Fibroblast growth factor 23 mRNA expression profile in chickens and its response to dietary phosphorus,

Fibroblast growth factor 23 mRNA expression profile in chickens and its response to dietary... ABSTRACT In mammals, fibroblast growth factor 23 (FGF23) regulates phosphate homeostasis in kidney by binding α-Klotho, a coreceptor of FGF23. FGF23 mRNA is highly expressed in bone and slightly expressed in liver, and is regulated by dietary phosphorus. Little is known about distribution and regulation of FGF23 mRNA in avian lineage. The expression of FGF23 and its coreceptor α-Klotho in chicken and embryo were investigated by real-time quantitative PCR. The effect of dietary phosphorus on FGF23 expression was measured. 36 laying hens at 25 wk were randomly assigned to three dietary available phosphorus (AP) treatments for 11 days: 0.15% AP (LP), 0.40% AP (MP), and 0.80% AP (HP). We first cloned the full coding sequence of FGF23 by the reverse transcription PCR from chicken liver and calvaria. Bioinformatics analysis indicated that the deduced amino acid sequence was 57–87% identical to FGF23 of other species. In adult chicken FGF23 mRNA was expressed at unexpected higher level in liver than other tissues evaluated, including calvaria, femur, tibia, medullary bone, brain, spleen, duodenum, jejunum, ileum, heart and kidney (P < 0.0001), and α-Klotho was expressed at highest level in kidney. However, in 18-d chicken embryos, FGF23 mRNA level was much higher in tibia than in liver, heart and jejunum (P < 0.0001). Chickens at 2, 25, 50 and 80 wk had higher FGF23 expression in liver than 18-d chicken embryos, whereas chickens at 25 wk had lower FGF23 expression in tibia than 18-d chicken embryos and 2-wk-old chickens. HP diets significantly increased serum inorganic phosphorus level (P < 0.001) and FGF23 expression (P < 0.05) in bone tissue compared with LP diets, however, FGF23 mRNA abundance in liver was not changed significantly (P > 0.05) by dietary phosphorus treatments. In conclusion, FGF23 mRNA expression pattern in chicken was clearly different from that in mammals and dietary phosphorus regulated the expression of FGF23 in a tissue-specific way. INTRODUCITON Phosphorus pollution caused by increased animal waste production is increasingly recognized as a critical environmental problem (Tilman et al., 2001). Poultry excreta can meet plant nitrogen needs, but results in excess soil phosphorus (Smil, 2003), which can enter surface water and results in eutrophication (Mallin, 2000). In the past years, many efforts have been conducted to reduce the dietary supplementation of inorganic phosphorus by improving the utilization of phytate (Faridi et al., 2015; Humer et al., 2015). Current knowledge of the regulation of phosphorus metabolism is based on the network of parathyroid hormone and 1,25-dihydroxyvitamin D3 (Dudas et al., 2002; Marks et al., 2010; Bouillon and Suda, 2014). As a known regulator of phosphate homeostasis, fibroblast growth factor 23 (FGF23) increases renal phosphate excretion (Berndt and Kumar, 2007) and reduces the amount of phosphate absorption from the gut (Shimada et al., 2004) in mammals. Circulating FGF23 may regulate phosphate homeostasis in chicken. Chicks with circulating anti-FGF-23 antibody has similar plasma phosphate and bone ash with chicks fed with the phosphate replete diet, when fed with a phosphorus deficient diet, suggesting the increased phosphate utilization in chicks (Bobeck et al., 2012). Neutralization of FGF-23 reduces excreta phosphorus of laying hens and chicks (Ren et al., 2017a, b). In mammals, the effects of FGF23 on phosphate homeostasis are mediated by binding α-Klotho, a coreceptor of FGF23 (Urakawa et al., 2006), which deficiency results in osteoporosis, osteomalacia, vascular calcification and peripheral insulin sensitivity (Kuro-o et al., 1997). In mammals, it has been confirmed that FGF23 mRNA is primarily produced by bone (Liu et al., 2003; Mirams et al., 2004; Yoshiko et al., 2007; Bonewald and Wacker, 2013) and is regulated by dietary phosphorus (Ito et al., 2005; Perwad et al., 2005). However, FGF23 mRNA expression profile and regulation by phosphorus in avian species have not yet been reported. In the present study, for the first time in avian species, we investigated chicken FGF23 mRNA expression profile and evaluated the effect of dietary phosphorus on FGF23 mRNA expression in liver and bone. The results of this study will provide a foundation for understanding the functions of the chicken FGF23 gene. MATERIALS AND METHODS All procedures in the study were approved by the Animal Care Committee of Shandong Agricultural University and were performed in accordance with the guidelines for experimental animals of the Ministry of Science and Technology (Beijing, China). Animal Experiment Assessment of FGF23 mRNA in Tissues of Mice and Chickens Eight Hy-Line Brown female chickens of 80 wk of age were obtained from a local commercial farm. After sacrifice, the center part of calvaria, the proximal shaft of femur, the proximal shaft of tibia, medullary bone of femur, brain, spleen, duodenum, jejunum, ileum, heart and the right kidney were sampled for the analysis of FGF23 and α-Klotho mRNA expression profiles in chicken. Eight 18-d embryos of Hy-Line Brown were obtained from a local hatchery. The shaft of tibia, liver, heart and jejunum were obtained for the measurement of embryo FGF23 mRNA expression profile. Eight 18-d embryos were obtained and eight chickens were respectively obtained at 2-, 25-, 50-, and 80-wk of age. The liver and proximal shaft tibia were sampled for the measurement of the developmental changes of FGF23 mRNA. Eight female 12-wk-old KM mice were obtained from China Biologic Products, Inc. (Taian, China) for analysis of FGF23 expression in mouse liver and femur. All the tissue samples were snap frozen in liquid nitrogen and stored at −80°C for subsequent RNA extraction. Effect of Dietary Phosphorus on FGF23 Expression To determine the effect of dietary phosphorus intake on the FGF23 mRNA expression, 36 Hy-Line Brown laying hens at 25 wk of age with similar egg production and body weight were randomly divided into three groups of 12 hens and fed with the corn-soybean meal basal diets (Table 1) differed in available phosphorus (AP): 0.15% AP (LP), 0.40% AP (MP, control), and 0.80% AP (HP). The experimental hens were reared in battery cage (0.40 m long × 0.45 m high × 0.40 m wide), with of 1 hen per cage. The light regime was 16 h light and 8 h dark. The hens had free access to feed and water. During the 11-d experimental period, feed intake, egg number, and egg weight were recorded every other day. At the end of the experiment, blood samples were collected from the wing vein of eight hens selected randomly from each group, and serum was separated by centrifugation at 1500 g for 15 min and stored at −20°C until analysis. These hens were sacrificed by exsanguination (Close et al., 1997). Liver, the proximal shaft of femur and tibia, and the center part of calvaria were immediately removed, snap-frozen in liquid nitrogen, and stored at −80°C for further analysis. Table 1. Composition of experimental diets. Ingredients LP (%) MP (%) HP (%) Corn (8.5% CP) 60.72 60.72 60.72 Soybean meal (46% CP) 25.39 25.39 25.39 Limestone 9.73 8.76 7.22 Dicalcium phosphate 0 1.62 4.18 Soybean oil 1.43 1.43 1.43 MaiFan stone 1.70 1.05 0.03 Sodium chloride 0.32 0.32 0.32 Vitamin-Mineral Premix1 0.25 0.25 0.25 Calculated composition Crude protein 16.50 16.50 16.50 ME, kcal/kg 2700 2700 2700 Calcium 3.50 3.50 3.50 Total phosphorus 0.32 0.58 0.99 Available phosphorus 0.15 0.40 0.80 Ingredients LP (%) MP (%) HP (%) Corn (8.5% CP) 60.72 60.72 60.72 Soybean meal (46% CP) 25.39 25.39 25.39 Limestone 9.73 8.76 7.22 Dicalcium phosphate 0 1.62 4.18 Soybean oil 1.43 1.43 1.43 MaiFan stone 1.70 1.05 0.03 Sodium chloride 0.32 0.32 0.32 Vitamin-Mineral Premix1 0.25 0.25 0.25 Calculated composition Crude protein 16.50 16.50 16.50 ME, kcal/kg 2700 2700 2700 Calcium 3.50 3.50 3.50 Total phosphorus 0.32 0.58 0.99 Available phosphorus 0.15 0.40 0.80 1Premix provided the following per kg of diet: vitamin A, 8000 IU; vitamin D3, 3200 IU; vitamin E, 20 IU; vitamin K, 3 mg; thiamin 1.7 mg; riboflavin, 5.5 mg; niacin, 28 mg; pantothenic acid, 6.6 mg; pyridoxine, 3.3 mg; biotin, 0.1 mg; folic acid, 0.6 mg; vitamin B12, 0.022 mg; Mn,88 mg; Zn, 88 mg; Fe, 55 mg; I, 1.7 mg; Cu, 5.5 mg; Se, 0.3 mg. View Large Table 1. Composition of experimental diets. Ingredients LP (%) MP (%) HP (%) Corn (8.5% CP) 60.72 60.72 60.72 Soybean meal (46% CP) 25.39 25.39 25.39 Limestone 9.73 8.76 7.22 Dicalcium phosphate 0 1.62 4.18 Soybean oil 1.43 1.43 1.43 MaiFan stone 1.70 1.05 0.03 Sodium chloride 0.32 0.32 0.32 Vitamin-Mineral Premix1 0.25 0.25 0.25 Calculated composition Crude protein 16.50 16.50 16.50 ME, kcal/kg 2700 2700 2700 Calcium 3.50 3.50 3.50 Total phosphorus 0.32 0.58 0.99 Available phosphorus 0.15 0.40 0.80 Ingredients LP (%) MP (%) HP (%) Corn (8.5% CP) 60.72 60.72 60.72 Soybean meal (46% CP) 25.39 25.39 25.39 Limestone 9.73 8.76 7.22 Dicalcium phosphate 0 1.62 4.18 Soybean oil 1.43 1.43 1.43 MaiFan stone 1.70 1.05 0.03 Sodium chloride 0.32 0.32 0.32 Vitamin-Mineral Premix1 0.25 0.25 0.25 Calculated composition Crude protein 16.50 16.50 16.50 ME, kcal/kg 2700 2700 2700 Calcium 3.50 3.50 3.50 Total phosphorus 0.32 0.58 0.99 Available phosphorus 0.15 0.40 0.80 1Premix provided the following per kg of diet: vitamin A, 8000 IU; vitamin D3, 3200 IU; vitamin E, 20 IU; vitamin K, 3 mg; thiamin 1.7 mg; riboflavin, 5.5 mg; niacin, 28 mg; pantothenic acid, 6.6 mg; pyridoxine, 3.3 mg; biotin, 0.1 mg; folic acid, 0.6 mg; vitamin B12, 0.022 mg; Mn,88 mg; Zn, 88 mg; Fe, 55 mg; I, 1.7 mg; Cu, 5.5 mg; Se, 0.3 mg. View Large RNA Extraction and cDNA Synthesis Total RNA was extracted with the TRIzol Reagent (Invitrogen, San Diego, CA, USA) according to RNA isolation procedure from non-bone tissues. During RNA precipitation procedure of bone tissue, 0.25 mL isopropanol and 0.25 mL mix of 0.8 mol/L sodium citrate and 1.2 mol/L NaCl per 1 mL TRIzol Reagent were added to the aqueous phase for precipitating the RNA and maintaining proteoglycans of bone tissue in a soluble form. RNA quality was determined with agarose gel electrophoresis and a biophotometer (Eppendorf, Hamburg, Germany) detecting the UV absorbance ratio at 260 nm and 280 nm. The cDNA was synthesized using reverse transcription-polymerase chain reaction kit (Roche, Germany). The reaction was performed in a volume of 20 μL containing 1000 ng total RNA, 60 μmol/L random hexamer primer, 8 mmol/L MgCl2, 20 U RNase inhibitor, 1 mmol/L dNTP, 10 U reverse transcriptase, and PCR-grade water. Cloning of Chicken FGF23 cDNA According to the predicted FGF23 mRNA sequence in Gallus (GenBank accession number: XM_425,663), the following primers were generated to amplify