Functional analysis of arginine decarboxylase gene speA of Bacteroides dorei by markerless gene deletion

Functional analysis of arginine decarboxylase gene speA of Bacteroides dorei by markerless gene... Abstract Polyamine concentrations in the intestine are regulated by their biosynthesis by hundreds of gut microbial species and these polyamines are involved in host health and disease. However, polyamine biosynthesis has not been sufficiently analyzed in major members of the human gut microbiota, possibly owing to a lack of gene manipulation systems. In this study, we successfully performed markerless gene deletion in Bacteroides dorei, one of the major members of the human gut microbiota. The combination of a thymidine kinase gene (tdk) deletion mutant and a counter-selection marker tdk, which has been applied in other Bacteroides species, was used for the markerless gene deletion. Deletion of tdk in B. dorei caused 5-fluoro-2΄-deoxyuridine resistance, suggesting the utility of B. dorei Δtdk as the host for future markerless gene deletions. Compared to parental strains, an arginine decarboxylase gene (speA) deletion mutant generated in this system showed a severe growth defect and decreased concentration of spermidine in the cells and culture supernatant. Collectively, our results indicate the accessibility of gene deletion and the important role of speA in polyamine biosynthesis in B. dorei. arginine decarboxylase, Bacteroides dorei, gene manipulation system, gut microbe, polyamine, spermidine INTRODUCTION Polyamines such as putrescine, spermidine and spermine are aliphatic amines containing two or more amino groups and are found in most organisms (Tabor and Tabor 1985; Michael 2015). They are also some of the main metabolites in the intestine. The intestinal polyamines are produced by hundreds of gut microbial species (Noack et al.1998; Matsumoto et al.2012) and are thought to play a key role in biological processes (e.g. the regulation of transcription and translation (Miller-Fleming et al.2015)) in host cells and gut microbial cells. Furthermore, intestinal polyamines are believed to be involved in host health and disease. As an example, higher levels of polyamines are known to be present in the colon mucosa from cancer patients than in that from normal individuals (Upp et al.1988). However, enhanced polyamine production from intestinal bacteria has been reported to lead to anti-aging effects in hosts (Matsumoto et al.2011; Kibe et al.2014). Considering the important roles of polyamines in the intestine, an understanding of polyamine biosynthesis by gut microbes and the sophisticated regulation of polyamine concentrations in the intestine is essential. To date, most studies on polyamine biosynthesis have focused on minor bacterial species in the human intestine such as Escherichia coli (Tabor and Tabor 1985). When using arginine as a starting substrate, putrescine is produced by sequential reactions catalyzed by SpeA (arginine decarboxylase) and SpeB (agmatine ureohydrolase) in E. coli (Tabor and Tabor 1985). Spermidine is then synthesized by SpeE (spermidine synthase) through the addition of the aminopropyl group of decarboxylated S-adenosylmethionine (Tabor and Tabor 1985). Recently, various species of major human gut microbes including Bacteroides species were predicted to have a unique polyamine biosynthetic pathway featuring enzymes different from those in E. coli (i.e. AIH, agmatine deiminase/iminohydrolase; NCPAH, N-carbamoylputrescine amidohydrolase; CASDH, carboxyspermidine dehydrogenase and CASDC, carboxyspermidine decarboxylase). The common enzyme arginine decarboxylase, SpeA, is expected to be conserved (Fig. 1; Hanfrey et al.2011; Sakanaka et al.2016; Sugiyama et al.2017). In these major gut microbial species, spermidine tends to be the main polyamine (Hosoya and Hamana 2004; Hamana et al.2008; Sakanaka et al.2016; Sugiyama et al.2017). Figure 1. View largeDownload slide Predicted polyamine biosynthetic pathway in various major species of human gut microbes including B. dorei JCM 13471T. Enzyme names are indicated by white characters in gray boxes. AIH, agmatine deiminase/iminohydrolase; CASDC, carboxyspermidine decarboxylase; CASDH, carboxyspermidine dehydrogenase; NCPAH, N-carbamoylputrescine amidohydrolase; SpeA, arginine decarboxylase. Figure 1. View largeDownload slide Predicted polyamine biosynthetic pathway in various major species of human gut microbes including B. dorei JCM 13471T. Enzyme names are indicated by white characters in gray boxes. AIH, agmatine deiminase/iminohydrolase; CASDC, carboxyspermidine decarboxylase; CASDH, carboxyspermidine dehydrogenase; NCPAH, N-carbamoylputrescine amidohydrolase; SpeA, arginine decarboxylase. In a previous study, we revealed that Bacteroides thetaiotaomicron, a model human gut microbe, produces cellular spermidine; carboxyspermidine decarboxylase (Fig. 1) is essential for converting carboxyspermidine to spermidine (Sakanaka et al.2016). However, polyamine biosynthesis has not been sufficiently analyzed in other Bacteroides species. This is partly because gene disruption methods have only been applied to limited species of Bacteroides (Baughn and Malamy 2002; Koropatkin et al.2008; Ichimura et al.2010; Lee et al.2013; Kino et al.2016; Rakoff-Nahoum, Foster and Comstock 2016; Wexler et al.2016). In Bacteroides species including B. thetaiotaomicron, a combination of thymidine kinase gene (tdk) deletion strain and a counter-selection marker, tdk, is frequently utilized for the efficient selection of second-crossover recombinants and markerless gene deletion (Koropatkin et al.2008; Wexler et al.2016). In this study, we applied this markerless gene deletion system to Bacteroides dorei (Bakir et al.2006), which is one of the major members of the human gut microbiota (Qin et al.2010), and has recently been characterized as an immunologically important gut microbe that may preclude certain aspects of immune education in children (Vatanen et al.2016). Furthermore, to demonstrate the usefulness of the established system for B. dorei, we disrupted the speA gene (Fig. 1), which is predicted to be involved in polyamine biosynthesis, and revealed that speA contributes to not only the growth ability but also the biosynthesis of spermidine, a final polyamine product present in B. dorei cells and the culture supernatant. MATERIALS AND METHODS Bacterial strain, plasmid and culture conditions The bacterial strains, plasmids, and primers used in this study are indicated in Table 1. Bacteroides dorei was anaerobically grown at 37°C in an anaerobic chamber InvivO2 400 (10% CO2, 10% H2 and 80% N2; Ruskinn Technology Ltd, Bridgend, UK). The media used to culture B. dorei were as follows: Gifu anaerobic medium (Nissui Pharmaceutical Co., Ltd, Tokyo, Japan), brain heart infusion (BHI) agar medium (Sigma-Aldrich Corp., St. Louis, MO, USA) supplemented with 10% horse blood (Nippon Bio-Supp. Center, Tokyo, Japan; BHI-blood agar medium) and a synthetic medium (Sakanaka et al.2016) supplemented with 10% (v/v) Gifu anaerobic medium (hereafter termed as polyamine-reduced medium [The polyamine concentrations are approximately 3 μM putrescine, 2 μM spermidine and 1 μM spermine, and are ten times lower than those present in original GAM]). Escherichia coli was aerobically grown at 37°C in Luria-Bertani medium, and the strain CC118 λpir (Herrero, de Lorenzo and Timmis 1990) was used as the cloning host. When necessary, the following antibiotics and nucleotide analogue were added to the medium: ampicillin (100 μg/mL), erythromycin (25 μg/mL), gentamycin (200 μg/mL) and 5-fluoro-2΄-deoxyuridine (FUdR, 200 μg/mL). Table 1. Bacterial strains, plasmids and primers used in this study. Strain, plasmid or primer  Descriptiona or sequence (5‘−3’)b  Reference or source  Escherichia coli      CC118 λpir  Δ(ara-leu), araD, ΔlacX74, galE, galK, phoA20, thi-1, rpsE, rpoB, argE(Am), recA1, λpir lysogen  Herrero, de Lorenzo and Timmis (1990)  S17-1 λpir  F−, thi, pro, hsdR, RP4-2 (Tc::Mu; Km::Tn7), λpir lysogen  National BioResource Project (NIG, Japan)  Bacteroides dorei  JCM 13471T  Wild type, GmR, FUdRS  Japan Collection of Microorganisms  MS416  Δtdk, GmR, FUdRR  This study  MS531  Δtdk ΔspeA, GmR, FUdRR  This study  Plasmid  pExchange-tdk  Plasmid for gene deletion, RP4 oriT/oriR6K, ApR, EmR, FUdRS  Koropatkin et al. (2008)  pKNOCK-bla-ermGb  RP4 oriT/oriR6K, ApR, EmR  Koropatkin et al. (2008)  pMSK42  Plasmid for tdk deletion, RP4 oriT/oriR6K, ApR, EmR  This study  pMSK61  Plasmid for speA deletion, RP4 oriT/oriR6K, ApR, EmR, FUdRS  This study  Primer  Pr-188  gtggatcccccgggcgaaacaggcctttcggcac    Pr-189  agcataaagcatatgaattttgatgtaacaatata    Pr-190  catatgctttatgctgcaga    Pr-191  ccccctcgaggtcgaaaaccgaaaccgatagctaa    Pr-196  gaagtcaataaagctacagataacaac    Pr-197  agataataggatgatggcaggattc    Pr-280  taacattcgagtcgattaagtctggaggcttgttt    Pr-281  ttctctttcatgttattcttcttctgtacaaagag    Pr-282  taacatgaaagagaaactgactatc    Pr-283  tatcgataccgtcgatcactaatggctgatgctaa    Pr-305  ccgatggagatttctttgga    Pr-306  cctccgcttcagcactattc    Pr-608  