Genetic characterization of a VanG-type vancomycin-resistant Enterococcus faecium clinical isolate

Genetic characterization of a VanG-type vancomycin-resistant Enterococcus faecium clinical isolate Abstract Objectives To characterize, phenotypically and genotypically, the first Enterococcus faecium clinical isolate harbouring a vanG operon. Methods The antibiotic resistance profile of E. faecium 16-346 was determined and its whole genome sequenced using PacBio technology. Attempts to transfer vancomycin resistance by filter mating were performed and the inducibility of expression of the vanG operon was studied by reverse-transcription quantitative PCR (RT-qPCR) in the presence or absence of subinhibitory concentrations of vancomycin. Results E. faecium 16-346 was resistant to rifampicin (MIC >4 mg/L), erythromycin (MIC >4 mg/L), tetracycline (MIC >16 mg/L) and vancomycin (MIC 8 mg/L), but susceptible to teicoplanin (MIC 0.5 mg/L). The strain harboured the vanG operon in its chromosome, integrated in a 45.5 kb putative mobile genetic element, similar to that of Enterococcus faecalis BM4518. We were unable to transfer vancomycin resistance from E. faecium 16-346 to E. faecium BM4107 and E. faecalis JH2-2. Lastly, transcription of the vanG gene was inducible by vancomycin. Conclusions This is, to the best of our knowledge, the first report of a VanG-type vancomycin-resistant strain of E. faecium. Despite the alarm pulled because of the therapeutic problems caused by VRE, our work shows that new resistant loci can still be found in E. faecium. Introduction Despite being commensal bacteria of the human gut microbiota, enterococci have become major opportunistic pathogens.1 In addition, vancomycin-resistant Enterococcus faecium (VREF) is currently a member of the list of bacteria, recently edited by the WHO, for which new antibiotics are urgently needed (http://www.who.int/mediacentre/news/releases/2017/bacteria-antibiotics-needed/en/). This points to the worldwide emergence of this species, especially hospital-adapted strains belonging to clonal complex (CC) 17, that leads to major concerns in clinical settings.2 Glycopeptide resistance is due to the presence of van operons that encode enzymes catalysing the production of modified peptidoglycan precursors ending in d-Ala-d-Lac (VanA, B, D and M) or d-Ala-d-Ser (VanC, E, G, L and N).2 These precursors have much less affinity for vancomycin than the d-Ala-d-Ala motif, leading to a resistant phenotype (MIC of vancomycin >4 mg/L).2 Moreover, these operons are tightly regulated by a VanS/VanR-type two-component system, where VanS is a membrane-bound histidine kinase and VanR is a transcriptional regulator.3 Because some van operons are part of mobile genetic elements, the glycopeptide resistance has spread among enterococci. The vanG operon, in which the VanG ligase allows synthesis of a precursor ending in d-Ala-d-Ser, has only been detected in a few Enterococcus faecalis clinical isolates and confers moderate levels of resistance to vancomycin (MIC 16 mg/L), but not to teicoplanin.4,5 It is characterized by a ‘three-component’ regulatory system that includes an additional repressor (VanUG) also involved in the control of the vanG operon transcription.6 We report, to the best of our knowledge, the first clinical isolate of E. faecium harbouring a vanG operon. The genome of this strain (E. faecium 16-346) was completely sequenced and we identified in the chromosome an acquired putative mobile genetic element containing the vanG locus. Materials and methods Bacterial strains and MIC determination E. faecium 16-346 was obtained in 2016 from a faecal sample of a non-infected 40-year-old female patient hospitalized in the medical centre of Sainte-Foy-l’Argentière, France. E. faecium BM4107 and E. faecalis JH2-2 were used for filter mating experiments. MICs of 20 antibiotics (chloramphenicol, daptomycin, gentamicin, linezolid, rifampicin, trimethoprim/sulfamethoxazole, quinupristin/dalfopristin, tetracycline, erythromycin, oxacillin, ampicillin, penicillin G, vancomycin, levofloxacin, tigecycline, moxifloxacin, clindamycin, streptomycin, ciprofloxacin and nitrofurantoin) were determined using a Sensititre™ automated system (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. WGS and accession number The whole genome sequence of the E. faecium 16-346 strain was determined with PacBio technology (GATC Biotech, Konstanz, Germany). The sequence was annotated using the NCBI Prokaryotic Genome Annotation Pipeline.7 The sequence was submitted to GenBank and assigned accession number CP021849. Filter mating Transfer of vancomycin resistance from E. faecium 16-346 to E. faecium BM4107 and E. faecalis JH2-2 was attempted by filter mating. Transconjugants were selected on brain heart infusion (BHI) agar containing rifampicin (60 mg/L), fusidic acid (50 mg/L) and vancomycin (4 mg/L). Reverse-transcription quantitative PCR (RT-qPCR) experiments The expression of the vanG gene was assessed by RT-qPCR using RNA extracted from bacterial cells (OD600 of 0.5) grown in the absence or in the presence of subinhibitory concentrations of vancomycin (i.e. 1 or 2 mg/L). PCR amplification was carried out with primers specific for vanG (vanG-F: 5′-TTCGTGCAGGCTCTTCCTTT-3′; vanG-R: 5′-CACAACCGACTTCAAAGCCG-3′) or adk (housekeeping reference gene) as described previously.8 Results and discussion Characterization of E. faecium 16-346 E. faecium 16-346 was resistant to vancomycin (MIC 8 mg/L). It was also resistant to rifampicin (MIC >4 mg/L), erythromycin (MIC >4 mg/L) and tetracycline (MIC >16 mg/L), but remained susceptible to teicoplanin (MIC 0.5 mg/L) and to the other antibiotics tested. Screening by specific PCR for the presence of the vanA, vanB, vanD, vanM and vanN genes, known to confer glycopeptide resistance in this species, was negative.2 Primers specific for the other van operons not yet described in E. faecium were tested and an amplification of the vanG gene was obtained. vanG-type operons have only been found in E. faecalis clinical isolates from Australia and Canada, as well as in various Clostridium spp.4,5,9,10 In the latter, vanG did not confer vancomycin resistance, but they may, however, be considered as a possible reservoir. It has been shown that part of the microflora of the human gastrointestinal tract harbours the vanG gene.11 Indeed, from 248 rectal swab samples, Domingo et al.12 showed that 9.3% were positive for vanG, but none was associated with enterococci. Since, to our knowledge, no VanG-type E. faecium have been identified so far, we further analysed this strain by WGS. With a size of 2 736 595 bp, the genome harboured 2824 putative genes (2730 coding sequences) (Figure S1, available as Supplementary data at JAC Online). This strain was plasmid free and belonged to ST121. Search for resistance genes revealed the presence of the vanG operon, but also that of erm(Y) and msr(C), both involved in macrolide resistance, as well as that of tet(M) and tet(L) that confer tetracycline resistance (Table 1). These data were in agreement with the resistance phenotype of E. faecium 16-346. Table 1. Antimicrobial-resistance genes identified in the genome sequence of E. faecium 16-346 Gene  Percentage identity  Position in contig  Phenotype  Accession no.  vanTG  100.00a  1 442 739..1 444 877  vancomycin resistance  AY271782  vanXYG  100.00a  1 444 870..1 445 634  vancomycin resistance  AY271782  vanG  100.00a  1 445 631..1 446 680  vancomycin resistance  AY271782  vanWG  99.88a  1 446 682..1 447 527  vancomycin resistance  AY271782  vanYG  100.00b  1 447 603..1 448 442  vancomycin resistance  DQ212986  vanSG  99.82a  1 448 579..1 449 683  vancomycin resistance  AY271782  vanRG  100.00a  1 449 697..1 450 404  vancomycin resistance  AY271782  vanUG  100.00a  1 450 406..1 450 633  vancomycin resistance  AY271782  tet(M)  97.45c  1 707 444..1 709 362  tetracycline resistance  EU182585  tet(L)  99.85d  1 709 491..1 710 832  tetracycline resistance  M29725  erm(Y)  81.51e  1 715 249..1 715 977  macrolide resistance  AB014481  msr(C)  98.99f  2 006 190..2 007 668  macrolide/lincosamide/ streptogramin resistance  AY004350  Gene  Percentage identity  Position in contig  Phenotype  Accession no.  vanTG  100.00a  1 442 739..1 444 877  vancomycin resistance  AY271782  vanXYG  100.00a  1 444 870..1 445 634  vancomycin resistance  AY271782  vanG  100.00a  1 445 631..1 446 680  vancomycin resistance  AY271782  vanWG  99.88a  1 446 682..1 447 527  vancomycin resistance  AY271782  vanYG  100.00b  1 447 603..1 448 442  vancomycin resistance  DQ212986  vanSG  99.82a  1 448 579..1 449 683  vancomycin resistance  AY271782  vanRG  100.00a  1 449 697..1 450 404  vancomycin resistance  AY271782  vanUG  100.00a  1 450 