Genetic correlates of clarithromycin susceptibility among isolates of the Mycobacterium abscessus group and the potential clinical applicability of a PCR-based analysis of erm(41)

Genetic correlates of clarithromycin susceptibility among isolates of the Mycobacterium abscessus... Abstract Objectives To define the genetic basis of clarithromycin resistance among isolates of the Mycobacterium abscessus group (MAG). Methods We analysed 133 isolates identified as MAG. Species identification was confirmed by sequencing the rpoB gene. Clarithromycin susceptibility testing was performed according to CLSI recommendations, with an extended 14 day incubation. Known resistance genotypes of erm(41) and rrl were identified by sequencing; the presence of deletions in erm(41) was detected by PCR. Results The 133 MAG isolates included 82 M. abscessus, 27 Mycobacterium massiliense and 24 Mycobacterium bolletii. After the 3 day incubation, only five isolates demonstrated clarithromycin resistance (R); after 14 days of extended incubation, an additional 92 exhibited inducible resistance (IR), with the remaining being susceptible (S). The distribution of susceptibility phenotypes varied among the species. Among M. abscessus isolates, 11% were S, 84% IR and 5% R; among M. bolletii isolates, 96% were IR and 4% R; and among M. massiliense isolates 100% were S. Sequencing of rrl identified only a single isolate with the A2058G mutation. Deletions in erm(41) were present in 30 susceptible isolates; among the remaining 103 isolates, 97 were R or IR (sensitivity, 83%; specificity, 100%; positive predictive value, 100%; negative predictive value, 94%). Among the six susceptible isolates without deletions, all carried the erm(41) T28C point mutation. Conclusions A significant proportion of MAG isolates demonstrate inducible resistance to clarithromycin that is only detectable with an extended 14 day incubation. Further, the majority of clarithromycin-susceptible MAG isolates have characteristic deletions in erm(41) that can rapidly and reliably be detected by a simple PCR. Introduction Isolates of the Mycobacterium abscessus group (MAG) are the most common rapidly growing mycobacteria isolated from patients with pulmonary infection. These environmental organisms are often opportunistic pathogens and have been associated with nosocomial infections, including outbreaks.1–8 Species classification of MAG isolates remains a controversial issue owing to considerable similarity between Mycobacterium bolletii and Mycobacterium massiliense. Based on DNA-DNA hybridization studies, Leão et al.9,10 have proposed that MAG be classified as a single species with two subspecies: M. abscessus subsp. abscessus and M. abscessus subsp. bolletii, the latter including both M. bolletii and M. massiliense. Other studies applying whole-genome analysis support the separation into three distinct species.11–14 Recently, Tortoli et al.15 proposed that the species M. abscessus encompasses M. abscessus subsp. abscessus, M. abscessus subsp. bolletii and a third subspecies named M. abscessus subsp. massiliense comb. nov. Treatment of MAG infections is complicated by the high frequency of antibiotic resistance among the isolates.16–18 Current guidelines identify clarithromycin and azithromycin as the primary agents used, but emphasize the need for multidrug treatment regimens to ensure effective therapy until susceptibility results are available.19 Clarithromycin resistance in MAG can be mediated by several mechanisms. The erm(41) gene, which is widely prevalent among MAG, transfers one or two methyl groups to an adenine in the peptidyl region of 23S rRNA, and thereby prevents clarithromycin binding.20–23 Two alterations of erm(41) are independently associated with reversion to clarithromycin susceptibility: a 274 bp deletion7and a T28C point mutation.8,24–28 The rrl gene encodes the 23S rRNA peptidyl transferase; the A2058G mutation in rrl confers high levels of resistance to clarithromycin.19–21 This study examined a collection of pulmonary MAG isolates for which species identification was resolved by rpoB sequencing; clarithromycin resistance phenotype was based on in vitro susceptibility testing with extended incubation; rrl and erm(41) genotypes were determined by sequence analysis; and the presence of deletions in erm(41) was assessed using PCR. Materials and methods Isolates Among 635 pulmonary isolates submitted to the Tuberculosis and Mycobacteriosis Branch of Adolfo Lutz Institute from January 2010 to December 2011 for species identification, 153 (24.1%) were classified as MAG by PRA-hsp65 typing.29 Of those, 134 were viable for analysis, including one isolate that by rpoB sequencing proved to be Mycobacterium porcinum, leaving 133 MAG isolates in the final study set. Species identification Definitive species identification was obtained by sequencing a fragment of the rpoB gene using Myco F (5′-GGCAAGGTCACCCCGAAGGG-3′) and Myco R (5′-AGCGGCTGCTGGGTGATCATC-3′) as primers.30 The sequences were analysed with the software BioNumerics version 7.1 (Applied Maths, TX, USA) and the BLAST tool (http://blast.ncbi.nlm.nih.gov) was used to determine similarity with the following reference strains: M. abscessus ATCC 19977 (GenBank accession number JF346872), M. bolletii CIP 108541 (AY859692.1) and M. massiliense CIP 108297 (JX041985.1). The species classification reported for each study isolate represents the highest similarity score with the indicated reference strain. For simplification, the species M. abscessus subsp. abscessus, M. abscessus subsp. bolletii and M. abscessus subsp. massiliense are referred to as M. abscessus, M. bolletii and M. massiliense, respectively. Clarithromycin susceptibility testing with resazurin The MIC test was performed according to CLSI31 recommendations, with clarithromycin concentrations from 0.5 to 64 mg/L and using Staphylococcus aureus ATCC 29213 as quality control. Replicate plates were prepared to provide readings after 3, 5, 7, 10 and 14 days of incubation, where 3 days represents the current standard recommendation and 14 days represents a proposed extended incubation.30 At each timepoint 30 μL of 0.01% resazurin was added to each well and the plate re-incubated overnight.32 A change in colour from blue (oxidized state) to pink (reduced) indicates bacterial growth. The MIC value was defined as the lowest drug concentration that prevented growth, and isolates were classified as susceptible (S; MIC ≤2 mg/L) or resistant (R; MIC >2 mg/L). Isolates that met the criteria for susceptibility on day 3, but were classified as resistant subsequently, are reported as ‘inducible resistance’ (IR).7,27,28 erm(41) and rrl gene sequencing The primers for amplifying rrl were SP1 (CCTGCACGAATGCGGTAACG) and SP2 (CACCAGAGGTTCGTCCGTC).7 The primers erm41f2 and erm41r2, described by Maurer et al.,7 were tested for amplification of the erm(41) gene. However, the amplified region did not contain the region where the mutation occurs. Consequently, the sequence to be amplified was analysed and the primer reverse was designed. The amplification and sequence analysis of erm(41) was performed using the following primers Forward (5′-GACCGGGGCCTTCTTCGTGAT-3′)7 and Reverse (5′-GGAGTTCGTTGTGGATCTGG-3′). The resulting product, which includes 114 