ctatctaaagcacgaggaggtaaa    Pr-609  ccaaggcagacatacggatag    Pr-612  gcgagataaagatagctggaaaaga    Pr-613  tcaaatgaggaaacaaagcatacttc    Pr-614  cgtaatatggacgcctgtggtt    Pr-615  gcagcaggaccgaaaaaataac    Strain, plasmid or primer  Descriptiona or sequence (5‘−3’)b  Reference or source  Escherichia coli      CC118 λpir  Δ(ara-leu), araD, ΔlacX74, galE, galK, phoA20, thi-1, rpsE, rpoB, argE(Am), recA1, λpir lysogen  Herrero, de Lorenzo and Timmis (1990)  S17-1 λpir  F−, thi, pro, hsdR, RP4-2 (Tc::Mu; Km::Tn7), λpir lysogen  National BioResource Project (NIG, Japan)  Bacteroides dorei  JCM 13471T  Wild type, GmR, FUdRS  Japan Collection of Microorganisms  MS416  Δtdk, GmR, FUdRR  This study  MS531  Δtdk ΔspeA, GmR, FUdRR  This study  Plasmid  pExchange-tdk  Plasmid for gene deletion, RP4 oriT/oriR6K, ApR, EmR, FUdRS  Koropatkin et al. (2008)  pKNOCK-bla-ermGb  RP4 oriT/oriR6K, ApR, EmR  Koropatkin et al. (2008)  pMSK42  Plasmid for tdk deletion, RP4 oriT/oriR6K, ApR, EmR  This study  pMSK61  Plasmid for speA deletion, RP4 oriT/oriR6K, ApR, EmR, FUdRS  This study  Primer  Pr-188  gtggatcccccgggcgaaacaggcctttcggcac    Pr-189  agcataaagcatatgaattttgatgtaacaatata    Pr-190  catatgctttatgctgcaga    Pr-191  ccccctcgaggtcgaaaaccgaaaccgatagctaa    Pr-196  gaagtcaataaagctacagataacaac    Pr-197  agataataggatgatggcaggattc    Pr-280  taacattcgagtcgattaagtctggaggcttgttt    Pr-281  ttctctttcatgttattcttcttctgtacaaagag    Pr-282  taacatgaaagagaaactgactatc    Pr-283  tatcgataccgtcgatcactaatggctgatgctaa    Pr-305  ccgatggagatttctttgga    Pr-306  cctccgcttcagcactattc    Pr-608  ctatctaaagcacgaggaggtaaa    Pr-609  ccaaggcagacatacggatag    Pr-612  gcgagataaagatagctggaaaaga    Pr-613  tcaaatgaggaaacaaagcatacttc    Pr-614  cgtaatatggacgcctgtggtt    Pr-615  gcagcaggaccgaaaaaataac    aApR, ampicilin resistance; EmR, erythromycin resistance; GmR, gentamycin resistance; FUdRR, 5-fluoro-2΄-deoxyuridine resistance; FUdRS, 5-fluoro-2΄-deoxyuridine susceptibility. bSequences for In-Fusion cloning are indicated by single line. View Large Generation of tdk deletion strain of B. dorei As tdk confers FUdR sensitivity and is utilized as a counter-selection marker for markerless gene deletion in Bacteroides species (Koropatkin et al.2008; Wexler et al.2016), tdk of B. dorei JCM 13471T was disrupted by double-crossover recombination (Fig. S1a, Supporting Information). The plasmid pMSK42 for tdk deletion was constructed by inserting the upstream and downstream regions of the tdk gene into PstI- and SalI-digested pKNOCK-bla-ermGb (Koropatkin et al.2008) using an In-Fusion HD cloning kit (Clontech Laboratories, Inc., Mountain View, CA, USA). These upstream and downstream regions of the tdk gene were PCR-amplified from the B. dorei JCM 13471T genome using the primer pairs Pr-188/Pr-189 and Pr-190/Pr-191, respectively. The resulting suicide plasmid pMSK42 was transferred from E. coli S17-1 λpir (donor) to B. dorei JCM 13471T (recipient) by bacterial conjugation as previously described (Sakanaka et al.2016); bacterial conjugation was performed by incubating a mixed culture of E. coli and B. dorei on BHI-blood agar medium. The whole colonies generated were suspended in 4 mL of liquid Gifu anaerobic medium, and then the integrant of pMSK42 into tdk locus (first-crossover recombinant) was selected by spreading the suspension on BHI-blood agar medium containing erythromycin and gentamycin. It should be noted that B. dorei is naturally resistant to gentamycin, but E. coli is not. Subsequently, second-crossover recombinants were selected by spreading the overnight culture of the first-crossover recombinant onto BHI-blood agar medium containing FUdR, and deletion of the tdk gene was verified by PCR using the primer pair Pr-196/Pr-197. Generation of speA deletion mutant of B. dorei The plasmid for speA deletion was constructed by inserting the upstream and downstream regions of the speA gene into SalI-digested pExchange-tdk (Koropatkin et al.2008) using an In-Fusion HD cloning kit (Clontech). These upstream and downstream regions of the speA gene were amplified by PCR from the B. dorei JCM 13471T genome using the primer pairs Pr-280/Pr-281 and Pr-282/Pr-283, respectively. The resulting suicide plasmid pMSK61 was introduced into B. dorei Δtdk (hereafter referred to MS416) by conjugational transfer, and the Δtdk ΔspeA mutant (hereafter referred to MS531) was generated by second-crossover recombination as described in the previous section (Fig. S1b, Supporting Information). The deletion of speA was verified by PCR using the primer pair Pr-305/Pr-306. Polyamine analysis by high-performance liquid chromatography Bacteroides dorei was cultured with initial optical density at 600 nm of 0.03 in polyamine-reduced medium, and growth was monitored by measuring optical density at 600 nm using a spectrophotometer. The cells and culture supernatant were collected by centrifugation of the cultures withdrawn at indicated times. Polyamines in the cells and culture supernatant of B. dorei were analyzed by high-performance liquid chromatography as described previously (Sakanaka et al.2016). The polyamine concentrations in the culture supernatant were determined in μM. The polyamine concentrations in the cells were corrected based on cellular protein concentration, which was determined by the Bradford method as described previously (Sakanaka et al.2016); the concentration was determined as nmol/(mg cellular protein). Reverse transcription-quantitative PCR Bacteroides dorei cells were grown to an exponential phase in polyamine-reduced medium (optical density at 600 nm of 0.5–0.6), harvested by centrifuging 1.4 mL of the cultures and resuspended in 700 μL of the RNAlater solution (Thermo Fischer Scientific Inc., Waltham, MA, USA). Total RNAs were isolated using the RiboPure-Bacteria kit (Thermo Fischer Scientific), and cDNA synthesis was performed using PrimeScript RT Master Mix (Takara Bio Inc., Shiga, Japan). Reverse transcription-quantitative PCR (RT-qPCR) was performed by SYBR Green system using TB Green Premix Ex Taq II (Takara Bio) and the following primer pairs: Pr-612/Pr-613 for potA; Pr-614/Pr-615 for potD; and Pr-608/Pr-609 for RNA polymerase gene of σ70 factor. The RNA polymerase gene was used as a reference gene (Li, Mandal and Rosen 2016). RESULTS AND DISCUSSION Markerless gene deletion of tdk and speA in B. dorei JCM 13471T Markerless gene deletion by double-crossover recombination has been performed in many bacterial species for gene function analysis (Koropatkin et al.2008; Okibe et al.2011; Hirayama et al.2012). However, an extremely low frequency of second-crossover recombination is a common obstacle to markerless gene deletion (Hirayama et al.2012), and efficient selection systems for second-crossover recombinants are desired. One effective approach is the utilization of counter-selection markers. Because the introduction of a tdk gene into the FUdR-resistant Δtdk strain of Bacteroides thetaiotaomicron confers FUdR sensitivity (Koropatkin et al.2008), application of the tdk gene as a counter-selection marker in Δtdk strains of various Bacteroides species or strains will facilitate selection for the generation of second-crossover recombinants (Fig. S1b, Supporting Information). To achieve this, we performed markerless gene deletion of tdk in Bacteroides dorei JCM 13471T (Fig. S1a, Supporting Information). When pMSK42 carrying the upstream and downstream regions of the tdk gene was introduced into B. dorei JCM 13471T by bacterial conjugation, erythromycin- and gentamycin-resistant transformants were obtained. Among 13 tested transformants, insertion of pMSK42 into the tdk locus (first-crossover recombinants) was observed in 11 transformants by PCR (data not shown). Subsequently, the first-crossover recombinant was grown on BHI-blood agar medium containing FUdR to select the second-crossover recombinant MS416 (Δtdk). Note that MS416 (Δtdk) can be positively selected on FUdR because deletion of tdk from the first-crossover recombinant confers FUdR resistance (Fig. S1a, Supporting Information). Deletion of the tdk gene was confirmed by PCR (Fig. 2a) in 7 strains among the 11 tested FUdR-resistant strains (data not shown). Bacteroides dorei JCM 13471T (tdk+) and MS416 (Δtdk) were sensitive and resistant to FUdR, respectively (Fig. 2b), confirming the potential of the tdk gene as a counter-selection marker. Figure 2. View largeDownload slide FUdR resistance of B. dorei strains. (a) Electrophoretic analysis of the tdk locus amplified by PCR using the primer pair Pr-196/Pr-197 (black arrows). Lane M, Gene Ladder Wide 1 (NIPPON GENE) as a molecular weight marker; lane JCM 13471T, the tdk locus from B. dorei JCM 13471T; lane Δtdk, the tdk locus from MS416 (Δtdk). (b) FUdR resistance analysis of B. dorei JCM 13471T and MS416 (Δtdk) on Gifu anaerobic agar medium containing FUdR. Figure 2. View largeDownload slide FUdR resistance of B. dorei strains. (a) Electrophoretic analysis of the tdk locus amplified by PCR using the primer pair Pr-196/Pr-197 (black arrows). Lane M, Gene Ladder Wide 1 (NIPPON GENE) as a molecular weight marker; lane JCM 13471T, the