2015). This demonstrates that Gln supplementation may regulate TJP expression, which has a beneficial effect on mucosal barrier function and health under heat stress conditions. However, very few studies have been performed to determine the effects of Gln supplementation on the expression of occludin and ZO-1 in broilers. The aim of the present study was to assess the effects of Gln on the small intestine morphology and intestinal barrier function with histopathology and RT-PCR analysis during heat stress in broiler chickens. In addition, the effects of Gln on the inflammatory response of the small intestine were also investigated during our trial. MATERIALS AND METHODS Materials and Reagents Glutamine was purchased from Henan Honda Biological Medicine Co., Ltd., China. The product is pharmaceutical-grade, 99% purity. Experimental Design and Diets Arbor Acres broilers (half male and half female) were weighed and randomly allocated to 4 treatment groups in a completely randomized design, each of which included 6 replicates with 15 birds per replicate, for 21 d. The 4 treatment groups were as follows: the control group, in which birds were kept in a thermoneutral room at 22 ± 1°C (no stress, NS; fed a basal diet); the heat stress group (33 ± 1°C for 10 h/d from 08:00 to 18:00 h and 22 ± 1°C for the remaining time, heat stress (HT); fed a basal diet); and heat stress + Gln group (0.5 and 1.0% Gln, respectively). The room was provided with electric heaters to adjust the environmental temperature. From 22 to 41 d, the heat treatment lasted for 20 consecutive days. The broiler chicks were fed diets with the same component composition and the only difference was their Gln supplementation. The basal diets were of the maize–soybean type. The diets were formulated based on the NRC (1994) to meet or slightly exceed the nutrient requirements of broilers (Table 1). Table 1. Ingredients and nutrient composition of experimental diets. Ingredients (%) 22 to 42 d Maize 29.50 Soybean meal (48%, crude protein) 31.5 Wheat 24.56 Soybean oil 9.43 Limestone 1.55 Dicalcium phosphate 1.13 Salt 0.2 Premix1 2.13 Calculated chemical composition Apparent metabolism energy (MJ/kg) 30.2 Crude protein (%) 21.50 Calcium (%) 0.90 Available phosphorus (%) 0.68 Lysine 1.36 Methionine 0.63 Methionine + cysteine 0.98 Ingredients (%) 22 to 42 d Maize 29.50 Soybean meal (48%, crude protein) 31.5 Wheat 24.56 Soybean oil 9.43 Limestone 1.55 Dicalcium phosphate 1.13 Salt 0.2 Premix1 2.13 Calculated chemical composition Apparent metabolism energy (MJ/kg) 30.2 Crude protein (%) 21.50 Calcium (%) 0.90 Available phosphorus (%) 0.68 Lysine 1.36 Methionine 0.63 Methionine + cysteine 0.98 1Premix provided per kg of diet: Chromium oxide 0.5 g, L-Lysine·HCl 0.25 g; DL-Methionine 0.3 g; Vitamin A (retinyl acetate) 5,000 IU; Vitamin D3 (cholecalciferol) 2.5 IU; Vitamin E (α-tocopherolacetate) 80 IU; menadione 3 mg; thiamine 2.5 mg; riboflavin 2.5 mg; nicotinamide 25 mg; choline chloride 800 mg; calcium pantothenate 10 mg; pyridoxine·HCl 0.3 mg; biotin 0.04 mg; folic acid 1 mg; vitamin B1 18 mg; vitamin B2 6.6 mg; vitamin B6 3 mg; vitamin B12 (cobalamine) 0.02 mg; Fe (from ferrous sulfate) 80 mg; Cu (from copper sulfate) 8 mg; Mn (from manganese sulfate) 110 mg; Zn (Bacitracin Zn) 65 mg; iodine (from calcium iodate) 1.1 mg; Se (from sodium selenite) 0.3 mg; Na (sodium chloride) 1.3 g; Mg (magnesium oxide) 0.55 g; Co [cobalt-(II)-sulfate-heptahydrate] 0.30 mg. View Large Table 1. Ingredients and nutrient composition of experimental diets. Ingredients (%) 22 to 42 d Maize 29.50 Soybean meal (48%, crude protein) 31.5 Wheat 24.56 Soybean oil 9.43 Limestone 1.55 Dicalcium phosphate 1.13 Salt 0.2 Premix1 2.13 Calculated chemical composition Apparent metabolism energy (MJ/kg) 30.2 Crude protein (%) 21.50 Calcium (%) 0.90 Available phosphorus (%) 0.68 Lysine 1.36 Methionine 0.63 Methionine + cysteine 0.98 Ingredients (%) 22 to 42 d Maize 29.50 Soybean meal (48%, crude protein) 31.5 Wheat 24.56 Soybean oil 9.43 Limestone 1.55 Dicalcium phosphate 1.13 Salt 0.2 Premix1 2.13 Calculated chemical composition Apparent metabolism energy (MJ/kg) 30.2 Crude protein (%) 21.50 Calcium (%) 0.90 Available phosphorus (%) 0.68 Lysine 1.36 Methionine 0.63 Methionine + cysteine 0.98 1Premix provided per kg of diet: Chromium oxide 0.5 g, L-Lysine·HCl 0.25 g; DL-Methionine 0.3 g; Vitamin A (retinyl acetate) 5,000 IU; Vitamin D3 (cholecalciferol) 2.5 IU; Vitamin E (α-tocopherolacetate) 80 IU; menadione 3 mg; thiamine 2.5 mg; riboflavin 2.5 mg; nicotinamide 25 mg; choline chloride 800 mg; calcium pantothenate 10 mg; pyridoxine·HCl 0.3 mg; biotin 0.04 mg; folic acid 1 mg; vitamin B1 18 mg; vitamin B2 6.6 mg; vitamin B6 3 mg; vitamin B12 (cobalamine) 0.02 mg; Fe (from ferrous sulfate) 80 mg; Cu (from copper sulfate) 8 mg; Mn (from manganese sulfate) 110 mg; Zn (Bacitracin Zn) 65 mg; iodine (from calcium iodate) 1.1 mg; Se (from sodium selenite) 0.3 mg; Na (sodium chloride) 1.3 g; Mg (magnesium oxide) 0.55 g; Co [cobalt-(II)-sulfate-heptahydrate] 0.30 mg. View Large Bird management, Sample collection, and procedures The protocol was approved by the Institutional Animal Care and Use Committee of Henan University of Science and Technology. All husbandry practices and euthanasia were performed with full consideration of animal welfare. A total of 360 healthy Arbor Acres broiler chicks (21 d), obtained from a commercial hatchery, were housed in wire-floored cages (cage size was 140 cm × 70 cm × 28 cm) in an environmentally controlled room with continuous light. From 22 to 41 d, the light regimen lasted for 24 h. During the 20 consecutive days of heat treatment, the mean relative humidity of the room was monitored daily by a digital hygrometer and ranged from 50 to 60%. The birds had access to feed and water ad libitum. Glutamine was added to the basal diet. There were just 4 dead broilers out of 360, which is within the normal range of mortality. At the end of each experimental period (42 d), 6 broilers (one bird per replicate) from each treatment