bp of the N-terminal coding region covering the T28C mutation28 and the deletion at 64–65 bp,33 was sequenced for all isolates. Sequence data were analysed with BioNumerics version 7.1 (Applied Maths, Sint-Martens-Latem, Belgium), using M. abscessus MAB30 (GenBank accession number EU590129) as the reference sequence for erm(41), and M. abscessus (GenBank accession number NC_010397.1) for rrl. PCR analysis of erm(41) The entire erm(41) coding region was amplified using the protocol of Brown-Elliott et al.34 and primers ermF (5′-GACCGGGGCCTTCTTCGTGAT-3′) and ermR1 (5′-GACTTCCCCGCACCGATTCC-3′). The presence of the characteristic deletions in erm(41) (2 bp, nucleotides 64–65; 274 bp, nucleotides 159–432) was identified from the reduced size of the PCR product (expected, 673 bp; deletions present, 397 bp) and confirmed for selected isolates by sequencing the entire coding region. Results Identification Among the 133 MAG isolates in the study set, all 78 isolates designated M. abscessus type 1 by PRA-hsp65 typing were identified as M. abscessus. Of the 55 isolates of M. abscessus type 2, 27 were identified as M. massiliense, 24 as M. bolletii and 4 as M. abscessus. Clarithromycin susceptibility testing The proportion of isolates showing clarithromycin inducible resistance increased over the course of the extended incubation, with the sharpest increase observed between days 7 and 10 (Figure 1). At day 14, inducible resistance was similarly prevalent among isolates of both M. abscessus (84%) and M. bolletii (96%), but absent among M. massiliense (0%). Figure 1. View largeDownload slide Percentage of 133 MAG isolates meeting the criteria for clarithromycin susceptible (S), resistant (R) or inducible resistance (IR) by day of reading of test. Figure 1. View largeDownload slide Percentage of 133 MAG isolates meeting the criteria for clarithromycin susceptible (S), resistant (R) or inducible resistance (IR) by day of reading of test. erm(41) and rrl gene sequencing For all 133 isolates, the genotypes at erm(41) and rrl were compared with the results of clarithromycin susceptibility testing using the day 14 reading and the results of rpoB species identification (Table 1). Sequencing of rrl identified only a single isolate with the A2058G mutation; that isolate also had intact erm(41) and was resistant. Table 1. Genetic profile of the erm(41) and rrl genes and MIC results after 14 days of incubation Genotype   Susceptibility to clarithromycina   Species within MAG   rrl  erm(41)  n  S (n = 36)  IR (n = 92)  R (n = 5)  M. abscessus (n = 82)  M. bolletii (n = 24)  M. massiliense (n = 27)  WT  WT  96  –  92  4  72  24  –  A2058G  WT  1  –  –  1  1  –  –  WT  deletionsb  30  30  –  –  3  –  27  WT  T28C  6  6  –  –  6  –  –  A2058G  T28C  0  –  –  –  –  –  –  Genotype   Susceptibility to clarithromycina   Species within MAG   rrl  erm(41)  n  S (n = 36)  IR (n = 92)  R (n = 5)  M. abscessus (n = 82)  M. bolletii (n = 24)  M. massiliense (n = 27)  WT  WT  96  –  92  4  72  24  –  A2058G  WT  1  –  –  1  1  –  –  WT  deletionsb  30  30  –  –  3  –  27  WT  T28C  6  6  –  –  6  –  –  A2058G  T28C  0  –  –  –  –  –  –  a S, susceptible after 14 days of incubation; R, resistant after 3 days of incubation; IR, inducible resistant based on change from 3 to 14 days of incubation. See text for details. b Two deletions in erm(41) of 2 bp (nucleotides 64–65) and 274 bp (nucleotides 159–432). PCR analysis indicated the presence of deletions in erm(41) among 30 (83%) of the 36 clarithromycin-susceptible isolates, including all 27 M. massiliense. Of the six susceptible isolates without deletions, all were M. abscessus that carried the erm(41) T28C point mutation. Among the 97 resistant isolates, PCR indicated that all had an intact WT erm(41). Based on these results, PCR detection of deletions in the erm(41) gene had excellent performance characteristics as a presumptive test for clarithromycin susceptibility: with sensitivity, 83%; specificity, 100%; positive predictive value, 100%; and negative predictive value, 94%. The sequence analysis of the N-terminal region of erm(41) was compared with the subspecies assignment determined by rpoB. All M. bolletii isolates were clustered (>99.2% homology) as a distinct subset within M. abscessus, and both of those subspecies were readily distinguished from M. massiliense (<95% homology; data not shown). As expected, all the M. massiliense isolates were clustered (>98% homology) and all had the smaller erm(41) PCR product consistent with the characteristic deletions. The M. massiliense cluster included three M. abscessus isolates (isolates 640, 979 and 1189), which also demonstrated the smaller PCR product. The sequences of the complete coding region of erm(41) for these isolates were identical to each other and to M. massiliense (isolate 2883). It is unclear whether the three isolates acquired the altered gene from M. massiliense or whether the same deletion process occurred independently. Discussion Among pulmonary infections associated with rapidly growing mycobacteria species, ∼80% are caused by MAG.7,17,35,36 The erm(41) gene, which is essentially universal among these organisms, mediates resistance to the macrolide clarithromycin and thereby greatly complicates effective treatment.26,28 Choi et al.37 proposed that a large accumulation of erm(41) protein is required to effectively block the drug binding site and forms the basis for the high frequency of inducible resistance that is missed using the routine 3 day incubation and only detected with an extended 14 day incubation in the presence of the drug. In this study of 133 pulmonary isolates of MAG, we performed replicate susceptibility tests with varying incubation periods ranging from 3 to 14 days to determine if IR could be reliably detected with shorter incubation, thereby providing a faster clinical result. The frequency of resistant phenotype after 3 days was <5% and increased steadily through 14 days of incubation to >70%, indicating the need for that entire period. This high rate of IR is consistent with other studies38–40 and supports the need to modify the clarithromycin susceptibility testing protocol currently recommended by CLSI.31 An incubation period of >14 days was not evaluated in this study; however, Christianson et al.41 tested a prolonged incubation of 21 days for 14 M. abscessus isolates that were susceptible at day 14. Of these isolates, only one presented an MIC = 8 mg/L, but the authors concluded that there is no additional value to adding a 21 day reading to the test. They also tested Mycobacterium chelonae isolates that have no inducible resistance to clarithromycin to verify the stability of this drug. The isolates were incubated for 21 days, and all of them were susceptible. The authors concluded from these results that the clarithromycin was sufficiently active over the entire 21 day incubation period. We further analysed the genotypes of the isolates using sequencing of rpoB to identify the species within MAG, sequencing of erm(41) to detect both a point mutation (T28C) and deletions associated with gene inactivation, and sequencing of rrl to detect the A2056G mutation associated with clarithromycin resistance. The species classification reported for each study isolate represents the highest similarity score compared with the indicated reference strain. Despite the cut-off value ≥97% for species differentiation proposed by McNabb et al.,42 we considered the similarity score ≥99%, as species belonging to MAG have only 1.46% divergence in rpoB sequences.43 Species identification indicated that both M. abscessus and M. bolletii isolates demonstrated high frequency of inducible resistance. In contrast, M. massiliense isolates were uniformly susceptible even after extended incubation and this was consistently associated with previously defined inactivating deletions. These observations are consistent those of Maurer et al.44 and Mougari et al.45 Analysis of erm(41) and rrl genotypes with susceptibility phenotypes was also revealing. Of the 133 isolates studied, 36 (27%) were susceptible. Among those, 30 (83%) had erm(41) deletions, including all 27 M. massiliense and three M. abscessus. The remaining six (17%) susceptible isolates were M. abscessus with the erm(41) T28C mutation. Of note, the A2058G mutation in rrl was detected in only a single isolate in the collection; that isolate was resistant, but also had WT erm(41). Finally, we applied PCR to erm(41) and consistently detected a shortened PCR product in isolates documented to have the inactivating deletions. Specifically, all 30 isolates with sequence-confirmed deletions in erm(41) were identified by PCR. These represented >80% of the susceptible isolates as determined by the extended 14 day incubation. We conclude that PCR provides a highly reliable method to detect inactivating deletions of the erm(41) gene and thereby rapidly identify the substantial majority of clarithromycin-susceptible MAG isolates and facilitate effective treatment. Some authors14,15,33 have suggested that detecting deletions of the erm(41) gene may effectively differentiate M. massiliense from M. abscessus and M. bolletii. Our results appear consistent with this possibility. Of the 30 isolates in this report with a deletion in the erm(41) gene, three (10%; 95% CI: 2.1%–26.5%) were identified as subspecies M. abscessus. We believe that a substantially larger study is needed to define more precisely the reliability of erm(41) deletions for identification of M. massiliense subspecies. In conclusion, this study verified that the clarithromycin susceptibility test with extended incubation for up to 14 days identified inducible resistance in 69.2% of MAG isolates that appeared susceptible by the standard 3 day incubation currently recommended.31 Together, erm(41) and mutations in rrl currently represent the best defined mechanisms of macrolide resistance among MAG isolates. Sequencing confirmed that the most frequent and consistent correlate of susceptibility was the presence of previously identified inactivating deletions in erm(41). Further, those deletions were reliably demonstrated by PCR, which yielded a smaller amplification product readily distinguished from that of intact WT genes. These results suggest that in the management of infections due to MAG, a simple, rapid PCR assay might be more efficient than in vitro susceptibility testing. Acknowledgements We thank Dr Carlos Henrique Camargo for revision of the manuscript. Funding This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) (grant number 2014/50094-4). Transparency declarations None to declare. References 1 Adékambi T, Berger P, Raoult D et al.   rpoB gene sequence-based characterization of emerging non-tuberculous mycobacteria with descriptions of Mycobacterium bolletii sp. nov., Mycobacterium phocaicum sp. nov. and Mycobacterium aubagnense sp. nov. Int J Syst Evol Microbiol  2006; 56: 133– 43. Google Scholar CrossRef Search ADS PubMed  2 Castro CM, Puerto G, García LM et al.   Molecular identification of non-tuberculous mycobacteria. Biomedica  2007; 27: 439– 46. Google Scholar CrossRef Search ADS PubMed  3 Padoveze MC, Fortaleza CM, Freire MP et al.   Outbreak of surgical infection caused by non-tuberculous mycobacteria in breast implants in Brazil. J Hosp Infect  2007; 67: 161– 7. Google Scholar CrossRef Search ADS PubMed  4 Esteban J, Martín-de-Hijas NZ, Kinnari TJ et al.   Biofilm development by potentially pathogenic non-pigmented rapidly growing mycobacteria. BMC Microbiol  2008; 8: 184. Google Scholar CrossRef Search ADS PubMed  5 Duarte RS, Lourenço MC, Fonseca L et al.   An epidemic of postsurgical infections caused by Mycobacterium massiliense. J Clin Microbiol  2009; 47: 2149– 55. Google Scholar CrossRef Search ADS PubMed  6 Medjahed H, Gaillard J, Reyrat J. Mycobacterium abscessus: a new player in the mycobacterial field. Trends Microbiol  2010; 18: 117– 23. Google Scholar CrossRef Search ADS PubMed  7 Maurer FP, Rüegger V, Ritter C et al.   Acquisition of clarithromycin resistance mutations in the 23S rRNA gene of Mycobacterium abscessus in the presence of inducible erm(41). J Antimicrob Chemother  2012; 67: 2606– 11. Google Scholar CrossRef Search ADS PubMed  8 Shallom SJ, Gardina PJ, Myers TG et al.   New rapid scheme for distinguishing the subspecies of the Mycobacterium abscessus group and identification of Mycobacterium massiliense with inducible clarithromycin resistance. J Clin Microbiol  2013; 51: 2943– 9. Google Scholar CrossRef Search ADS PubMed  9 Leão SC, Tortoli E, Vianna-Niero C et al.   Characterization of mycobacteria from a major Brazilian outbreak suggest that revision of the taxonomic status of members of the Mycobacterium chelonae–M. abscessus group is needed. J Clin Microbiol  2009; 47: 2691– 8. Google Scholar CrossRef Search ADS PubMed  10 Leão SC, Tortoli E, Euzéby JP et al.   Proposal that Mycobacterium massiliense and Mycobacterium bolletii be united and reclassified as Mycobacterium abscessus subsp. bolletii comb. nov., designation of Mycobacterium abscessus subsp. abscessus subsp. nov. and emended description of Mycobacterium abscessus. Int J Syst Evol Microbiol  2011; 61: 2311– 3. Google Scholar CrossRef Search ADS PubMed  11 Cho Y, Yi H, Chun J et al.   The genome sequence of ′Mycobacterium massiliense′ strain CIP 108297 suggests the independent taxonomic status of the Mycobacterium abscessus complex at the subspecies level. PLoS One  2013; 8: e81560. Google Scholar CrossRef Search ADS PubMed  12 Koh W, Jeon K, Lee NY et al.   Clinical significance of differentiation of Mycobacterium massiliense from Mycobacterium abscessus. Am J Respir Crit Care Med  2011; 183: 405– 10. Google Scholar CrossRef Search ADS PubMed  13 Bryant JM, Grogono DM, Greaves D et al.   Whole-genome sequencing to identify transmission of Mycobacterium abscessus between patients with cystic fibrosis: a retrospective cohort study. Lancet  2013; 381: 1551– 60. Google Scholar CrossRef Search ADS PubMed  14 Tan JL, Ngeow YF, Choo SW. Support from phylogenomic networks and subspecies signatures for separation of Mycobacterium massiliense from Mycobacterium bolletii. J Clin Microbiol  2015; 53: 3042– 6. Google Scholar CrossRef Search ADS PubMed  15 Tortoli E, Kohl TA, Brown-Elliott BA et al.   Emended description of Mycobacterium abscessus, Mycobacterium abscessus subsp. abscessus and Mycobacterium abscessus subsp. bolletii and designation of Mycobacterium abscessus subsp. massiliense comb. nov. Int J Syst Evol Microbiol  2016; 66: 4471– 9. Google Scholar CrossRef Search ADS PubMed  16 Petrini B. Mycobacterium abscessus: an emerging rapid-growing potential pathogen. APMIS  2006; 114: 319– 28. Google Scholar CrossRef Search ADS PubMed  17 Groote MAD, Huitt G. Infections due to rapidly growing mycobacteria. Clin Infect Dis  2006; 42: 1756– 63. Google Scholar CrossRef Search ADS PubMed  18 Gayathri R, Lily TK, Deepa P et al.   Antibiotic susceptibility pattern of rapidly growing mycobacteria. J Postgrad Med  2010; 56: 76– 8. Google Scholar CrossRef Search ADS PubMed  19 Griffith DE, Aksamit T, Brown-Elliott BA et al.   An official ATS/IDSA statement: diagnosis, treatment, and prevention of nontuberculous mycobacterial diseases. Am J Respir Crit Care Med  2007; 175: 367– 416. Google Scholar CrossRef Search ADS PubMed  20 Wallace RJJr, Meier A, Brown BA et al.   Genetic basis for clarithromycin resistance among isolates of Mycobacterium chelonae and Mycobacterium abscessus. Antimicrob Agents Chemother  1996; 40: 1676– 81. Google Scholar PubMed  21 Vester B, Douthwaite S. Macrolide resistance conferred by base substitutions in 23S rRNA. Antimicrob Agents Chemother  2001; 45: 1– 12. Google Scholar CrossRef Search ADS PubMed  22 Brown-Elliott BA, Nash KA, Wallace RJJr. Antimicrobial susceptibility testing, drug resistance mechanism, and therapy of infections with nontuberculous mycobacteria. Clin Microbiol Rev  2012; 25: 545– 82. Google Scholar CrossRef Search ADS PubMed  23 Nash KA. Intrinsic macrolide resistance in Mycobacterium smegmatis is conferred by a novel erm gene, erm(38). Antimicrob Agents Chemother  2003; 47: 3053– 60. Google Scholar CrossRef Search ADS PubMed  24 Nash KA, Brown-Elliott BA, Wallace RJJr. Molecular basis of intrinsic macrolide resistance in clinical isolates of Mycobacterium fortuitum. J Antimicrob Chemother  2005; 55: 170– 7. Google Scholar CrossRef Search ADS PubMed  25 Bailey M, Chettiath T, Mankin AS. Induction of erm(C) expression by noninducing antibiotics. Antimicrob Agents Chemother  2008; 52: 866– 74. Google Scholar CrossRef Search ADS PubMed  26 Stout JE, Floto RA. Treatment of Mycobacterium abcessus: all macrolides are equal, but perhaps some are more equal than others. Am J Respir Crit Care Med  2012; 186: 822– 3. Google Scholar CrossRef Search ADS PubMed  27 Nash KA, Brown-Elliott BA, Wallace RJJr. A novel gene, erm(41), confers inducible macrolide resistance to clinical isolates of Mycobacterium abscessus from Mycobacterium chelonae. Antimicrob Agents Chemother  2009; 53: 1367– 76. Google Scholar CrossRef Search ADS PubMed  28 Bastian S, Veziris N, Roux A et al.   Assessment of clarithromycin susceptibility in strains belonging to the Mycobacterium abscessus group by erm(41) and rrl sequencing. Antimicrob Agents Chemother  2011; 55: 775– 81. Google Scholar CrossRef Search ADS PubMed  29 Chimara E, Ferrazoli L, Ueky SY et al.   Reliable identification of mycobacterial species by PCR restriction enzyme analysis (PRA)-hsp65 in a reference laboratory and elaboration of a sequence-based extended algorithm of PRA-hsp65 patterns. BMC Microbiol  2008; 8: 48. Google Scholar CrossRef Search ADS PubMed  30 Adékambi T, Colson P, Drancourt M. rpoB-based identification of nonpigmented and late-pigmenting rapidly growing mycobacteria. J Clin Microbiol  2003; 41: 5699– 708. Google Scholar CrossRef Search ADS PubMed  31 Clinical and Laboratory Standards Institute. Susceptibility Testing of Mycobacteria, Nocardiae, and Other Aerobic Actinomycetes—Second Edition: Approved Standard M24-A2 . CLSI, Wayne, PA, USA, 2011. 32 Carvalho NFG, Sato DN, Pavan FR et al.   Resazurin microtiter assay for clarithromycin susceptibility testing of clinical isolates of Mycobacterium abscessus group. J Clin Lab Anal  2016; 30: 751. Google Scholar CrossRef Search ADS PubMed  33 Kim HY, Kim BJ, Kook Y et al.   Mycobacterium massiliense is differentiated from Mycobacterium abscessus and Mycobacterium bolletii by erythromycin ribosome methyltransferase gene (erm) and clarithromycin susceptibility patterns. Microbiol Immunol  2010; 54: 347– 53. Google Scholar CrossRef Search ADS PubMed  34 Brown-Elliott BA, Vasireddy S, Vasireddy R et al.   Utility of sequencing the erm(41) gene in isolates of Mycobacterium abscessus subsp. abscessus with low and intermediate clarithromycin MICs. J Clin Microbiol  2015; 53: 1211– 5. Google Scholar CrossRef Search ADS PubMed  35 Costa ARF, Lopes ML, Leão SC et al.   Molecular identification of rapidly growing mycobacteria isolates from pulmonary specimens of patients in the State of Pará, Amazon region, Brazil. Diagn Microbiol Infect Dis  2009; 65: 358– 64. Google Scholar CrossRef Search ADS PubMed  36 Jeon K, Kwon OJ, Lee NY et al.   Antibiotic treatment of Mycobacterium abscessus lung disease: a retrospective analysis of 65 patients. Am J Respir Crit Care Med  2009; 180: 896– 902. Google Scholar CrossRef Search ADS PubMed  37 Choi E, Shin SJ, Won C et al.   Macrolide treatment for Mycobacterium abscessus and Mycobacterium massiliense infection and inducible resistance. Am J Respir Crit Care Med  2012; 186: 917– 25. Google Scholar CrossRef Search ADS PubMed  38 Hanson KE, Slechta ES, Muir H et al.   Rapid molecular detection of inducible macrolide resistance in Mycobacterium chelonae and M. abscessus strains: a replacement for 14-day susceptibility testing? J Clin Microbiol  2014; 52: 1705– 7. Google Scholar CrossRef Search ADS PubMed  39 Cowman S, Burns K, Benson S et al.   The antimicrobial susceptibility of non-tuberculous mycobacteria. J Infect  2016; 72: 324– 31. Google Scholar CrossRef Search ADS PubMed  40 Lee SH, Yoo HK, Kim SH et al.   The drug resistance profile of Mycobacterium abscessus group strains from Korea. Ann Lab Med  2014; 34: 31– 7. Google Scholar CrossRef Search ADS PubMed  41 Christianson S, Grierson W, Kein D et al.   Time-to-detection of inducible macrolide resistance in Mycobacterium abscessus subspecies and its association with the Erm(41) sequevar. PLoS One  2016; 11: e0158723. Google Scholar CrossRef Search ADS PubMed  42 McNabb A, Eisler D, Adie K et al.   Assessment of partial sequencing of the 65-kilodalton heat shock protein gene (hsp65) for routine identification of Mycobacterium species isolated from clinical sources. J Clin Microbiol  2004; 42: 3000– 11. Google Scholar CrossRef Search ADS PubMed  43 Macheras E, Roux AL, Bastian S et al.   Multilocus sequence analysis and rpoB sequencing of Mycobacterium abscessus (sensu lato) strains. J Clin Microbiol  2011; 49: 491– 9. Google Scholar CrossRef Search ADS PubMed  44 Maurer FP, Castelberg C, Quiblier C et al.   erm(41)-dependent inducible resistance to azithromycin and clarithromycin in clinical isolates of Mycobacterium abscessus. J Antimicrob Chemother  2014; 69: 1559– 63. Google Scholar CrossRef Search ADS PubMed  45 Mougari F, Amarsy R, Veziris N et al.   Standardized interpretation for antibiotic susceptibility testing and resistance genotyping for Mycobacterium abscessus with regard to subspecies and erm(41) sequevar. J Antimicrob Chemother  2016; 71: 2208– 12. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Antimicrobial Chemotherapy Oxford University Press

Genetic correlates of clarithromycin susceptibility among isolates of the Mycobacterium abscessus group and the potential clinical applicability of a PCR-based analysis of erm(41)

Loading next page...
 
/lp/ou_press/genetic-correlates-of-clarithromycin-susceptibility-among-isolates-of-n0vWmV036R
Publisher
Oxford University Press
ISSN
0305-7453
eISSN
1460-2091
D.O.I.
10.1093/jac/dkx476
Publisher site
See Article on Publisher Site

Abstract

Abstract Objectives To define the genetic basis of clarithromycin resistance among isolates of the Mycobacterium abscessus group (MAG). Methods We analysed 133 isolates identified as MAG. Species identification was confirmed by sequencing the rpoB gene. Clarithromycin susceptibility testing was performed according to CLSI recommendations, with an extended 14 day incubation. Known resistance genotypes of erm(41) and rrl were identified by sequencing; the presence of deletions in erm(41) was detected by PCR. Results The 133 MAG isolates included 82 M. abscessus, 27 Mycobacterium massiliense and 24 Mycobacterium bolletii. After the 3 day incubation, only five isolates demonstrated clarithromycin resistance (R); after 14 days of extended incubation, an additional 92 exhibited inducible resistance (IR), with the remaining being susceptible (S). The distribution of susceptibility phenotypes varied among the species. Among M. abscessus isolates, 11% were S, 84% IR and 5% R; among M. bolletii isolates, 96% were IR and 4% R; and among M. massiliense isolates 100% were S. Sequencing of rrl identified only a single isolate with the A2058G mutation. Deletions in erm(41) were present in 30 susceptible isolates; among the remaining 103 isolates, 97 were R or IR (sensitivity, 83%; specificity, 100%; positive predictive value, 100%; negative predictive value, 94%). Among the six susceptible isolates without deletions, all carried the erm(41) T28C point mutation. Conclusions A significant proportion of MAG isolates demonstrate inducible resistance to clarithromycin that is only detectable with an extended 14 day incubation. Further, the majority of clarithromycin-susceptible MAG isolates have characteristic deletions in erm(41) that can rapidly and reliably be detected by a simple PCR. Introduction Isolates of the Mycobacterium abscessus group (MAG) are the most common rapidly growing mycobacteria isolated from patients with pulmonary infection. These environmental organisms are often opportunistic pathogens and have been associated with nosocomial infections, including outbreaks.1–8 Species classification of MAG isolates remains a controversial issue owing to considerable similarity between Mycobacterium bolletii and Mycobacterium massiliense. Based on DNA-DNA hybridization studies, Leão et al.9,10 have proposed that MAG be classified as a single species with two subspecies: M. abscessus subsp. abscessus and M. abscessus subsp. bolletii, the latter including both M. bolletii and M. massiliense. Other studies applying whole-genome analysis support the separation into three distinct species.11–14 Recently, Tortoli et al.15 proposed that the species M. abscessus encompasses M. abscessus subsp. abscessus, M. abscessus subsp. bolletii and a third subspecies named M. abscessus subsp. massiliense comb. nov. Treatment of MAG infections is complicated by the high frequency of antibiotic resistance among the isolates.16–18 Current guidelines identify clarithromycin and azithromycin as the primary agents used, but emphasize the need for multidrug treatment regimens to ensure effective therapy until susceptibility results are available.19 Clarithromycin resistance in MAG can be mediated by several mechanisms. The erm(41) gene, which is widely prevalent among MAG, transfers one or two methyl groups to an adenine in the peptidyl region of 23S rRNA, and thereby prevents clarithromycin binding.20–23 Two alterations of erm(41) are independently associated with reversion to clarithromycin susceptibility: a 274 bp deletion7and a T28C point mutation.8,24–28 The rrl gene encodes the 23S rRNA peptidyl transferase; the A2058G mutation in rrl confers high levels of resistance to clarithromycin.19–21 This study examined a collection of pulmonary MAG isolates for which species identification was resolved by rpoB sequencing; clarithromycin resistance phenotype was based on in vitro susceptibility testing with extended incubation; rrl and erm(41) genotypes were determined by sequence analysis; and the presence of deletions in erm(41) was assessed using PCR. Materials and methods Isolates Among 635 pulmonary isolates submitted to the Tuberculosis and Mycobacteriosis Branch of Adolfo Lutz Institute from January 2010 to December 2011 for species identification, 153 (24.1%) were classified as MAG by PRA-hsp65 typing.29 Of those, 134 were viable for analysis, including one isolate that by rpoB sequencing proved to be Mycobacterium porcinum, leaving 133 MAG isolates in the final study set. Species identification Definitive species identification was obtained by sequencing a fragment of the rpoB gene using Myco F (5′-GGCAAGGTCACCCCGAAGGG-3′) and Myco R (5′-AGCGGCTGCTGGGTGATCATC-3′) as primers.30 The sequences were analysed with the software BioNumerics version 7.1 (Applied Maths, TX, USA) and the BLAST tool (http://blast.ncbi.nlm.nih.gov) was used to determine similarity with the following reference strains: M. abscessus ATCC 19977 (GenBank accession number JF346872), M. bolletii CIP 108541 (AY859692.1) and M. massiliense CIP 108297 (JX041985.1). The species classification reported for each study isolate represents the highest similarity score with the indicated reference strain. For simplification, the species M. abscessus subsp. abscessus, M. abscessus subsp. bolletii and M. abscessus subsp. massiliense are referred to as M. abscessus, M. bolletii and M. massiliense, respectively. Clarithromycin susceptibility testing with resazurin The MIC test was performed according to CLSI31 recommendations, with clarithromycin concentrations from 0.5 to 64 mg/L and using Staphylococcus aureus ATCC 29213 as quality control. Replicate plates were prepared to provide readings after 3, 5, 7, 10 and 14 days of incubation, where 3 days represents the current standard recommendation and 14 days represents a proposed extended incubation.30 At each timepoint 30 μL of 0.01% resazurin was added to each well and the plate re-incubated overnight.32 A change in colour from blue (oxidized state) to pink (reduced) indicates bacterial growth. The MIC value was defined as the lowest drug concentration that prevented growth, and isolates were classified as susceptible (S; MIC ≤2 mg/L) or resistant (R; MIC >2 mg/L). Isolates that met the criteria for susceptibility on day 3, but were classified as resistant subsequently, are reported as ‘inducible resistance’ (IR).7,27,28 erm(41) and rrl gene sequencing The primers for amplifying rrl were SP1 (CCTGCACGAATGCGGTAACG) and SP2 (CACCAGAGGTTCGTCCGTC).7 The primers erm41f2 and erm41r2, described by Maurer et al.,7 were tested for amplification of the erm(41) gene. However, the amplified region did not contain the region where the mutation occurs. Consequently, the sequence to be amplified was analysed and the primer reverse was designed. The amplification and sequence analysis of erm(41) was performed using the following primers Forward (5′-GACCGGGGCCTTCTTCGTGAT-3′)7 and Reverse (5′-GGAGTTCGTTGTGGATCTGG-3′). The resulting product, which includes 114 bp