tdk locus from B. dorei JCM 13471T; lane Δtdk, the tdk locus from MS416 (Δtdk). (b) FUdR resistance analysis of B. dorei JCM 13471T and MS416 (Δtdk) on Gifu anaerobic agar medium containing FUdR. Bacteroides dorei has a different polyamine biosynthetic pathway than Escherichia coli (Fig. 1) (Sugiyama et al.2017). In this study, speA was disrupted in B. dorei to investigate the role of SpeA in this pathway (Fig. S1b, Supporting Information). When pMSK61 for speA deletion was introduced into MS416 (Δtdk), erythromycin- and gentamycin-resistant transformants were generated. Among 5 transformants, 1 transformant was confirmed to harbor the insertion of pMSK61 into the speA locus by PCR (data not shown). The integrant containing pMSK61 in the speA locus was then grown on BHI-blood agar medium containing FUdR to select FUdR resistant strains. Deletion of the speA gene was confirmed by PCR (Fig. 3) in 3 strains among the 6 tested FUdR−resistant strains (data not shown). The remaining 3 strains were shown to be revertants containing speA by PCR (data not shown). These results indicate that the combination of MS416 (Δtdk) and a counter-selection marker, tdk, facilitates the generation of second-crossover recombinants, and allows for markerless gene deletion in B. dorei. Because B. dorei has been reported to be an immunologically important gut microbe that may preclude early immune education (Vatanen et al.2016), the successful establishment of markerless gene deletions in B. dorei will be valuable for understanding the roles of different genes in immunology. Figure 3. View largeDownload slide Electrophoretic analysis of the speA locus. Electrophoretic analysis of the speA locus amplified by PCR using the primer pair Pr-305/Pr-306 (black arrows) was performed. Lane M, Gene Ladder Wide 1 (NIPPON GENE) as a molecular weight marker; lane Δtdk, the speA locus from MS416 (Δtdk); lane Δtdk ΔspeA, the speA locus from MS531 (Δtdk ΔspeA). Figure 3. View largeDownload slide Electrophoretic analysis of the speA locus. Electrophoretic analysis of the speA locus amplified by PCR using the primer pair Pr-305/Pr-306 (black arrows) was performed. Lane M, Gene Ladder Wide 1 (NIPPON GENE) as a molecular weight marker; lane Δtdk, the speA locus from MS416 (Δtdk); lane Δtdk ΔspeA, the speA locus from MS531 (Δtdk ΔspeA). Deletion of tdk has no effect on growth or spermidine production in B. dorei Contribution of tdk to the growth and spermidine biosynthesis of B. dorei was analyzed by the gene deletion method. First, a synthetic medium lacking polyamines for B. thetaiotaomicron (Sakanaka et al.2016) was employed for culturing B. dorei JCM 13471T, but no obvious growth was observed; this could be due to a lack of ingredients that are currently unknown but are important for the growth of B. dorei (data not shown). A final concentration of 10% (v/v) Gifu anaerobic medium was then added to the synthetic medium to supplement the potentially missing ingredients, and this polyamine-reduced medium (containing approximately 3 μM putrescine, 2 μM spermidine and 1 μM spermine) was used. When B. dorei strains were grown in polyamine-reduced medium, the same growth curve was observed for JCM 13471T and MS416 (Δtdk; Fig. 4a). The spermidine concentration in cells and culture supernatant was almost the same in both JCM 13471T and MS416 (Δtdk; Fig. 4b and c). These data suggest that deletion of tdk does not cause any obvious physiological effects on B. dorei grown in polyamine-reduced medium, and MS416 (Δtdk) has no noticeable disadvantage as a host for gene deletion in the context of studying polyamine biosynthetic genes. In fact, the Δtdk strains of other Bacteroides species have been utilized in vivo in murine models as well as in vitro for functional analysis of various genes (Degnan et al.2014; Wexler et al.2016). Figure 4. View largeDownload slide Growth, spermidine concentration, and RT-qPCR analyses of B. dorei strains in the polyamine-reduced medium. (a) Growth curve of B. dorei grown in the polyamine-reduced medium. B. dorei JCM 13471T is indicated by shaded square. MS416 (Δtdk) and MS531 (Δtdk ΔspeA) strains are shown by the white and black circles, respectively. (b) Intracellular spermidine concentration from B. dorei. Cells withdrawn after being cultured for 24 h (Fig. 4a) were analyzed by high-performance liquid chromatography. (c) Spermidine concentration in the culture supernatant. The culture supernatant was withdrawn at the indicated times and analyzed by high-performance liquid chromatography. The symbols indicate the same strains as Fig. 4a. (d) RT-qPCR analysis of spermidine transporter genes potA and potD in MS416 (Δtdk; white bars) and MS531 (Δtdk ΔspeA; black bars) strains. Relative expression levels are represented as the proportion of potA and potD transcripts among those of the RNA polymerase gene of σ70 factor. Data are shown as the mean ± standard deviation (n = 3), and asterisks indicate the significant difference of the relative expression levels between strains (**P < 0.01; Student's two-tailed t-test). Figure 4. View largeDownload slide Growth, spermidine concentration, and RT-qPCR analyses of B. dorei strains in the polyamine-reduced medium. (a) Growth curve of B. dorei grown in the polyamine-reduced medium. B. dorei JCM 13471T is indicated by shaded square. MS416 (Δtdk) and MS531 (Δtdk ΔspeA) strains are shown by the white and black circles, respectively. (b) Intracellular spermidine concentration from B. dorei. Cells withdrawn after being cultured for 24 h (Fig. 4a) were analyzed by high-performance liquid chromatography. (c) Spermidine concentration in the culture supernatant. The culture supernatant was withdrawn at the indicated times and analyzed by high-performance liquid chromatography. The symbols indicate the same strains as Fig. 4a. (d) RT-qPCR analysis of spermidine transporter genes potA and potD in MS416 (Δtdk; white bars) and MS531 (Δtdk ΔspeA; black bars) strains. Relative expression levels are represented as the proportion of potA and potD transcripts among those of the RNA polymerase gene of σ70 factor. Data are shown as the mean ± standard deviation (n = 3), and asterisks indicate the significant difference of the relative expression levels between strains (**P < 0.01; Student's two-tailed t-test). speA is required for normal growth and spermidine biosynthesis of B. dorei Although speA is conserved among various species of dominant human gut microbes (Sugiyama et al.2017) and is mainly studied in E. coli (Tabor and Tabor 1985), the genetic function of speA has not been sufficiently analyzed in major members of the human gut microbiota. The contribution of speA to growth of B. dorei was analyzed by the gene deletion method. When compared to JCM 13471T and MS416 (Δtdk), MS531 (Δtdk ΔspeA) showed a severe growth defect in polyamine-reduced medium (Fig. 4a). This result is consistent with many previous studies that disruption of polyamine biosynthetic genes including speA leads to delayed growth in various bacterial species (Patel et al.2006; Hanfrey et al.2011; Sakanaka et al.2016). Because speA encodes a putative arginine decarboxylase, an enzyme necessary for spermidine biosynthesis in cells, intracellular spermidine concentration in B. dorei strains was investigated next. In contrast to the presence of intracellular spermidine as the sole polyamine in JCM 13471T and MS416 (Δtdk), spermidine was barely detected in MS531 (Δtdk ΔspeA; Fig. 4b). These findings indicate that speA is the main gene involved in the spermidine biosynthetic pathway of B. dorei. According to the in silico analysis, B. dorei JCM 13471T has only one spermidine biosynthetic pathway shown in Fig. 1 (i.e. this organism has neither spermidine biosynthetic pathway via aminopropylagmatine found in some archaea nor the pathway composed of ornithine decarboxylase and spermidine synthase; Sugiyama et al.2017). Therefore, although there is a possibility that B. dorei has completely novel pathway, the remaining intracellular spermidine level in MS531 (Δtdk ΔspeA) may be attributable to the spermidine import from polyamine-reduced medium via a predicted ATP-binding cassette transporter of spermidine, PotABCD (Furuchi et al.1991; Sugiyama et al.2017). This prediction was strongly supported by the RT q-PCR assay, in which more upregulated expression levels of potA (ATP-binding protein) and potD (solute-binding protein) were observed in MS531 (Δtdk ΔspeA), than in MS416 (Δtdk; Fig. 4d). It is noteworthy that no other polyamines except for spermidine were observed in the cells of all strains in this study. Recently, we reported that spermidine is detected in culture supernatant as well as cells of B. dorei, suggesting the export of spermidine biosynthesized in cells (Sugiyama et al.2017). This characteristic was observed in the limited species among major members of the human gut microbiota (Sugiyama et al.2017) and may contribute to the increase in spermidine concentration in the host intestine. The concentration of spermidine in the culture supernatant was increased along with the culture time of JCM 13471T and