group were randomly selected. Blood samples were obtained as quickly as possible from the wing vein, carefully moved into EDTA tubes, then immediately transferred to the laboratory, and separated by centrifugation at 4,000 × g for 15 min at 4°C. Serum samples were stored at −80°C for further analysis. After collection of blood samples, all birds were sacrificed by cervical dislocation followed by exsanguination. The abdominal and thoracic cavities were then opened and the jejunum (from the end of the pancreatic loop to Meckel's diverticulum) and ileum (from Meckel's diverticulum to the cecal junction) were collected and emptied using gentle pressure. Approximately 2-cm sections of the proximal jejunum and proximal ileum were removed, flushed with ice-cold phosphate buffer solution at pH 7.4 and immediately fixed with formalin solution for gut morphological measurements. The remaining portion of the jejunum and ileum were excised, mucosa samples were collected using glass slides, and the jejunal and ileal sections were then washed with ice-cold sterilized saline and stored at −80°C for the analysis of cytokine concentration and gene expression. Morphology Analyses of the Jejunal and Ileal Mucosa Three cross-sections for each intestinal segment (jejunum and ileum) were processed for paraffin embedding; 6-μm thicknesses were cut, placed on glass slides, and stained with hematoxylin and eosin following standard procedures. A total of 15 intact, well-oriented crypt-villus units were selected in triplicate for each intestinal cross-section. Villus height and crypt depth were determined using an image processing and analysis system (version 6.0, Image-Pro Plus) and were expressed as micrometers (μm). Villus height was measured from the tip of the villus to the villus-crypt junction; crypt depth was defined as the depth of the invagination between adjacent villi. D-Lactic Acid and Diamine Oxidase (DAO) Activity in Serum The levels of d-lactic acid and DAO in the serum were measured by an enzyme-linked immunosorbent antibody assay (ELISA) kit (Cusabio Biotech, Wuhan, China) with a microplate reader. sICAM-1 and Cytokine Assay The intestinal mucosal concentrations of soluble intercellular adhesion molecule-1 (sICAM-1) were assayed by dual antibody solid phase enzyme-linked immunoassay according to the manufacturer's instructions (monoclonal antibody against mouse sICAM-1: Blue Gene, Shanghai, and People's Republic of China). The intestinal mucosal concentrations of TNF-α (monoclonal antibody against chicken TNF-α: Adlitteram Diagnostic Laboratories, San Diego, CA, USA) and IL-10 (monoclonal antibody against chicken IL-10: BlueGene, Shanghai, People's Republic of China) were evaluated by ELISA kits according to the manufacturer's instructions. Messenger RNA Quantification Real-time quantitative PCR (qPCR) was used to verify intestinal tissue proteins of differing abundance at the mRNA level. Total RNA from samples of jejunum and ileum were isolated using Trizol Reagent (TaKaRa Biotechnology. Dalian, Liaoning, PR China) according to the instructions of the manufacturer, and RNA quantity was determined by a spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Subsequently, 1 μg of extracted total RNA was reverse-transcribed with the Prime Script RT Reagent Kit (TaKaRa Biotechnology, Dalian, Liaoning, and PR China). The obtained first-strand complementary DNA (cDNA) was diluted to a final concentration of 10 g/L. In detail, cDNA was synthesized from 5 μg of total RNA using oligo dT primers and superscript II reverse transcriptase according to the manufacturer's instructions (Roche, USA), then diluted with sterile water; 1 μL of each diluted sample was added to a 20 μL reaction, also containing 10 μL of 2× SYBR Green I PCR Master Mix (TaKaRa, China), 2 μL of diluted cDNA, 0.4 μL of each primer (10 μM), 0.4 μL of 50× ROX reference Dye II, and 6.8 μL of PCR-grade water. The primer sequences were commercially produced (TaKaRa Biotechnology, Dalian, Liaoning, PR China) and are shown in Table 2. Real-time PCR was performed using the ABI StepOnePlus Real-Time PCR system (Applied Biosystems, Grand island, NY, USA). Each sample was processed in triplicate. Cycling parameters were as follows: 1 cycle at 95°C for 30 s, 40 cycles of 95°C for 10 s, annealing temperature for 30 s, and 72°C for 30 s, and extension for 2 min at 72°C. The melting curve analysis showed only one peak for each PCR product. Electrophoresis was performed with the PCR products to verify the primer specificity and product purity. The relative fold-change was calculated according to the 2−ΔΔCT method, which accounts for gene-specific efficiencies and was normalized to the mean expression of the abovementioned index. Furthermore, mRNA expression of the TJP (occludin, claudin-1 and ZO-1) in sections from the jejunum and ileum were measured. Table 2. Gene-specific sequences primers used in real-time quantitative PCR. Primer Sequence (5΄ → 3΄) Length ZO-11 TGTAACCACAGCATGAGGTG 98 CTGGGATGGCTCCATGTGGT Occludin CCGTAAGCCCTAGTTGGAT 214 ATTGAGCCGGGCGTTGATG Claudin-1 CCTGATCACCCTCTTGGGAG 145 GCTGCACTCACTCATTGGCT β-actin TTGGTTCGTCAAGCAAGTGG 100 CCCCCATATACTGGCACCTT Primer Sequence (5΄ → 3΄) Length ZO-11 TGTAACCACAGCATGAGGTG 98 CTGGGATGGCTCCATGTGGT Occludin CCGTAAGCCCTAGTTGGAT 214 ATTGAGCCGGGCGTTGATG Claudin-1 CCTGATCACCCTCTTGGGAG 145 GCTGCACTCACTCATTGGCT β-actin TTGGTTCGTCAAGCAAGTGG 100 CCCCCATATACTGGCACCTT 1ZO-1, zonula occludens-1. View Large Table 2. Gene-specific sequences primers used in real-time quantitative PCR. Primer Sequence (5΄ → 3΄) Length ZO-11 TGTAACCACAGCATGAGGTG 98 CTGGGATGGCTCCATGTGGT Occludin CCGTAAGCCCTAGTTGGAT 214 ATTGAGCCGGGCGTTGATG Claudin-1 CCTGATCACCCTCTTGGGAG 145 GCTGCACTCACTCATTGGCT β-actin TTGGTTCGTCAAGCAAGTGG 100 CCCCCATATACTGGCACCTT Primer Sequence (5΄ → 3΄) Length ZO-11 TGTAACCACAGCATGAGGTG 98 CTGGGATGGCTCCATGTGGT Occludin CCGTAAGCCCTAGTTGGAT 214 ATTGAGCCGGGCGTTGATG Claudin-1 CCTGATCACCCTCTTGGGAG 145 GCTGCACTCACTCATTGGCT β-actin TTGGTTCGTCAAGCAAGTGG 100 CCCCCATATACTGGCACCTT 1ZO-1, zonula occludens-1. View Large Statistical Analysis The statistical analyses of all data were performed by one-way analysis of variance using SPSS for Windows (version 20.0, SPSS Inc., Chicago, IL, USA). Differences among groups were evaluated by Tukey's multiple range tests. Statistical significance (P-value) was considered at 0.05. RESULTS The Morphology of the Small Intestine The results regarding the effects of Gln on the morphology of the intestinal tissues of broilers under heat stress are presented in Table 3. Compared to the NS group, broilers in the HT group had lower villus height of the jejunum and ileum (P < 0.05) and higher crypt depth of the ileum (P < 0.05). Dietary Gln supplementation (0.5 and 1.0%) increased the villus height of the jejunum and the ileum (P < 0.05) and decreased the crypt depth (P < 0.05) in the ileum of broilers compared to that of the HT group. The villus height:crypt depth ratio in the HT group was decreased by 15.3% compared to that in the NS group (P < 0.05). Dietary Gln supplementation (0.5 and 1.0%) increased the villus height:crypt depth ratio of the jejunum and the ileum (P < 0.05). However, no differences in villus height, crypt depth, or villus height:crypt depth ratio was observed between the NS, Gln1, and Gln2 groups (P > 0.05). Moreover, no significant differences were detected in crypt depth of the jejunum among all groups (P > 0.05). Table 3. Effects of Gln on the morphology of the intestinal tissues of broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Villus height (μm)  Jejunum 1545.68b 1314.12a 1498.97b 1526.30b 45.36 0.037  Ileum 900.31b 762.13a 854.35b 898.69b 25.37 0.020 Crypt depth (μm)  Jejunum 181.82 200.34 183.27 180.37 5.87 0.219  Ileum 153.78a 178.92b 160.49a 154.03a 6.60 0.042 Villus height:crypt depth  Jejunum 8.50b 6.56a 8.18b 8.46b 0.27 0.047  Ileum 5.85b 4.26a 5.32b 5.83b 0.17 0.031 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Villus height (μm)  Jejunum 1545.68b 1314.12a 1498.97b 1526.30b 45.36 0.037  Ileum 900.31b 762.13a 854.35b 898.69b 25.37 0.020 Crypt depth (μm)  Jejunum 181.82 200.34 183.27 180.37 5.87 0.219  Ileum 153.78a 178.92b 160.49a 154.03a 6.60 0.042 Villus height:crypt depth  Jejunum 8.50b 6.56a 8.18b 8.46b 0.27 0.047  Ileum 5.85b 4.26a 5.32b 5.83b 0.17 0.031 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a,bMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large Table 3. Effects of Gln on the morphology of the intestinal tissues of broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Villus height (μm)  Jejunum 1545.68b 1314.12a 1498.97b 1526.30b 45.36 0.037  Ileum 900.31b 762.13a 854.35b 898.69b 25.37 0.020 Crypt depth (μm)  Jejunum 181.82 200.34 183.27 180.37 5.87 0.219  Ileum 153.78a 178.92b 160.49a 154.03a 6.60 0.042 Villus height:crypt depth  Jejunum 8.50b 6.56a 8.18b 8.46b 0.27 0.047  Ileum 5.85b 4.26a 5.32b 5.83b 0.17 0.031 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Villus height (μm)  Jejunum 1545.68b 1314.12a 1498.97b 1526.30b 45.36 0.037  Ileum 900.31b 762.13a 854.35b 898.69b 25.37 0.020 Crypt depth (μm)  Jejunum 181.82 200.34 183.27 180.37 5.87 0.219  Ileum 153.78a 178.92b 160.49a 154.03a 6.60 0.042 Villus height:crypt depth  Jejunum 8.50b 6.56a 8.18b 8.46b 0.27 0.047  Ileum 5.85b 4.26a 5.32b 5.83b 0.17 0.031 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a,bMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large D-Lactic Acid and Diamine Oxidase (DAO) Activity in Serum The results regarding the effects of Gln on the serum DAO activity of broilers under heat stress are presented in Table 4. D-lactate and DAO activity in serum was higher (P < 0.05) in the HT group than in that of the NS and Gln groups. Diets supplemented with Gln significantly decreased the serum D-lactic acid and DAO activity (P < 0.05) of broilers exposed to heat stress. However, no differences were observed between the Gln groups and NS group (P > 0.05). Table 4. Effects of Gln on the serum DAO activity of broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 D-Lac (μmol/mL) 1.95a 3.73c 3.04b 2.91b 0.37 0.031 DAO (ng/mL) 43.15a 76.28c 60.37b 59.20b 6.01 0.042 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 D-Lac (μmol/mL) 1.95a 3.73c 3.04b 2.91b 0.37 0.031 DAO (ng/mL) 43.15a 76.28c 60.37b 59.20b 6.01 0.042 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large Table 4. Effects of Gln on the serum DAO activity of broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 D-Lac (μmol/mL) 1.95a 3.73c 3.04b 2.91b 0.37 0.031 DAO (ng/mL) 43.15a 76.28c 60.37b 59.20b 6.01 0.042 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 D-Lac (μmol/mL) 1.95a 3.73c 3.04b 2.91b 0.37 0.031 DAO (ng/mL) 43.15a 76.28c 60.37b 59.20b 6.01 0.042 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large sICAM-1 Concentration in Serum and Intestinal Mucosa The results regarding the effects of Gln on the sICAM-1 concentration of broilers under heat stress are presented in Table 5. Heat stress significantly increased the sICAM-1 concentrations in the jejunum, ileum, and serum of broilers in the HT group as compared to those in the NS group (P < 0.05). Broilers fed with Gln had lower sICAM-1 concentrations in the jejunum, ileum, and serum than those in the heat-stressed broilers (P < 0.05). However, no differences were observed between the Gln groups and NS group (P > 0.05). Table 5. Effects of Gln on the sICAM-1 activity of the intestinal mucosa in broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Serum (μg/mL) 106.32a 207.75c 146.34b 140.12b 62.13 0.034 Jejunum (ng/g prot) 1.32a 1.67b 1.38a 1.31a 0.24 0.041 Ileum (ng/g prot) 1.25a 1.51b 1.28a 1.26a 0.20 0.039 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Serum (μg/mL) 106.32a 207.75c 146.34b 140.12b 62.13 0.034 Jejunum (ng/g prot) 1.32a 1.67b 1.38a 1.31a 0.24 0.041 Ileum (ng/g prot) 1.25a 1.51b 1.28a 1.26a 0.20 0.039 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large Table 5. Effects of Gln on the sICAM-1 activity of the intestinal mucosa in broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Serum (μg/mL) 106.32a 207.75c 146.34b 140.12b 62.13 0.034 Jejunum (ng/g prot) 1.32a 1.67b 1.38a 1.31a 0.24 0.041 Ileum (ng/g prot) 1.25a 1.51b 1.28a 1.26a 0.20 0.039 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Serum (μg/mL) 106.32a 207.75c 146.34b 140.12b 62.13 0.034 Jejunum (ng/g prot) 1.32a 1.67b 1.38a 1.31a 0.24 0.041 Ileum (ng/g prot) 1.25a 1.51b 1.28a 1.26a 0.20 0.039 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large Cytokine Levels The results regarding the effects of Gln on the intestinal cytokine levels of broilers under heat stress are presented in Table 6. The broilers in the HT group exhibited significantly higher intestinal mucosal TNF-α and TNF-α/IL-10 levels, but lower IL-10 levels than those of the NS group (P < 0.05). Dietary supplementation of Gln ameliorated the decrease of TNF-α and TNF-α/IL-10 levels, as well as the increase of IL-10 levels in the intestinal mucosa of the heat-stressed broilers (P < 0.05). No differences were found in the TNF-α, TNF-α/IL-10, and IL-10 levels in the intestinal mucosa among treatments (P > 0.05). Table 6. Effects of Gln on the intestinal cytokines levels in broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum TNF-α (ng/mg prot) 100.17a 201.43b 112.75a 104.61a 42.75 0.034 IL-10 (ng/mg prot) 280.34b 215.67a 309.12c 324.75c 20.01 0.039 TNF-α/IL-10 0.36a 0.93b 0.36a 0.32a 0.11 0.010 Ileum TNF-α (ng/L) 87.61a 162.59b 96.19a 90.47a 31.08 0.021 IL-10 (ng/mg prot) 239.61b 210.46a 309.07c 321.42c 22.34 0.028 TNF-α/IL-10 0.26a 0.77b 0.31a 0.28a 0.09 0.014 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum TNF-α (ng/mg prot) 100.17a 201.43b 112.75a 104.61a 42.75 0.034 IL-10 (ng/mg prot) 280.34b 215.67a 309.12c 324.75c 20.01 0.039 TNF-α/IL-10 0.36a 0.93b 0.36a 0.32a 0.11 0.010 Ileum TNF-α (ng/L) 87.61a 162.59b 96.19a 90.47a 31.08 0.021 IL-10 (ng/mg prot) 239.61b 210.46a 309.07c 321.42c 22.34 0.028 TNF-α/IL-10 0.26a 0.77b 0.31a 0.28a 0.09 0.014 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large Table 6. Effects of Gln on the intestinal cytokines levels in broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum TNF-α (ng/mg prot) 100.17a 201.43b 112.75a 104.61a 42.75 0.034 IL-10 (ng/mg prot) 280.34b 215.67a 309.12c 324.75c 20.01 0.039 TNF-α/IL-10 0.36a 0.93b 0.36a 0.32a 0.11 0.010 Ileum TNF-α (ng/L) 87.61a 162.59b 96.19a 90.47a 31.08 0.021 IL-10 (ng/mg prot) 239.61b 210.46a 309.07c 321.42c 22.34 0.028 TNF-α/IL-10 0.26a 0.77b 0.31a 0.28a 0.09 0.014 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum TNF-α (ng/mg prot) 100.17a 201.43b 112.75a 104.61a 42.75 0.034 IL-10 (ng/mg prot) 280.34b 215.67a 309.12c 324.75c 20.01 0.039 TNF-α/IL-10 0.36a 0.93b 0.36a 0.32a 0.11 0.010 Ileum TNF-α (ng/L) 87.61a 162.59b 96.19a 90.47a 31.08 0.021 IL-10 (ng/mg prot) 239.61b 210.46a 309.07c 321.42c 22.34 0.028 TNF-α/IL-10 0.26a 0.77b 0.31a 0.28a 0.09 0.014 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); n = 8. View Large TJP mRNA Expression Levels in Jejunum and Ileum The results regarding the effects of Gln on the TJP of broilers under heat stress are presented in Table 7. Heat stress resulted in significant mRNA down-regulation of occludin, claudin-1, and ZO-1 in both jejunum and ileum as compared to those in the control chickens (P < 0.05). Broilers in the Gln group had higher ZO-1, claudin-1, and occludin mRNA expression levels in the jejunum and ileum as compared to the HT group (P < 0.05). However, no differences were observed in the Gln1 and Gln2 groups compared with the NS group (P > 0.05). Additionally, in general, the induction of the heat stress response observed by the expression of ZO-1, claudin-1, and occludin was lower in the chicken ileum in comparison with the jejunum. Table 7. Effects of Gln on the mRNA expression of the tight junction protein in intestinal tissue of broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum  ZO-1 1.92b 1.25a 1.83b 1.88b 0.32 0.021  Claudin-1 1.27b 0.68a 1.21b 1.26b 0.28 0.034  Occludin 1.35a 0.45b 1.27a 1.34a 0.47 0.017 Ileum  ZO-1 0.71c 0.12a 0.39b 0.40b 0.20 0.025  Claudin-1 0.94b 0.35a 0.82b 0.88b 0.37 0.037  Occludin 1.23c 0.37a 0.75b 0.80b 0.25 0.013 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum  ZO-1 1.92b 1.25a 1.83b 1.88b 0.32 0.021  Claudin-1 1.27b 0.68a 1.21b 1.26b 0.28 0.034  Occludin 1.35a 0.45b 1.27a 1.34a 0.47 0.017 Ileum  ZO-1 0.71c 0.12a 0.39b 0.40b 0.20 0.025  Claudin-1 0.94b 0.35a 0.82b 0.88b 0.37 0.037  Occludin 1.23c 0.37a 0.75b 0.80b 0.25 0.013 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); values are expressed in arbitrary units. The mRNA level of each target gene for the NS group is assigned a value of 1 and normalized against β-actin. n = 8. View Large Table 7. Effects of Gln on the mRNA expression of the tight junction protein in intestinal tissue of broilers under heat stress. Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum  ZO-1 1.92b 1.25a 1.83b 1.88b 0.32 0.021  Claudin-1 1.27b 0.68a 1.21b 1.26b 0.28 0.034  Occludin 1.35a 0.45b 1.27a 1.34a 0.47 0.017 Ileum  ZO-1 0.71c 0.12a 0.39b 0.40b 0.20 0.025  Claudin-1 0.94b 0.35a 0.82b 0.88b 0.37 0.037  Occludin 1.23c 0.37a 0.75b 0.80b 0.25 0.013 Diet treatments1 Items NS HT G1 G2 SEM2 P-value3 Jejunum  ZO-1 1.92b 1.25a 1.83b 1.88b 0.32 0.021  Claudin-1 1.27b 0.68a 1.21b 1.26b 0.28 0.034  Occludin 1.35a 0.45b 1.27a 1.34a 0.47 0.017 Ileum  ZO-1 0.71c 0.12a 0.39b 0.40b 0.20 0.025  Claudin-1 0.94b 0.35a 0.82b 0.88b 0.37 0.037  Occludin 1.23c 0.37a 0.75b 0.80b 0.25 0.013 1NS = birds were kept at 22 ± 1°C and fed the basal diets; HT = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet; G1 and G2 groups = birds were kept at 33 ± 1°C for 10 h (08:00 to 18:00 h) and 22 ± 1°C for the remaining time and fed the basal diet with 0.5 and 1.0% Gln, respectively. 2Standard error of the mean based on pooled estimate of variation. 3a–cMeans within the same row that do not share a common superscript are significantly different (P < 0.05); values are expressed in arbitrary units. The mRNA level of each target gene for the NS group is assigned a value of 1 and normalized against β-actin. n = 8. View Large DISCUSSION The intestinal tract is considered one of the main target organs and is particularly susceptible to stressors. Heat stress can imitate epithelial surface receptors for pathogen binding and result in reduction in villus height and crypt depth, thus damaging the integrity of the gut epithelial tissue (Burkholder et al., 2008). In the present study, apparent damage to villi, shortened villus height, deeper crypt depth, and a lower villus height:crypt depth ratio were observed in heat-stressed broilers, which is consistent with the findings of Song et al. (2013) in heat stress. It is likely that high environmental temperature reduces the feed intake of the birds, thus greatly reducing the amounts of energy delivered to the gastrointestinal tract cells during periods of heat stress. Moreover, low feed intake will reduce the absorptive area of the intestinal mucosa and limit the secretion of digestive enzymes (Porto et al., 2015). These factors may delay intestinal mucosal development, resulting in the observation of shorter villi, lower villus height:crypt depth ratio and greater crypt depth. Some studies showed that Gln has important functional roles in the promotion of mucosal growth and protein synthesis in the intestine (Porto et al., 2015). Glutamine provides sufficient energy for cell proliferation and differentiation. It should be noted that we observed an increase in villus height and villus height:crypt depth ratio in heat-stressed broilers supplemented with Gln in the present study. This result agrees with Porto et al. (2015), who reported that supplementation of Gln promotes epithelial cell proliferation and renewal, increases villus height, and limits the damage to the intestinal epithelium elicited by heat stress in broilers. It has been shown that addition of 1% Gln to broiler diets presented positive effect on villus height, crypt depth, and the villus:crypt in different segments of the small intestine under normal temperature conditions (Murakami et al., 2007). The benefit of Gln is associated with its involvement in increasing intestinal cell proliferation, as it is the main energy source of small intestinal enterocytes (Akiba et al., 2009). On the other hand, these results could be attributed to better nutrient absorption and its nutritive importance for villus growth. Because Gln is an important amino acid for utilization as an energy source for the development of the mucosa and maintains the normal intestinal structure and increases transcellular transport (Farhad, et al., 2014), these may increase the absorptive surface of the gastrointestinal mucosa, and improve the digestion and absorption of nutrients during stress (Murakami et al., 2007; Xiao et al., 2014). Even though Gln increases the villus lengths, it did not increase the BWG (d 22 to 41) of broilers in our unpublished study; these results are in agreement with Maiorka et al. (2000). The present study is probably related to the role of Gln in ammoniagenesis and the production of high ammonium ions in Gln-fed birds (Farhad, et al., 2014). The activity of the plasma D-lactic acid and DAO might serve as a marker of intestinal mucosal barrier integrity and injury (Gordon et al., 1983). Plasma D-lactic acid and DAO activity increase in the broiler when the intestinal mucosa is injured (Wu et al., 2013). Our present results also confirm the results of other investigators (Wu et al., 2013; Song et al., 2017). These results showed that damage to a certain degree existed in the intestinal mucosa of the HT broiler, and the intestinal permeability increased. Our intestinal morphology findings further verified that the vascular release of D-lactic acid and DAO as a result of heat stress must involve the villus tip cells or the mucosal surface as these are the prime sources of the enzyme. Therefore, levels of plasma D-lactic acid and DAO activity may be one factor associated with the severity and extent of the intestinal mucosa injury in broilers. It was observed in our present study that feeding Gln decreased D-lactic acid and DAO activity in the plasma of heat-stressed birds. These results indicated that the intestinal mucosal permeability had somewhat improved. Therefore, Gln may attenuate enzyme release from the villus tip cells or the intestinal mucosa, and result in improvement in intestinal permeability under heat stress conditions. These results indicate that Gln could abate the degree of intestinal injury, lessen intestinal mucosal permeability, and increase intestinal mucosa protection. Soluble intercellular adhesion molecule-1 belongs to the immunoglobulin superfamily, is a biomarker for the degree of systemic inflammatory responses and is a target on intestinal epithelial cells (Zhang et al., 2015). Soluble intercellular adhesion molecule-1 levels have been reported to increase significantly after experiencing physiological stress in a normal setting (Vonkänel et al., 2007). In our study, heat stress-induced sICAM-1 increase was achieved in the inflammatory intestinal mucosa of broilers with HT and was related to the concentration of sICAM-1 in the serum; this outcome agrees with previous studies showing increased sICAM-1 levels after other physiological stress (Wu et al., 2013). This corroboration verified that the sICAM-1 level was clearly related to the condition of the animal body. This result may indicate that greater physiological stress and subsequent pro-inflammatory cytokines lead to increased release of sICAM-1 from endothelial cells. These results were also supported in the cytokine levels of broilers in our study. In the present heat stress broiler study, Gln treatment has been shown to inhibit sICAM-1 release when compared to HT alone, which may be due to the inhibition of pro-inflammatory cytokines, such as TNF-α. Data from this study suggest that the anti-inflammatory effects are, at least in part, due to the inhibition of TNF-α release. T-helper cells can be divided into T helper 1 (Th1) and T helper 2 (Th2) subsets according to their cytokine production. Th1 cells induce the secretion of the pro-inflammatory cytokine TNF-α (Huang et al., 2015), whereas Th2 cells induce the secretion of the anti-inflammatory cytokine IL-10 (Lv et al., 2015). Tumor necrosis factor-α is an important inflammatory factor that plays important roles in various inflammatory reactions. It is well known that IL-10, a potent anti-inflammatory cytokine, inhibits the production of the major pro-inflammatory cytokines, and attenuates cell-mediated immune reactions (Moore et al., 1993). Our findings showed that stimulated cells in the inflamed mucosa markedly decreased the concentrations of Th2 cytokines (IL-10) but elevated the levels of Th1 cytokines (TNF-α) under heat stress. Thus, the effect on Th1 cells is opposite that on Th2 cells. This result likely increases the susceptibility of broilers to heat stress. Stress-induced bowel inflammation might have released pro-inflammatory mediators from the gut mucosa, such as IL-1, TNF-α, and IL-6, as has been reported elsewhere in a different experimental context (Gautier et al., 2012). Increased inflammatory cytokines in broilers subjected to heat stress has been reported (Quinteiro-Filho et al., 2010). Our result also showed that heat stress increased inflammatory cytokines, specifically, the release of TNF-α in the jejunum and ileum of broilers; this result agrees with previous reports (DeNardo and Coussens, 2007). Moreover, in our study, the levels of the anti-inflammatory cytokine IL-10 were also significantly different. These results suggest that HT can regulate the activation of inflammatory cells and cytokine production. This data showed that the intestinal mucosa and villi of the broilers were seriously injured by the HT, which was verified in the findings regarding the villus height, deeper crypt depth, and villus height:crypt depth ratio. A previous study reported that Gln reduced the concentration of various pro-inflammatory cytokines, and increased the concentration of various anti-inflammatory cytokines, in the intestinal mucosa of broilers challenged with stress (Zhong et al., 2014). Our results were consistent with the above reports. The findings suggest that both Th1 and Th2 responses were inhibited by Gln and that Gln plays a beneficial role in alleviating the intestinal inflammatory response. We conclude that it is conceivable that Gln may contribute to preventing the development of inflammatory responses. Bartell and Batal (2007) reported decreased cytokine production in broilers fed 1% Gln and had better gut barrier function under normal temperature conditions. In the normal conditions, Lai et al. (2004) showed that Gln administration reduced the production of inflammatory mediators systemically, and enhanced cellular immunity in rats. Moreover, normal intestinal structure and immune function may be helpful for maintaining normal cytokine levels (Deng et al., 2012). Some reports have shown that Gln is an important factor in maintaining intestinal mucosal structure (Xu et al., 2014). In the current study, supplementation with Gln may be effective in protecting the intestinal mucosa of broilers and increasing the villus height of the intestine. Thus, we conclude that Gln can simultaneously inhibit cellular immunity. The underlying mechanism involved in the beneficial influence of Gln on the intestinal inflammatory response needs to be further investigated. Intestinal TJP, such as claudin, ZO, and occludin, were directly related to the normal function of the intestinal mucosa barrier. The abnormal expression of TJP is closely related to the inflammatory responses of the intestine (Xu et al., 2016). Many cytokines are involved in the regulation of TJP. According to the results of this study, the expression of ZO-1, claudin-1, and occludin for broilers in the HT group were all significantly lower than those in the control group, which indicated that the abnormal expression of TJP was the main mechanism causing reduced function of the intestinal mucosal barrier, as well as increased intestinal permeability. These results agreed with previous findings, in which HT decreased protein levels of ZO-1, claudin-1, and occludin in the small intestine (Song et al., 2017). After treatment with Gln, the expression of TJP in the epithelium was increased, which indicated that the TJP played an important role in the pathogenesis of inflammatory responses under heat stress. Similarly, Wang et al. (2015) also observed that Gln improved intestinal barrier integrity, leading to enhanced transepithelial electrical resistance in weanling piglets. These results were attributed to Gln as a truly functional amino acid in nutrition, and broilers have dietary requirements of this nutrient to support intestinal health and development (Wu 2013). Our results indicate that Gln supplementation can regulate TJP expression in the small intestine of broilers, thereby conferring a beneficial effect on mucosal barrier function, and can be a promising approach for protecting the intestinal barrier in broilers. Moreover, in the present study, the induction of heat stress response observed by the expression of ZO-1, claudin-1, and occludin was lower in the chicken ileum in comparison with the jejunum. The mechanisms of the differences are not clarified in the present study. However, 4 explanations may account for the differences. One possibility is different characteristics of jejunum and ileum (Kitazawa et al., 1997), a second is different susceptibility to heat stress treatment between the jejunum and ileum (Varasteh et al., 2015), and a third is the different contractile mechanism coupled to motilin receptors between the jejunum and ileum (Van der Hoeven-Hangoor et al., 2013), and a fourth is the different microbiota composition between the jejunum and ileum (Sohail et al., 2012). These findings are consistent with a study result Varasteh et al. (2015), in which differences in the mRNA expression of the TJ proteins claudin and ZO-1 between tissue-specific differences during heat stress treatment are described. However, it is unknown how heat stress and Gln regulate the expression or function of the ZO-1, claudin-1, and occludin proteins. Therefore, to further examine the regulation of TJP by Gln, further studies will be needed to clarify the molecular mechanisms regulating Gln-induced intestinal cell migration via alteration of the organization of TJP using genetic manipulation technologies. CONCLUSION In summary, heat stress may delay intestinal mucosa and barrier development, adjust the functions of cell cytokine factor mRNA expression, and reduce the mRNA expression of ZO-1, claudin-1, and occludin proteins. Intestinal epithelial barrier function and the cytokines secretion are regulated by TJP, and Gln plays an important role in inflammatory responses in the intestinal mucosa. Therefore, study of the role of Gln in regulating TJP will be of continuing value in efforts to understand the mechanisms of the repair of injured intestinal mucosa. Acknowledgements The authors express special thanks to Shao Yang Zhi, Sai Wu Zhang, Ping Ping Han, and Sheng Nan Ren for skillful technical assistance with this research. Notes This research was supported by a project supported by the National Natural Science Foundation of China (Grant No. 31601971). REFERENCES Akiba Y. , Watanabe C. , Mizumori M. , Kaunitz J. D. . 2009 . Luminal L-glutamate enhances duodenal mucosal defense mechanisms via multiple glutamate receptors in rats . Am. J. Physiol. Gastrointest. Liver. Physiol . 297 : G781 – G791 . Google Scholar CrossRef Search ADS PubMed Bartell S. M. , Batal A. B. . 2007 . The effect of supplemental glutamine on growth performance, development of the gastrointestinal tract, and humoral immune response of broilers . Poult. Sci. 86 : 1940 – 1947 . Google Scholar CrossRef Search ADS PubMed Burkholder K. M. , Thompson K. L. , Einstein M. E. , Applegate T. J. , Patterson J. A. . 2008 . Influence of stressors on normal intestinal microbiota, intestinal morphology, and susceptibility to salmonella enteritidis colonization in broilers . Poult. Sci. 87 : 1734 – 1741 . Google Scholar CrossRef Search ADS PubMed DeNardo D. G. , Coussens L. M. . 2007 . Inflammation and breast cancer. Balancing immune response: Crosstalk between adaptive and innate immune cells during breast cancer progression . Breast. Cancer. Res . 9 : 212 . Google Scholar CrossRef Search ADS PubMed Deng W. , Dong X. F. , Tong J. M. , Zhang Q. . 2012 . The probiotic Bacillus licheniformis ameliorates heat stress-induced impairment of egg production, gut morphology, and intestinal mucosal immunity in laying hens . Poult. Sci. 91 : 575 – 582 . Google Scholar CrossRef Search ADS PubMed Farhad J. , Parviz F. , Mohsen D. , Gholamreza N. . 2014 . The effects of dietary glutamine supplementation on growth performance and intestinal morphology of broiler chickens reared under hot conditions . Turk. J. Vet. Anim. Sci . 38 : 264 – 270 . Google Scholar CrossRef Search ADS Gautier E. L. , Shay T. , Miller J. . 2012 . Gene-expression profiles and transcriptional regulatory pathways that underlie the identity and diversity of mouse tissue macrophages . Nat. Immunol . 13 : 1118 – 1128 . Google Scholar CrossRef Search ADS PubMed Gordon D. L. , Theodore M. B. , Stephen B. . 1983 . Plasma postheparin diamine oxidase. Sensitive provocative test for quantitating length of acute intestinal mucosal injury in the rat. J. Clin. Invest. 71 : 1308 – 1315 . Google Scholar CrossRef Search ADS PubMed Huang B. X. , Xu S. Y. , Yang D. X. , Zeng Y. L. , Liu D. F. , Wang W. . 2015 . Mycophenolate mofetil modulates differentiation of Th1/Th2 and the secretion of cytokines in an active Crohn's disease mouse model . Int. J. Mol. Sci . 16 : 26654 – 26666 . Google Scholar CrossRef Search ADS PubMed Kitazawa T. , Taneike T. , Ohga A. . 1997 . Functional characterization of neural and smooth muscle motilin receptors in the chicken proventriculus and ileum . Regul. Pept. 71 : 87 – 95 . Google Scholar CrossRef Search ADS PubMed Lai Y. N. , Yeh S. L. , Lin M. T. , Shang H. F. , Yeh C. L. , Chen W. J. . 2004 . Glutamine supplementation enhances mucosal immunity in rats with gut-derived sepsis . Nutrition 20 : 286 – 291 . Google Scholar CrossRef Search ADS PubMed Li N. , Neu J. . 2009 . Glutamine deprivation alters intestinal tight junctions via a PI3-K/Akt mediated pathway in Caco-2 cells/Akt mediated pathway in Caco-2 cells . J. Nutr . 139 : 710 – 714 . Google Scholar CrossRef Search ADS PubMed Lin X. J. , Mei G. P. , Liu J. , Li Y. L. , Zuo D. , Liu S. J. , Zhao T. B. , Lin M. T. . 2011 . Therapeutic effects of melatonin on heatstroke-induced multiple organ dysfunction syndrome in rats . J. Pineal. Res . 50 : 436 – 444 . Google Scholar CrossRef Search ADS PubMed Marchini C. F. P. , Café M. B. , Araùjo E. G. , Nascimento M. R. B. M. . 2016 . Physiology, cell dynamics of small intestinal mucosa, and performance of broiler chickens under heat stress: A review . Rev. Colomb Cienc. Pecu . 29 : 159 – 168 . Google Scholar CrossRef Search ADS Maiorka A. , Silva A. V. F. , Santin E. , Borges S. A. , Boleli I. C. , Macari M. . 2000 . Influência da suplementação de glutamina sobre o desempenho e o desenvolvimento de vilos e criptas do intestino delgado de frangos . Arq. Bras. Med. Vet. Zootec. 52 : 487 – 490 ( in Portuguese ). Google Scholar CrossRef Search ADS Murakami A. E. , Sakamoto M. I. , Natali M. R. M. , Souza L. M. G. , Franco J. R. G. . 2007 . Supplementation of glutamine and vitamin E on the morphometry of the intestinal mucosa in broiler chickens . Poult. Sci. 86 : 488 – 495 . Google Scholar CrossRef Search ADS PubMed Moeser A. J. , Ryan K. A. , Nighot P. K. , Blikslager A. T. . 2007 . Gastrointestinal dysfunction induced by early weaning is attenuated by delayed weaning and mast cell blockade in pigs . Am. J. Physiol . 293 : 413 – 421 . Moore K. W. , O’Garra A. , Malefyt R. W. , Vieira A. P. , Mosmann T. R. . 1993 . Interleukin-10 . Annu. Rev. Immunol. 11 : 165 – 190 . Google Scholar CrossRef Search ADS PubMed Nan L. , Patricia L. , Don S. , Kellym L. , Josef N. . 2004 . Glutamine regulates Caco-2 cell tight junction proteins . Am. J. Physiol-Gastr. L . 287 : G726 – G733 . Nasu Y , Ido A. , Tanoue S. , Hashimoto S. , Sasaki F. , Kanmura S. , Setoyama H. , Numata M. , Funakawa K. , Moriuchi A. , Fujita H. , Sakiyama T. , Uto H. , Oketani M. , Tsubouchi H. . 2013 . Hepatocyte growth factor stimulates the migration of gastric epithelial cells by altering the subcellular localization of the tight junction protein ZO-1 . J. Gastroenterol. 48 : 193 – 202 . Google Scholar CrossRef Search ADS PubMed National Research Council . 1994 . Nutrient Requirements of Poultry . Acad. Press , Washington, DC . Lv H. , Ren H. , Wang L. , Chen W. , Ci X. . 2015 . Lico A enhances Nrf2-Mediated defense mechanisms against t-BHP-induced oxidative stress and cell death via Akt and ERK activation in RAW 264.7 cells . Oxid. Med. Cell. Longev. 2015 : 709 – 845 . Google Scholar CrossRef Search ADS Porto M. L. , Givisiez P. E. N. , Saraiva E. P. , Costa F. G. P. , Filho A. L. B. M. , Andrade M. F. S. , Brandão P. A. , Guerra R. R. . 2015 . Glutamic acid improves body weight gain and intestinal morphology of broiler chickens submitted to heat stress . Braz. J. of Poultry. Sci . 17 : 355 – 362 . Google Scholar CrossRef Search ADS Quinteiro-Filho W. M. , Ribeiro A. , Ferraz-de-Paula V. , Pinheiro M. L. , Sakai M. , Sá L. R. M. . 2010 . Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens . Poult. Sci. 89 : 1905 – 1914 . Google Scholar CrossRef Search ADS PubMed Sohail M. U. , Hume M. E. , Byrd J. A. , Nisbet D. J. , Ijaz A. , Sohail A. , Shabbir M. Z. , Rehman H. . 2012 . Effect of supplementation of prebiotic mannan-oligosaccharides and probiotic mixture on growth performance of broilers subjected to chronic heat stress . Poult. Sci. 91 : 2235 – 2240 . Google Scholar CrossRef Search ADS PubMed Song J. , Jiao L. F. , Xiao K. , Luan Z. S. , Hu C. H. , Shi B. , Zhan X. A. . 2013 . Cello-oligosaccharide ameliorates heat stress-induced impairment of intestinal microflora, morphology and barrier integrity in broilers . Anim. Feed Sci. Technol. 185 : 175 – 181 . Google Scholar CrossRef Search ADS Song Z. H. , Cheng K. , Zhang L. L. , T. Wang . 2017 . Dietary supplementation of enzymatically treated Artemisia annua could alleviate the intestinal inflammatory response in heat-stressed broilers . J. Therm. Biol . 69 : 184 – 190 . Google Scholar CrossRef Search ADS PubMed Uni Z. , Geyra A. , Ben-Hur H. . 2000 . Small intestinal development in the young chick: Crypt formation and enterocyte proliferation and migration . Br. Poult. Sci. 41 : 544 – 551 . Google Scholar CrossRef Search ADS PubMed Van der Hoeven-Hangoor E. , van der Vossen J. M. B. M. , Schuren F. H. J. , Verstegen M. W. A. , de Oliveira J. E. , Montijn R. C. , Hendriks W. H. . 2013 . Ileal microbiota composition of broilers fed various commercial diet compositions . Poult. Sci. 92 : 2713 – 2723 . Google Scholar CrossRef Search ADS PubMed Varasteh S. , Braber S. , Akbari P. , Garssen J. , Fink-Gremmels J. . 2015 . Differences in susceptibility to heat stress along the chicken intestine and the protective effects of galacto-oligosaccharides . PLoS. One. 10 : e0138975 . Google Scholar CrossRef Search ADS PubMed Vonkänel R. , Preckel D. , Kudielka B. M. , Fischer J. E. . 2007 . Responsiveness and habituation of soluble ICAM-1 to acute psychosocial stress in men: Determinants and effect of stress-hemoconcentration . Physiol. Res . 56 : 627 – 639 . Google Scholar PubMed Wang H. , Zhang C. , Wu G. Y. , Sun Y. L. , Wang B. , He B. B. , Dai Z. L. , Wu Z. L. . 2015 . Glutamine enhances tight junction protein expression and modulates corticotropin-releasing factor signaling in the jejunum of weanling piglets . J. Nutr . 145 : 25 – 31 . Google Scholar CrossRef Search ADS PubMed Wu G. 2013 . Functional amino acids in nutrition and health . Amino Acids . 45 : 407 – 411 . Google Scholar CrossRef Search ADS PubMed Wu Q. J. , Zhou Y. M. , Wu Y. N. , Zhang L. L. , Wang T. . 2013 . The effects of natural and modified clinoptilolite on intestinal barrier function and immune response to LPS in broiler chickens . Vet. Immunol. Immunopathol. 153 : 70 – 76 . Google Scholar CrossRef Search ADS PubMed Xiao W. , Feng Y. , Holst J. J. , Hartmann B. , Yang H. , Teitelbaum D. H. . 2014 . Glutamate prevents intestinal atrophy via luminal nutrient sensing in a mouse model of total parenteral nutrition . FASEB J. 28 : 2073 – 2087 . Google Scholar CrossRef Search ADS PubMed Xu C. L. , Sun R. , Qiao X. J. , Xu C. C. , Shang X. Y. , Niu W. N. . 2014 . Protective effect of glutamine on intestinal injury and bacterial community in rats exposed to hypobaric hypoxia environment . World. J. Gastroenterol . 20 : 4662 – 4674 . Google Scholar CrossRef Search ADS PubMed Xu C. M. , Li X. M. , Qin B. Z. , Liu B. . 2016 . Effect of tight junction protein of intestinal epithelium and permeability of colonic mucosa in pathogenesis of injured colonic barrier during chronic recovery stage of rats with inflammatory bowel disease . Asian. Pac. J. Trop. Med . 9 : 148 – 152 . Google Scholar CrossRef Search ADS PubMed Zhang S. Y. , Kuang Z. Z. , Zhang X. K. . 2015 . Effects of simulated heat waves with strong sudden cooling weather on ApoE Knockout Mice . Inter. J. Env. Res. Pub. Heal . 12 : 5743 – 5757 . Google Scholar CrossRef Search ADS Zhong L. , Zhang X. , Covasa M. . 2014 . Emerging roles of lactic acid bacteria in protection against colorectal cancer . World. J. Gastroenterol . 20 : 7878 – 7886 . Google Scholar CrossRef Search ADS PubMed Zuo J. J. , Guo A. H. , Yan X. Y. , Xu M. , Xia W. G. , Feng D. Y. . 2014 . Supplementation of β-mannanase in diet with energy adjustmention affect performance, intestinal morphology and tight junction proteins mRNA expression in broiler chickens . J. Anim. American Control Conference-acc. 2014 : 4810 – 4815 . © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Poultry ScienceOxford University Press

Published: Jul 11, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off