the complete coding sequence (CDS) of FGF23 cDNA from the liver and calvaria of chicken at 25 wk of age by PCR: forward primer 5΄-CTGCTCTTCATAAGCCCCTG-3΄, reverse primer 5΄-AGCCACCTTGAGGGTTAGAAA-3΄. PCR program initially started with 94°C for 5 min, following by 35 cycles of 30 s at 94°C, 30 s at 55°C, 1 min at 72°C, and an extension step of 10 min at 72°C. The purified PCR products were cloned into the PEASY-T1 vector (TransGen Biotech Co., Ltd., Beijing, China) and sequenced commercially (Sangon, Shanghai, China). Sequence Analysis DNAMAN software (Lynnon Biosoft, Quebec, Canada) was used for deducing the amino acid sequence and multiple sequence alignment. Signal peptides were predicted by SignalP 4.0 Server (http://www.cbs.dtu.dk/services/SignalP/). Sequence similarity analysis was performed by using the BLAST program (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Real-time Quantitative PCR (RT-qPCR) Assay for mRNA Expression RT-qPCR analysis was conducted using 20 μL mix consisting of 2 μL the cDNA template (diluted 10 times), 0.25 μmol/L of each primer and 7 μL SYBR Green Master (Roche, Germany) through quantstudio 5 Real-Time PCR Systems (Applied Biosystems by Thermo Fisher Scientific). The cycling condition consisted of a predenaturation at 95°C for 10 min followed by 40 cycles denaturation at 95°C for 15 s and annealing and extension at 60°C for 1 min. Standard curve and melt curve were plotted to calculate the efficiency of the primers. RT-qPCR production was sequenced (Sangon Biotech, Shanghai, China) to verify amplification specificity further. The sequences of primers were described in Table 2. The relative expression quantity was calculated using the method of 2−ΔΔCt (Livak and Schmittgen, 2001) and data were presented as fold changes relative to the reference sample. The three genes, β-actin, TATA-binding protein gene (TBP) and glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH), were measured and the gene whose expression was not affected by experimental treatment was used as internal control gene. Table 2. Real-time PCR primers used in this study. gene GeneBank accession No. Primer sequence (5΄-3΄) Product length (bp) Chicken FGF23 XM_425,663.2 Forward ATGCTGCTTGTGCTCTGTATC 190 Reverse ACTGTAAATGGTTTGGTGAGG Chicken β-actin NM_205,518.1 Forward TGCGTGACATCAAGGAGAAG 300 Reverse TGCCAGGGTACATTGTGGTA Chicken TBP XM_01,528,4048.1 Forward ACAACAGCTTGCCGCCCTACG 51 Reverse TTGCACCCTGAGGGGAGGCT Chicken α-Klotho XM_417,105.5 Forward ACCCGTCAATCCTGTTGG 174 Reverse TCAGCGTAGTCGTGGAAGAG Mouse FGF23 NM_02,2657.4 Forward GGATCTCCACGGCAACATT 113 Reverse AGTGATGCTTCTGCGACAAGT Mouse GAPDH XM_01,732,1385 Forward GGTTGTCTCCTGCGACTTCA 183 Reverse TGGTCCAGGGTTTCTTACTCC gene GeneBank accession No. Primer sequence (5΄-3΄) Product length (bp) Chicken FGF23 XM_425,663.2 Forward ATGCTGCTTGTGCTCTGTATC 190 Reverse ACTGTAAATGGTTTGGTGAGG Chicken β-actin NM_205,518.1 Forward TGCGTGACATCAAGGAGAAG 300 Reverse TGCCAGGGTACATTGTGGTA Chicken TBP XM_01,528,4048.1 Forward ACAACAGCTTGCCGCCCTACG 51 Reverse TTGCACCCTGAGGGGAGGCT Chicken α-Klotho XM_417,105.5 Forward ACCCGTCAATCCTGTTGG 174 Reverse TCAGCGTAGTCGTGGAAGAG Mouse FGF23 NM_02,2657.4 Forward GGATCTCCACGGCAACATT 113 Reverse AGTGATGCTTCTGCGACAAGT Mouse GAPDH XM_01,732,1385 Forward GGTTGTCTCCTGCGACTTCA 183 Reverse TGGTCCAGGGTTTCTTACTCC View Large Table 2. Real-time PCR primers used in this study. gene GeneBank accession No. Primer sequence (5΄-3΄) Product length (bp) Chicken FGF23 XM_425,663.2 Forward ATGCTGCTTGTGCTCTGTATC 190 Reverse ACTGTAAATGGTTTGGTGAGG Chicken β-actin NM_205,518.1 Forward TGCGTGACATCAAGGAGAAG 300 Reverse TGCCAGGGTACATTGTGGTA Chicken TBP XM_01,528,4048.1 Forward ACAACAGCTTGCCGCCCTACG 51 Reverse TTGCACCCTGAGGGGAGGCT Chicken α-Klotho XM_417,105.5 Forward ACCCGTCAATCCTGTTGG 174 Reverse TCAGCGTAGTCGTGGAAGAG Mouse FGF23 NM_02,2657.4 Forward GGATCTCCACGGCAACATT 113 Reverse AGTGATGCTTCTGCGACAAGT Mouse GAPDH XM_01,732,1385 Forward GGTTGTCTCCTGCGACTTCA 183 Reverse TGGTCCAGGGTTTCTTACTCC gene GeneBank accession No. Primer sequence (5΄-3΄) Product length (bp) Chicken FGF23 XM_425,663.2 Forward ATGCTGCTTGTGCTCTGTATC 190 Reverse ACTGTAAATGGTTTGGTGAGG Chicken β-actin NM_205,518.1 Forward TGCGTGACATCAAGGAGAAG 300 Reverse TGCCAGGGTACATTGTGGTA Chicken TBP XM_01,528,4048.1 Forward ACAACAGCTTGCCGCCCTACG 51 Reverse TTGCACCCTGAGGGGAGGCT Chicken α-Klotho XM_417,105.5 Forward ACCCGTCAATCCTGTTGG 174 Reverse TCAGCGTAGTCGTGGAAGAG Mouse FGF23 NM_02,2657.4 Forward GGATCTCCACGGCAACATT 113 Reverse AGTGATGCTTCTGCGACAAGT Mouse GAPDH XM_01,732,1385 Forward GGTTGTCTCCTGCGACTTCA 183 Reverse TGGTCCAGGGTTTCTTACTCC View Large Serum Parameters Serum inorganic phosphorus (Pi) and ion calcium levels were determined using Pi assay kit by UV method and calcium assay kit by Arsenazo III method (Sichuan Maccura Biotechnology Co., Sichuan, China) respectively. Statistical Analysis Data were presented as the means ± SEM. For the variables FGF23 gene expression in tissues, a one-way ANOVA model was used to estimate the difference between tissues with individual chicken or embryo or mouse served as replicate (n = 8). For the variables FGF23 gene expression in liver, the proximal shaft of femur and tibia, a one-way ANOVA model was used to estimate the main effect of dietary AP level with individual experimental hen served as replicate (n = 8). The homogeneity of variances among groups was confirmed using Bartlett's test (SAS Institute). All the data were analyzed with SAS software (SAS version 8.1; SAS Institute Inc., Cary, NC, USA). When the main effect of the treatment was significant, the differences between means were assessed by Tukey's multiple comparisons test. P < 0.05 was considered statistically significant. RESULTS Cloning and Sequence Analysis of Chicken FGF23 Gene Gallus gallus FGF23 was predicted to encode a protein of 254 amino acids, including three exons. In Hy-Line Brown laying hen, the complete CDS of FGF23 (GenBank accession number: KY498532) with 753 bp from liver (Figure 1) was 100% identical to that from calvaria (Figure S1). There were two different bases between the CDS of Hy-Line Brown laying hen FGF23 and that of Gallus FGF23 by sequence alignment (Figure 1), but the deduced amino acid sequence of Hy-Line Brown laying hen FGF23 was 100% identical to that of Gallus (Figure S2) and shared 57%, 58%, and 87% identity with that of human, mouse, and pigeon, respectively. Analysis using SignalP Server predicted that chicken FGF23 had a signal peptide containing 25 amino acids, which also existed in FGF23 of other species (Figure 2). Chicken FGF23 included a conserved “RXXR” protease cleavage site similar to that of human, mouse, and pigeon (Figure 2). Figure 1. View largeDownload slide Alignment of coding sequence of Hy-Line Brown laying hen FGF23 (KY498532) with that of Gallus FGF23 (XM_425,663). Sequences were aligned using DNAMAN. The black shading indicates identical base sequences, and gray shading shows different base. The start codon (ATG) and the stop codon (TAA) are indicated with a triangle and an asterisk, respectively. Figure 1. View largeDownload slide Alignment of coding sequence of Hy-Line Brown laying hen FGF23 (KY498532) with that of Gallus FGF23 (XM_425,663). Sequences were aligned using DNAMAN. The black shading indicates identical base sequences, and gray shading shows different base. The start codon (ATG) and the stop codon (TAA) are indicated with a triangle and an asterisk, respectively. Figure 2. View largeDownload slide Multiple alignment of chicken FGF23 (ARU09840) amino acid sequence with those of other species, pigeon (PKK30177), human (AAG09917), and mouse (AAG09916). Sequences were aligned using DNAMAN. The signal peptides were boxed with solid line. Protease cleavage sites “RXXR” were boxed with dotted line. Identical amino acids were shaded and gaps were indicated by dots in order to optimize the alignment. Figure 2. View largeDownload slide Multiple alignment of chicken FGF23 (ARU09840) amino acid sequence with those of other species, pigeon (PKK30177), human (AAG09917), and mouse (AAG09916). Sequences were aligned using DNAMAN. The signal peptides were boxed with solid line. Protease cleavage sites “RXXR” were boxed with dotted line. Identical amino acids were shaded and gaps were indicated by dots in order to optimize the alignment. FGF23 and α-Klotho Expression Profile FGF23 mRNA expression was detected by RT-qPCR in all the evaluated tissues of chicken, and the level was significantly higher in liver than in other tissues including calvaria, femur, tibia, medullary bone, brain, spleen, duodenum, jejunum, ileum, heart and kidney (Figure 3A, P < 0.0001). FGF23 mRNA expression levels in calvaria, femur and tibia were higher than in jejunum, ileum, kidney and heart (Figure 3A, P < 0.01). FGF23 requires α-Klotho as cofactor to cognate FGF receptors to regulate phosphate homeostasis. The mRNA expression of α-Klotho was the highest in kidney in all the evaluated tissues (Figure 3B, P < 0.0001). α-Klotho expressed at a relative medium level in calvaria, brain, and heart, which was significantly higher than that in liver, ileum, duodenum, medullary bone, tibia, and spleen (Figure 3B, P < 0.01). In mice, FGF23 mRNA level in femur was far higher (>100 times) than in liver (Figure 4, P < 0.0001). Figure 3. View largeDownload slide FGF23 (A) and α-Klotho (B) mRNA expression in multiple tissues of 80-wk-old laying hens. Relative quantification of gene expression was determined using real-time PCR. The internal control was β-actin. Results were presented as fold changes relative to the tibia (n = 8). Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Figure 3. View largeDownload slide FGF23 (A) and α-Klotho (B) mRNA expression in multiple tissues of 80-wk-old laying hens. Relative quantification of gene expression was determined using real-time PCR. The internal control was β-actin. Results were presented as fold changes relative to the tibia (n = 8). Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Figure 4. View largeDownload slide FGF23 mRNA expression in mouse liver and femur. Relative quantification of FGF23 expression was determined using real-time PCR. The internal control was GAPDH. Result was presented as fold change relative to the liver. Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Figure 4. View largeDownload slide FGF23 mRNA expression in mouse liver and femur. Relative quantification of FGF23 expression was determined using real-time PCR. The internal control was GAPDH. Result was presented as fold change relative to the liver. Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). The developmental changes of FGF23 mRNA expression were also analyzed. In embryos, the FGF23 mRNA expression was much higher in tibia than in liver, heart, and jejunum (P < 0.01, Figure 5A). However, in liver, the FGF23 expression levels in 2-, 25-, 50-, 80-wk-old chickens were much higher (> 24 times) than in embryos (P<0.0001, Figure 5B), and there was no difference among chickens at 2, 25, 50 and 80 wk (P > 0.05). The expression levels in tibia of embryos and 2-, 50-, 80-wk-old chickens were similar (P > 0.05), and the level in 25-wk-old chickens was lower than in embryos and 2-wk-old chickens (P < 0.05, Figure 5C) and had no difference to 50-, 80-wk-old chickens (P > 0.05). Figure 5. View largeDownload slide FGF23 mRNA expression in 18-d embryos (A), 18-d embryo (18-d E) and 2-, 25-, 50, 80-wk-old chicken livers (B), 18-d embryo (18-d E) and 2-, 25-, -50, -80-wk-old chicken tibiae (C). Relative quantification of FGF23 expression was determined using real-time PCR. The internal control was β-actin. Results were presented as fold changes relative to 18-d embryos. Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Figure 5. View largeDownload slide FGF23 mRNA expression in 18-d embryos (A), 18-d embryo (18-d E) and 2-, 25-, 50, 80-wk-old chicken livers (B), 18-d embryo (18-d E) and 2-, 25-, -50, -80-wk-old chicken tibiae (C). Relative quantification of FGF23 expression was determined using real-time PCR. The internal control was β-actin. Results were presented as fold changes relative to 18-d embryos. Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Effect of Dietary Phosphorus Supplementation on the Expression of FGF23 and α-Klotho mRNA To detect the effect of phosphorus supplementation on the expression of FGF23 mRNA, laying hens were treated with 3 levels of dietary phosphorus. Serum Pi concentration was increased by dietary phosphorus supplementation in a dose dependent manner (P < 0.001, Table 3), but serum calcium level was not changed significantly (P > 0.05, Table 3). HP diets significantly up-regulated the level of FGF23 mRNA in calvaria, femur, and tibia compared with LP diets (P < 0.05, Figure 6), whereas the level in liver didn’t differ significantly among the three groups (P > 0.05, Figure 6). HP diets up-regulated FGF23 mRNA expression significantly compared with MP diets only in calvaria (P < 0.05, Figure 6). However, the mRNA level of α-Klotho in kidney was not changed significantly by dietary phosphorus supplementation (P > 0.05, Figure 7). Figure 6. View largeDownload slide Effect of the levels of dietary available phosphorus on the expression of FGF23 mRNA in the liver, calvaria, femur and tibia of laying hens treated with LP, MP and HP diets. Relative quantification of FGF23 expression was determined using real-time PCR. The internal control was TATA-binding protein (TBP) gene. Results were presented as fold changes relative to LP diets. Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Figure 6. View largeDownload slide Effect of the levels of dietary available phosphorus on the expression of FGF23 mRNA in the liver, calvaria, femur and tibia of laying hens treated with LP, MP and HP diets. Relative quantification of FGF23 expression was determined using real-time PCR. The internal control was TATA-binding protein (TBP) gene. Results were presented as fold changes relative to LP diets. Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Figure 7. View largeDownload slide Effect of the levels of dietary available phosphorus on the expression of α-Klotho mRNA in the kidney of laying hens treated with LP, MP and HP diets. Relative quantification of α-Klotho expression was determined using real-time PCR. The internal control was β-actin. Results were presented as fold changes relative to LP diets. Vertical bars represent the means ± SEM (n = 8). Figure 7. View largeDownload slide Effect of the levels of dietary available phosphorus on the expression of α-Klotho mRNA in the kidney of laying hens treated with LP, MP and HP diets. Relative quantification of α-Klotho expression was determined using real-time PCR. The internal control was β-actin. Results were presented as fold changes relative to LP diets. Vertical bars represent the means ± SEM (n = 8). Table 3. Effect of dietary phosphorus supplementation on serum parameters of laying hens.1 LP MP HP P-value Phosohorus, mmol/L 1.21±0.07a 1.50±0.10b 1.85±0.11c <0.001 Calcium, mmol/L 3.88±0.07 3.77±0.06 3.90±0.06 0.290 LP MP HP P-value Phosohorus, mmol/L 1.21±0.07a 1.50±0.10b 1.85±0.11c <0.001 Calcium, mmol/L 3.88±0.07 3.77±0.06 3.90±0.06 0.290 1Data are shown as the mean ± SEM. a,b,cMeans with different letters differ significantly (n = 8, P < 0.05). View Large Table 3. Effect of dietary phosphorus supplementation on serum parameters of laying hens.1 LP MP HP P-value Phosohorus, mmol/L 1.21±0.07a 1.50±0.10b 1.85±0.11c <0.001 Calcium, mmol/L 3.88±0.07 3.77±0.06 3.90±0.06 0.290 LP MP HP P-value Phosohorus, mmol/L 1.21±0.07a 1.50±0.10b 1.85±0.11c <0.001 Calcium, mmol/L 3.88±0.07 3.77±0.06 3.90±0.06 0.290 1Data are shown as the mean ± SEM. a,b,cMeans with different letters differ significantly (n = 8, P < 0.05). View Large DISCUSSION To date, most of studies on FGF23 have been carried out on mammalian species, such as human, rat, and mouse. Several recent reports have shown that anti-FGF-23 antibody treatment increased phosphorus retention in chickens (Bobeck et al., 2012; Ren et al., 2017a, b). However, the information about FGF23 mRNA expression in avian species is limited. In this study, we first cloned cDNA sequence of chicken FGF23 predicted to encode a protein with a signal peptide and a RXXR motif, which was consistent with the observations from human and mammalian cell line (White et al., 2001; Liu et al., 2003). We first found that FGF23 mRNA was widely expressed in chicken tissues (Figure 3A), but the expression pattern was different to that of mammals. Human FGF23 mRNA expression was found to be higher in normal bone than in kidney, liver, thyroid, or parathyroid tissue (Mirams et al., 2004). In rat, FGF23 mRNA levels were much higher (>30 times) in calvaria, femur, and incisor than in other tissues such as spleen, thymus, small intestine, liver, kidney, heart, and brain (Yoshiko et al., 2007).The mouse FGF23 mRNA was expressed in bone, thymus, brain, heart, skeletal muscle, spleen, skin, lung, and testes, and the aboundance in bone was the highest (Liu et al., 2003; Mirams et al., 2004). In line with the previous study, our results also indicated that mouse FGF23 mRNA level was much higher (>100 times) in femur than in liver (Figure 4). These studies indicated that in mouse, rat, and human, FGF23 mRNA was predominantly expressed in bone and slightly expressed in liver. In contrast to the above findings in mammals, the present result indicated that FGF23 mRNA was expressed at unexpected higher level in liver than other tissues like bone in chickens (Figure 3A). In adult zebrafish, FGF23 is expressed in the corpuscles of Stannius, which are endocrine glands that lie in close proximity to the nephron (Mangos et al., 2012). These results suggest that FGF23 expresses in a species-specific way. Chicken FGF23 was predicted to be a secreted protein with a signal peptide (Figure 2), and its coreceptor, α-Klotho, was highly expressed in chicken kidney (Figure 3B), This result was in accordance with that in mammals whose α-Klotho mRNA is highly expressed in kidney (Kuro-o et al., 1997; Lim et al., 2015). The result suggests that kidney may be an important target organ of FGF23 in chicken. This speculation was supported by the fact that kidney is a target organ of FGF23 in human, rat, and mouse (Saito et al., 2003; Segawa et al., 2003; Shimada et al., 2004; Berndt and Kumar, 2007). In human embryo, FGF23 mRNA is only expressed in the heart and liver at 30-day and 8 wk gestation stage and not expressed at later developmental stages (Cormier et al., 2005). Moreover, FGF23 is not required to regulate fetal phosphorus metabolism but exerts effects within 12 h after birth (Ma et al., 2017). The rat FGF23 mRNA is detectable in multiple fetal and adult tissues and is highly expressed in adult calvaria, femur, and incisor, suggesting that FGF23 may be of less general importance in fetal than after birth (Yoshiko et al., 2007). In contrast to the result in mammals, in chicken, FGF23 mRNA level was significantly higher in embryo tibia than other embryo tissues tested (Figure 5A), and had comparable expression level with chickens at different ages (Figure 5C), suggesting that FGF23 may play an important role in embryo bone development as well as after hatching. In contrast, FGF23 mRNA level was significantly lower in liver of embryo than in 2-, 25-, 50-, 80-wk-old chicken livers (Figure 5B). The result may imply that FGF23 functions differently in chicken embryo and in post-hatching chickens. To the best of our knowledge, this is the first report about the FGF23 expression in chicken, and the biological significance of the high expression of FGF23 in chicken liver needs to be investigated further. As the expression of FGF23 in embryos from 18-day to hatching was measured, the possibility that FGF23 has not yet been “up-regulated” for hatch needs to be investigated further. Previous studies have shown that Pi regulates FGF23 mRNA expression in vitro and vivo. In mouse, the low (0.02%) Pi diets downregulated FGF23 mRNA expression in calvaria and levels of serum Pi compared with high (1%) Pi diets (Perwad et al., 2005). In primary cultured rat osteoblasts and SV40-transformed human fetal bone cells, the mRNA expression of FGF23 was increased by high concentrations of extracellular phosphate (Mirams et al., 2004; Yamamoto et al., 2010). In laying hen, the inhibition of FGF-23 action by neutralizing antibody reduced phosphorus excretion (Ren et al., 2017a, b). According to these findings, we hypothesized that dietary phosphorus level may regulate the expression of FGF23 to maintain phosphate homeostasis in chicken. Compared with LP diets, HP diets up-regulated serum Pi concentration (Table 3) and FGF23 mRNA level in bone tissue (Figure 6), indicating that bone FGF23 expression is regulated by dietary phosphorus level in chickens. In this study, feed intake (LP: 114.4±3.0 g, MP: 112.5±3.6 g, and HP: 112.4±5.0 g, P > 0.05) and egg production (LP: 57.8±1.7 g, MP: 56.1±0.9 g, and HP: 56.8±2.3 g/hen/day, P > 0.05) were not influenced by phosphorus supplementation, indicating that the laying performance was not influenced by dietary phosphorus level within a short period. The result indicates that the laying performance play a less important role in FGF23 expression in bone. Moreover, dietary phosphorus level didn’t affect FGF23 mRNA level in liver (Figure 6), suggesting that FGF23 in chicken liver may not be involved in maintaining phosphate homeostasis and the function of hepatic FGF23 needs further study. However, there are some reports showing that calcium regulates FGF23 expression (Shimada et al., 2005; David et al., 2013). Dietary calcium supplementation significantly increased FGF23 mRNA abundance in the femur of both wild-type and VDR KO mice (Shimada et al., 2005; David et al., 2013), and the addition of calcium to the culture media also stimulated FGF23 message expression in MC3T3-E1 osteoblasts (David et al., 2013). In this study, serum calcium concentration was not changed by dietary phosphorus supplementation (Table 3), suggesting that calcium is not involved in the altered FGF23 mRNA expression by dietary phosphorus level in the present study. In mammals, FGF23 reduces expression of the Na-dependent phosphate transporters (type IIa and IIc) within the renal proximal tubular membranes to excrete excess phosphate (Berndt and Kumar, 2007). In the present study, the α-Klotho mRNA in kidney was not influenced by dietary phosphorus treatment (Figure 7), indicating that dietary phosphorus level regulates the transcription of FGF23 but not its co-receptor α-Klotho. In conclusion, FGF23 was widely expressed in chicken tissues. Interestingly, FGF23 mRNA expression pattern in chicken was clearly different from that in mammals; chicken had the highest FGF23 expression in liver rather than in bone like mammals. In chicken embryo, however, FGF23 was highly expressed in tibia. High dietary phosphorus level up-regulated FGF23 mRNA expression in bone, whereas had no influence on its expression in liver. The expression of α-Klotho was high in kidney in chickens. The result provides a basis for future investigations into the functions of FGF23 in chicken. SUPPLEMENTARY DATA Supplementary data are available at Poultry Science online. Figure S1. Alignment coding sequence of liver FGF23 with that of calvaria FGF23. The black shading indicates identical sequences. Figure S2. Alignment of Gallus FGF23 (XP_ 425, 663.1) with the deduced amino acid sequence of Hy-Line Brown laying hen FGF23. The black shading indicates identical amino acids. Acknowledgements This work was supported by National Natural Science Foundation of China (31772619,31672442), National Key Research Program of China (2016YFD0500510), the China Agriculture Research System (CARS-41), the Taishan Scholars Program (201511023), and Funds of Shandong “Double Tops” Program. Footnotes 1The nucleotide sequence data reported in this paper have been submitted to GenBank Submission nucleotide sequence database and have been assigned the accession number KY498532. 2The appropriate scientific section is Genetics and Genomics. REFERENCES Berndt T. , Kumar R. . 2007 . Phosphatonins and the regulation of phosphate homeostasis . Annu. Rev. Physiol. 69 : 341 – 359 . Google Scholar CrossRef Search ADS PubMed Bobeck E. A. , Burgess K. S. , Jarmes T. R. , Piccione M. L. , Cook M. E. . 2012 . Maternally-derived antibody to fibroblast growth factor-23 reduced dietary phosphate requirements in growing chicks . Biochem. Biophys. Res. Commun. 420 : 666 – 670 . Google Scholar CrossRef Search ADS PubMed Bonewald L. F. , Wacker M. J. . 2013 . FGF23 production by osteocytes . Pediatr. Nephrol. 8 : 563 – 568 . Google Scholar CrossRef Search ADS Bouillon R. , Suda T. . 2014 . Vitamin D: calcium and bone homeostasis during evolution . Bonekey Rep . 3 : 480 . Google Scholar CrossRef Search ADS PubMed Close B. , Banister K. , Baumans V. , Bernoth E. M. , Bromage N. , Bunyan J. , Erhardt W. , Flecknell P. , Gregory N. , Hackbarth H. , Morton D. , Warwick C. . 1997 . Recommendations for euthanasia of experimental animals: Part 2 . Lab. Anim. 31 : 1 – 32 . Google Scholar CrossRef Search ADS PubMed Cormier S. , Leroy C. , Delezoide A. L , Silve C. . 2005 . Expression of fibroblast growth factors 18 and 23 during human embryonic and fetal development . Gene Expr. Patterns 5 : 569 – 573 . Google Scholar CrossRef Search ADS PubMed David V. , Dai B. , Martin A. , Huang J. , Han X. , Quarles L. D. . 2013 . Calcium regulates FGF-23 expression in bone . Endocrinology . 154 : 4469 – 4482 . Google Scholar CrossRef Search ADS PubMed Dudas P. L. , Villalobos A. R. , Gocek-Sutterlin G. , Laverty G. , Renfro J. L. . 2002 . Regulation of transepithelial phosphate transport by PTH in chicken proximal tubule epithelium . Am. J. Physiol. Regul. Integr. Comp. Physiol. 282 : R139 – R146 . Google Scholar CrossRef Search ADS PubMed Faridi A. , Gitoee A. , France J. . 2015 . A meta-analysis of the effects of nonphytate phosphorus on broiler performance and tibia ash concentration . Poult. Sci. 94 : 2753 – 2762 . Google Scholar CrossRef Search ADS PubMed Humer E. , Schwarz C. , Schedle K. . 2015 . Phytate in pig and poultry nutrition . J Anim Physiol Anim Nutr 99 : 605 – 625 . Google Scholar CrossRef Search ADS Ito M. , Sakai Y. , Furumoto M. , Segawa H. , Haito S. , Yamanaka S. , Nakamura R. , Kuwahata M. , Miyamoto K. . 2005 . Vitamin D and phosphate regulate fibroblast growth factor-23 in K-562 cells . Am. J. Physiol. Endocrinol. Metab. 288 : E1101 – E1109 . Google Scholar CrossRef Search ADS PubMed Kuro-o M. , Matsumura Y. , Aizawa H. , Kawaguchi H. , Suga T. , Utsugi T. , Ohyama Y. , Kurabayashi M. , Kaname T. , Kume E. , Iwasaki H. , Iida A. , Shiraki-Iida T. , Nishikawa S. , Nagai R. , Nabeshima Y. I. . 1997 . Mutation of the mouse klotho gene leads to a syndrome resembling ageing . Nature . 390 : 45 – 51 . Google Scholar CrossRef Search ADS PubMed Lim K. , Groen A. , Molostvov G. , Lu T. , Lilley K. S. , Snead D. , James S. , Wilkinson I. B. , Ting S. , Hsiao L. L. , Hiemstra T. F. . 2015 . α-Klotho Expression in Human Tissues . J. Clin. Endocrinol. Metab. 100 : E1308 – E1318 . Google Scholar CrossRef Search ADS PubMed Liu S. G. , Guo R. , Simpson L. G. , Xiao Z. S. , Burnham C. E. , Quarles L. D. . 2003 . Regulation of fibroblastic growth factor 23 expression but not degradation by PHEX . J. Biol. Chem. 278 : 37419 – 37426 . Google Scholar CrossRef Search ADS PubMed Livak K. J. , Schmittgen T. D. . 2001 . Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta C(T)) . Methods . 25 : 402 – 408 . Google Scholar CrossRef Search ADS PubMed Ma Y. , Kirby B. J. , Fairbridge N. A. , Karaplis A. C. , Lanske B. , Kovacs C. S. . 2017 . FGF23 is not required to regulate fetal phosphorus metabolism but exerts effects within 12 hours after birth . Endocrinology . 158 : 252 – 263 . Google Scholar PubMed Mallin M. A. 2000 . Impacts of industrial animal production on rivers and estuaries . Am. Sci. 88 : 26 – 37 . Google Scholar CrossRef Search ADS Mangos S. , Amaral A. P. , Faul C. , Jüppner H. , Reiser J. , Wolf M. . 2012 . Expression of fgf23 and αklotho in developing embryonic tissues and adult kidney of the zebrafish, Danio rerio . Nephrol. Dial. Transplant. 27 : 4314 – 4322 . Google Scholar CrossRef Search ADS PubMed Marks J. , Debnam E. S. , Unwin R. J. . 2010 . Phosphate homeostasis and the renal-gastrointestinal axis . Am. J. Physiol. Renal Physiol. 299 : F285 – F296 . Google Scholar CrossRef Search ADS PubMed Mirams M. , Robinson B. G. , Mason R. S. , Nelson A. E. . 2004 . Bone as a source of FGF23: regulation by phosphate? Bone . 35 : 1192 – 1199 . Google Scholar CrossRef Search ADS PubMed Perwad F. , Azam N. , Zhang M. Y. , Yamashita T. , Tenenhouse H. S. , Portale A. A. . 2005 . Dietary and serum phosphorus regulate fibroblast growth factor 23 expression and 1,25-dihydroxyvitamin D metabolism in mice . Endocrinology . 146 : 5358 – 5364 . Google Scholar CrossRef Search ADS PubMed Ren Z. , B̈utz D. E. , Sand J. M. , Cook M. E. . 2017a . Antibody to fibroblast growth factor 23-peptide reduces excreta phosphorus of laying hens . Poult. Sci. 96 : 127 – 134 . Google Scholar CrossRef Search ADS Ren Z. , Ebrahimi M. , B̈utz D. E. , Sand J. M. , Zhang K. , Cook M. E. . 2017b . Antibody to fibroblast growth factor 23-peptide reduces excreta phosphorus of laying hens . Poult. Sci. 96 : 127 – 134 . Google Scholar CrossRef Search ADS Saito H. , Kusano K. , Kinosaki M. , Ito H. , Hirata M. , Segawa H. , Miyamoto K. , Fukushima N. . 2003 . Human fibroblast growth factor-23 mutants suppress Na+-dependent phosphate co-transport activity and 1alpha,25-dihydroxyvitamin D3 production . J. Biol. Chem. 278 : 2206 – 2211 . Google Scholar CrossRef Search ADS PubMed Segawa H. , Kawakami E. , Kaneko I. , Kuwahata M. , Ito M. , Kusano K. , Saito H. , Fukushima N. , Miyamoto K. . 2003 . Effect of hydrolysis-resistant FGF23-R179Q on dietary phosphate regulation of the renal type-II Na/Pi transporter . Pflugers Arch - Eur J Physiol . 446 : 585 – 592 . Google Scholar CrossRef Search ADS Shimada T. , Hasegawa H. , Yamazaki Y. , Muto T. , Hino R. , Takeuchi Y. , Fujita T. , Nakahara K. , Fukumoto S. , Yamashita T. . 2004 . FGF-23 is a potent regulator of vitamin D metabolism and phosphate homeostasis . J. Bone Miner. Res. 19 : 429 – 435 . Google Scholar CrossRef Search ADS PubMed Shimada T. , Yamazaki Y. , Takahashi M. , Hasegawa H. , Urakawa I. , Oshima T. , Ono K. , Kakitani M. , Tomizuka K. , Fujita T. , Fukumoto S. , Yamashita T. . 2005 . Vitamin D receptor-independent FGF23 actions in regulating phosphate and vitamin D metabolism . Am. J. Physiol. Renal Physiol. 298 : F1088 – F1095 . Google Scholar CrossRef Search ADS Smil V. 2000 . Phosphorus in the environment: natural flows and human interferences . Annu. Rev. Energy. Environ. 25 : 53 – 88 . Google Scholar CrossRef Search ADS Tilman D. , Fargione J. , Wolff B. , D’Antonio C. , Dobson A. , Howarth R. , Schindler D. , Schlesinger W. H. , Simberloff D. , Swackhamer D. . 2001 . Forecasting agriculturally driven global environmental change . Science . 292 : 281 – 284 . Google Scholar CrossRef Search ADS PubMed Urakawa I. , Yamazaki Y. , Shimada T. , Iijima K. , Hasegawa H. , Okawa K. , Fujita T. , Fukumoto S. , Yamashita T. . 2006 . Klotho converts canonical FGF receptor into a specific receptor for FGF23 . Nature . 444 : 770 – 774 . Google Scholar CrossRef Search ADS PubMed White K. E. , Carn G. , Lorenz-Depiereux B. , Benet-Pages A. , Strom T. M. , Econs M. J. . 2001 . Autosomal-dominant hypophosphatemic rickets (ADHR) mutations stabilize FGF-23 . Kidney Int. 60 : 2079 – 2086 . Google Scholar CrossRef Search ADS PubMed Yamamoto R. , Minamizaki T. , Yoshiko Y. , Yoshioka H. , Tanne K. , Aubin J. E. , Maeda N. . 2010 . 1alpha,25-dihydroxyvitamin D3 acts predominately in mature osteoblasts under conditions of high extracellular phosphate to increase fibroblast growth factor 23 production in vitro . J. Endocrinol. 206 : 279 – 286 . Google Scholar CrossRef Search ADS PubMed Yoshiko Y. , Wang H. , Minamizaki T. , Ijuin C. , Yamamoto R. , Suemune S. , Kozai K. , Tanne K. , Aubin J. E. , Maeda N. . 2007 . Mineralized tissue cells are a principal source of FGF23 . Bone . 40 : 1565 – 1573 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc. This article is published and distributed under the term of oxford University Press, standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Fibroblast growth factor 23 mRNA expression profile in chickens and its response to dietary phosphorus,

Loading next page...
 
/lp/ou_press/fibroblast-growth-factor-23-mrna-expression-profile-in-chicken-and-its-KFCsfzJxT9
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pey092
Publisher site
See Article on Publisher Site

Abstract

ABSTRACT In mammals, fibroblast growth factor 23 (FGF23) regulates phosphate homeostasis in kidney by binding α-Klotho, a coreceptor of FGF23. FGF23 mRNA is highly expressed in bone and slightly expressed in liver, and is regulated by dietary phosphorus. Little is known about distribution and regulation of FGF23 mRNA in avian lineage. The expression of FGF23 and its coreceptor α-Klotho in chicken and embryo were investigated by real-time quantitative PCR. The effect of dietary phosphorus on FGF23 expression was measured. 36 laying hens at 25 wk were randomly assigned to three dietary available phosphorus (AP) treatments for 11 days: 0.15% AP (LP), 0.40% AP (MP), and 0.80% AP (HP). We first cloned the full coding sequence of FGF23 by the reverse transcription PCR from chicken liver and calvaria. Bioinformatics analysis indicated that the deduced amino acid sequence was 57–87% identical to FGF23 of other species. In adult chicken FGF23 mRNA was expressed at unexpected higher level in liver than other tissues evaluated, including calvaria, femur, tibia, medullary bone, brain, spleen, duodenum, jejunum, ileum, heart and kidney (P < 0.0001), and α-Klotho was expressed at highest level in kidney. However, in 18-d chicken embryos, FGF23 mRNA level was much higher in tibia than in liver, heart and jejunum (P < 0.0001). Chickens at 2, 25, 50 and 80 wk had higher FGF23 expression in liver than 18-d chicken embryos, whereas chickens at 25 wk had lower FGF23 expression in tibia than 18-d chicken embryos and 2-wk-old chickens. HP diets significantly increased serum inorganic phosphorus level (P < 0.001) and FGF23 expression (P < 0.05) in bone tissue compared with LP diets, however, FGF23 mRNA abundance in liver was not changed significantly (P > 0.05) by dietary phosphorus treatments. In conclusion, FGF23 mRNA expression pattern in chicken was clearly different from that in mammals and dietary phosphorus regulated the expression of FGF23 in a tissue-specific way. INTRODUCITON Phosphorus pollution caused by increased animal waste production is increasingly recognized as a critical environmental problem (Tilman et al., 2001). Poultry excreta can meet plant nitrogen needs, but results in excess soil phosphorus (Smil, 2003), which can enter surface water and results in eutrophication (Mallin, 2000). In the past years, many efforts have been conducted to reduce the dietary supplementation of inorganic phosphorus by improving the utilization of phytate (Faridi et al., 2015; Humer et al., 2015). Current knowledge of the regulation of phosphorus metabolism is based on the network of parathyroid hormone and 1,25-dihydroxyvitamin D3 (Dudas et al., 2002; Marks et al., 2010; Bouillon and Suda, 2014). As a known regulator of phosphate homeostasis, fibroblast growth factor 23 (FGF23) increases renal phosphate excretion (Berndt and Kumar, 2007) and reduces the amount of phosphate absorption from the gut (Shimada et al., 2004) in mammals. Circulating FGF23 may regulate phosphate homeostasis in chicken. Chicks with circulating anti-FGF-23 antibody has similar plasma phosphate and bone ash with chicks fed with the phosphate replete diet, when fed with a phosphorus deficient diet, suggesting the increased phosphate utilization in chicks (Bobeck et al., 2012). Neutralization of FGF-23 reduces excreta phosphorus of laying hens and chicks (Ren et al., 2017a, b). In mammals, the effects of FGF23 on phosphate homeostasis are mediated by binding α-Klotho, a coreceptor of FGF23 (Urakawa et al., 2006), which deficiency results in osteoporosis, osteomalacia, vascular calcification and peripheral insulin sensitivity (Kuro-o et al., 1997). In mammals, it has been confirmed that FGF23 mRNA is primarily produced by bone (Liu et al., 2003; Mirams et al., 2004; Yoshiko et al., 2007; Bonewald and Wacker, 2013) and is regulated by dietary phosphorus (Ito et al., 2005; Perwad et al., 2005). However, FGF23 mRNA expression profile and regulation by phosphorus in avian species have not yet been reported. In the present study, for the first time in avian species, we investigated chicken FGF23 mRNA expression profile and evaluated the effect of dietary phosphorus on FGF23 mRNA expression in liver and bone. The results of this study will provide a foundation for understanding the functions of the chicken FGF23 gene. MATERIALS AND METHODS All procedures in the study were approved by the Animal Care Committee of Shandong Agricultural University and were performed in accordance with the guidelines for experimental animals of the Ministry of Science and Technology (Beijing, China). Animal Experiment Assessment of FGF23 mRNA in Tissues of Mice and Chickens Eight Hy-Line Brown female chickens of 80 wk of age were obtained from a local commercial farm. After sacrifice, the center part of calvaria, the proximal shaft of femur, the proximal shaft of tibia, medullary bone of femur, brain, spleen, duodenum, jejunum, ileum, heart and the right kidney were sampled for the analysis of FGF23 and α-Klotho mRNA expression profiles in chicken. Eight 18-d embryos of Hy-Line Brown were obtained from a local hatchery. The shaft of tibia, liver, heart and jejunum were obtained for the measurement of embryo FGF23 mRNA expression profile. Eight 18-d embryos were obtained and eight chickens were respectively obtained at 2-, 25-, 50-, and 80-wk of age. The liver and proximal shaft tibia were sampled for the measurement of the developmental changes of FGF23 mRNA. Eight female 12-wk-old KM mice were obtained from China Biologic Products, Inc. (Taian, China) for analysis of FGF23 expression in mouse liver and femur. All the tissue samples were snap frozen in liquid nitrogen and stored at −80°C for subsequent RNA extraction. Effect of Dietary Phosphorus on FGF23 Expression To determine the effect of dietary phosphorus intake on the FGF23 mRNA expression, 36 Hy-Line Brown laying hens at 25 wk of age with similar egg production and body weight were randomly divided into three groups of 12 hens and fed with the corn-soybean meal basal diets (Table 1) differed in available phosphorus (AP): 0.15% AP (LP), 0.40% AP (MP, control), and 0.80% AP (HP). The experimental hens were reared in battery cage (0.40 m long × 0.45 m high × 0.40 m wide), with of 1 hen per cage. The light regime was 16 h light and 8 h dark. The hens had free access to feed and water. During the 11-d experimental period, feed intake, egg number, and egg weight were recorded every other day. At the end of the experiment, blood samples were collected from the wing vein of eight hens selected randomly from each group, and serum was separated by centrifugation at 1500 g for 15 min and stored at −20°C until analysis. These hens were sacrificed by exsanguination (Close et al., 1997). Liver, the proximal shaft of femur and tibia, and the center part of calvaria were immediately removed, snap-frozen in liquid nitrogen, and stored at −80°C for further analysis. Table 1. Composition of experimental diets. Ingredients LP (%) MP (%) HP (%) Corn (8.5% CP) 60.72 60.72 60.72 Soybean meal (46% CP) 25.39 25.39 25.39 Limestone 9.73 8.76 7.22 Dicalcium phosphate 0 1.62 4.18 Soybean oil 1.43 1.43 1.43 MaiFan stone 1.70 1.05 0.03 Sodium chloride 0.32 0.32 0.32 Vitamin-Mineral Premix1 0.25 0.25 0.25 Calculated composition Crude protein 16.50 16.50 16.50 ME, kcal/kg 2700 2700 2700 Calcium 3.50 3.50 3.50 Total phosphorus 0.32 0.58 0.99 Available phosphorus 0.15 0.40 0.80 Ingredients LP (%) MP (%) HP (%) Corn (8.5% CP) 60.72 60.72 60.72 Soybean meal (46% CP) 25.39 25.39 25.39 Limestone 9.73 8.76 7.22 Dicalcium phosphate 0 1.62 4.18 Soybean oil 1.43 1.43 1.43 MaiFan stone 1.70 1.05 0.03 Sodium chloride 0.32 0.32 0.32 Vitamin-Mineral Premix1 0.25 0.25 0.25 Calculated composition Crude protein 16.50 16.50 16.50 ME, kcal/kg 2700 2700 2700 Calcium 3.50 3.50 3.50 Total phosphorus 0.32 0.58 0.99 Available phosphorus 0.15 0.40 0.80 1Premix provided the following per kg of diet: vitamin A, 8000 IU; vitamin D3, 3200 IU; vitamin E, 20 IU; vitamin K, 3 mg; thiamin 1.7 mg; riboflavin, 5.5 mg; niacin, 28 mg; pantothenic acid, 6.6 mg; pyridoxine, 3.3 mg; biotin, 0.1 mg; folic acid, 0.6 mg; vitamin B12, 0.022 mg; Mn,88 mg; Zn, 88 mg; Fe, 55 mg; I, 1.7 mg; Cu, 5.5 mg; Se, 0.3 mg. View Large Table 1. Composition of experimental diets. Ingredients LP (%) MP (%) HP (%) Corn (8.5% CP) 60.72 60.72 60.72 Soybean meal (46% CP) 25.39 25.39 25.39 Limestone 9.73 8.76 7.22 Dicalcium phosphate 0 1.62 4.18 Soybean oil 1.43 1.43 1.43 MaiFan stone 1.70 1.05 0.03 Sodium chloride 0.32 0.32 0.32 Vitamin-Mineral Premix1 0.25 0.25 0.25 Calculated composition Crude protein 16.50 16.50 16.50 ME, kcal/kg 2700 2700 2700 Calcium 3.50 3.50 3.50 Total phosphorus 0.32 0.58 0.99 Available phosphorus 0.15 0.40 0.80 Ingredients LP (%) MP (%) HP (%) Corn (8.5% CP) 60.72 60.72 60.72 Soybean meal (46% CP) 25.39 25.39 25.39 Limestone 9.73 8.76 7.22 Dicalcium phosphate 0 1.62 4.18 Soybean oil 1.43 1.43 1.43 MaiFan stone 1.70 1.05 0.03 Sodium chloride 0.32 0.32 0.32 Vitamin-Mineral Premix1 0.25 0.25 0.25 Calculated composition Crude protein 16.50 16.50 16.50 ME, kcal/kg 2700 2700 2700 Calcium 3.50 3.50 3.50 Total phosphorus 0.32 0.58 0.99 Available phosphorus 0.15 0.40 0.80 1Premix provided the following per kg of diet: vitamin A, 8000 IU; vitamin D3, 3200 IU; vitamin E, 20 IU; vitamin K, 3 mg; thiamin 1.7 mg; riboflavin, 5.5 mg; niacin, 28 mg; pantothenic acid, 6.6 mg; pyridoxine, 3.3 mg; biotin, 0.1 mg; folic acid, 0.6 mg; vitamin B12, 0.022 mg; Mn,88 mg; Zn, 88 mg; Fe, 55 mg; I, 1.7 mg; Cu, 5.5 mg; Se, 0.3 mg. View Large RNA Extraction and cDNA Synthesis Total RNA was extracted with the TRIzol Reagent (Invitrogen, San Diego, CA, USA) according to RNA isolation procedure from non-bone tissues. During RNA precipitation procedure of bone tissue, 0.25 mL isopropanol and 0.25 mL mix of 0.8 mol/L sodium citrate and 1.2 mol/L NaCl per 1 mL TRIzol Reagent were added to the aqueous phase for precipitating the RNA and maintaining proteoglycans of bone tissue in a soluble form. RNA quality was determined with agarose gel electrophoresis and a biophotometer (Eppendorf, Hamburg, Germany) detecting the UV absorbance ratio at 260 nm and 280 nm. The cDNA was synthesized using reverse transcription-polymerase chain reaction kit (Roche, Germany). The reaction was performed in a volume of 20 μL containing 1000 ng total RNA, 60 μmol/L random hexamer primer, 8 mmol/L MgCl2, 20 U RNase inhibitor, 1 mmol/L dNTP, 10 U reverse transcriptase, and PCR-grade water. Cloning of Chicken FGF23 cDNA According to the predicted FGF23 mRNA sequence in Gallus (GenBank accession number: XM_425,663), the following primers were generated to amplify the complete coding sequence (CDS) of FGF23 cDNA from the liver and calvaria of chicken at 25 wk of age by PCR: forward primer 5΄-CTGCTCTTCATAAGCCCCTG-3΄, reverse primer 5΄-AGCCACCTTGAGGGTTAGAAA-3΄. PCR program initially started with 94°C for 5 min, following by 35 cycles of 30 s at 94°C, 30 s at 55°C, 1 min at 72°C, and an extension step of 10 min at 72°C. The purified PCR products were cloned into the PEASY-T1 vector (TransGen Biotech Co., Ltd., Beijing, China) and sequenced commercially (Sangon, Shanghai, China). Sequence Analysis DNAMAN software (Lynnon Biosoft, Quebec, Canada) was used for deducing the amino acid sequence and multiple sequence alignment. Signal peptides were predicted by SignalP 4.0 Server (http://www.cbs.dtu.dk/services/SignalP/). Sequence similarity analysis was performed by using the BLAST program (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Real-time Quantitative PCR (RT-qPCR) Assay for mRNA Expression RT-qPCR analysis was conducted using 20 μL mix consisting of 2 μL the cDNA template (diluted 10 times), 0.25 μmol/L of each primer and 7 μL SYBR Green Master (Roche, Germany) through quantstudio 5 Real-Time PCR Systems (Applied Biosystems by Thermo Fisher Scientific). The cycling condition consisted of a predenaturation at 95°C for 10 min followed by 40 cycles denaturation at 95°C for 15 s and annealing and extension at 60°C for 1 min. Standard curve and melt curve were plotted to calculate the efficiency of the primers. RT-qPCR production was sequenced (Sangon Biotech, Shanghai, China) to verify amplification specificity further. The sequences of primers were described in Table 2. The relative expression quantity was calculated using the method of 2−ΔΔCt (Livak and Schmittgen, 2001) and data were presented as fold changes relative to the reference sample. The three genes, β-actin, TATA-binding protein gene (TBP) and glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH), were measured and the gene whose expression was not affected by experimental treatment was used as internal control gene. Table 2. Real-time PCR primers used in this study. gene GeneBank accession No. Primer sequence (5΄-3΄) Product length (bp) Chicken FGF23 XM_425,663.2 Forward ATGCTGCTTGTGCTCTGTATC 190 Reverse ACTGTAAATGGTTTGGTGAGG Chicken β-actin NM_205,518.1 Forward TGCGTGACATCAAGGAGAAG 300 Reverse TGCCAGGGTACATTGTGGTA Chicken TBP XM_01,528,4048.1 Forward ACAACAGCTTGCCGCCCTACG 51 Reverse TTGCACCCTGAGGGGAGGCT Chicken α-Klotho XM_417,105.5 Forward ACCCGTCAATCCTGTTGG 174 Reverse TCAGCGTAGTCGTGGAAGAG Mouse FGF23 NM_02,2657.4 Forward GGATCTCCACGGCAACATT 113 Reverse AGTGATGCTTCTGCGACAAGT Mouse GAPDH XM_01,732,1385 Forward GGTTGTCTCCTGCGACTTCA 183 Reverse TGGTCCAGGGTTTCTTACTCC gene GeneBank accession No. Primer sequence (5΄-3΄) Product length (bp) Chicken FGF23 XM_425,663.2 Forward ATGCTGCTTGTGCTCTGTATC 190 Reverse ACTGTAAATGGTTTGGTGAGG Chicken β-actin NM_205,518.1 Forward TGCGTGACATCAAGGAGAAG 300 Reverse TGCCAGGGTACATTGTGGTA Chicken TBP XM_01,528,4048.1 Forward ACAACAGCTTGCCGCCCTACG 51 Reverse TTGCACCCTGAGGGGAGGCT Chicken α-Klotho XM_417,105.5 Forward ACCCGTCAATCCTGTTGG 174 Reverse TCAGCGTAGTCGTGGAAGAG Mouse FGF23 NM_02,2657.4 Forward GGATCTCCACGGCAACATT 113 Reverse AGTGATGCTTCTGCGACAAGT Mouse GAPDH XM_01,732,1385 Forward GGTTGTCTCCTGCGACTTCA 183 Reverse TGGTCCAGGGTTTCTTACTCC View Large Table 2. Real-time PCR primers used in this study. gene GeneBank accession No. Primer sequence (5΄-3΄) Product length (bp) Chicken FGF23 XM_425,663.2 Forward ATGCTGCTTGTGCTCTGTATC 190 Reverse ACTGTAAATGGTTTGGTGAGG Chicken β-actin NM_205,518.1 Forward TGCGTGACATCAAGGAGAAG 300 Reverse TGCCAGGGTACATTGTGGTA Chicken TBP XM_01,528,4048.1 Forward ACAACAGCTTGCCGCCCTACG 51 Reverse TTGCACCCTGAGGGGAGGCT Chicken α-Klotho XM_417,105.5 Forward ACCCGTCAATCCTGTTGG 174 Reverse TCAGCGTAGTCGTGGAAGAG Mouse FGF23 NM_02,2657.4 Forward GGATCTCCACGGCAACATT 113 Reverse AGTGATGCTTCTGCGACAAGT Mouse GAPDH XM_01,732,1385 Forward GGTTGTCTCCTGCGACTTCA 183 Reverse TGGTCCAGGGTTTCTTACTCC gene GeneBank accession No. Primer sequence (5΄-3΄) Product length (bp) Chicken FGF23 XM_425,663.2 Forward ATGCTGCTTGTGCTCTGTATC 190 Reverse ACTGTAAATGGTTTGGTGAGG Chicken β-actin NM_205,518.1 Forward TGCGTGACATCAAGGAGAAG 300 Reverse TGCCAGGGTACATTGTGGTA Chicken TBP XM_01,528,4048.1 Forward ACAACAGCTTGCCGCCCTACG 51 Reverse TTGCACCCTGAGGGGAGGCT Chicken α-Klotho XM_417,105.5 Forward ACCCGTCAATCCTGTTGG 174 Reverse TCAGCGTAGTCGTGGAAGAG Mouse FGF23 NM_02,2657.4 Forward GGATCTCCACGGCAACATT 113 Reverse AGTGATGCTTCTGCGACAAGT Mouse GAPDH XM_01,732,1385 Forward GGTTGTCTCCTGCGACTTCA 183 Reverse TGGTCCAGGGTTTCTTACTCC View Large Serum Parameters Serum inorganic phosphorus (Pi) and ion calcium levels were determined using Pi assay kit by UV method and calcium assay kit by Arsenazo III method (Sichuan Maccura Biotechnology Co., Sichuan, China) respectively. Statistical Analysis Data were presented as the means ± SEM. For the variables FGF23 gene expression in tissues, a one-way ANOVA model was used to estimate the difference between tissues with individual chicken or embryo or mouse served as replicate (n = 8). For the variables FGF23 gene expression in liver, the proximal shaft of femur and tibia, a one-way ANOVA model was used to estimate the main effect of dietary AP level with individual experimental hen served as replicate (n = 8). The homogeneity of variances among groups was confirmed using Bartlett's test (SAS Institute). All the data were analyzed with SAS software (SAS version 8.1; SAS Institute Inc., Cary, NC, USA). When the main effect of the treatment was significant, the differences between means were assessed by Tukey's multiple comparisons test. P < 0.05 was considered statistically significant. RESULTS Cloning and Sequence Analysis of Chicken FGF23 Gene Gallus gallus FGF23 was predicted to encode a protein of 254 amino acids, including three exons. In Hy-Line Brown laying hen, the complete CDS of FGF23 (GenBank accession number: KY498532) with 753 bp from liver (Figure 1) was 100% identical to that from calvaria (Figure S1). There were two different bases between the CDS of Hy-Line Brown laying hen FGF23 and that of Gallus FGF23 by sequence alignment (Figure 1), but the deduced amino acid sequence of Hy-Line Brown laying hen FGF23 was 100% identical to that of Gallus (Figure S2) and shared 57%, 58%, and 87% identity with that of human, mouse, and pigeon, respectively. Analysis using SignalP Server predicted that chicken FGF23 had a signal peptide containing 25 amino acids, which also existed in FGF23 of other species (Figure 2). Chicken FGF23 included a conserved “RXXR” protease cleavage site similar to that of human, mouse, and pigeon (Figure 2). Figure 1. View largeDownload slide Alignment of coding sequence of Hy-Line Brown laying hen FGF23 (KY498532) with that of Gallus FGF23 (XM_425,663). Sequences were aligned using DNAMAN. The black shading indicates identical base sequences, and gray shading shows different base. The start codon (ATG) and the stop codon (TAA) are indicated with a triangle and an asterisk, respectively. Figure 1. View largeDownload slide Alignment of coding sequence of Hy-Line Brown laying hen FGF23 (KY498532) with that of Gallus FGF23 (XM_425,663). Sequences were aligned using DNAMAN. The black shading indicates identical base sequences, and gray shading shows different base. The start codon (ATG) and the stop codon (TAA) are indicated with a triangle and an asterisk, respectively. Figure 2. View largeDownload slide Multiple alignment of chicken FGF23 (ARU09840) amino acid sequence with those of other species, pigeon (PKK30177), human (AAG09917), and mouse (AAG09916). Sequences were aligned using DNAMAN. The signal peptides were boxed with solid line. Protease cleavage sites “RXXR” were boxed with dotted line. Identical amino acids were shaded and gaps were indicated by dots in order to optimize the alignment. Figure 2. View largeDownload slide Multiple alignment of chicken FGF23 (ARU09840) amino acid sequence with those of other species, pigeon (PKK30177), human (AAG09917), and mouse (AAG09916). Sequences were aligned using DNAMAN. The signal peptides were boxed with solid line. Protease cleavage sites “RXXR” were boxed with dotted line. Identical amino acids were shaded and gaps were indicated by dots in order to optimize the alignment. FGF23 and α-Klotho Expression Profile FGF23 mRNA expression was detected by RT-qPCR in all the evaluated tissues of chicken, and the level was significantly higher in liver than in other tissues including calvaria, femur, tibia, medullary bone, brain, spleen, duodenum, jejunum, ileum, heart and kidney (Figure 3A, P < 0.0001). FGF23 mRNA expression levels in calvaria, femur and tibia were higher than in jejunum, ileum, kidney and heart (Figure 3A, P < 0.01). FGF23 requires α-Klotho as cofactor to cognate FGF receptors to regulate phosphate homeostasis. The mRNA expression of α-Klotho was the highest in kidney in all the evaluated tissues (Figure 3B, P < 0.0001). α-Klotho expressed at a relative medium level in calvaria, brain, and heart, which was significantly higher than that in liver, ileum, duodenum, medullary bone, tibia, and spleen (Figure 3B, P < 0.01). In mice, FGF23 mRNA level in femur was far higher (>100 times) than in liver (Figure 4, P < 0.0001). Figure 3. View largeDownload slide FGF23 (A) and α-Klotho (B) mRNA expression in multiple tissues of 80-wk-old laying hens. Relative quantification of gene expression was determined using real-time PCR. The internal control was β-actin. Results were presented as fold changes relative to the tibia (n = 8). Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Figure 3. View largeDownload slide FGF23 (A) and α-Klotho (B) mRNA expression in multiple tissues of 80-wk-old laying hens. Relative quantification of gene expression was determined using real-time PCR. The internal control was β-actin. Results were presented as fold changes relative to the tibia (n = 8). Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Figure 4. View largeDownload slide FGF23 mRNA expression in mouse liver and femur. Relative quantification of FGF23 expression was determined using real-time PCR. The internal control was GAPDH. Result was presented as fold change relative to the liver. Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Figure 4. View largeDownload slide FGF23 mRNA expression in mouse liver and femur. Relative quantification of FGF23 expression was determined using real-time PCR. The internal control was GAPDH. Result was presented as fold change relative to the liver. Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). The developmental changes of FGF23 mRNA expression were also analyzed. In embryos, the FGF23 mRNA expression was much higher in tibia than in liver, heart, and jejunum (P < 0.01, Figure 5A). However, in liver, the FGF23 expression levels in 2-, 25-, 50-, 80-wk-old chickens were much higher (> 24 times) than in embryos (P<0.0001, Figure 5B), and there was no difference among chickens at 2, 25, 50 and 80 wk (P > 0.05). The expression levels in tibia of embryos and 2-, 50-, 80-wk-old chickens were similar (P > 0.05), and the level in 25-wk-old chickens was lower than in embryos and 2-wk-old chickens (P < 0.05, Figure 5C) and had no difference to 50-, 80-wk-old chickens (P > 0.05). Figure 5. View largeDownload slide FGF23 mRNA expression in 18-d embryos (A), 18-d embryo (18-d E) and 2-, 25-, 50, 80-wk-old chicken livers (B), 18-d embryo (18-d E) and 2-, 25-, -50, -80-wk-old chicken tibiae (C). Relative quantification of FGF23 expression was determined using real-time PCR. The internal control was β-actin. Results were presented as fold changes relative to 18-d embryos. Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Figure 5. View largeDownload slide FGF23 mRNA expression in 18-d embryos (A), 18-d embryo (18-d E) and 2-, 25-, 50, 80-wk-old chicken livers (B), 18-d embryo (18-d E) and 2-, 25-, -50, -80-wk-old chicken tibiae (C). Relative quantification of FGF23 expression was determined using real-time PCR. The internal control was β-actin. Results were presented as fold changes relative to 18-d embryos. Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Effect of Dietary Phosphorus Supplementation on the Expression of FGF23 and α-Klotho mRNA To detect the effect of phosphorus supplementation on the expression of FGF23 mRNA, laying hens were treated with 3 levels of dietary phosphorus. Serum Pi concentration was increased by dietary phosphorus supplementation in a dose dependent manner (P < 0.001, Table 3), but serum calcium level was not changed significantly (P > 0.05, Table 3). HP diets significantly up-regulated the level of FGF23 mRNA in calvaria, femur, and tibia compared with LP diets (P < 0.05, Figure 6), whereas the level in liver didn’t differ significantly among the three groups (P > 0.05, Figure 6). HP diets up-regulated FGF23 mRNA expression significantly compared with MP diets only in calvaria (P < 0.05, Figure 6). However, the mRNA level of α-Klotho in kidney was not changed significantly by dietary phosphorus supplementation (P > 0.05, Figure 7). Figure 6. View largeDownload slide Effect of the levels of dietary available phosphorus on the expression of FGF23 mRNA in the liver, calvaria, femur and tibia of laying hens treated with LP, MP and HP diets. Relative quantification of FGF23 expression was determined using real-time PCR. The internal control was TATA-binding protein (TBP) gene. Results were presented as fold changes relative to LP diets. Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Figure 6. View largeDownload slide Effect of the levels of dietary available phosphorus on the expression of FGF23 mRNA in the liver, calvaria, femur and tibia of laying hens treated with LP, MP and HP diets. Relative quantification of FGF23 expression was determined using real-time PCR. The internal control was TATA-binding protein (TBP) gene. Results were presented as fold changes relative to LP diets. Vertical bars represent the means ± SEM (n = 8). Bars with different letters are significantly different (P < 0.05). Figure 7. View largeDownload slide Effect of the levels of dietary available phosphorus on the expression of α-Klotho mRNA in the kidney of laying hens treated with LP, MP and HP diets. Relative quantification of α-Klotho expression was determined using real-time PCR. The internal control was β-actin. Results were presented as fold changes relative to LP diets. Vertical bars represent the means ± SEM (n = 8). Figure 7. View largeDownload slide Effect of the levels of dietary available phosphorus on the expression of α-Klotho mRNA in the kidney of laying hens treated with LP, MP and HP diets. Relative quantification of α-Klotho expression was determined using real-time PCR. The internal control was β-actin. Results were presented as fold changes relative to LP diets. Vertical bars represent the means ± SEM (n = 8). Table 3. Effect of dietary phosphorus supplementation on serum parameters of laying hens.1 LP MP HP P-value Phosohorus, mmol/L 1.21±0.07a 1.50±0.10b 1.85±0.11c <0.001 Calcium, mmol/L 3.88±0.07 3.77±0.06 3.90±0.06 0.290 LP MP HP P-value Phosohorus, mmol/L 1.21±0.07a 1.50±0.10b 1.85±0.11c <0.001 Calcium, mmol/L 3.88±0.07 3.77±0.06 3.90±0.06 0.290 1Data are shown as the mean ± SEM. a,b,cMeans with different letters differ significantly (n = 8, P < 0.05). View Large Table 3. Effect of dietary phosphorus supplementation on serum parameters of laying hens.1 LP MP HP P-value Phosohorus, mmol/L 1.21±0.07a 1.50±0.10b 1.85±0.11c <0.001 Calcium, mmol/L 3.88±0.07 3.77±0.06 3.90±0.06 0.290 LP MP HP P-value Phosohorus, mmol/L 1.21±0.07a 1.50±0.10b 1.85±0.11c <0.001 Calcium, mmol/L 3.88±0.07 3.77±0.06 3.90±0.06 0.290 1Data are shown as the mean ± SEM. a,b,cMeans with different letters differ significantly (n = 8, P < 0.05). View Large DISCUSSION To date, most of studies on FGF23 have been carried out on mammalian species, such as human, rat, and mouse. Several recent reports have shown that anti-FGF-23 antibody treatment increased phosphorus retention in chickens (Bobeck et al., 2012; Ren et al., 2017a, b). However, the information about FGF23 mRNA expression in avian species is limited. In this study, we first cloned cDNA sequence of chicken FGF23 predicted to encode a protein with a signal peptide and a RXXR motif, which was consistent with the observations from human and mammalian cell line (White et al., 2001; Liu et al., 2003). We first found that FGF23 mRNA was widely expressed in chicken tissues (Figure 3A), but the expression pattern was different to that of mammals. Human FGF23 mRNA expression was found to be higher in normal bone than in kidney, liver, thyroid, or parathyroid tissue (Mirams et al., 2004). In rat, FGF23 mRNA levels were much higher (>30 times) in calvaria, femur, and incisor than in other tissues such as spleen, thymus, small intestine, liver, kidney, heart, and brain (Yoshiko et al., 2007).The mouse FGF23 mRNA was expressed in bone, thymus, brain, heart, skeletal muscle, spleen, skin, lung, and testes, and the aboundance in bone was the highest (Liu et al., 2003; Mirams et al., 2004). In line with the previous study, our results also indicated that mouse FGF23 mRNA level was much higher (>100 times) in femur than in liver (Figure 4). These studies indicated that in mouse, rat, and human, FGF23 mRNA was predominantly expressed in bone and slightly expressed in liver. In contrast to the above findings in mammals, the present result indicated that FGF23 mRNA was expressed at unexpected higher level in liver than other tissues like bone in chickens (Figure 3A). In adult zebrafish, FGF23 is expressed in the corpuscles of Stannius, which are endocrine glands that lie in close proximity to the nephron (Mangos et al., 2012). These results suggest that FGF23 expresses in a species-specific way. Chicken FGF23 was predicted to be a secreted protein with a signal peptide (Figure 2), and its coreceptor, α-Klotho, was highly expressed in chicken kidney (Figure 3B), This result was in accordance with that in mammals whose α-Klotho mRNA is highly expressed in kidney (Kuro-o et al., 1997; Lim et al., 2015). The result suggests that kidney may be an important target organ of FGF23 in chicken. This speculation was supported by the fact that kidney is a target organ of FGF23 in human, rat, and mouse (Saito et al., 2003; Segawa et al., 2003; Shimada et al., 2004; Berndt and Kumar, 2007). In human embryo, FGF23 mRNA is only expressed in the heart and liver at 30-day and 8 wk gestation stage and not expressed at later developmental stages (Cormier et al., 2005). Moreover, FGF23 is not required to regulate fetal phosphorus metabolism but exerts effects within 12 h after birth (Ma et al., 2017). The rat FGF23 mRNA is detectable in multiple fetal and adult tissues and is highly expressed in adult calvaria, femur, and incisor, suggesting that FGF23 may be of less general importance in fetal than after birth (Yoshiko et al., 2007). In contrast to the result in mammals, in chicken, FGF23 mRNA level was significantly higher in embryo tibia than other embryo tissues tested (Figure 5A), and had comparable expression level with chickens at different ages (Figure 5C), suggesting that FGF23 may play an important role in embryo bone development as well as after hatching. In contrast, FGF23 mRNA level was significantly lower in liver of embryo than in 2-, 25-, 50-, 80-wk-old chicken livers (Figure 5B). The result may imply that FGF23 functions differently in chicken embryo and in post-hatching chickens. To the best of our knowledge, this is the first report about the FGF23 expression in chicken, and the biological significance of the high expression of FGF23 in chicken liver needs to be investigated further. As the expression of FGF23 in embryos from 18-day to hatching was measured, the possibility that FGF23 has not yet been “up-regulated” for hatch needs to be investigated further. Previous studies have shown that Pi regulates FGF23 mRNA expression in vitro and vivo. In mouse, the low (0.02%) Pi diets downregulated FGF23 mRNA expression in calvaria and levels of serum Pi compared with high (1%) Pi diets (Perwad et al., 2005). In primary cultured rat osteoblasts and SV40-transformed human fetal bone cells, the mRNA expression of FGF23 was increased by high concentrations of extracellular phosphate (Mirams et al., 2004; Yamamoto et al., 2010). In laying hen, the inhibition of FGF-23 action by neutralizing antibody reduced phosphorus excretion (Ren et al., 2017a, b). According to these findings, we hypothesized that dietary phosphorus level may regulate the expression of FGF23 to maintain phosphate homeostasis in chicken. Compared with LP diets, HP diets up-regulated serum Pi concentration (Table 3) and FGF23 mRNA level in bone tissue (Figure 6), indicating that bone FGF23 expression is regulated by dietary phosphorus level in chickens. In this study, feed intake (LP: 114.4±3.0 g, MP: 112.5±3.6 g, and HP: 112.4±5.0 g, P > 0.05) and egg production (LP: 57.8±1.7 g, MP: 56.1±0.9 g, and HP: 56.8±2.3 g/hen/day, P > 0.05) were not influenced by phosphorus supplementation, indicating that the laying performance was not influenced by dietary phosphorus level within a short period. The result indicates that the laying performance play a less important role in FGF23 expression in bone. Moreover, dietary phosphorus level didn’t affect FGF23 mRNA level in liver (Figure 6), suggesting that FGF23 in chicken liver may not be involved in maintaining phosphate homeostasis and the function of hepatic FGF23 needs further study. However, there are some reports showing that calcium regulates FGF23 expression (Shimada et al., 2005; David et al., 2013). Dietary calcium supplementation significantly increased FGF23 mRNA abundance in the femur of both wild-type and VDR KO mice (Shimada et al., 2005; David et al., 2013), and the addition of calcium to the culture media also stimulated FGF23 message expression in MC3T3-E1 osteoblasts (David et al., 2013). In this study, serum calcium concentration was not changed by dietary phosphorus supplementation (Table 3), suggesting that calcium is not involved in the altered FGF23 mRNA expression by dietary phosphorus level in the present study. In mammals, FGF23 reduces expression of the Na-dependent phosphate transporters (type IIa and IIc) within the renal proximal tubular membranes to excrete excess phosphate (Berndt and Kumar, 2007). In the present study, the α-Klotho mRNA in kidney was not influenced by dietary phosphorus treatment (Figure 7), indicating that dietary phosphorus level regulates the transcription of FGF23 but not its co-receptor α-Klotho. In conclusion, FGF23 was widely expressed in chicken tissues. Interestingly, FGF23 mRNA expression pattern in chicken was clearly different from that in mammals; chicken had the highest FGF23 expression in liver rather than in bone like mammals. In chicken embryo, however, FGF23 was highly expressed in tibia. High dietary phosphorus level up-regulated FGF23 mRNA expression in bone, whereas had no influence on its expression in liver. The expression of α-Klotho was high in kidney in chickens. The result provides a basis for future investigations into the functions of FGF23 in chicken. SUPPLEMENTARY DATA Supplementary data are available at Poultry Science online. Figure S1. Alignment coding sequence of liver FGF23 with that of calvaria FGF23. The black shading indicates identical sequences. Figure S2. Alignment of Gallus FGF23 (XP_ 425, 663.1) with the deduced amino acid sequence of Hy-Line Brown laying hen FGF23. The black shading indicates identical amino acids. Acknowledgements This work was supported by National Natural Science Foundation of China (31772619,31672442), National Key Research Program of China (2016YFD0500510), the China Agriculture Research System (CARS-41), the Taishan Scholars Program (201511023), and Funds of Shandong “Double Tops” Program. Footnotes 1The nucleotide sequence data reported in this paper have been submitted to GenBank Submission nucleotide sequence database and have been assigned the accession number KY498532. 2The appropriate scientific section is Genetics and Genomics. REFERENCES Berndt T. , Kumar R. . 2007 . Phosphatonins and the regulation of phosphate homeostasis . Annu. Rev. Physiol. 69 : 341 – 359 . Google Scholar CrossRef Search ADS PubMed Bobeck E. A. , Burgess K. S. , Jarmes T. R. , Piccione M. L. , Cook M. E. . 2012 . Maternally-derived antibody to fibroblast growth factor-23 reduced dietary phosphate requirements in growing chicks . Biochem. Biophys. Res. Commun. 420 : 666 – 670 . Google Scholar CrossRef Search ADS PubMed Bonewald L. F. , Wacker M. J. . 2013 . FGF23 production by osteocytes . Pediatr. Nephrol. 8 : 563 – 568 . Google Scholar CrossRef Search ADS Bouillon R. , Suda T. . 2014 . Vitamin D: calcium and bone homeostasis during evolution . Bonekey Rep . 3 : 480 . Google Scholar CrossRef Search ADS PubMed Close B. , Banister K. , Baumans V. , Bernoth E. M. , Bromage N. , Bunyan J. , Erhardt W. , Flecknell P. , Gregory N. , Hackbarth H. , Morton D. , Warwick C. . 1997 . Recommendations for euthanasia of experimental animals: Part 2 . Lab. Anim. 31 : 1 – 32 . Google Scholar CrossRef Search ADS PubMed Cormier S. , Leroy C. , Delezoide A. L , Silve C. . 2005 . Expression of fibroblast growth factors 18 and 23 during human embryonic and fetal development . Gene Expr. Patterns 5 : 569 – 573 . Google Scholar CrossRef Search ADS PubMed David V. , Dai B. , Martin A. , Huang J. , Han X. , Quarles L. D. . 2013 . Calcium regulates FGF-23 expression in bone . Endocrinology . 154 : 4469 – 4482 . Google Scholar CrossRef Search ADS PubMed Dudas P. L. , Villalobos A. R. , Gocek-Sutterlin G. , Laverty G. , Renfro J. L. . 2002 . Regulation of transepithelial phosphate transport by PTH in chicken proximal tubule epithelium . Am. J. Physiol. Regul. Integr. Comp. Physiol. 282 : R139 – R146 . Google Scholar CrossRef Search ADS PubMed Faridi A. , Gitoee A. , France J. . 2015 . A meta-analysis of the effects of nonphytate phosphorus on broiler performance and tibia ash concentration . Poult. Sci. 94 : 2753 – 2762 . Google Scholar CrossRef Search ADS PubMed Humer E. , Schwarz C. , Schedle K. . 2015 . Phytate in pig and poultry nutrition . J Anim Physiol Anim Nutr 99 : 605 – 625 . Google Scholar CrossRef Search ADS Ito M. , Sakai Y. , Furumoto M. , Segawa H. , Haito S. , Yamanaka S. , Nakamura R. , Kuwahata M. , Miyamoto K. . 2005 . Vitamin D and phosphate regulate fibroblast growth factor-23 in K-562 cells . Am. J. Physiol. Endocrinol. Metab. 288 : E1101 – E1109 . Google Scholar CrossRef Search ADS PubMed Kuro-o M. , Matsumura Y. , Aizawa H. , Kawaguchi H. , Suga T. , Utsugi T. , Ohyama Y. , Kurabayashi M. , Kaname T. , Kume E. , Iwasaki H. , Iida A. , Shiraki-Iida T. , Nishikawa S. , Nagai R. , Nabeshima Y. I. . 1997 . Mutation of the mouse klotho gene leads to a syndrome resembling ageing . Nature . 390 : 45 – 51 . Google Scholar CrossRef Search ADS PubMed Lim K. , Groen A. , Molostvov G. , Lu T. , Lilley K. S. , Snead D. , James S. , Wilkinson I. B. , Ting S. , Hsiao L. L. , Hiemstra T. F. . 2015 . α-Klotho Expression in Human Tissues . J. Clin. Endocrinol. Metab. 100 : E1308 – E1318 . Google Scholar CrossRef Search ADS PubMed Liu S. G. , Guo R. , Simpson L. G. , Xiao Z. S. , Burnham C. E. , Quarles L. D. . 2003 . Regulation of fibroblastic growth factor 23 expression but not degradation by PHEX . J. Biol. Chem. 278 : 37419 – 37426 . Google Scholar CrossRef Search ADS PubMed Livak K. J. , Schmittgen T. D. . 2001 . Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta C(T)) . Methods . 25 : 402 – 408 . Google Scholar CrossRef Search ADS PubMed Ma Y. , Kirby B. J. , Fairbridge N. A. , Karaplis A. C. , Lanske B. , Kovacs C. S. . 2017 . FGF23 is not required to regulate fetal phosphorus metabolism but exerts effects within 12 hours after birth . Endocrinology . 158 : 252 – 263 . Google Scholar PubMed Mallin M. A. 2000 . Impacts of industrial animal production on rivers and estuaries . Am. Sci. 88 : 26 – 37 . Google Scholar CrossRef Search ADS Mangos S. , Amaral A. P. , Faul C. , Jüppner H. , Reiser J. , Wolf M. . 2012 . Expression of fgf23 and αklotho in developing embryonic tissues and adult kidney of the zebrafish, Danio rerio . Nephrol. Dial. Transplant. 27 : 4314 – 4322 . Google Scholar CrossRef Search ADS PubMed Marks J. , Debnam E. S. , Unwin R. J. . 2010 . Phosphate homeostasis and the renal-gastrointestinal axis . Am. J. Physiol. Renal Physiol. 299 : F285 – F296 . Google Scholar CrossRef Search ADS PubMed Mirams M. , Robinson B. G. , Mason R. S. , Nelson A. E. . 2004 . Bone as a source of FGF23: regulation by phosphate? Bone . 35 : 1192 – 1199 . Google Scholar CrossRef Search ADS PubMed Perwad F. , Azam N. , Zhang M. Y. , Yamashita T. , Tenenhouse H. S. , Portale A. A. . 2005 . Dietary and serum phosphorus regulate fibroblast growth factor 23 expression and 1,25-dihydroxyvitamin D metabolism in mice . Endocrinology . 146 : 5358 – 5364 . Google Scholar CrossRef Search ADS PubMed Ren Z. , B̈utz D. E. , Sand J. M. , Cook M. E. . 2017a . Antibody to fibroblast growth factor 23-peptide reduces excreta phosphorus of laying hens . Poult. Sci. 96 : 127 – 134 . Google Scholar CrossRef Search ADS Ren Z. , Ebrahimi M. , B̈utz D. E. , Sand J. M. , Zhang K. , Cook M. E. . 2017b . Antibody to fibroblast growth factor 23-peptide reduces excreta phosphorus of laying hens . Poult. Sci. 96 : 127 – 134 . Google Scholar CrossRef Search ADS Saito H. , Kusano K. , Kinosaki M. , Ito H. , Hirata M. , Segawa H. , Miyamoto K. , Fukushima N. . 2003 . Human fibroblast growth factor-23 mutants suppress Na+-dependent phosphate co-transport activity and 1alpha,25-dihydroxyvitamin D3 production . J. Biol. Chem. 278 : 2206 – 2211 . Google Scholar CrossRef Search ADS PubMed Segawa H. , Kawakami E. , Kaneko I. , Kuwahata M. , Ito M. , Kusano K. , Saito H. , Fukushima N. , Miyamoto K. . 2003 . Effect of hydrolysis-resistant FGF23-R179Q on dietary phosphate regulation of the renal type-II Na/Pi transporter . Pflugers Arch - Eur J Physiol . 446 : 585 – 592 . Google Scholar CrossRef Search ADS Shimada T. , Hasegawa H. , Yamazaki Y. , Muto T. , Hino R. , Takeuchi Y. , Fujita T. , Nakahara K. , Fukumoto S. , Yamashita T. . 2004 . FGF-23 is a potent regulator of vitamin D metabolism and phosphate homeostasis . J. Bone Miner. Res. 19 : 429 – 435 . Google Scholar CrossRef Search ADS PubMed Shimada T. , Yamazaki Y. , Takahashi M. , Hasegawa H. , Urakawa I. , Oshima T. , Ono K. , Kakitani M. , Tomizuka K. , Fujita T. , Fukumoto S. , Yamashita T. . 2005 . Vitamin D receptor-independent FGF23 actions in regulating phosphate and vitamin D metabolism . Am. J. Physiol. Renal Physiol. 298 : F1088 – F1095 . Google Scholar CrossRef Search ADS Smil V. 2000 . Phosphorus in the environment: natural flows and human interferences . Annu. Rev. Energy. Environ. 25 : 53 – 88 . Google Scholar CrossRef Search ADS Tilman D. , Fargione J. , Wolff B. , D’Antonio C. , Dobson A. , Howarth R. , Schindler D. , Schlesinger W. H. , Simberloff D. , Swackhamer D. . 2001 . Forecasting agriculturally driven global environmental change . Science . 292 : 281 – 284 . Google Scholar CrossRef Search ADS PubMed Urakawa I. , Yamazaki Y. , Shimada T. , Iijima K. , Hasegawa H. , Okawa K. , Fujita T. , Fukumoto S. , Yamashita T. . 2006 . Klotho converts canonical FGF receptor into a specific receptor for FGF23 . Nature . 444 : 770 – 774 . Google Scholar CrossRef Search ADS PubMed White K. E. , Carn G. , Lorenz-Depiereux B. , Benet-Pages A. , Strom T. M. , Econs M. J. . 2001 . Autosomal-dominant hypophosphatemic rickets (ADHR) mutations stabilize FGF-23 . Kidney Int. 60 : 2079 – 2086 . Google Scholar CrossRef Search ADS PubMed Yamamoto R. , Minamizaki T. , Yoshiko Y. , Yoshioka H. , Tanne K. , Aubin J. E. , Maeda N. . 2010 . 1alpha,25-dihydroxyvitamin D3 acts predominately in mature osteoblasts under conditions of high extracellular phosphate to increase fibroblast growth factor 23 production in vitro . J. Endocrinol. 206 : 279 – 286 . Google Scholar CrossRef Search ADS PubMed Yoshiko Y. , Wang H. , Minamizaki T. , Ijuin C. , Yamamoto R. , Suemune S. , Kozai K. , Tanne K. , Aubin J. E. , Maeda N. . 2007 . Mineralized tissue cells are a principal source of FGF23 . Bone . 40 : 1565 – 1573 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc. This article is published and distributed under the term of oxford University Press, standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Poultry ScienceOxford University Press

Published: Jun 22, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off