MS416 (Δtdk; Fig. 4c). However, no spermidine was observed in the culture supernatant of MS531 (Δtdk ΔspeA) (Fig. 4c). This result strongly suggests that spermidine biosynthesis by speA in cells is essential for the increased spermidine level in the extracellular environment, such as in the intestinal lumen. The effect of the spermidine biosynthesis of B. dorei on intestinal polyamine concentrations should be revealed by a future work using a murine model. CONCLUDING REMARKS Hundreds of microbial species inhabit the intestine of humans and produce various metabolites (Matsumoto et al.2012). Polyamines are one of the major metabolites produced by gut microbes; they are believed to exert both beneficial and harmful effects on host health (Upp et al.1988; Matsumoto et al.2011; Kibe et al.2014). Currently, the molecular mechanisms of polyamine biosynthesis by gut microbes, particularly major members of the human gut microbiota, are largely unexplored. In this study, we successfully performed markerless speA deletion in a major human gut microbe, Bacteroides dorei, by using the MS416 (Δtdk) and counter-selection marker tdk, which has been previously established in other Bacteroides species (Koropatkin et al.2008; Wexler et al.2016). We also revealed the importance of the speA gene on polyamine biosynthesis in B. dorei: speA is the main gene contributing to the presence of spermidine in the culture supernatant and in cells. Although elucidation of the spermidine export mechanisms to the extracellular environment remains unknown, our results shed light on how the intestinal polyamines are regulated by gut microbes. Furthermore, because B. dorei is an immunologically important gut microbe (Vatanen et al.2016), the established markerless gene deletion system will be widely applicable in various studies of B. dorei. SUPPLEMENTARY DATA Supplementary data are available at FEMSLE online. Acknowledgements We acknowledge Dr Thomas J. Smith (Donald Danforth Plant Science Center, USA) and Dr Nicole Koropatkin (University of Michigan Medical School, USA) for providing us with pKNOCK-bla-ermGb and pExchange-tdk. We are grateful to the National BioResource Project (NIG, Japan) for providing us with Escherichia coli S17-1 λpir. FUNDING This work was partly supported by Grants-in-Aid from the Institute for Fermentation, Osaka (K-25-04 to SK and MS) and Asahi Glass foundation (to SK). Conflict of interest. None declared. REFERENCES Bakir MA, Sakamoto M, Kitahara M et al.   Bacteroides dorei sp. nov., isolated from human faeces. Int J Syst Evol Microbiol  2006; 56: 1639– 43. Google Scholar CrossRef Search ADS PubMed  Baughn AD, Malamy MH. A mitochondrial-like aconitase in the bacterium Bacteroides fragilis: implications for the evolution of the mitochondrial Krebs cycle. Proc Natl Acad Sci USA  2002; 99: 4662– 7. Google Scholar CrossRef Search ADS PubMed  Degnan PH, Barry NA, Mok KC et al.   Human gut microbes use multiple transporters to distinguish vitamin B12 analogs and compete in the gut. Cell Host Microbe  2014; 15: 47– 57. Google Scholar CrossRef Search ADS PubMed  Furuchi T, Kashiwagi K, Kobayashi H et al.   Characteristics of the gene for a spermidine and putrescine transport system that maps at 15 min on the Escherichia coli chromosome. J Biol Chem  1991; 266: 20928– 33. Google Scholar PubMed  Hamana K, Itoh T, Benno Y et al.   Polyamine distribution profiles of new members of the phylum Bacteroidetes. J Gen Appl Microbiol  2008; 54: 229– 36. Google Scholar CrossRef Search ADS PubMed  Hanfrey CC, Pearson BM, Hazeldine S et al.   Alternative spermidine biosynthetic route is critical for growth of Campylobacter jejuni and is the dominant polyamine pathway in human gut microbiota. J Biol Chem  2011; 286: 43301– 12. Google Scholar CrossRef Search ADS PubMed  Herrero M, de Lorenzo V, Timmis KN. Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria. J Bacteriol  1990; 172: 6557– 67. Google Scholar CrossRef Search ADS PubMed  Hirayama Y, Sakanaka M, Fukuma H et al.   Development of a double-crossover markerless gene deletion system in Bifidobacterium longum: functional analysis of the α-galactosidase gene for raffinose assimilation. Appl Environ Microbiol  2012; 78: 4984– 94. Google Scholar CrossRef Search ADS PubMed  Hosoya R, Hamana K. Distribution of two triamines, spermidine and homospermidine, and an aromatic amine, 2-phenylethylamine, within the phylum Bacteroidetes. J Gen Appl Microbiol  2004; 50: 255– 60. Google Scholar CrossRef Search ADS PubMed  Ichimura M, Nakayama-Imaohji H, Wakimoto S et al.   Efficient electrotransformation of Bacteroides fragilis. Appl Environ Microbiol  2010; 76: 3325– 32. Google Scholar CrossRef Search ADS PubMed  Kibe R, Kurihara S, Sakai Y et al.   Upregulation of colonic luminal polyamines produced by intestinal microbiota delays senescence in mice. Sci Rep  2014; 4: 4548. Google Scholar CrossRef Search ADS PubMed  Kino Y, Nakayama-Imaohji H, Fujita M et al.   Counterselection employing mutated pheS for markerless genetic deletion in Bacteroides species. Anaerobe  2016; 42: 81– 8. Google Scholar CrossRef Search ADS PubMed  Koropatkin NM, Martens EC, Gordon JI et al.   Starch catabolism by a prominent human gut symbiont is directed by the recognition of amylose helices. Structure  2008; 16: 1105– 15. Google Scholar CrossRef Search ADS PubMed  Lee SM, Donaldson GP, Mikulski Z et al.   Bacterial colonization factors control specificity and stability of the gut microbiota. Nature  2013; 501: 426– 9. Google Scholar CrossRef Search ADS PubMed  Li J, Mandal G, Rosen BP. Expression of arsenic resistance genes in the obligate anaerobe Bacteroides vulgatus ATCC 8482, a gut microbiome bacterium. Anaerobe  2016; 39: 117– 23. Google Scholar CrossRef Search ADS PubMed  Matsumoto M, Kurihara S, Kibe R et al.   Longevity in mice is promoted by probiotic-induced suppression of colonic senescence dependent on upregulation of gut bacterial polyamine production. PLoS One  2011; 6: e23652. Google Scholar CrossRef Search ADS PubMed  Matsumoto M, Kibe R, Ooga T et al.   Impact of intestinal microbiota on intestinal luminal metabolome. Sci Rep  2012; 2: 233. Google Scholar CrossRef Search ADS PubMed  Michael AJ. Biosynthesis of polyamines in eukaryotes, archaea, and bacteria. In: Kusano T, Suzuki H (eds). Polyamines: A Universal Molecular Nexus For Growth, Survival, And Specialized Metabolism . Tokyo: Springer, 2015, 3– 14. Google Scholar CrossRef Search ADS   Miller-Fleming L, Olin-Sandoval V, Campbell K et al.   Remaining mysteries of molecular biology: the role of polyamines in the cell. J Mol Biol  2015; 427: 3389– 406. Google Scholar CrossRef Search ADS PubMed  Noack J, Kleessen B, Proll J et al.   Dietary guar gum and pectin stimulate intestinal microbial polyamine synthesis in rats. J Nutr  1998; 128: 1385– 91. Google Scholar CrossRef Search ADS PubMed  Okibe N, Suzuki N, Inui M et al.   Efficient markerless gene replacement in Corynebacterium glutamicum using a new temperature-sensitive plasmid. J Microbiol Methods  2011; 85: 155– 63. Google Scholar CrossRef Search ADS PubMed  Patel CN, Wortham BW, Lines JL et al.   Polyamines are essential for the formation of plague biofilm. J Bacteriol  2006; 188: 2355– 63. Google Scholar CrossRef Search ADS PubMed  Qin J, Li R, Raes J et al.   A human gut microbial gene catalogue established by metagenomic sequencing. Nature  2010; 464: 59– 65. Google Scholar CrossRef Search ADS PubMed  Rakoff-Nahoum S, Foster KR, Comstock LE. The evolution of cooperation within the gut microbiota. Nature  2016; 533: 255– 9. Google Scholar CrossRef Search ADS PubMed  Sakanaka M, Sugiyama Y, Kitakata A et al.   Carboxyspermidine decarboxylase of the prominent intestinal microbiota species Bacteroides thetaiotaomicron is required for spermidine biosynthesis and contributes to normal growth. Amino Acids  2016; 48: 2443– 51. Google Scholar CrossRef Search ADS PubMed  Sugiyama Y, Nara M, Sakanaka M et al.   Comprehensive analysis of polyamine transport and biosynthesis in the dominant human gut bacteria: Potential presence of novel polyamine metabolism and transport genes. Int J Biochem Cell Biol  2017; 93: 52– 61. Google Scholar CrossRef Search ADS PubMed  Tabor CW, Tabor H. Polyamines in microorganisms. Microbiol Rev  1985; 49: 81– 99. Google Scholar PubMed  Upp JRJr, Saydjari R, Townsend CMJr et al.   Polyamine levels and gastrin receptors in colon cancers. Ann Surg  1988; 207: 662– 9. Google Scholar CrossRef Search ADS PubMed  Vatanen T, Kostic AD, d’Hennezel E et al.   Variation in microbiome LPS immunogenicity contributes to autoimmunity in humans. Cell  2016; 165: 842– 53. Google Scholar CrossRef Search ADS PubMed  Wexler AG, Bao Y, Whitney JC et al.   Human symbionts inject and neutralize antibacterial toxins to persist in the gut. Proc Natl Acad Sci USA  2016; 113: 3639– 44. Google Scholar CrossRef Search ADS PubMed  © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png FEMS Microbiology Letters Oxford University Press

Functional analysis of arginine decarboxylase gene speA of Bacteroides dorei by markerless gene deletion

Loading next page...