of the N-terminal coding region covering the T28C mutation28 and the deletion at 64–65 bp,33 was sequenced for all isolates. Sequence data were analysed with BioNumerics version 7.1 (Applied Maths, Sint-Martens-Latem, Belgium), using M. abscessus MAB30 (GenBank accession number EU590129) as the reference sequence for erm(41), and M. abscessus (GenBank accession number NC_010397.1) for rrl. PCR analysis of erm(41) The entire erm(41) coding region was amplified using the protocol of Brown-Elliott et al.34 and primers ermF (5′-GACCGGGGCCTTCTTCGTGAT-3′) and ermR1 (5′-GACTTCCCCGCACCGATTCC-3′). The presence of the characteristic deletions in erm(41) (2 bp, nucleotides 64–65; 274 bp, nucleotides 159–432) was identified from the reduced size of the PCR product (expected, 673 bp; deletions present, 397 bp) and confirmed for selected isolates by sequencing the entire coding region. Results Identification Among the 133 MAG isolates in the study set, all 78 isolates designated M. abscessus type 1 by PRA-hsp65 typing were identified as M. abscessus. Of the 55 isolates of M. abscessus type 2, 27 were identified as M. massiliense, 24 as M. bolletii and 4 as M. abscessus. Clarithromycin susceptibility testing The proportion of isolates showing clarithromycin inducible resistance increased over the course of the extended incubation, with the sharpest increase observed between days 7 and 10 (Figure 1). At day 14, inducible resistance was similarly prevalent among isolates of both M. abscessus (84%) and M. bolletii (96%), but absent among M. massiliense (0%). Figure 1. View largeDownload slide Percentage of 133 MAG isolates meeting the criteria for clarithromycin susceptible (S), resistant (R) or inducible resistance (IR) by day of reading of test. Figure 1. View largeDownload slide Percentage of 133 MAG isolates meeting the criteria for clarithromycin susceptible (S), resistant (R) or inducible resistance (IR) by day of reading of test. erm(41) and rrl gene sequencing For all 133 isolates, the genotypes at erm(41) and rrl were compared with the results of clarithromycin susceptibility testing using the day 14 reading and the results of rpoB species identification (Table 1). Sequencing of rrl identified only a single isolate with the A2058G mutation; that isolate also had intact erm(41) and was resistant. Table 1. Genetic profile of the erm(41) and rrl genes and MIC results after 14 days of incubation Genotype   Susceptibility to clarithromycina   Species within MAG   rrl  erm(41)  n  S (n = 36)  IR (n = 92)  R (n = 5)  M. abscessus (n = 82)  M. bolletii (n = 24)  M. massiliense (n = 27)  WT  WT  96  –  92  4  72  24  –  A2058G  WT  1  –  –  1  1  –  –  WT  deletionsb  30  30  –  –  3  –  27  WT  T28C  6  6  –  –  6  –  –  A2058G  T28C  0  –  –  –  –  –  –  Genotype   Susceptibility to clarithromycina   Species within MAG   rrl  erm(41)  n  S (n = 36)  IR (n = 92)  R (n = 5)  M. abscessus (n = 82)  M. bolletii (n = 24)  M. massiliense (n = 27)  WT  WT  96  –  92  4  72  24  –  A2058G  WT  1  –  –  1  1  –  –  WT  deletionsb  30  30  –  –  3  –  27  WT  T28C  6  6  –  –  6  –  –  A2058G  T28C  0  –  –  –  –  –  –  a S, susceptible after 14 days of incubation; R, resistant after 3 days of incubation; IR, inducible resistant based on change from 3 to 14 days of incubation. See text for details. b Two deletions in erm(41) of 2 bp (nucleotides 64–65) and 274 bp (nucleotides 159–432). PCR analysis indicated the presence of deletions in erm(41) among 30 (83%) of the 36 clarithromycin-susceptible isolates, including all 27 M. massiliense. Of the six susceptible isolates without deletions, all were M. abscessus that carried the erm(41) T28C point mutation. Among the 97 resistant isolates, PCR indicated that all had an intact WT erm(41). Based on these results, PCR detection of deletions in the erm(41) gene had excellent performance characteristics as a presumptive test for clarithromycin susceptibility: with sensitivity, 83%; specificity, 100%; positive predictive value, 100%; and negative predictive value, 94%. The sequence analysis of the N-terminal region of erm(41) was compared with the subspecies assignment determined by rpoB. All M. bolletii isolates were clustered (>99.2% homology) as a distinct subset within M. abscessus, and both of those subspecies were readily distinguished from M. massiliense (<95% homology; data not shown). As expected, all the M. massiliense isolates were clustered (>98% homology) and all had the smaller erm(41) PCR product consistent with the characteristic deletions. The M. massiliense cluster included three M. abscessus isolates (isolates 640, 979 and 1189), which also demonstrated the smaller PCR product. The sequences of the complete coding region of erm(41) for these isolates were identical to each other and to M. massiliense (isolate 2883). It is unclear whether the three isolates acquired the altered gene from M. massiliense or whether the same deletion process occurred independently. Discussion Among pulmonary infections associated with rapidly growing mycobacteria species, ∼80% are caused by MAG.7,17,35,36 The erm(41) gene, which is essentially universal among these organisms, mediates resistance to the macrolide clarithromycin and thereby greatly complicates effective treatment.26,28 Choi et al.37 proposed that a large accumulation of erm(41) protein is required to effectively block the drug binding site and forms the basis for the high frequency of inducible resistance that is missed using the routine 3 day incubation and only detected with an extended 14 day incubation in the presence of the drug. In this study of 133 pulmonary isolates of MAG, we performed replicate susceptibility tests with varying incubation periods ranging from 3 to 14 days to determine if IR could be reliably detected with shorter incubation, thereby providing a faster clinical result. The frequency of resistant phenotype after 3 days was <5% and increased steadily through 14 days of incubation to >70%, indicating the need for that entire period. This high rate of IR is consistent with other studies38–40 and supports the need to modify the clarithromycin susceptibility testing protocol currently recommended by CLSI.31 An incubation period of >14 days was not evaluated in this study; however, Christianson et al.41 tested a prolonged incubation of 21 days for 14 M. abscessus isolates that were susceptible at day 14. Of these isolates, only one presented an MIC = 8 mg/L, but the authors concluded that there is no additional value to adding a 21 day reading to the test. They also tested Mycobacterium chelonae isolates that have no inducible resistance to clarithromycin to verify the stability of this drug. The isolates were incubated for 21 days, and all of them were susceptible. The authors concluded from these results that the clarithromycin was sufficiently active over the entire 21 day incubation period. We further analysed the genotypes of the isolates using sequencing of rpoB to identify the species within MAG, sequencing of erm(41) to detect both a point mutation (T28C) and deletions associated with gene inactivation, and sequencing of rrl to detect the A2056G mutation associated with clarithromycin resistance. The species classification reported for each study isolate represents the highest similarity score compared with the indicated reference strain. Despite the cut-off value ≥97% for species differentiation proposed by McNabb et al.,42 we considered the similarity score ≥99%, as species belonging to MAG have only 1.46% divergence in rpoB sequences.43 Species identification indicated that both M. abscessus and M. bolletii isolates demonstrated high frequency of inducible resistance. In contrast, M. massiliense isolates were uniformly susceptible even after extended incubation and this was consistently associated with previously defined inactivating deletions. These observations are consistent those of Maurer et al.44 and Mougari et al.45 Analysis of erm(41) and rrl genotypes with susceptibility phenotypes was also revealing. Of the 133 isolates studied, 36 (27%) were susceptible. Among those, 30 (83%) had erm(41) deletions, including all 27 M. massiliense and three M. abscessus. The remaining six (17%) susceptible isolates were M. abscessus with the erm(41) T28C mutation. Of note, the A2058G mutation in rrl was detected in only a single isolate in the collection; that isolate was resistant, but also had WT erm(41). Finally, we applied PCR to erm(41) and consistently detected a shortened PCR product in isolates documented to have the inactivating deletions. Specifically, all 30 isolates with sequence-confirmed deletions in erm(41) were identified by PCR. These represented >80% of the susceptible isolates as determined by the extended 14 day incubation. We conclude that PCR provides a highly reliable method to detect inactivating deletions of the erm(41) gene and thereby rapidly identify the substantial majority of clarithromycin-susceptible MAG isolates and facilitate effective treatment. Some authors14,15,33 have suggested that detecting deletions of the erm(41) gene may effectively differentiate M. massiliense from M. abscessus and M. bolletii. Our results appear consistent with this possibility. Of the 30 isolates in this report with a deletion in the erm(41) gene, three (10%; 95% CI: 2.1%–26.5%) were identified as subspecies M. abscessus. We believe that a substantially larger study is needed to define more precisely the reliability of erm(41) deletions for identification of M. massiliense subspecies. In conclusion, this study verified that the clarithromycin susceptibility test with extended incubation for up to 14 days identified inducible resistance in 69.2% of MAG isolates that appeared susceptible by the standard 3 day incubation currently recommended.31 Together, erm(41) and mutations in rrl currently represent the best defined mechanisms of macrolide resistance among MAG isolates. Sequencing confirmed that the most frequent and consistent correlate of susceptibility was the presence of previously identified inactivating deletions in erm(41). Further, those deletions were reliably demonstrated by PCR, which yielded a smaller amplification product readily distinguished from that of intact WT genes. These results suggest that in the management of infections due to MAG, a simple, rapid PCR assay might be more efficient than in vitro susceptibility testing. Acknowledgements We thank Dr Carlos Henrique Camargo for revision of the manuscript. Funding This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) (grant number 2014/50094-4). Transparency declarations None to declare. References 1 Adékambi T, Berger P, Raoult D et al.   rpoB gene sequence-based characterization of emerging non-tuberculous mycobacteria with descriptions of Mycobacterium bolletii sp. nov., Mycobacterium phocaicum sp. nov. and Mycobacterium aubagnense sp. nov. Int J Syst Evol Microbiol  2006; 56: 133– 43. Google Scholar CrossRef Search ADS PubMed  2 Castro CM, Puerto G, García LM et al.   Molecular identification of non-tuberculous mycobacteria. Biomedica  2007; 27: 439– 46. Google Scholar CrossRef Search ADS PubMed  3 Padoveze MC, Fortaleza CM, Freire MP et al.   Outbreak of surgical infection caused by non-tuberculous mycobacteria in breast implants in Brazil. J Hosp Infect  2007; 67: 161– 7. Google Scholar CrossRef Search ADS PubMed  4 Esteban J, Martín-de-Hijas NZ, Kinnari TJ et al.   Biofilm development by potentially pathogenic non-pigmented rapidly growing mycobacteria. BMC Microbiol  2008; 8: 184. Google Scholar CrossRef Search ADS PubMed  5 Duarte RS, Lourenço MC, Fonseca L et al.   An epidemic of postsurgical infections caused by Mycobacterium massiliense. J Clin Microbiol  2009; 47: 2149– 55. Google Scholar CrossRef Search ADS PubMed  6 Medjahed H, Gaillard J, Reyrat J. Mycobacterium abscessus: a new player in the mycobacterial field. Trends Microbiol  2010; 18: 117– 23. Google Scholar CrossRef Search ADS PubMed  7 Maurer FP, Rüegger V, Ritter C et al.   Acquisition of clarithromycin resistance mutations in the 23S rRNA gene of Mycobacterium abscessus in the presence of inducible erm(41). J Antimicrob Chemother  2012; 67: 2606– 11. Google Scholar CrossRef Search ADS PubMed  8 Shallom SJ, Gardina PJ, Myers TG et al.   New rapid scheme for distinguishing the subspecies of the Mycobacterium abscessus group and identification of Mycobacterium massiliense with inducible clarithromycin resistance. J Clin Microbiol  2013; 51: 2943– 9. Google Scholar CrossRef Search ADS PubMed  9 Leão SC, Tortoli E, Vianna-Niero C et al.   Characterization of mycobacteria from a major Brazilian outbreak suggest that revision of the taxonomic status of members of the Mycobacterium chelonae–M. abscessus group is needed. J Clin Microbiol  2009; 47: 2691– 8. Google Scholar CrossRef Search ADS PubMed  10 Leão SC, Tortoli E, Euzéby JP et al.   Proposal that Mycobacterium massiliense and Mycobacterium bolletii be united and reclassified as Mycobacterium abscessus subsp. bolletii comb. nov., designation of Mycobacterium abscessus subsp. abscessus subsp. nov. and emended description of Mycobacterium abscessus. Int J Syst Evol Microbiol  2011; 61: 2311– 3. Google Scholar CrossRef Search ADS PubMed  11 Cho Y, Yi H, Chun J et al.   The genome sequence of ′Mycobacterium massiliense′ strain CIP 108297 suggests the independent taxonomic status of the Mycobacterium abscessus complex at the subspecies level. PLoS One  2013; 8: e81560. Google Scholar CrossRef Search ADS PubMed  12 Koh W, Jeon K, Lee NY et al.   Clinical significance of differentiation of Mycobacterium massiliense from Mycobacterium abscessus. Am J Respir Crit Care Med  2011; 183: 405– 10. Google Scholar CrossRef Search ADS PubMed  13 Bryant JM, Grogono DM, Greaves D et al.   Whole-genome sequencing to identify transmission of Mycobacterium abscessus between patients with cystic fibrosis: a retrospective cohort study. Lancet  2013; 381: 1551– 60. Google Scholar CrossRef Search ADS PubMed  14 Tan JL, Ngeow YF, Choo SW. Support from phylogenomic networks and subspecies signatures for separation of Mycobacterium massiliense from Mycobacterium bolletii. J Clin Microbiol  2015; 53: 3042– 6. Google Scholar CrossRef Search ADS PubMed  15 Tortoli E, Kohl TA, Brown-Elliott BA et al.   