406..1 450 633  vancomycin resistance  AY271782  tet(M)  97.45c  1 707 444..1 709 362  tetracycline resistance  EU182585  tet(L)  99.85d  1 709 491..1 710 832  tetracycline resistance  M29725  erm(Y)  81.51e  1 715 249..1 715 977  macrolide resistance  AB014481  msr(C)  98.99f  2 006 190..2 007 668  macrolide/lincosamide/ streptogramin resistance  AY004350  a Identity with the homologous gene from E. faecalis BM4518. b Identity with the homologous gene from E. faecalis G1-0247. c Identity with the homologous gene from Streptococcus suis T2S3. d Identity with the homologous gene from the pLS1 plasmid of Streptococcus agalactiae. e Identity with the homologous gene from the pMS97 plasmid of Staphylococcus aureus RN4220. f Identity with the homologous gene from E. faecium TX2465. Analysis of the vanG operon The sequence of the vanG operon was very similar to those from E. faecalis BM4518, WCH9 and G1-0247 (Figure 1).4,5,13 Indeed, the van genes (UG, RG, SG, YG, WG, G, XYG and TG) were between 99.82% and 100% identical (Table 1). Thus, after VanN, VanG is the second ligase able to synthesize d-Ala-d-Ser-ending precursors in E. faecium.14 This is consistent with low-level vancomycin resistance (MIC 8–16 mg/L), since the precursors ending with d-Ala-d-Ser present only a 7-fold lower affinity for the antibiotic.15 In vanYG of E. faecalis BM4518, a frameshift mutation is present.13 In E. faecium, vanYG has no mutations, as in the vanYG from E. faecalis G1-0247 strain.5 Figure 1. View largeDownload slide Schematic of the chromosome region harbouring the vanG operon of E. faecium 16-346, compared with the corresponding region of E. faecalis BM4518. DR-L, left DR; DR-R, right DR; IR-L, left IR; IR-R, right IR. Figure 1. View largeDownload slide Schematic of the chromosome region harbouring the vanG operon of E. faecium 16-346, compared with the corresponding region of E. faecalis BM4518. DR-L, left DR; DR-R, right DR; IR-L, left IR; IR-R, right IR. Twenty-two bp imperfect IRs framed the mobile genetic element (Figure 1). In E. faecalis BM4518, the element is 240 kb long, whereas, in E. faecium, its size was 45.5 kb comprising 43 genes (Table S1). Of note, the sequence of the left IR was identical to that of E. faecalis G1-0247 (CGGTAGTACTTCTTTCCCACAA) and diverged from that of BM4518 by 2 bases (CGGTGGTACTGCTTTCCCACAA).5,13 Surprisingly, the sequence of the left DR (TGGA) was not the same as the TTGA sequence of the right DR (Figure 1). Based on the sequence of the reference strain E. faecium AUS 0004, TGGA appears as the motif present in the gene in which the element has been inserted.16 It may be hypothesized that the target site of integration could be only the GA 2 bp sequence. To date, in E. faecalis, two types of vanG operon have been characterized, one from strains BM4518, WCH9 and G1-0247 (vanG) and another from N03-0233 (vanG2), lacking the vanYG gene and showing also a 2 bp (CA) DR.5 Interestingly, in all the VanG-type strains (clinical isolates or transconjugants) insertion of the vanG cluster systematically occurred in the gene encoding an RNA methyltransferase, whereas vanG2 is located in the dctP gene (encoding a subunit of the TRAP dicarboxylate transporter).13 This was not observed in E. faecium where the element was integrated in a gene encoding a hypothetical protein (annotated EFAU004_00391) (Figure 1). Attempts to transfer and inducibility of expression of the vanG operon We were unable to transfer vancomycin resistance from E. faecium 16-346 to E. faecium BM4107 and E. faecalis JH2-2. Similarly, McKessar et al.4 failed to transfer vanG operons from E. faecalis to E. faecium. In E. faecalis BM4518, erm(B) was co-transferred with vanG and transconjugants could only be obtained on erythromycin-containing plates.13 In E. faecium 16-346, the mobile genetic element did not harbour erm(B) and macrolide resistance was likely due to the presence of the erm(Y) and msr(C) genes located 231 and 522 kb downstream, respectively (Table 1). As in E. faecalis G1-0247 and N03-0233, it may be possible that the experimental conditions were not adapted. In order to test if vanG expression was inducible, RT-qPCR experiments were carried out from cells grown with 0, 1 or 2 mg/L vancomycin (1 and 2 mg/L vancomycin corresponding to ⅛ and ¼ of MIC, respectively). As expected, vanG transcription was increased 3- and 5-fold (P < 0.05) in the presence of 1 and 2 mg/L antibiotic, respectively. This strongly suggests that transcriptional regulation may be similar to that of E. faecalis where the repressor VanUG and the activator VanRG (both present in E. faecium) compete for the same PYG promoter leading to rheostatic control of vanG operon expression.6 Conclusions To our knowledge, this is the first report of a vanG-type locus acquired by a strain of E. faecium. This points out that the surveillance of VREF remains crucial to overcome the spread of this major opportunistic pathogen. Acknowledgements We thank M. Auzou for excellent technical assistance. Funding This work was supported by internal funding. Transparency declarations None to declare. Supplementary data Figure S1 and Table S1 are available as Supplementary data at JAC Online. References 1 Arias CA, Murray BE. The rise of the Enterococcus: beyond vancomycin resistance. Nat Rev Microbiol  2012; 10: 266– 78. Google Scholar CrossRef Search ADS PubMed  2 Cattoir V, Giard JC. Antibiotic resistance in Enterococcus faecium clinical isolates. Expert Rev Anti Infect Ther  2014; 12: 239– 48. Google Scholar CrossRef Search ADS PubMed  3 Depardieu F, Podglajen I, Leclercq R et al.   Modes and modulations of antibiotic resistance gene expression. Clin Microbiol Rev  2007; 20: 79– 114. Google Scholar CrossRef Search ADS PubMed  4 McKessar SJ, Berry AM, Bell JM et al.   Genetic characterization of vanG, a novel vancomycin resistance locus of Enterococcus faecalis. Antimicrob Agents Chemother  2000; 44: 3224– 8. Google Scholar CrossRef Search ADS PubMed  5 Boyd DA, Du T, Hizon R et al.   VanG-type vancomycin-resistant Enterococcus faecalis strains isolated in Canada. Antimicrob Agents Chemother  2006; 50: 2217– 21. Google Scholar CrossRef Search ADS PubMed  6 Depardieu F, Mejean V, Courvalin P. Competition between VanUG repressor and VanRG activator leads to rheostatic control of vanG vancomycin resistance operon expression. PLoS Genet  2015; 11: e1005170. Google Scholar CrossRef Search ADS PubMed  7 Angiuoli SV, Gussman A, Klimke W et al.   Toward an online repository of standard operating procedures (SOPs) for (meta)genomic annotation. Omics  2008; 12: 137– 41. Google Scholar CrossRef Search ADS PubMed  8 Sinel C, Cacaci M, Meignen P et al.   Subinhibitory concentrations of ciprofloxacin enhance antimicrobial resistance and pathogenicity of Enterococcus faecium. Antimicrob Agents Chemother  2017; 61: e02763- 16. Google Scholar CrossRef Search ADS PubMed  9 Berthet N, Périchon B, Mazuet C et al.   A vanG-type locus in Clostridium argentinense. J Antimicrob Chemother  2015; 70: 1942– 5. Google Scholar CrossRef Search ADS PubMed  10 Peltier J, Courtin P, El Meouche I et al.   Genomic and expression analysis of the vanG-like gene cluster of Clostridium difficile. Microbiology  2013; 159: 1510– 20. Google Scholar CrossRef Search ADS PubMed  11 Domingo MC, Huletsky A, Giroux R et al.   vanD and vanG-like gene clusters in a Ruminococcus species isolated from human bowel flora. Antimicrob Agents Chemother  2007; 51: 4111– 7. Google Scholar CrossRef Search ADS PubMed  12 Domingo MC, Huletsky A, Giroux R et al.   High prevalence of glycopeptide resistance genes vanB, vanD, and vanG not associated with enterococci in human fecal flora. Antimicrob Agents Chemother  2005; 49: 4784– 6. Google Scholar CrossRef Search ADS PubMed  13 Depardieu F, Bonora MG, Reynolds PE et al.   The vanG glycopeptide resistance operon from Enterococcus faecalis revisited. Mol Microbiol  2003; 50: 931– 48. Google Scholar CrossRef Search ADS PubMed  14 Lebreton F, Depardieu F, Bourdon N et al.   d-Ala-d-Ser VanN-type transferable vancomycin resistance in Enterococcus faecium. Antimicrob Agents Chemother  2011; 55: 4606– 12. Google Scholar CrossRef Search ADS PubMed  15 Courvalin P. Vancomycin resistance in Gram-positive cocci. Clin Infect Dis  2006; 42 Suppl 1: S25– 34. Google Scholar CrossRef Search ADS PubMed  16 Lam MM, Seemann T, Bulach DM et al.   Comparative analysis of the first complete Enterococcus faecium genome. J Bacteriol  2012; 194: 2334– 41. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2018. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Antimicrobial Chemotherapy Oxford University Press

Genetic characterization of a VanG-type vancomycin-resistant Enterococcus faecium clinical isolate

Loading next page...
 
/lp/ou_press/genetic-characterization-of-a-vang-type-vancomycin-resistant-mwK8070odH
Publisher
Oxford University Press
ISSN
0305-7453
eISSN
1460-2091
D.O.I.
10.1093/jac/dkx510
Publisher site
See Article on Publisher Site

Abstract

Abstract Objectives To characterize, phenotypically and genotypically, the first Enterococcus faecium clinical isolate harbouring a vanG operon. Methods The antibiotic resistance profile of E. faecium 16-346 was determined and its whole genome sequenced using PacBio technology. Attempts to transfer vancomycin resistance by filter mating were performed and the inducibility of expression of the vanG operon was studied by reverse-transcription quantitative PCR (RT-qPCR) in the presence or absence of subinhibitory concentrations of vancomycin. Results E. faecium 16-346 was resistant to rifampicin (MIC >4 mg/L), erythromycin (MIC >4 mg/L), tetracycline (MIC >16 mg/L) and vancomycin (MIC 8 mg/L), but susceptible to teicoplanin (MIC 0.5 mg/L). The strain harboured the vanG operon in its chromosome, integrated in a 45.5 kb putative mobile genetic element, similar to that of Enterococcus faecalis BM4518. We were unable to transfer vancomycin resistance from E. faecium 16-346 to E. faecium BM4107 and E. faecalis JH2-2. Lastly, transcription of the vanG gene was inducible by vancomycin. Conclusions This is, to the best of our knowledge, the first report of a VanG-type vancomycin-resistant strain of E. faecium. Despite the alarm pulled because of the therapeutic problems caused by VRE, our work shows that new resistant loci can still be found in E. faecium. Introduction Despite being commensal bacteria of the human gut microbiota, enterococci have become major opportunistic pathogens.1 In addition, vancomycin-resistant Enterococcus faecium (VREF) is currently a member of the list of bacteria, recently edited by the WHO, for which new antibiotics are urgently needed (http://www.who.int/mediacentre/news/releases/2017/bacteria-antibiotics-needed/en/). This points to the worldwide emergence of this species, especially hospital-adapted strains belonging to clonal complex (CC) 17, that leads to major concerns in clinical settings.2 Glycopeptide resistance is due to the presence of van operons that encode enzymes catalysing the production of modified peptidoglycan precursors ending in d-Ala-d-Lac (VanA, B, D and M) or d-Ala-d-Ser (VanC, E, G, L and N).2 These precursors have much less affinity for vancomycin than the d-Ala-d-Ala motif, leading to a resistant phenotype (MIC of vancomycin >4 mg/L).2 Moreover, these operons are tightly regulated by a VanS/VanR-type two-component system, where VanS is a membrane-bound histidine kinase and VanR is a transcriptional regulator.3 Because some van operons are part of mobile genetic elements, the glycopeptide resistance has spread among enterococci. The vanG operon, in which the VanG ligase allows synthesis of a precursor ending in d-Ala-d-Ser, has only been detected in a few Enterococcus faecalis clinical isolates and confers moderate levels of resistance to vancomycin (MIC 16 mg/L), but not to teicoplanin.4,5 It is characterized by a ‘three-component’ regulatory system that includes an additional repressor (VanUG) also involved in the control of the vanG operon transcription.6 We report, to the best of our knowledge, the first clinical isolate of E. faecium harbouring a vanG operon. The genome of this strain (E. faecium 16-346) was completely sequenced and we identified in the chromosome an acquired putative mobile genetic element containing the vanG locus. Materials and methods Bacterial strains and MIC determination E. faecium 16-346 was obtained in 2016 from a faecal sample of a non-infected 40-year-old female patient hospitalized in the medical centre of Sainte-Foy-l’Argentière, France. E. faecium BM4107 and E. faecalis JH2-2 were used for filter mating experiments. MICs of 20 antibiotics (chloramphenicol, daptomycin, gentamicin, linezolid, rifampicin, trimethoprim/sulfamethoxazole, quinupristin/dalfopristin, tetracycline, erythromycin, oxacillin, ampicillin, penicillin G, vancomycin, levofloxacin, tigecycline, moxifloxacin, clindamycin, streptomycin, ciprofloxacin and nitrofurantoin) were determined using a Sensititre™ automated system (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. WGS and accession number The whole genome sequence of the E. faecium 16-346 strain was determined with PacBio technology (GATC Biotech, Konstanz, Germany). The sequence was annotated using the NCBI Prokaryotic Genome Annotation Pipeline.7 The sequence was submitted to GenBank and assigned accession number CP021849. Filter mating Transfer of vancomycin resistance from E. faecium 16-346 to E. faecium BM4107 and E. faecalis JH2-2 was attempted by filter mating. Transconjugants were selected on brain heart infusion (BHI) agar containing rifampicin (60 mg/L), fusidic acid (50 mg/L) and vancomycin (4 mg/L). Reverse-transcription quantitative PCR (RT-qPCR) experiments The expression of the vanG gene was assessed by RT-qPCR using RNA extracted from bacterial cells (OD600 of 0.5) grown in the absence or in the presence of subinhibitory concentrations of vancomycin (i.e. 1 or 2 mg/L). PCR amplification was carried out with primers specific for vanG (vanG-F: 5′-TTCGTGCAGGCTCTTCCTTT-3′; vanG-R: 5′-CACAACCGACTTCAAAGCCG-3′) or adk (housekeeping reference gene) as described previously.8 Results and discussion Characterization of E. faecium 16-346 E. faecium 16-346 was resistant to vancomycin (MIC 8 mg/L). It was also resistant to rifampicin (MIC >4 mg/L), erythromycin (MIC >4 mg/L) and tetracycline (MIC >16 mg/L), but remained susceptible to teicoplanin (MIC 0.5 mg/L) and to the other antibiotics tested. Screening by specific PCR for the presence of the vanA, vanB, vanD, vanM and vanN genes, known to confer glycopeptide resistance in this species, was negative.2 Primers specific for the other van operons not yet described in E. faecium were tested and an amplification of the vanG gene was obtained. vanG-type operons have only been found in E. faecalis clinical isolates from Australia and Canada, as well as in various Clostridium spp.4,5,9,10 In the latter, vanG did not confer vancomycin resistance, but they may, however, be considered as a possible reservoir. It has been shown that part of the microflora of the human gastrointestinal tract harbours the vanG gene.11 Indeed, from 248 rectal swab samples, Domingo et al.12 showed that 9.3% were positive for vanG, but none was associated with enterococci. Since, to our knowledge, no VanG-type E. faecium have been identified so far, we further analysed this strain by WGS. With a size of 2 736 595 bp, the genome harboured 2824 putative genes (2730 coding sequences) (Figure S1, available as Supplementary data at JAC Online). This strain was plasmid free and belonged to ST121. Search for resistance genes revealed the presence of the vanG operon, but also that of erm(Y) and msr(C), both involved in macrolide resistance, as well as that of tet(M) and tet(L) that confer tetracycline resistance (Table 1). These data were in agreement with the resistance phenotype of E. faecium 16-346. Table 1. Antimicrobial-resistance genes identified in the genome sequence of E. faecium 16-346 Gene  Percentage identity  Position in contig  Phenotype  Accession no.  vanTG  100.00a  1 442 739..1 444 877  vancomycin resistance  AY271782  vanXYG  100.00a  1 444 870..1 445 634  vancomycin resistance  AY271782  vanG  100.00a  1 445 631..1 446 680  vancomycin resistance  AY271782  vanWG  99.88a  1 446 682..1 447 527  vancomycin resistance  AY271782  vanYG  100.00b  1 447 603..1 448 442  vancomycin resistance  DQ212986  vanSG  99.82a  1 448 579..1 449 683  vancomycin resistance  AY271782  vanRG  100.00a  1 449 697..1 450 404  vancomycin resistance  AY271782  vanUG  100.00a  1 450 406..1 450 633  vancomycin resistance  AY271782  tet(M)  97.45c  1 707 444..1 709 362  tetracycline resistance  EU182585  tet(L)  99.85d  1 709 491..1 710 832  tetracycline resistance  M29725  erm(Y)  81.51e  1 715 249..1 715 977  macrolide resistance  AB014481  msr(C)  98.99f  2 006 190..2 007 668  macrolide/lincosamide/ streptogramin resistance  AY004350  Gene  Percentage identity  Position in contig  Phenotype  Accession no.  vanTG  100.00a  1 442 739..1 444 877  vancomycin resistance  AY271782  vanXYG  100.00a  1 444 870..1 445 634  vancomycin resistance  AY271782  vanG  100.00a  1 445 631..1 446 680  vancomycin resistance  AY271782  vanWG  99.88a  1 446 682..1 447 527  vancomycin resistance  AY271782  vanYG  100.00b  1 447 603..1 448 442  vancomycin resistance  DQ212986  vanSG  99.82a  1 448 579..1 449 683  vancomycin resistance  AY271782  vanRG  100.00a  1 449 697..1 450 404  vancomycin resistance  AY271782  vanUG  100.00a  1 450 406..1 450 633  vancomycin resistance  AY271782  tet(M)  97.45c  1 707 444..1 709 362  tetracycline resistance  EU182585  tet(L)  99.85d  1 709 491..1 710 832  tetracycline resistance  M29725  erm(Y)  81.51e  1 715 249..1 715 977  macrolide resistance  AB014481  msr(C)  98.99f  2 006 190..2 007 668  macrolide/lincosamide/ streptogramin resistance  AY004350  a Identity with the homologous gene from E. faecalis BM4518. b Identity with the homologous gene from E. faecalis G1-0247. c Identity with the homologous gene from Streptococcus suis T2S3. d Identity with the homologous gene from the pLS1 plasmid of Streptococcus agalactiae. e Identity with the homologous gene from the pMS97 plasmid of Staphylococcus aureus RN4220. f Identity with the homologous gene from E. faecium TX2465. Analysis of the vanG operon The sequence of the vanG operon was very similar to those from E. faecalis BM4518, WCH9 and G1-0247 (Figure 1).4,5,13 Indeed, the van genes (UG, RG, SG, YG, WG, G, XYG and TG) were between 99.82% and 100% identical (Table 1). Thus, after VanN, VanG is the second ligase able to synthesize d-Ala-d-Ser-ending precursors in E. faecium.14 This is consistent with low-level vancomycin resistance (MIC 8–16 mg/L), since the precursors ending with d-Ala-d-Ser present only a 7-fold lower affinity for the antibiotic.15 In vanYG of E. faecalis BM4518, a frameshift mutation is present.13 In E. faecium, vanYG has no mutations, as in the vanYG from E. faecalis G1-0247 strain.5 Figure 1. View largeDownload slide Schematic of the chromosome region harbouring the vanG operon of E. faecium 16-346, compared with the corresponding region of E. faecalis BM4518. DR-L, left DR; DR-R, right DR; IR-L, left IR; IR-R, right IR. Figure 1. View largeDownload slide Schematic of the chromosome region harbouring the vanG operon of E. faecium 16-346, compared with the corresponding region of E. faecalis BM4518. DR-L, left DR; DR-R, right DR; IR-L, left IR; IR-R, right IR. Twenty-two bp imperfect IRs framed the mobile genetic element (Figure 1). In E. faecalis BM4518, the element is 240 kb long, whereas, in E. faecium, its size was 45.5 kb comprising 43 genes (Table S1). Of note, the sequence of the left IR was identical to that of E. faecalis G1-0247 (CGGTAGTACTTCTTTCCCACAA) and diverged from that of BM4518 by 2 bases (CGGTGGTACTGCTTTCCCACAA).5,13 Surprisingly, the sequence of the left DR (TGGA) was not the same as the TTGA sequence of the right DR (Figure 1). Based on the sequence of the reference strain E. faecium AUS 0004, TGGA appears as the motif present in the gene in which the element has been inserted.16 It may be hypothesized that the target site of integration could be only the GA 2 bp sequence. To date, in E. faecalis, two types of vanG operon have been characterized, one from strains BM4518, WCH9 and G1-0247 (vanG) and another from N03-0233 (vanG2), lacking the vanYG gene and showing also a 2 bp (CA) DR.5 Interestingly, in all the VanG-type strains (clinical isolates or transconjugants) insertion of the vanG cluster systematically occurred in the gene encoding an RNA methyltransferase, whereas vanG2 is located in the dctP gene (encoding a subunit of the TRAP dicarboxylate transporter).13 This was not observed in E. faecium where the element was integrated in a gene encoding a hypothetical protein (annotated EFAU004_00391) (Figure 1). Attempts to transfer and inducibility of expression of the vanG operon We were unable to transfer vancomycin resistance from E. faecium 16-346 to E. faecium BM4107 and E. faecalis JH2-2. Similarly, McKessar et al.4 failed to transfer vanG operons from E. faecalis to E. faecium. In E. faecalis BM4518, erm(B) was co-transferred with vanG and transconjugants could only be obtained on erythromycin-containing plates.13 In E. faecium 16-346, the mobile genetic element did not harbour erm(B) and macrolide resistance was likely due to the presence of the erm(Y) and msr(C) genes located 231 and 522 kb downstream, respectively (Table 1). As in E. faecalis G1-0247 and N03-0233, it may be possible that the experimental conditions were not adapted. In order to test if vanG expression was inducible, RT-qPCR experiments were carried out from cells grown with 0, 1 or 2 mg/L vancomycin (1 and 2 mg/L vancomycin corresponding to ⅛ and ¼ of MIC, respectively). As expected, vanG transcription was increased 3- and 5-fold (P < 0.05) in the presence of 1 and 2 mg/L antibiotic, respectively. This strongly suggests that transcriptional regulation may be similar to that of E. faecalis where the repressor VanUG and the activator VanRG (both present in E. faecium) compete for the same PYG promoter leading to rheostatic control of vanG operon expression.6 Conclusions To our knowledge, this is the first report of a vanG-type locus acquired by a strain of E. faecium. This points out that the surveillance of VREF remains crucial to overcome the spread of this major opportunistic pathogen. Acknowledgements We thank M. Auzou for excellent technical assistance. Funding This work was supported by internal funding. Transparency declarations None to declare. Supplementary data Figure S1 and Table S1 are available as Supplementary data at JAC Online. References 1 Arias CA, Murray BE. The rise of the Enterococcus: beyond vancomycin resistance. Nat Rev Microbiol  2012; 10: 266– 78. Google Scholar CrossRef Search ADS PubMed  2 Cattoir V, Giard JC. Antibiotic resistance in Enterococcus faecium clinical isolates. Expert Rev Anti Infect Ther  2014; 12: 239– 48. Google Scholar CrossRef Search ADS PubMed  3 Depardieu F, Podglajen I, Leclercq R et al.   Modes and modulations of antibiotic resistance gene expression. Clin Microbiol Rev  2007; 20: 79– 114. Google Scholar CrossRef Search ADS PubMed  4 McKessar SJ, Berry AM, Bell JM et al.   Genetic characterization of vanG, a novel vancomycin resistance locus of Enterococcus faecalis. Antimicrob Agents Chemother  2000; 44: 3224– 8. Google Scholar CrossRef Search ADS PubMed  5 Boyd DA, Du T, Hizon R et al.   VanG-type vancomycin-resistant Enterococcus faecalis strains isolated in Canada. Antimicrob Agents Chemother  2006; 50: 2217– 21. Google Scholar CrossRef Search ADS PubMed  6 Depardieu F, Mejean V, Courvalin P. Competition between VanUG repressor and VanRG activator leads to rheostatic control of vanG vancomycin resistance operon expression. PLoS Genet  2015; 11: e1005170. Google Scholar CrossRef Search ADS PubMed  7 Angiuoli SV, Gussman A, Klimke W et al.   Toward an online repository of standard operating procedures (SOPs) for (meta)genomic annotation. Omics  2008; 12: 137– 41. Google Scholar CrossRef Search ADS PubMed  8 Sinel C, Cacaci M, Meignen P et al.   Subinhibitory concentrations of ciprofloxacin enhance antimicrobial resistance and pathogenicity of Enterococcus faecium. Antimicrob Agents Chemother  2017; 61: e02763- 16. Google Scholar CrossRef Search ADS PubMed  9 Berthet N, Périchon B, Mazuet C et al.   A vanG-type locus in Clostridium argentinense. J Antimicrob Chemother  2015; 70: 1942– 5. Google Scholar CrossRef Search ADS PubMed  10 Peltier J, Courtin P, El Meouche I et al.   Genomic and expression analysis of the vanG-like gene cluster of Clostridium difficile. Microbiology  2013; 159: 1510– 20. Google Scholar CrossRef Search ADS PubMed  11 Domingo MC, Huletsky A, Giroux R et al.   vanD and vanG-like gene clusters in a Ruminococcus species isolated from human bowel flora. Antimicrob Agents Chemother  2007; 51: 4111– 7. Google Scholar CrossRef Search ADS PubMed  12 Domingo MC, Huletsky A, Giroux R et al.   High prevalence of glycopeptide resistance genes vanB, vanD, and vanG not associated with enterococci in human fecal flora. Antimicrob Agents Chemother  2005; 49: 4784– 6. Google Scholar CrossRef Search ADS PubMed  13 Depardieu F, Bonora MG, Reynolds PE et al.   The vanG glycopeptide resistance operon from Enterococcus faecalis revisited. Mol Microbiol  2003; 50: 931– 48. Google Scholar CrossRef Search ADS PubMed  14 Lebreton F, Depardieu F, Bourdon N et al.   d-Ala-d-Ser VanN-type transferable vancomycin resistance in Enterococcus faecium. Antimicrob Agents Chemother  2011; 55: 4606– 12. Google Scholar CrossRef Search ADS PubMed  15 Courvalin P. Vancomycin resistance in Gram-positive cocci. Clin Infect Dis  2006; 42 Suppl 1: S25– 34. Google Scholar CrossRef Search ADS PubMed  16 Lam MM, Seemann T, Bulach DM et al.   Comparative analysis of the first complete Enterococcus faecium genome. J Bacteriol  2012; 194: 2334– 41. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2018. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Journal

Journal of Antimicrobial ChemotherapyOxford University Press

Published: Apr 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off