 
/lp/ou_press/functional-analysis-of-arginine-decarboxylase-gene-spea-of-bacteroides-U80u70okqz
Publisher
Blackwell
Copyright
© FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
0378-1097
eISSN
1574-6968
D.O.I.
10.1093/femsle/fny003
Publisher site
See Article on Publisher Site

Abstract

Abstract Polyamine concentrations in the intestine are regulated by their biosynthesis by hundreds of gut microbial species and these polyamines are involved in host health and disease. However, polyamine biosynthesis has not been sufficiently analyzed in major members of the human gut microbiota, possibly owing to a lack of gene manipulation systems. In this study, we successfully performed markerless gene deletion in Bacteroides dorei, one of the major members of the human gut microbiota. The combination of a thymidine kinase gene (tdk) deletion mutant and a counter-selection marker tdk, which has been applied in other Bacteroides species, was used for the markerless gene deletion. Deletion of tdk in B. dorei caused 5-fluoro-2΄-deoxyuridine resistance, suggesting the utility of B. dorei Δtdk as the host for future markerless gene deletions. Compared to parental strains, an arginine decarboxylase gene (speA) deletion mutant generated in this system showed a severe growth defect and decreased concentration of spermidine in the cells and culture supernatant. Collectively, our results indicate the accessibility of gene deletion and the important role of speA in polyamine biosynthesis in B. dorei. arginine decarboxylase, Bacteroides dorei, gene manipulation system, gut microbe, polyamine, spermidine INTRODUCTION Polyamines such as putrescine, spermidine and spermine are aliphatic amines containing two or more amino groups and are found in most organisms (Tabor and Tabor 1985; Michael 2015). They are also some of the main metabolites in the intestine. The intestinal polyamines are produced by hundreds of gut microbial species (Noack et al.1998; Matsumoto et al.2012) and are thought to play a key role in biological processes (e.g. the regulation of transcription and translation (Miller-Fleming et al.2015)) in host cells and gut microbial cells. Furthermore, intestinal polyamines are believed to be involved in host health and disease. As an example, higher levels of polyamines are known to be present in the colon mucosa from cancer patients than in that from normal individuals (Upp et al.1988). However, enhanced polyamine production from intestinal bacteria has been reported to lead to anti-aging effects in hosts (Matsumoto et al.2011; Kibe et al.2014). Considering the important roles of polyamines in the intestine, an understanding of polyamine biosynthesis by gut microbes and the sophisticated regulation of polyamine concentrations in the intestine is essential. To date, most studies on polyamine biosynthesis have focused on minor bacterial species in the human intestine such as Escherichia coli (Tabor and Tabor 1985). When using arginine as a starting substrate, putrescine is produced by sequential reactions catalyzed by SpeA (arginine decarboxylase) and SpeB (agmatine ureohydrolase) in E. coli (Tabor and Tabor 1985). Spermidine is then synthesized by SpeE (spermidine synthase) through the addition of the aminopropyl group of decarboxylated S-adenosylmethionine (Tabor and Tabor 1985). Recently, various species of major human gut microbes including Bacteroides species were predicted to have a unique polyamine biosynthetic pathway featuring enzymes different from those in E. coli (i.e. AIH, agmatine deiminase/iminohydrolase; NCPAH, N-carbamoylputrescine amidohydrolase; CASDH, carboxyspermidine dehydrogenase and CASDC, carboxyspermidine decarboxylase). The common enzyme arginine decarboxylase, SpeA, is expected to be conserved (Fig. 1; Hanfrey et al.2011; Sakanaka et al.2016; Sugiyama et al.2017). In these major gut microbial species, spermidine tends to be the main polyamine (Hosoya and Hamana 2004; Hamana et al.2008; Sakanaka et al.2016; Sugiyama et al.2017). Figure 1. View largeDownload slide Predicted polyamine biosynthetic pathway in various major species of human gut microbes including B. dorei JCM 13471T. Enzyme names are indicated by white characters in gray boxes. AIH, agmatine deiminase/iminohydrolase; CASDC, carboxyspermidine decarboxylase; CASDH, carboxyspermidine dehydrogenase; NCPAH, N-carbamoylputrescine amidohydrolase; SpeA, arginine decarboxylase. Figure 1. View largeDownload slide Predicted polyamine biosynthetic pathway in various major species of human gut microbes including B. dorei JCM 13471T. Enzyme names are indicated by white characters in gray boxes. AIH, agmatine deiminase/iminohydrolase; CASDC, carboxyspermidine decarboxylase; CASDH, carboxyspermidine dehydrogenase; NCPAH, N-carbamoylputrescine amidohydrolase; SpeA, arginine decarboxylase. In a previous study, we revealed that Bacteroides thetaiotaomicron, a model human gut microbe, produces cellular spermidine; carboxyspermidine decarboxylase (Fig. 1) is essential for converting carboxyspermidine to spermidine (Sakanaka et al.2016). However, polyamine biosynthesis has not been sufficiently analyzed in other Bacteroides species. This is partly because gene disruption methods have only been applied to limited species of Bacteroides (Baughn and Malamy 2002; Koropatkin et al.2008; Ichimura et al.2010; Lee et al.2013; Kino et al.2016; Rakoff-Nahoum, Foster and Comstock 2016; Wexler et al.2016). In Bacteroides species including B. thetaiotaomicron, a combination of thymidine kinase gene (tdk) deletion strain and a counter-selection marker, tdk, is frequently utilized for the efficient selection of second-crossover recombinants and markerless gene deletion (Koropatkin et al.2008; Wexler et al.2016). In this study, we applied this markerless gene deletion system to Bacteroides dorei (Bakir et al.2006), which is one of the major members of the human gut microbiota (Qin et al.2010), and has recently been characterized as an immunologically important gut microbe that may preclude certain aspects of immune education in children (Vatanen et al.2016). Furthermore, to demonstrate the usefulness of the established system for B. dorei, we disrupted the speA gene (Fig. 1), which is predicted to be involved in polyamine biosynthesis, and revealed that speA contributes to not only the growth ability but also the biosynthesis of spermidine, a final polyamine product present in B. dorei cells and the culture supernatant. MATERIALS AND METHODS Bacterial strain, plasmid and culture conditions The bacterial strains, plasmids, and primers used in this study are indicated in Table 1. Bacteroides dorei was anaerobically grown at 37°C in an anaerobic chamber InvivO2 400 (10% CO2, 10% H2 and 80% N2; Ruskinn Technology Ltd, Bridgend, UK). The media used to culture B. dorei were as follows: Gifu anaerobic medium (Nissui Pharmaceutical Co., Ltd, Tokyo, Japan), brain heart infusion (BHI) agar medium (Sigma-Aldrich Corp., St. Louis, MO, USA) supplemented with 10% horse blood (Nippon Bio-Supp. Center, Tokyo, Japan; BHI-blood agar medium) and a synthetic medium (Sakanaka et al.2016) supplemented with 10% (v/v) Gifu anaerobic medium (hereafter termed as polyamine-reduced medium [The polyamine concentrations are approximately 3 μM putrescine, 2 μM spermidine and 1 μM spermine, and are ten times lower than those present in original GAM]). Escherichia coli was aerobically grown at 37°C in Luria-Bertani medium, and the strain CC118 λpir (Herrero, de Lorenzo and Timmis 1990) was used as the cloning host. When necessary, the following antibiotics and nucleotide analogue were added to the medium: ampicillin (100 μg/mL), erythromycin (25 μg/mL), gentamycin (200 μg/mL) and 5-fluoro-2΄-deoxyuridine (FUdR, 200 μg/mL). Table 1. Bacterial strains, plasmids and primers used in this study. Strain, plasmid or primer  Descriptiona or sequence (5‘−3’)b  Reference or source  Escherichia coli      CC118 λpir  Δ(ara-leu), araD, ΔlacX74, galE, galK, phoA20, thi-1, rpsE, rpoB, argE(Am), recA1, λpir lysogen  Herrero, de Lorenzo and Timmis (1990)  S17-1 λpir  F−, thi, pro, hsdR, RP4-2 (Tc::Mu; Km::Tn7), λpir lysogen  National BioResource Project (NIG, Japan)  Bacteroides dorei  JCM 13471T  Wild type, GmR, FUdRS  Japan Collection of Microorganisms  MS416  Δtdk, GmR, FUdRR  This study  MS531  Δtdk ΔspeA, GmR, FUdRR  This study  Plasmid  pExchange-tdk  Plasmid for gene deletion, RP4 oriT/oriR6K, ApR, EmR, FUdRS  Koropatkin et al. (2008)  pKNOCK-bla-ermGb  RP4 oriT/oriR6K, ApR, EmR  Koropatkin et al. (2008)  pMSK42  Plasmid for tdk deletion, RP4 oriT/oriR6K, ApR, EmR  This study  pMSK61  Plasmid for speA deletion, RP4 oriT/oriR6K, ApR, EmR, FUdRS  This study  Primer  Pr-188  gtggatcccccgggcgaaacaggcctttcggcac    Pr-189  agcataaagcatatgaattttgatgtaacaatata    Pr-190  catatgctttatgctgcaga    Pr-191  ccccctcgaggtcgaaaaccgaaaccgatagctaa    Pr-196  gaagtcaataaagctacagataacaac    Pr-197  agataataggatgatggcaggattc    Pr-280  taacattcgagtcgattaagtctggaggcttgttt    Pr-281  ttctctttcatgttattcttcttctgtacaaagag    Pr-282  taacatgaaagagaaactgactatc    Pr-283  tatcgataccgtcgatcactaatggctgatgctaa    