Emended description of Mycobacterium abscessus, Mycobacterium abscessus subsp. abscessus and Mycobacterium abscessus subsp. bolletii and designation of Mycobacterium abscessus subsp. massiliense comb. nov. Int J Syst Evol Microbiol  2016; 66: 4471– 9. Google Scholar CrossRef Search ADS PubMed  16 Petrini B. Mycobacterium abscessus: an emerging rapid-growing potential pathogen. APMIS  2006; 114: 319– 28. Google Scholar CrossRef Search ADS PubMed  17 Groote MAD, Huitt G. Infections due to rapidly growing mycobacteria. Clin Infect Dis  2006; 42: 1756– 63. Google Scholar CrossRef Search ADS PubMed  18 Gayathri R, Lily TK, Deepa P et al.   Antibiotic susceptibility pattern of rapidly growing mycobacteria. J Postgrad Med  2010; 56: 76– 8. Google Scholar CrossRef Search ADS PubMed  19 Griffith DE, Aksamit T, Brown-Elliott BA et al.   An official ATS/IDSA statement: diagnosis, treatment, and prevention of nontuberculous mycobacterial diseases. Am J Respir Crit Care Med  2007; 175: 367– 416. Google Scholar CrossRef Search ADS PubMed  20 Wallace RJJr, Meier A, Brown BA et al.   Genetic basis for clarithromycin resistance among isolates of Mycobacterium chelonae and Mycobacterium abscessus. Antimicrob Agents Chemother  1996; 40: 1676– 81. Google Scholar PubMed  21 Vester B, Douthwaite S. Macrolide resistance conferred by base substitutions in 23S rRNA. Antimicrob Agents Chemother  2001; 45: 1– 12. Google Scholar CrossRef Search ADS PubMed  22 Brown-Elliott BA, Nash KA, Wallace RJJr. Antimicrobial susceptibility testing, drug resistance mechanism, and therapy of infections with nontuberculous mycobacteria. Clin Microbiol Rev  2012; 25: 545– 82. Google Scholar CrossRef Search ADS PubMed  23 Nash KA. Intrinsic macrolide resistance in Mycobacterium smegmatis is conferred by a novel erm gene, erm(38). Antimicrob Agents Chemother  2003; 47: 3053– 60. Google Scholar CrossRef Search ADS PubMed  24 Nash KA, Brown-Elliott BA, Wallace RJJr. Molecular basis of intrinsic macrolide resistance in clinical isolates of Mycobacterium fortuitum. J Antimicrob Chemother  2005; 55: 170– 7. Google Scholar CrossRef Search ADS PubMed  25 Bailey M, Chettiath T, Mankin AS. Induction of erm(C) expression by noninducing antibiotics. Antimicrob Agents Chemother  2008; 52: 866– 74. Google Scholar CrossRef Search ADS PubMed  26 Stout JE, Floto RA. Treatment of Mycobacterium abcessus: all macrolides are equal, but perhaps some are more equal than others. Am J Respir Crit Care Med  2012; 186: 822– 3. Google Scholar CrossRef Search ADS PubMed  27 Nash KA, Brown-Elliott BA, Wallace RJJr. A novel gene, erm(41), confers inducible macrolide resistance to clinical isolates of Mycobacterium abscessus from Mycobacterium chelonae. Antimicrob Agents Chemother  2009; 53: 1367– 76. Google Scholar CrossRef Search ADS PubMed  28 Bastian S, Veziris N, Roux A et al.   Assessment of clarithromycin susceptibility in strains belonging to the Mycobacterium abscessus group by erm(41) and rrl sequencing. Antimicrob Agents Chemother  2011; 55: 775– 81. Google Scholar CrossRef Search ADS PubMed  29 Chimara E, Ferrazoli L, Ueky SY et al.   Reliable identification of mycobacterial species by PCR restriction enzyme analysis (PRA)-hsp65 in a reference laboratory and elaboration of a sequence-based extended algorithm of PRA-hsp65 patterns. BMC Microbiol  2008; 8: 48. Google Scholar CrossRef Search ADS PubMed  30 Adékambi T, Colson P, Drancourt M. rpoB-based identification of nonpigmented and late-pigmenting rapidly growing mycobacteria. J Clin Microbiol  2003; 41: 5699– 708. Google Scholar CrossRef Search ADS PubMed  31 Clinical and Laboratory Standards Institute. Susceptibility Testing of Mycobacteria, Nocardiae, and Other Aerobic Actinomycetes—Second Edition: Approved Standard M24-A2 . CLSI, Wayne, PA, USA, 2011. 32 Carvalho NFG, Sato DN, Pavan FR et al.   Resazurin microtiter assay for clarithromycin susceptibility testing of clinical isolates of Mycobacterium abscessus group. J Clin Lab Anal  2016; 30: 751. Google Scholar CrossRef Search ADS PubMed  33 Kim HY, Kim BJ, Kook Y et al.   Mycobacterium massiliense is differentiated from Mycobacterium abscessus and Mycobacterium bolletii by erythromycin ribosome methyltransferase gene (erm) and clarithromycin susceptibility patterns. Microbiol Immunol  2010; 54: 347– 53. Google Scholar CrossRef Search ADS PubMed  34 Brown-Elliott BA, Vasireddy S, Vasireddy R et al.   Utility of sequencing the erm(41) gene in isolates of Mycobacterium abscessus subsp. abscessus with low and intermediate clarithromycin MICs. J Clin Microbiol  2015; 53: 1211– 5. Google Scholar CrossRef Search ADS PubMed  35 Costa ARF, Lopes ML, Leão SC et al.   Molecular identification of rapidly growing mycobacteria isolates from pulmonary specimens of patients in the State of Pará, Amazon region, Brazil. Diagn Microbiol Infect Dis  2009; 65: 358– 64. Google Scholar CrossRef Search ADS PubMed  36 Jeon K, Kwon OJ, Lee NY et al.   Antibiotic treatment of Mycobacterium abscessus lung disease: a retrospective analysis of 65 patients. Am J Respir Crit Care Med  2009; 180: 896– 902. Google Scholar CrossRef Search ADS PubMed  37 Choi E, Shin SJ, Won C et al.   Macrolide treatment for Mycobacterium abscessus and Mycobacterium massiliense infection and inducible resistance. Am J Respir Crit Care Med  2012; 186: 917– 25. Google Scholar CrossRef Search ADS PubMed  38 Hanson KE, Slechta ES, Muir H et al.   Rapid molecular detection of inducible macrolide resistance in Mycobacterium chelonae and M. abscessus strains: a replacement for 14-day susceptibility testing? J Clin Microbiol  2014; 52: 1705– 7. Google Scholar CrossRef Search ADS PubMed  39 Cowman S, Burns K, Benson S et al.   The antimicrobial susceptibility of non-tuberculous mycobacteria. J Infect  2016; 72: 324– 31. Google Scholar CrossRef Search ADS PubMed  40 Lee SH, Yoo HK, Kim SH et al.   The drug resistance profile of Mycobacterium abscessus group strains from Korea. Ann Lab Med  2014; 34: 31– 7. Google Scholar CrossRef Search ADS PubMed  41 Christianson S, Grierson W, Kein D et al.   Time-to-detection of inducible macrolide resistance in Mycobacterium abscessus subspecies and its association with the Erm(41) sequevar. PLoS One  2016; 11: e0158723. Google Scholar CrossRef Search ADS PubMed  42 McNabb A, Eisler D, Adie K et al.   Assessment of partial sequencing of the 65-kilodalton heat shock protein gene (hsp65) for routine identification of Mycobacterium species isolated from clinical sources. J Clin Microbiol  2004; 42: 3000– 11. Google Scholar CrossRef Search ADS PubMed  43 Macheras E, Roux AL, Bastian S et al.   Multilocus sequence analysis and rpoB sequencing of Mycobacterium abscessus (sensu lato) strains. J Clin Microbiol  2011; 49: 491– 9. Google Scholar CrossRef Search ADS PubMed  44 Maurer FP, Castelberg C, Quiblier C et al.   erm(41)-dependent inducible resistance to azithromycin and clarithromycin in clinical isolates of Mycobacterium abscessus. J Antimicrob Chemother  2014; 69: 1559– 63. Google Scholar CrossRef Search ADS PubMed  45 Mougari F, Amarsy R, Veziris N et al.   Standardized interpretation for antibiotic susceptibility testing and resistance genotyping for Mycobacterium abscessus with regard to subspecies and erm(41) sequevar. J Antimicrob Chemother  2016; 71: 2208– 12. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Journal

Journal of Antimicrobial ChemotherapyOxford University Press

Published: Apr 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off