Pr-305  ccgatggagatttctttgga    Pr-306  cctccgcttcagcactattc    Pr-608  ctatctaaagcacgaggaggtaaa    Pr-609  ccaaggcagacatacggatag    Pr-612  gcgagataaagatagctggaaaaga    Pr-613  tcaaatgaggaaacaaagcatacttc    Pr-614  cgtaatatggacgcctgtggtt    Pr-615  gcagcaggaccgaaaaaataac    Strain, plasmid or primer  Descriptiona or sequence (5‘−3’)b  Reference or source  Escherichia coli      CC118 λpir  Δ(ara-leu), araD, ΔlacX74, galE, galK, phoA20, thi-1, rpsE, rpoB, argE(Am), recA1, λpir lysogen  Herrero, de Lorenzo and Timmis (1990)  S17-1 λpir  F−, thi, pro, hsdR, RP4-2 (Tc::Mu; Km::Tn7), λpir lysogen  National BioResource Project (NIG, Japan)  Bacteroides dorei  JCM 13471T  Wild type, GmR, FUdRS  Japan Collection of Microorganisms  MS416  Δtdk, GmR, FUdRR  This study  MS531  Δtdk ΔspeA, GmR, FUdRR  This study  Plasmid  pExchange-tdk  Plasmid for gene deletion, RP4 oriT/oriR6K, ApR, EmR, FUdRS  Koropatkin et al. (2008)  pKNOCK-bla-ermGb  RP4 oriT/oriR6K, ApR, EmR  Koropatkin et al. (2008)  pMSK42  Plasmid for tdk deletion, RP4 oriT/oriR6K, ApR, EmR  This study  pMSK61  Plasmid for speA deletion, RP4 oriT/oriR6K, ApR, EmR, FUdRS  This study  Primer  Pr-188  gtggatcccccgggcgaaacaggcctttcggcac    Pr-189  agcataaagcatatgaattttgatgtaacaatata    Pr-190  catatgctttatgctgcaga    Pr-191  ccccctcgaggtcgaaaaccgaaaccgatagctaa    Pr-196  gaagtcaataaagctacagataacaac    Pr-197  agataataggatgatggcaggattc    Pr-280  taacattcgagtcgattaagtctggaggcttgttt    Pr-281  ttctctttcatgttattcttcttctgtacaaagag    Pr-282  taacatgaaagagaaactgactatc    Pr-283  tatcgataccgtcgatcactaatggctgatgctaa    Pr-305  ccgatggagatttctttgga    Pr-306  cctccgcttcagcactattc    Pr-608  ctatctaaagcacgaggaggtaaa    Pr-609  ccaaggcagacatacggatag    Pr-612  gcgagataaagatagctggaaaaga    Pr-613  tcaaatgaggaaacaaagcatacttc    Pr-614  cgtaatatggacgcctgtggtt    Pr-615  gcagcaggaccgaaaaaataac    aApR, ampicilin resistance; EmR, erythromycin resistance; GmR, gentamycin resistance; FUdRR, 5-fluoro-2΄-deoxyuridine resistance; FUdRS, 5-fluoro-2΄-deoxyuridine susceptibility. bSequences for In-Fusion cloning are indicated by single line. View Large Generation of tdk deletion strain of B. dorei As tdk confers FUdR sensitivity and is utilized as a counter-selection marker for markerless gene deletion in Bacteroides species (Koropatkin et al.2008; Wexler et al.2016), tdk of B. dorei JCM 13471T was disrupted by double-crossover recombination (Fig. S1a, Supporting Information). The plasmid pMSK42 for tdk deletion was constructed by inserting the upstream and downstream regions of the tdk gene into PstI- and SalI-digested pKNOCK-bla-ermGb (Koropatkin et al.2008) using an In-Fusion HD cloning kit (Clontech Laboratories, Inc., Mountain View, CA, USA). These upstream and downstream regions of the tdk gene were PCR-amplified from the B. dorei JCM 13471T genome using the primer pairs Pr-188/Pr-189 and Pr-190/Pr-191, respectively. The resulting suicide plasmid pMSK42 was transferred from E. coli S17-1 λpir (donor) to B. dorei JCM 13471T (recipient) by bacterial conjugation as previously described (Sakanaka et al.2016); bacterial conjugation was performed by incubating a mixed culture of E. coli and B. dorei on BHI-blood agar medium. The whole colonies generated were suspended in 4 mL of liquid Gifu anaerobic medium, and then the integrant of pMSK42 into tdk locus (first-crossover recombinant) was selected by spreading the suspension on BHI-blood agar medium containing erythromycin and gentamycin. It should be noted that B. dorei is naturally resistant to gentamycin, but E. coli is not. Subsequently, second-crossover recombinants were selected by spreading the overnight culture of the first-crossover recombinant onto BHI-blood agar medium containing FUdR, and deletion of the tdk gene was verified by PCR using the primer pair Pr-196/Pr-197. Generation of speA deletion mutant of B. dorei The plasmid for speA deletion was constructed by inserting the upstream and downstream regions of the speA gene into SalI-digested pExchange-tdk (Koropatkin et al.2008) using an In-Fusion HD cloning kit (Clontech). These upstream and downstream regions of the speA gene were amplified by PCR from the B. dorei JCM 13471T genome using the primer pairs Pr-280/Pr-281 and Pr-282/Pr-283, respectively. The resulting suicide plasmid pMSK61 was introduced into B. dorei Δtdk (hereafter referred to MS416) by conjugational transfer, and the Δtdk ΔspeA mutant (hereafter referred to MS531) was generated by second-crossover recombination as described in the previous section (Fig. S1b, Supporting Information). The deletion of speA was verified by PCR using the primer pair Pr-305/Pr-306. Polyamine analysis by high-performance liquid chromatography Bacteroides dorei was cultured with initial optical density at 600 nm of 0.03 in polyamine-reduced medium, and growth was monitored by measuring optical density at 600 nm using a spectrophotometer. The cells and culture supernatant were collected by centrifugation of the cultures withdrawn at indicated times. Polyamines in the cells and culture supernatant of B. dorei were analyzed by high-performance liquid chromatography as described previously (Sakanaka et al.2016). The polyamine concentrations in the culture supernatant were determined in μM. The polyamine concentrations in the cells were corrected based on cellular protein concentration, which was determined by the Bradford method as described previously (Sakanaka et al.2016); the concentration was determined as nmol/(mg cellular protein). Reverse transcription-quantitative PCR Bacteroides dorei cells were grown to an exponential phase in polyamine-reduced medium (optical density at 600 nm of 0.5–0.6), harvested by centrifuging 1.4 mL of the cultures and resuspended in 700 μL of the RNAlater solution (Thermo Fischer Scientific Inc., Waltham, MA, USA). Total RNAs were isolated using the RiboPure-Bacteria kit (Thermo Fischer Scientific), and cDNA synthesis was performed using PrimeScript RT Master Mix (Takara Bio Inc., Shiga, Japan). Reverse transcription-quantitative PCR (RT-qPCR) was performed by SYBR Green system using TB Green Premix Ex Taq II (Takara Bio) and the following primer pairs: Pr-612/Pr-613 for potA; Pr-614/Pr-615 for potD; and Pr-608/Pr-609 for RNA polymerase gene of σ70 factor. The RNA polymerase gene was used as a reference gene (Li, Mandal and Rosen 2016). RESULTS AND DISCUSSION Markerless gene deletion of tdk and speA in B. dorei JCM 13471T Markerless gene deletion by double-crossover recombination has been performed in many bacterial species for gene function analysis (Koropatkin et al.2008; Okibe et al.2011; Hirayama et al.2012). However, an extremely low frequency of second-crossover recombination is a common obstacle to markerless gene deletion (Hirayama et al.2012), and efficient selection systems for second-crossover recombinants are desired. One effective approach is the utilization of counter-selection markers. Because the introduction of a tdk gene into the FUdR-resistant Δtdk strain of Bacteroides thetaiotaomicron confers FUdR sensitivity (Koropatkin et al.2008), application of the tdk gene as a counter-selection marker in Δtdk strains of various Bacteroides species or strains will facilitate selection for the generation of second-crossover recombinants (Fig. S1b, Supporting Information). To achieve this, we performed markerless gene deletion of tdk in Bacteroides dorei JCM 13471T (Fig. S1a, Supporting Information). When pMSK42 carrying the upstream and downstream regions of the tdk gene was introduced into B. dorei JCM 13471T by bacterial conjugation, erythromycin- and gentamycin-resistant transformants were obtained. Among 13 tested transformants, insertion of pMSK42 into the tdk locus (first-crossover recombinants) was observed in 11 transformants by PCR (data not shown). Subsequently, the first-crossover recombinant was grown on BHI-blood agar medium containing FUdR to select the second-crossover recombinant MS416 (Δtdk). Note that MS416 (Δtdk) can be positively selected on FUdR because deletion of tdk from the first-crossover recombinant confers FUdR resistance (Fig. S1a, Supporting Information). Deletion of the tdk gene was confirmed by PCR (Fig. 2a) in 7 strains among the 11 tested FUdR-resistant strains (data not shown). Bacteroides dorei JCM 13471T (tdk+) and MS416 (Δtdk) were sensitive and resistant to FUdR, respectively (Fig. 2b), confirming the potential of the tdk gene as a counter-selection marker. Figure 2. View largeDownload slide FUdR resistance of B. dorei strains. (a) Electrophoretic analysis of the tdk locus amplified by PCR using the primer pair Pr-196/Pr-197 (black arrows). Lane M, Gene Ladder Wide 1 (NIPPON GENE) as a molecular weight marker; lane JCM 13471T, the tdk locus from B. dorei JCM 13471T; lane Δtdk, the tdk locus from MS416 (Δtdk). (b) FUdR resistance analysis of B. dorei JCM 13471T and MS416 (Δtdk) on Gifu anaerobic agar medium containing FUdR. Figure 2. View largeDownload slide FUdR resistance of B. dorei strains. (a) Electrophoretic analysis of the tdk locus amplified by PCR using the primer pair Pr-196/Pr-197 (black arrows). Lane M, Gene Ladder Wide 1 (NIPPON GENE) as a molecular weight marker; lane JCM 13471T, the tdk locus from B. dorei JCM 13471T; lane Δtdk, the tdk locus from MS416 (Δtdk). (b) FUdR resistance analysis of B. dorei JCM 13471T and MS416 (Δtdk) on Gifu anaerobic agar medium containing FUdR. Bacteroides dorei has a different polyamine biosynthetic pathway than Escherichia coli (Fig. 1) (Sugiyama et al.2017). In this study, speA was disrupted in B. dorei to investigate the role of SpeA in this pathway (Fig. S1b, Supporting Information). When pMSK61 for speA deletion was introduced into MS416 (Δtdk), erythromycin- and gentamycin-resistant transformants were generated. Among 5 transformants, 1 transformant was confirmed to harbor the insertion of pMSK61 into the speA locus by PCR (data not shown). The integrant containing pMSK61 in the speA locus was then grown on BHI-blood agar medium containing FUdR to select FUdR resistant strains. Deletion of the speA gene was confirmed by PCR (Fig. 3) in 3 strains among the 6 tested FUdR−resistant strains (data not shown). The remaining 3 strains were shown to be revertants containing speA by PCR (data not shown). These results indicate that the combination of MS416 (Δtdk) and a counter-selection marker, tdk, facilitates the generation of second-crossover recombinants, and allows for markerless gene deletion in B. dorei. Because B. dorei has been reported to be an immunologically important gut microbe that may preclude early immune education (Vatanen et al.2016), the successful establishment of markerless gene deletions in B. dorei will be valuable for understanding the roles of different genes in immunology. Figure 3. View largeDownload slide Electrophoretic analysis of the speA locus. Electrophoretic analysis of the speA locus amplified by PCR using the primer pair Pr-305/Pr-306 (black arrows) was performed. Lane M, Gene Ladder Wide 1 (NIPPON GENE) as a molecular weight marker; lane Δtdk, the speA locus from MS416 (Δtdk); lane Δtdk ΔspeA, the speA locus from MS531 (Δtdk ΔspeA). Figure 3. View largeDownload slide Electrophoretic analysis of the speA locus. Electrophoretic analysis of the speA locus amplified by PCR using the primer pair Pr-305/Pr-306 (black arrows) was performed. Lane M, Gene Ladder Wide 1 (NIPPON GENE) as a molecular weight marker; lane Δtdk, the speA locus from MS416 (Δtdk); lane Δtdk ΔspeA, the speA locus from MS531 (Δtdk ΔspeA). Deletion of tdk has no effect on growth or spermidine production in B. dorei Contribution of tdk to the growth and spermidine biosynthesis of B. dorei was analyzed by the gene deletion method. First, a synthetic medium lacking polyamines for B. thetaiotaomicron (Sakanaka et al.2016) was employed for culturing B. dorei JCM 13471T, but no obvious growth was observed; this could be due to a lack of ingredients that are currently unknown but are important for the growth of B. dorei (data not shown). A final concentration of 10% (v/v) Gifu anaerobic medium was then added to the synthetic medium to supplement the potentially missing ingredients, and this polyamine-reduced medium (containing approximately 3 μM putrescine, 2 μM spermidine and 1 μM spermine) was used. When B. dorei strains were grown in polyamine-reduced medium, the same growth curve was observed for JCM 13471T and MS416 (Δtdk; Fig. 4a). The spermidine concentration in cells and culture supernatant was almost the same in both JCM 13471T and MS416 (Δtdk; Fig. 4b and c). These data suggest that deletion of tdk does not cause any obvious physiological effects on B. dorei grown in polyamine-reduced medium, and MS416 (Δtdk) has no noticeable disadvantage as a host for gene deletion in the context of studying polyamine biosynthetic genes. In fact, the Δtdk strains of other Bacteroides species have been utilized in vivo in murine models as well as in vitro for functional analysis of various genes (Degnan et al.2014; Wexler et al.2016). Figure 4. View largeDownload slide Growth, spermidine concentration, and RT-qPCR analyses of B. dorei strains in the polyamine-reduced medium. (a) Growth curve of B. dorei grown in the polyamine-reduced medium. B. dorei JCM 13471T is indicated by shaded square. MS416 (Δtdk) and MS531 (Δtdk ΔspeA) strains are shown by the white and black circles, respectively. (b) Intracellular spermidine concentration from B. dorei. Cells withdrawn after being cultured for 24 h (Fig. 4a) were analyzed by high-performance liquid chromatography. (c) Spermidine concentration in the culture supernatant. The culture supernatant was withdrawn at the indicated times and analyzed by high-performance liquid chromatography. The symbols indicate the same strains as Fig. 4a. (d) RT-qPCR analysis of spermidine transporter genes potA and potD in MS416 (Δtdk; white bars) and MS531 (Δtdk ΔspeA; black bars) strains. Relative expression levels are represented as the proportion of potA and potD transcripts among those of the RNA polymerase gene of σ70 factor. Data are shown as the mean ± standard deviation (n = 3), and asterisks indicate the significant difference of the relative expression levels between strains (**P < 0.01; Student's two-tailed t-test). Figure 4. View largeDownload slide Growth, spermidine concentration, and RT-qPCR analyses of B. dorei strains in the polyamine-reduced medium. (a) Growth curve of B. dorei grown in the polyamine-reduced medium. B. dorei JCM 13471T is indicated by shaded square. MS416 (Δtdk) and MS531 (Δtdk ΔspeA) strains are shown by the white and black circles, respectively. (b) Intracellular spermidine concentration from B. dorei. Cells withdrawn after being cultured for 24 h (Fig. 4a) were analyzed by high-performance liquid chromatography. (c) Spermidine concentration in the culture supernatant. The culture supernatant was withdrawn at the indicated times and analyzed by high-performance liquid chromatography. The symbols indicate the same strains as Fig. 4a. (d) RT-qPCR analysis of spermidine transporter genes potA and potD in MS416 (Δtdk; white bars) and MS531 (Δtdk ΔspeA; black bars) strains. Relative expression levels are represented as the proportion of potA and potD transcripts among those of the RNA polymerase gene of σ70 factor. Data are shown as the mean ± standard deviation (n = 3), and asterisks indicate the significant difference of the relative expression levels between strains (**P < 0.01; Student's two-tailed t-test). speA is required for normal growth and spermidine biosynthesis of B. dorei Although speA is conserved among various species of dominant human gut microbes (Sugiyama et al.2017) and is mainly studied in E. coli (Tabor and Tabor 1985), the genetic function of speA has not been sufficiently analyzed in major members of the human gut microbiota. The contribution of speA to growth of B. dorei was analyzed by the gene deletion method. When compared to JCM 13471T and MS416 (Δtdk), MS531 (Δtdk ΔspeA) showed a severe growth defect in polyamine-reduced medium (Fig. 4a). This result is consistent with many previous studies that disruption of polyamine biosynthetic genes including speA leads to delayed growth in various bacterial species (Patel et al.2006; Hanfrey et al.2011; Sakanaka et al.2016). Because speA encodes a putative arginine decarboxylase, an enzyme necessary for spermidine biosynthesis in cells, intracellular spermidine concentration in B. dorei strains was investigated next. In contrast to the presence of intracellular spermidine as the sole polyamine in JCM 13471T and MS416 (Δtdk), spermidine was barely detected in MS531 (Δtdk ΔspeA; Fig. 4b). These findings indicate that speA is the main gene involved in the spermidine biosynthetic pathway of B. dorei. According to the in silico analysis, B. dorei JCM 13471T has only one spermidine biosynthetic pathway shown in Fig. 1 (i.e. this organism has neither spermidine biosynthetic pathway via aminopropylagmatine found in some archaea nor the pathway composed of ornithine decarboxylase and spermidine synthase; Sugiyama et al.2017). Therefore, although there is a possibility that B. dorei has completely novel pathway, the remaining intracellular spermidine level in MS531 (Δtdk ΔspeA) may be attributable to the spermidine import from polyamine-reduced medium via a predicted ATP-binding cassette transporter of spermidine, PotABCD (Furuchi et al.1991; Sugiyama et al.2017). This prediction was strongly supported by the RT q-PCR assay, in which more upregulated expression levels of potA (ATP-binding protein) and potD (solute-binding protein) were observed in MS531 (Δtdk ΔspeA), than in MS416 (Δtdk; Fig. 4d). It is noteworthy that no other polyamines except for spermidine were observed in the cells of all strains in this study. Recently, we reported that spermidine is detected in culture supernatant as well as cells of B. dorei, suggesting the export of spermidine biosynthesized in cells (Sugiyama et al.2017). This characteristic was observed in the limited species among major members of the human gut microbiota (Sugiyama et al.2017) and may contribute to the increase in spermidine concentration in the host intestine. The concentration of spermidine in the culture supernatant was increased along with the culture time of JCM 13471T and MS416 (Δtdk; Fig. 4c). However, no spermidine was observed in the culture supernatant of MS531 (Δtdk ΔspeA) (Fig. 4c). This result strongly suggests that spermidine biosynthesis by speA in cells is essential for the increased spermidine level in the extracellular environment, such as in the intestinal lumen. The effect of the spermidine biosynthesis of B. dorei on intestinal polyamine concentrations should be revealed by a future work using a murine model. CONCLUDING REMARKS Hundreds of microbial species inhabit the intestine of humans and produce various metabolites (Matsumoto et al.2012). Polyamines are one of the major metabolites produced by gut microbes; they are believed to exert both beneficial and harmful effects on host health (Upp et al.1988; Matsumoto et al.2011; Kibe et al.2014). Currently, the molecular mechanisms of polyamine biosynthesis by gut microbes, particularly major members of the human gut microbiota, are largely unexplored. In this study, we successfully performed markerless speA deletion in a major human gut microbe, Bacteroides dorei, by using the MS416 (Δtdk) and counter-selection marker tdk, which has been previously established in other Bacteroides species (Koropatkin et al.2008; Wexler et al.2016). We also revealed the importance of the speA gene on polyamine biosynthesis in B. dorei: speA is the main gene contributing to the presence of spermidine in the culture supernatant and in cells. Although elucidation of the spermidine export mechanisms to the extracellular environment remains unknown, our results shed light on how the intestinal polyamines are regulated by gut microbes. Furthermore, because B. dorei is an immunologically important gut microbe (Vatanen et al.2016), the established markerless gene deletion system will be widely applicable in various studies of B. dorei. SUPPLEMENTARY DATA Supplementary data are available at FEMSLE online. Acknowledgements We acknowledge Dr Thomas J. Smith (Donald Danforth Plant Science Center, USA) and Dr Nicole Koropatkin (University of Michigan Medical School, USA) for providing us with pKNOCK-bla-ermGb and pExchange-tdk. We are grateful to the National BioResource Project (NIG, Japan) for providing us with Escherichia coli S17-1 λpir. FUNDING This work was partly supported by Grants-in-Aid from the Institute for Fermentation, Osaka (K-25-04 to SK and MS) and Asahi Glass foundation (to SK). Conflict of interest. None declared. REFERENCES Bakir MA, Sakamoto M, Kitahara M et al.   Bacteroides dorei sp. nov., isolated from human faeces. Int J Syst Evol Microbiol  2006; 56: 1639– 43. Google Scholar CrossRef Search ADS PubMed  Baughn AD, Malamy MH. A mitochondrial-like aconitase in the bacterium Bacteroides fragilis: implications for the evolution of the mitochondrial Krebs cycle. Proc Natl Acad Sci USA  2002; 99: 4662– 7. Google Scholar CrossRef Search ADS PubMed  Degnan PH, Barry NA, Mok KC et al.   Human gut microbes use multiple transporters to distinguish vitamin B12 analogs and compete in the gut. Cell Host Microbe  2014; 15: 47– 57. Google Scholar CrossRef Search ADS PubMed  Furuchi T, Kashiwagi K, Kobayashi H et al.   Characteristics of the gene for a spermidine and putrescine transport system that maps at 15 min on the Escherichia coli chromosome. J Biol Chem  1991; 266: 20928– 33. Google Scholar PubMed  Hamana K, Itoh T, Benno Y et al.   Polyamine distribution profiles of new members of the phylum Bacteroidetes. J Gen Appl Microbiol  2008; 54: 229– 36. Google Scholar CrossRef Search ADS PubMed  Hanfrey CC, Pearson BM, Hazeldine S et al.   Alternative spermidine biosynthetic route is critical for growth of Campylobacter jejuni and is the dominant polyamine pathway in human gut microbiota. J Biol Chem  2011; 286: 43301– 12. Google Scholar CrossRef Search ADS PubMed  Herrero M, de Lorenzo V, Timmis KN. Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria. J Bacteriol  1990; 172: 6557– 67. Google Scholar CrossRef Search ADS PubMed  Hirayama Y, Sakanaka M, Fukuma H et al.   Development of a double-crossover markerless gene deletion system in Bifidobacterium longum: functional analysis of the α-galactosidase gene for raffinose assimilation. Appl Environ Microbiol  2012; 78: 4984– 94. Google Scholar CrossRef Search ADS PubMed  Hosoya R, Hamana K. Distribution of two triamines, spermidine and homospermidine, and an aromatic amine, 2-phenylethylamine, within the phylum Bacteroidetes. J Gen Appl Microbiol  2004; 50: 255– 60. Google Scholar CrossRef Search ADS PubMed  Ichimura M, Nakayama-Imaohji H, Wakimoto S et al.   Efficient electrotransformation of Bacteroides fragilis. Appl Environ Microbiol  2010; 76: 3325– 32. Google Scholar CrossRef Search ADS PubMed  Kibe R, Kurihara S, Sakai Y et al.   Upregulation of colonic luminal polyamines produced by intestinal microbiota delays senescence in mice. Sci Rep  2014; 4: 4548. Google Scholar CrossRef Search ADS PubMed  Kino Y, Nakayama-Imaohji H, Fujita M et al.   Counterselection employing mutated pheS for markerless genetic deletion in Bacteroides species. Anaerobe  2016; 42: 81– 8. Google Scholar CrossRef Search ADS PubMed  Koropatkin NM, Martens EC, Gordon JI et al.   Starch catabolism by a prominent human gut symbiont is directed by the recognition of amylose helices. Structure  2008; 16: 1105– 15. Google Scholar CrossRef Search ADS PubMed  Lee SM, Donaldson GP, Mikulski Z et al.   Bacterial colonization factors control specificity and stability of the gut microbiota. Nature  2013; 501: 426– 9. Google Scholar CrossRef Search ADS PubMed  Li J, Mandal G, Rosen BP. Expression of arsenic resistance genes in the obligate anaerobe Bacteroides vulgatus ATCC 8482, a gut microbiome bacterium. Anaerobe  2016; 39: 117– 23. Google Scholar CrossRef Search ADS PubMed  Matsumoto M, Kurihara S, Kibe R et al.   Longevity in mice is promoted by probiotic-induced suppression of colonic senescence dependent on upregulation of gut bacterial polyamine production. PLoS One  2011; 6: e23652. Google Scholar CrossRef Search ADS PubMed  Matsumoto M, Kibe R, Ooga T et al.   Impact of intestinal microbiota on intestinal luminal metabolome. Sci Rep  2012; 2: 233. Google Scholar CrossRef Search ADS PubMed  Michael AJ. Biosynthesis of polyamines in eukaryotes, archaea, and bacteria. In: Kusano T, Suzuki H (eds). Polyamines: A Universal Molecular Nexus For Growth, Survival, And Specialized Metabolism . Tokyo: Springer, 2015, 3– 14. Google Scholar CrossRef Search ADS   Miller-Fleming L, Olin-Sandoval V, Campbell K et al.   Remaining mysteries of molecular biology: the role of polyamines in the cell. J Mol Biol  2015; 427: 3389– 406. Google Scholar CrossRef Search ADS PubMed  Noack J, Kleessen B, Proll J et al.   Dietary guar gum and pectin stimulate intestinal microbial polyamine synthesis in rats. J Nutr  1998; 128: 1385– 91. Google Scholar CrossRef Search ADS PubMed  Okibe N, Suzuki N, Inui M et al.   Efficient markerless gene replacement in Corynebacterium glutamicum using a new temperature-sensitive plasmid. J Microbiol Methods  2011; 85: 155– 63. Google Scholar CrossRef Search ADS PubMed  Patel CN, Wortham BW, Lines JL et al.   Polyamines are essential for the formation of plague biofilm. J Bacteriol  2006; 188: 2355– 63. Google Scholar CrossRef Search ADS PubMed  Qin J, Li R, Raes J et al.   A human gut microbial gene catalogue established by metagenomic sequencing. Nature  2010; 464: 59– 65. Google Scholar CrossRef Search ADS PubMed  Rakoff-Nahoum S, Foster KR, Comstock LE. The evolution of cooperation within the gut microbiota. Nature  2016; 533: 255– 9. Google Scholar CrossRef Search ADS PubMed  Sakanaka M, Sugiyama Y, Kitakata A et al.   Carboxyspermidine decarboxylase of the prominent intestinal microbiota species Bacteroides thetaiotaomicron is required for spermidine biosynthesis and contributes to normal growth. Amino Acids  2016; 48: 2443– 51. Google Scholar CrossRef Search ADS PubMed  Sugiyama Y, Nara M, Sakanaka M et al.   Comprehensive analysis of polyamine transport and biosynthesis in the dominant human gut bacteria: Potential presence of novel polyamine metabolism and transport genes. Int J Biochem Cell Biol  2017; 93: 52– 61. Google Scholar CrossRef Search ADS PubMed  Tabor CW, Tabor H. Polyamines in microorganisms. Microbiol Rev  1985; 49: 81– 99. Google Scholar PubMed  Upp JRJr, Saydjari R, Townsend CMJr et al.   Polyamine levels and gastrin receptors in colon cancers. Ann Surg  1988; 207: 662– 9. Google Scholar CrossRef Search ADS PubMed  Vatanen T, Kostic AD, d’Hennezel E et al.   Variation in microbiome LPS immunogenicity contributes to autoimmunity in humans. Cell  2016; 165: 842– 53. Google Scholar CrossRef Search ADS PubMed  Wexler AG, Bao Y, Whitney JC et al.   Human symbionts inject and neutralize antibacterial toxins to persist in the gut. Proc Natl Acad Sci USA  2016; 113: 3639– 44. Google Scholar CrossRef Search ADS PubMed  © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Journal

FEMS Microbiology LettersOxford University Press

Published: Feb 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial