Fibroblast growth factor-2 and transforming growth factor-beta1 oppositely regulate miR-221 that targets thrombospondin-1 in bovine luteal endothelial cells

Fibroblast growth factor-2 and transforming growth factor-beta1 oppositely regulate miR-221 that... Abstract Thrombospondin-1 (THBS1) affects corpus luteum (CL) regression. Highly induced during luteolysis, it acts as a natural anti-angiogenic, proapoptotic compound. THBS1 expression is regulated in bovine luteal endothelial cells (LECs) by fibroblast growth factor-2 (FGF2) and transforming growth factor-beta1 (TGFB1) acting in an opposite manner. Here we sought to identify specific microRNAs (miRNAs) targeting THBS1 and investigate their possible involvement in FGF2 and TGFB1-mediated THBS1 expression. Several miRNAs predicted to target THBS1 mRNA (miR-1, miR-18a, miR-144, miR-194, and miR-221) were experimentally tested. Of these, miR-221 was shown to efficiently target THBS1 expression and function in LECs. We found that this miRNA is highly expressed in luteal cells and in mid-cycle CL. Consistent with the inhibition of THBS1 function, miR-221 also reduced Serpin Family E Member 1 [SERPINE1] in LECs and promoted angiogenic characteristics of LECs. Plasminogen activator inhibitor-1 (PAI-1), the gene product of SERPINE1, inhibited cell adhesion, suggesting that PAI-1, like THBS1, has anti-angiogenic properties. Importantly, FGF2, which negatively regulates THBS1, elevates miR-221. Conversely, TGFB1 that stimulates THBS1, significantly reduces miR-221. Furthermore, FGF2 enhances the suppression of THBS1 caused by miR-221 mimic, and prevents the increase in THBS1 induced by miR-221 inhibitor. In contrast, TGFB1 reverses the inhibitory effect of miR-221 mimic on THBS1, and enhances the upregulation of THBS1 induced by miR-221 inhibitor. These data support the contention that FGF2 and TGFB1 modulate THBS1 via miR-221. These in vitro data propose that dynamic regulation of miR-221 throughout the cycle, affecting THBS1 and SERPINE1, can modulate vascular function in the CL. Introduction Thrombospondin-1 (THBS1) is a large matricellular glycoprotein; its multifaceted actions depend on its ability to interact with different ligands, including structural components of the extracellular matrix (ECM), other matricellular proteins, cell receptors, growth factors, cytokines, and proteases [1, 2]. Our previous reports depicted THBS1 as a central player in luteolysis, acting as an efficient proapoptotic antiangiogenic factor [3–5]. THBS1 also affected two other vital luteal factors: fibroblast growth factor-2 (FGF2) and transforming growth factor-beta1 (TGFB1). It inhibited FGF2 expression and its angiogenic activities [3, 5]. On the other hand, it activated latent TGFB1 in luteal endothelial cells (LECs), thus enabling TGFB1 signaling (SMAD2 phosphorylation) and action (serpin family E member 1 [SERPINE1]) [4]. In the bovine corpus luteum (CL), THBS1 is specifically induced during natural luteolysis or induced by prostaglandin F2 alpha (PGF2a) administration at midcycle [4, 5]. In agreement, a study in ewes also showed an increase in THBS1 mRNA in regressing CL, which was inhibited by early pregnancy [6]. Like THBS1, SERPINE1 expression was characterized by luteal stage-specific expression with extensive responses observed in regressing CL [4]. The SERPINE1 gene encodes endothelial plasminogen activator inhibitor-1 (PAI-1). PAI-1 is the primary inhibitor of tissue plasminogen activator (tPA) and urokinase plasminogen activator (uPA), which convert plasminogen to plasmin [7]. The tPA, uPA, and plasmin directly degrade ECM proteins and activate latent matrix metalloproteinases [8]. Thus, by impairing ECM degradation and remodeling, PAI-1 can significantly alter organ fibrogenesis. PAI-1 also has plasmin-independent actions, such as binding to vitronectin (VN). Cells adhere to VN by engaging both integrins and uPA receptor (uPAR) [9]. The binding of PAI-1 to VN directly blocks uPAR-VN and integrin-VN-mediated cell adhesion required for cell survival [10, 11]. Therefore, PAI-1, because of its profibrotic and proapoptoic actions, may promote the transition of active CL to corpus albicans. We recently reported that THBS1 is hormonally regulated in luteal cells; it is stimulated by luteolytic PGF2a and inhibited by luteinizing signals (LH and insulin) in luteinized granulosa cells (LGCs) [3]. In addition, in LECs THBS1 expression is tightly controlled by FGF2 and TGFB1, which act in an opposite manner. FGF2 suppressed THBS1, whereas TGFB1 elevated THBS1 [3, 4]. Silencing of Dicer and Drosha, key components of the microRNA (miRNA) biogenesis machinery, was reported to elevate THBS1 levels in human umbilical vein endothelial cells (HUVEC) cells, suggesting that multiple miRNAs may regulate THBS1 [12]. Several studies have identified a number of miRNAs that can target THBS1 in different types of cells [13–16], but whether miRNAs play a role in regulating THBS1 in luteal cells remains to be elucidated. The aim of this study was to identify specific miRNAs that target THBS1 expression, investigate their involvement in FGF2 and TGFB1-mediated THBS1 regulation, and understand the biological importance of these miRNAs in LEC function. Materials and methods CL collection Bovine CL was collected at a local slaughterhouse; luteal stage was determined by macroscopic examination. For studies involving luteal RNA extractions, CL in midluteal phase (day 9–14) was frozen in liquid N2 immediately after slaughter. Isolation of granulosa cells Ovaries were collected at a local slaughterhouse as previously described [17]. Only large follicles (1.2–1.5 cm in diameter) containing ≥4 million cells were used. Briefly, granulosa cells (GCs) were gently scraped with a glass stick and placed in Dulbecco modified Eagle medium (DMEM)-F12 containing 1% L-Glutamine and 1% penicillin/streptomycin (Biological Industries, Kibbutz Beit Haemek, Israel), 10 μg/ml of DNAse, hyaluronidase, and collagenase (Sigma-Aldrich, St. Louis, MO). Isolated GCs were cultured and allowed to luteinize, giving rise to luteinized granulosa cells (LGCs). Isolation and culture of LECs The procedure for LECs enrichment was previously described in detail [18]. Briefly, midcycle CL was dispersed using sequential incubations with collagenase. Then, cells were incubated with BS-1-coated magnetic beads. The adherent cells were washed and concentrated using a magnet until the supernatant was free of cells. Next, BS-1-positive cells (with an enriched LECs fraction) were plated in DMEM/F-12 containing 1% L-Glutamine and 1% penicillin/streptomycin (Biological Industries) with 10% fetal calf serum (FCS; Biological Industries) on collagen type I-coated plates (Surecoat; Advanced BioMatrix, San Diego, CA). Colonies of LECs were trypsinized with 1% crystalline trypsin (Biological Industries), collected, and reseeded; this process was repeated until homogenous cell cultures were visualized. Cell identity was verified using endothelial cells (ECs) markers (CD31, EDN1), and the lack of contamination by smooth muscle cells (ACTA2 expression), fibroblasts (COL1A1 expression), and steroidogenic cells (STAR, CYP11A1) was evaluated. Cells of passages 4–10 were utilized in this study. LEC used for these studies were from three cows obtained at different occasions. Cell transfection Small interfering RNA: LECs were trypsinized, seeded in 12-well plates, and cultured for 24 h in DMEM/F-12 medium containing 10% FCS. Then, cells were transfected with 10 nM siRNA constructs (GeneCust, Luxembourg) targeting THBS1 (siTHBS1) or with scrambled siRNA (NC siRNA) (Table 1) using INTERFERin reagent (Polyplus, Illkirch, France) in 1% FCS according to the manufacturer’s protocol. After 24 h of transfection, the medium was replaced with 1% FCS. Total RNA or proteins were then extracted from cells 48 and 72 h after transfection (for determining mRNA and protein levels, respectively). Table 1. siRNA constructs. Name  Sequence  siTHBS1  sense: CUCAGUUACCAUCUGCAAAdTdT    antisense: UUUGCAGAUGGUAACUGAG  NC siRNA  sense: UUCUCCGAACGUGUCACGUdTdT    antisense: ACGUGACACGUUCGGAGAAdTdT  Name  Sequence  siTHBS1  sense: CUCAGUUACCAUCUGCAAAdTdT    antisense: UUUGCAGAUGGUAACUGAG  NC siRNA  sense: UUCUCCGAACGUGUCACGUdTdT    antisense: ACGUGACACGUUCGGAGAAdTdT  View Large MicroRNAs, namely, miR-1, miR-18a, miR-144, miR-194, miR-221-mimic, and miR-221 inhibitor as well as their negative control oligonucleotides were obtained from Bioneer (Daejeon, Republic of Korea). LECs were plated in 12-well plates 24 h before transfection. Cells were then transfected with either mimic miRNAs (20 nM) or inhibitor miRNAs (50 nM) or their respective negative control (miR-NC or miR-iNC) in 1% FCS for 24 h using INTERFERin reagent (Polyplus) according to the manufacturer’s recommended protocol. After 24 h of transfection, the medium was replaced with 1% FCS, and cells were harvested for RNA and protein determinations, 48 h and 72 h post transfection, respectively. Messenger RNA and miRNA quantification Total RNA was isolated using Tri-reagent (Molecular Research Center, Cincinnati, OH, USA). This reagent allows for mRNA and miRNA extraction. Total cDNA was synthesized as previously described [4]. MicroRNA cDNA was synthesized from the purified total RNA using the qScript miRNA Synthesis Kit (Quanta Biosciences, Inc., USA). Quantitative PCRs (q-PCR) for gene expression were performed using the LightCycler 96 system (Roche Diagnostics, USA), with Platinum SYBR Green (SuperMix, Invitrogen, USA) and for miRNAs with PerfeCTa SYBR Green SuperMix, Low ROX (Quanta Biosciences, Inc., USA). The PerfeCTa miRNA assay included Universal Primer, specific miRNA Primer, and small nucleolar RNA, C/D Box 44 (SNORD44) serves as positive control primer used to quantitate ubiquitously expressed small nucleolar RNA. The glyceraldehyde 3-phosphate dehydrogenase (GPDH) gene was used as the housekeeping gene for gene expression. Sequences of primers used for q-PCR are listed in Table 2. Primers were designed using Oligo Primer analysis software (Molecular Biology Insights, Inc. Colorado Springs, USA) based on the available bovine sequences and span an intron to prevent amplification of genomic DNA. Dissociation curve analysis was performed after each real-time experiment to confirm the presence of only one product and the absence of the formation of primer dimers. The threshold cycle number (CT) for each tested gene X was used to quantify the relative abundance of the gene; arbitrary units were calculated as: 2−ΔCt = 2− (Ct target gene X−Ct housekeeping gene). Sequences of the miRNA primers used are listed in Table 3. Table 2. Primer list. Gene name  Primer  Sequence (5΄-3΄)  Accession no.  GPDH  Forward  GTCTTCACTACCATGGAGAAGG  NM_001034034    Reverse  TCATGGATGACCTTGGCCAG    SERPINE1  Forward  CAGAAGGTGAAGATTGAGGTG  NM_174137    Reverse  GGCCCATGAACAGGACAGTTCC    THBS1  Forward  ATCATGGCTGACTCAGGAC  NM_174196    Reverse  TAAGCCCATGGTTCCAGAA    TGFB1  Forward  CAGGACCTTGCTGTACTGTG  NM_001166068    Reverse  GAGCCCTGGACACCAACTAC    FGF2  Forward  TGTCTCCCCCTCACTCTGGTA  NM_174056    Reverse  ACTCCCTGTATAGCCAAAGGTCTG    Gene name  Primer  Sequence (5΄-3΄)  Accession no.  GPDH  Forward  GTCTTCACTACCATGGAGAAGG  NM_001034034    Reverse  TCATGGATGACCTTGGCCAG    SERPINE1  Forward  CAGAAGGTGAAGATTGAGGTG  NM_174137    Reverse  GGCCCATGAACAGGACAGTTCC    THBS1  Forward  ATCATGGCTGACTCAGGAC  NM_174196    Reverse  TAAGCCCATGGTTCCAGAA    TGFB1  Forward  CAGGACCTTGCTGTACTGTG  NM_001166068    Reverse  GAGCCCTGGACACCAACTAC    FGF2  Forward  TGTCTCCCCCTCACTCTGGTA  NM_174056    Reverse  ACTCCCTGTATAGCCAAAGGTCTG    View Large Table 3. MiRNA primers. ID  Sequence  Accession number  SNORD44  5΄CCUGGAUGAUGAUAAGCAAAUGCUGACUGAACAUGAAGGUCUUAAUUAGCUCUAACUGACU 3΄  NR_002750.2  hsa-miR-1-3p  UGGAAUGUAAAGAAGUAUGUAU  MIMAT0000416  hsa-miR-194-5p  UGUAACAGCAACUCCAUGUGGA  MIMAT0000460  hsa-miR-221-3p  AGCUACAUUGUCUGCUGGGUUU  MIMAT0000278  ID  Sequence  Accession number  SNORD44  5΄CCUGGAUGAUGAUAAGCAAAUGCUGACUGAACAUGAAGGUCUUAAUUAGCUCUAACUGACU 3΄  NR_002750.2  hsa-miR-1-3p  UGGAAUGUAAAGAAGUAUGUAU  MIMAT0000416  hsa-miR-194-5p  UGUAACAGCAACUCCAUGUGGA  MIMAT0000460  hsa-miR-221-3p  AGCUACAUUGUCUGCUGGGUUU  MIMAT0000278  hsa-miR-1-3p, hsa-miR-194-5p, and hsa-miR-221-3p have 100% similarity to bta-miR sequences. View Large Western blot analyses Proteins were extracted by adding sample buffer (×2), separated by 7.5% SDS-PAGE, and subsequently transferred to nitrocellulose membranes as we previously reported [5]. Membranes were blocked for 1 h in TBST (20 mmol/L Tris, 150 mmol/L NaCl, and 0.1% Tween 20; pH 7.6) containing 5% low-fat milk, and then incubated overnight at 4°C with mouse anti-THBS1; (1:500; ab1823, Abcam) or rabbit anti-p44/42 total mitogen-activated protein kinase (MAPK) (1:50 000, Sigma) in 1% low-fat milk. The membranes were incubated with peroxidase-conjugated goat anti-rabbit IgG or goat anti-mouse IgG (H + L) for 1 h at room temperature. A chemiluminescent signal was generated with SuperSignal (Thermo Fisher Scientific, Rockford, IL). The signal was analyzed using the Gel-Pro 32 program and normalized to total p44/42 MAPK. Cell adhesion and determination of viable cells numbers Microtiter wells (0.32 cm2/96 wells/plate) were coated with 1 μg/ml of vitronectin (VN, PeproTech Asia, Rehovot, Israel) by incubation overnight at 4°C. The wells were then washed with 1% bovine serum albumin (BSA) in phosphate buffered saline (PBS) and blocked by incubation for 1 h at room temperature with 200 μl of 3% BSA in PBS. Then wells were washed twice with 1% BSA in PBS. Cells were seeded onto the coated wells (15 000 cells/well) in serum-free medium alone (control) or with varying concentrations of PAI-1 variants 50–500 nM (PAI-1-14-1b—an active stable mutant, PAI-1-R—a mutant lacking anti-uPA/tPA activity, PAI-1-AK—a mutant defective in VN binding). All PAI-1 molecules were kindly provided by Professor D. Lawrence, University of Michigan Medical School, Ann Arbor, MI. After 2 h of incubation at 37°C, the floating cells were removed by washing, and the number of remaining attached cells was determined by using the XTT kit (Biological Industries), as previously described [19]. XTT was added according to the manufacturer’s instructions. Plates were incubated at 37°C for 2 h. The absorbance was read at 450 nm (reference absorbance, 630 nm). XTT was also used to determine number of cells transfected with miRNA. Scratch/wound healing assays LECs were seeded in 12-well plates. At 24 h after transfection with a negative control or miR-221 mimic, LEC monolayer was wounded by using a 200-μl tip. Cells were washed and microphotographs (original magnification ×10) were taken 0 h and 16 h after wounding. Cell coverage of the scratched area was analyzed with NIH image software. Cell treatments LECs were seeded in 12-well dishes (45 000 cells/well) and cultured overnight in DMEM/F-12 medium containing 10% FCS. The next day, the cells were transferred to starvation medium (0.5% BSA, 0.1% FCS) for 24 h and were then incubated with 10 ng/ml of recombinant human FGF2 basic (FGF2, PeproTech Asia, Rehovot, Israel) or 1 ng/ml of recombinant human TGFB1 (TGFB1, ProSpec-Tany TechnoGene Ltd, Rehovot, Israel) for 24 h. Total RNA was extracted, and gene expression or miRNA quantitation was analyzed by q-PCR as described before. Cells without treatments were used as a control. Transfected LECs with miR-221 mimic or inhibitor and their negative control were treated 24 h post transfection with 10 ng/ml FGF2 or 1 ng/ml TGFB1. After 24 h of treatment, total RNA was extracted and gene expression was analyzed by q-PCR as described above. Untreated cells were used as a control. Statistical analyses Data are presented as means ± SEM; experiments were repeated at least three times. Statistical analyses were performed using Student t-test or one-way ANOVA, followed by Bonferroni multiple comparison tests, when appropriate. In all analyses, a value of P < 0.05 was considered significant. Statistical analysis of the experimental data was performed using SigmaPlot Systat software. Asterisks represent significant differences from their respective controls. *P < 0.05, **P < 0.01, *** P < 0.001. Results Screening of miRNAs targeting the THBS1 3΄ untranslated region The THBS1 gene has 3΄ untranslated region (UTR) with several predicted binding sites for multiple miRNAs. TargetScan prediction tool (Whitehead Institute for Biomedical Research, Cambridge, MA) was used to identify candidate miRNAs (Figure 1). It showed several potential binding sites for miRNAs conserved among vertebrates, of which we selected five miRNAs with the highest aggregate PCT value (the probability of conserved targeting, as described in Friedman et al., is presented in Table 4 [20]): miR-1, miR-18a, miR-144, miR-194, and miR-221. Figure 1. View largeDownload slide In silico screening for thrombospondin-1 (THBS1) regulatory miRNAs. Schematic representation of the conserved binding sites of miRNAs in the THBS1 3΄UTR predicted by TargetScan. Five miRNAs conserved in vertebrates were chosen for investigation (marked by an amber rectangle). Figure 1. View largeDownload slide In silico screening for thrombospondin-1 (THBS1) regulatory miRNAs. Schematic representation of the conserved binding sites of miRNAs in the THBS1 3΄UTR predicted by TargetScan. Five miRNAs conserved in vertebrates were chosen for investigation (marked by an amber rectangle). Table 4. TargetScan-predicted miRNAs targeting THBS1 3΄UTR broadly conserved among vertebrates. Table entries were sorted by aggregate PCT. ID  Conserved sites  Position in the 3΄UTR  Aggregate PCT  miR-1/206  1  920–926  0.84  miR-18  1  48–54  0.81  miR-144  2  1396–1402  0.70      1591–1597    miR-221/222  2  796–790  0.65      805–812    miR-194  1  514–521  0.47  ID  Conserved sites  Position in the 3΄UTR  Aggregate PCT  miR-1/206  1  920–926  0.84  miR-18  1  48–54  0.81  miR-144  2  1396–1402  0.70      1591–1597    miR-221/222  2  796–790  0.65      805–812    miR-194  1  514–521  0.47  View Large To experimentally validate these five potential THBS1-targeting miRNAs, their miRNA mimics were overexpressed in LECs as described in Materials and Methods. A negative control miRNA mimic was used as a control. In addition, we transfected THBS1 siRNA as a positive control (Figure 2) [3]. Overexpression of miR-1, miR-194, and miR-221 significantly decreased THBS1 to levels ∼60% lower than in the control, whereas miR-18a and miR-144 did not affect THBS1 expression (Figure 2A). Western blot analysis revealed that miR-1, miR-194, and miR-221 also markedly suppressed THBS1 protein levels in LECs, supporting gene expression results (Figure 2B). Figure 2. View largeDownload slide THBS1 mRNA (A) and protein (B) expression in LECs transfected with negative control (NC), miRNAs mimics, and siTHBS1. Samples were harvested 48 h post-transfection. The threshold cycle number (Ct) for each tested gene X was used to quantify the relative abundance of the gene; arbitrary units were calculated as 2−ΔCt = 2–(Ct target gene X–Ct reference gene). Negative control was designated as 100%. The results are presented as means ± SEM. Significance was calculated using two-tailed Student t-test *P < 0.05, **P < 0.01, ***P < 0.0001 (as compared to NC). (B) THBS1 protein was determined by western blotting and normalized relative to the abundance of total MAPK (p44/42). A representative western blot is shown. Figure 2. View largeDownload slide THBS1 mRNA (A) and protein (B) expression in LECs transfected with negative control (NC), miRNAs mimics, and siTHBS1. Samples were harvested 48 h post-transfection. The threshold cycle number (Ct) for each tested gene X was used to quantify the relative abundance of the gene; arbitrary units were calculated as 2−ΔCt = 2–(Ct target gene X–Ct reference gene). Negative control was designated as 100%. The results are presented as means ± SEM. Significance was calculated using two-tailed Student t-test *P < 0.05, **P < 0.01, ***P < 0.0001 (as compared to NC). (B) THBS1 protein was determined by western blotting and normalized relative to the abundance of total MAPK (p44/42). A representative western blot is shown. To determine whether miR-1, miR-194, and miR-221 were endogenously expressed in luteal cells, their expression was determined by q-PCR using total RNA from mature CL, LGCs, and LECs (Figure 3). MiR-1 was detected at very low levels in either whole CL or luteal cell types. Expression of miR-194 was readily detectable in both cell types and in total CL, with higher expression levels in whole CL tissue. Levels of miR-221 were the most highly expressed, compared with miR-1 and miR-194 in luteal cells and CL tissue alike. Figure 3. View largeDownload slide Endogenous expression of miR-1, miR-194, and miR-221 in midcycle CL, LGCs, and LECs. The levels of miRNA expression were measured by q-PCR. The results are presented as means ± SEM from four samples. Data were normalized relative to the abundance of SNORD expression in the same samples. Figure 3. View largeDownload slide Endogenous expression of miR-1, miR-194, and miR-221 in midcycle CL, LGCs, and LECs. The levels of miRNA expression were measured by q-PCR. The results are presented as means ± SEM from four samples. Data were normalized relative to the abundance of SNORD expression in the same samples. THBS1-targeting miRNAs affect the expression of SERPINE1 and FGF2 The data presented in Figure 4A show that SERPINE1 expression in miRNA-transfected cells mirrored that of THBS1. It was strongly reduced by miR-221 similar to the reduction induced by siTHBS1 (about 50%). These data further support the essential role of THBS1 in SERPINE1 expression [4]. MiR-1 and miR-18a induced a moderate decrease in SERPINE1 mRNA. Overexpression of miR-194 and miR-144 did not affect SERPINE1 mRNA (Figure 2). Figure 4. View largeDownload slide Effect of miRNAs on SERPINE1 and FGF2 mRNA. SERPINE1 (A) and FGF2 (B) mRNA levels in LECs transfected with miR-1, miR-18a, miR-144, miR-194, miR-221 mimics, or siTHBS1. Samples were harvested 48 h post-transfection. Negative control was designated as 100%. The results are presented as means ± SEM. Significance was calculated using two-tailed Student t-test (*P < 0.05, **P < 0.01, ***P < 0.0001). Figure 4. View largeDownload slide Effect of miRNAs on SERPINE1 and FGF2 mRNA. SERPINE1 (A) and FGF2 (B) mRNA levels in LECs transfected with miR-1, miR-18a, miR-144, miR-194, miR-221 mimics, or siTHBS1. Samples were harvested 48 h post-transfection. Negative control was designated as 100%. The results are presented as means ± SEM. Significance was calculated using two-tailed Student t-test (*P < 0.05, **P < 0.01, ***P < 0.0001). Our previous studies indicated that THBS1 inhibits FGF2 gene expression [3]; it was therefore interesting to find out if miRNAs targeting THBS1 will also affect FGF2. Indeed, we observed that the expression of FGF2 was elevated by miR-221 and miR-144, similar to the effects exerted by siTHBS1 (Figure 4B). Overexpression of miR-1, miR-18a, and miR-194 in LECs did not have an appreciable effect on FGF2 expression. Inhibition of miR-221 restores THBS1 expression Among the five miRNAs that we investigated, miR-221 is highly expressed in CL tissue and luteal cells (Figure 3). Furthermore, the overexpression of miR-221 strongly inhibited THBS1 (Figure 2) and affected the levels of SERPINE1 and FGF2 similar to siTHBS1 (Figure 4). Therefore, in the subsequent experiments we focused on miR-221. To determine whether the endogenously expressed miR-221 regulates THBS1 expression, we transfected LECs with miR-221 inhibitor (anti-miR-221). Transfection of miR-221 inhibitor markedly elevated THBS1 levels in LECs by approximately 40%, as compared with its negative control (Figure 5). As expected, this effect was opposite to that induced by the miRNA mimic (Figure 2). Importantly, together with THBS1 expression, levels of SERPINE1 mRNA were also upregulated by anti-miR-221 (Figure 5). Figure 5. View largeDownload slide Transfection with miR-221 inhibitor (anti-miR-221) increased the expression of THBS1 and SERPINE1 mRNA. Samples were harvested 48 h post-transfection. Negative control was designated as 100%. The results are presented as means ± SEM. Data are from five independent experiments. Significance was calculated using two-tailed Student t-test (***P < 0.0001). Figure 5. View largeDownload slide Transfection with miR-221 inhibitor (anti-miR-221) increased the expression of THBS1 and SERPINE1 mRNA. Samples were harvested 48 h post-transfection. Negative control was designated as 100%. The results are presented as means ± SEM. Data are from five independent experiments. Significance was calculated using two-tailed Student t-test (***P < 0.0001). MiR-221 expression is regulated by FGF2 and TGFB1 in an opposite manner Having established that miR-221 targets THBS1 in LECs and since FGF2 and TGFB1 control THBS1 oppositely [3, 4], we next examined whether incubation of LECs with FGF2 or TGFB1 could influence miR-221 expression (Figure 6). We observed that incubation of LECs with FGF2 for 24 h significantly elevated miR-221 expression (1.4-fold higher as compared with the control, P < 0.001). In contrast, TGFB1 significantly downregulated miR-221 in these cells (2-fold less than the control, P < 0.001; Figure 6). Figure 6. View largeDownload slide Inverse regulation of miR-221 by FGF2 and TGFB1. LECs were incubated with 10 ng/ml of FGF2 or 1 ng/ml of TGFB1. After 24 h of treatment, cells were harvested for RNA extraction and endogenous miR-221 expression levels were measured. Untreated cells were designated as control (100%). The results are presented as means ± SEM. Asterisks indicate significant differences from the control group (***P < 0.001). The data were from five independent experiments. Figure 6. View largeDownload slide Inverse regulation of miR-221 by FGF2 and TGFB1. LECs were incubated with 10 ng/ml of FGF2 or 1 ng/ml of TGFB1. After 24 h of treatment, cells were harvested for RNA extraction and endogenous miR-221 expression levels were measured. Untreated cells were designated as control (100%). The results are presented as means ± SEM. Asterisks indicate significant differences from the control group (***P < 0.001). The data were from five independent experiments. Next, to assess the role of miR-221 in FGF2 and TGFB1-mediated THBS1 expression, we treated the cells with miR-221 mimic or miR-221 inhibitor together with FGF2 or TGFB1 (Figure 7). Treatment with FGF2 reduced THBS1 levels by 30%, compared with the negative control without treatment, in accordance with our previous report [3]. Overexpression of miR-221 inhibited THBS1, as also shown in Figure 2. However, treatment of miR-221, together with FGF2 (inducing endogenous miR-221, Figure 6), further reduced THBS1 (Figure 7A). MiR-221 inhibitor alone elevated THBS1 as expected from data presented in Figure 5; the addition of FGF2, which can antagonize this effect by elevating miR-221 (Figure 6), prevented the increase of THBS1 (Figure 7A). Figure 7. View largeDownload slide Role of miR-221 in FGF2 and TGFB1-mediated THBS1 expression. LECs were transfected with miR-221 mimic or the anti-miR along with their negative controls. At 24 h post-transfection, cells were treated with 10 ng/ml FGF2 (A) or 1 ng/ml TGFB1 (B). At 24 h later, cells were harvested for RNA extraction and the levels of THBS1 mRNA were measured. Results are presented as means ± SEM. The data were from five independent experiments. Different letters indicate significant differences of P < 0.05 or more. Figure 7. View largeDownload slide Role of miR-221 in FGF2 and TGFB1-mediated THBS1 expression. LECs were transfected with miR-221 mimic or the anti-miR along with their negative controls. At 24 h post-transfection, cells were treated with 10 ng/ml FGF2 (A) or 1 ng/ml TGFB1 (B). At 24 h later, cells were harvested for RNA extraction and the levels of THBS1 mRNA were measured. Results are presented as means ± SEM. The data were from five independent experiments. Different letters indicate significant differences of P < 0.05 or more. TGFB1 had opposite effects (Figure 7B). TGFB1 alone significantly increased THBS1 mRNA to 180%, compared with a negative control [4]. TGFB1, which can reduce miR-221 levels (Figure 6), also reversed the inhibitory effect of miR-221 mimic on THBS1. Inhibition of miR-221 by anti-miR, together with TGFB1, further increased THBS1, as compared with the miRNA inhibitor alone. This most probably resulted from the combined miR-221 suppression by anti-miR and TGFB1. Biological functions of miR-221 in LECs Cells transfected with miR-221 exhibited a marked increase in their cell proliferation rate compared with control oligonucleotide-transfected cells (Figure 8A). We also evaluated effects of miR-221 on LEC migration. Cells transfected with miR-221 exhibited a much higher migration rate than did control cells (Figure 8B). Figure 8. View largeDownload slide Effects of miR-221 mimic transfection on the proliferation and migration of LECs. (A) Cells were transfected with negative control (NC) or miR-221 mimic. At 24 h post-transfection, the number of cells was determined by XTT. Data represent the means ± SEM from three independent experiments. Asterisks indicate significant differences from the NC group (**P < 0.01). (B) Scratch assay in LECs transfected with NC or miR-221. At 24 h after transfection, the LEC monolayer was wounded by a 200-μl tip. Wound closure after 16 h is shown (original magnification ×10). Red dotted lines denote the edge of the wound at the beginning of the experiment. Representative images are shown. Figure 8. View largeDownload slide Effects of miR-221 mimic transfection on the proliferation and migration of LECs. (A) Cells were transfected with negative control (NC) or miR-221 mimic. At 24 h post-transfection, the number of cells was determined by XTT. Data represent the means ± SEM from three independent experiments. Asterisks indicate significant differences from the NC group (**P < 0.01). (B) Scratch assay in LECs transfected with NC or miR-221. At 24 h after transfection, the LEC monolayer was wounded by a 200-μl tip. Wound closure after 16 h is shown (original magnification ×10). Red dotted lines denote the edge of the wound at the beginning of the experiment. Representative images are shown. Data presented in Figure 4A show that miR-221 targeting THBS1 also markedly reduced SERPINE1 levels in LECs. Therefore, assessing the activity of PAI-1 protein encoded by the SERPINE1 gene can advance our understanding of the biological functions produced by miR-221 in LECs. We tested the effects of the three PAI-1 variants [21] (described in the M&M section) on cell adhesion (Figure 9). Cell adhesion was inhibited by all three PAI-1 variants (Figure 9). PAI-1-AK and PAI-1-R reduced cell adhesion in dose-dependent manner and were more potent than mutant 14-1b (which blocks both uPA/tPA and integrin-mediated binding to VN) in the high concentration (more than 200 nM). Nevertheless, mutant 14-1b was more effective at the lowest concentration. Figure 9. View largeDownload slide Effects of recombinant PAI-1s on LECs adhesion. Microtiter wells were coated with vitronectin and then blocked with BSA for 2 h as described in Materials and Methods. Cells were seeded onto the coated wells in serum-free medium with varying concentrations of PAI-1 variants 50–500 nM (PAI-1-14-1b—an active stable mutant, PAI-1-R—a mutant lacking anti-uPA/tPA activity, PAI-1-AK—a mutant defective in VN binding). After 2 h of incubation, the floating cells were removed by washing, and the number of remaining attached cells was determined. Cells without treatments were designated as control (100%). Data are from four independent experiments. Results are presented as means ± SEM. Asterisks indicate significant differences from the control group (*P < 0.05, **P < 0.01, ***P < 0.001). Figure 9. View largeDownload slide Effects of recombinant PAI-1s on LECs adhesion. Microtiter wells were coated with vitronectin and then blocked with BSA for 2 h as described in Materials and Methods. Cells were seeded onto the coated wells in serum-free medium with varying concentrations of PAI-1 variants 50–500 nM (PAI-1-14-1b—an active stable mutant, PAI-1-R—a mutant lacking anti-uPA/tPA activity, PAI-1-AK—a mutant defective in VN binding). After 2 h of incubation, the floating cells were removed by washing, and the number of remaining attached cells was determined. Cells without treatments were designated as control (100%). Data are from four independent experiments. Results are presented as means ± SEM. Asterisks indicate significant differences from the control group (*P < 0.05, **P < 0.01, ***P < 0.001). Discussion This study identified miR-221 as a key regulator of THBS1 expression and function in bovine LECs. Highly expressed in luteal cells and bovine CL, miR-221 effectively suppressed THBS1 levels. TGFB1 and FGF2 inversely modulated miR-221 levels, providing a possible explanation for their opposite control of THBS1 mRNA expression. Furthermore, consistent with THBS1 and consequent SERPINE1 inhibitions, miR-221 induced LECs migration, proliferation, and survival, suggesting that it plays a role in luteal angiogenesis (Figure 10). Figure 10. View largeDownload slide Proposed role of miR-221 in luteal angiogenesis. Highly expressed in luteal cells and in bovine CL, miR-221 effectively suppressed antiangiogenic THBS1. This miRNA also suppressed SERPINE1, whose expression is dependent on TGFB1 activation by THBS1 [4]. TGFB1 and FGF2 inversely modulated miR-221 levels, providing a possible explanation for their opposite control of THBS1 expression observed before [3, 4]. Consistent with THBS1 and consequent SERPINE1 inhibitions, miR-221 induced LEC migration, proliferation, and survival, thus demonstrating its proangiogenic role. Figure 10. View largeDownload slide Proposed role of miR-221 in luteal angiogenesis. Highly expressed in luteal cells and in bovine CL, miR-221 effectively suppressed antiangiogenic THBS1. This miRNA also suppressed SERPINE1, whose expression is dependent on TGFB1 activation by THBS1 [4]. TGFB1 and FGF2 inversely modulated miR-221 levels, providing a possible explanation for their opposite control of THBS1 expression observed before [3, 4]. Consistent with THBS1 and consequent SERPINE1 inhibitions, miR-221 induced LEC migration, proliferation, and survival, thus demonstrating its proangiogenic role. Both THBS1 and SERPINE1 are induced in the CL during luteal regression and these two genes are widely implicated in vascular biology. Although the impact of THBS1 on ovarian vascular functions was extensively demonstrated before [3–5, 22–24], much less is known about the roles of SERPINE1-encoded protein PAI-1. Here, we examined the role of PAI-1 using three mutants that allowed us to distinguish between PAI-1 protease inhibitory activity and its VN-binding properties [21]. PAI-1-R (devoid of antiprotease activity) and PAI-1-AK (defective in VN binding domain) reduced LECs adhesion to VN similarly. Thus, our results suggest that PAI-1 can block LEC-VN interactions either by the VN binding domain or through antiprotease activity. The existence of such a VN-independent, uPA-uPAR-dependent mechanism by which PAI-1 induces cell detachment was also reported in other cell types [25]. Thus, it appears that PAI-1, like THBS1, is an antiangiogenic factor. Numerous reports have shown that the miR-221/222 cluster plays a significant role in vascular biology [26–32]. Both pro- and antiangiogenic effects were reported for this miRNA. In human venous or lymphatic ECs, miR-221/222 exhibit strictly antiangiogenic properties by inhibiting factors such as C-KIT [33] and Ets1, Ets2 [30]. In contrast, in embryonic ECs, miR-221 was shown to promote proliferation and migration of tip ECs in sprouting vessels [34]. Likewise, miR-221 deficiency blocked ECs proliferation in zebrafish embryos [35]. These effects were mediated by repression of two distinct target transcripts: CDKN1B and PI3KR1 [34]. Our data suggest that miR-221 has proangiogenic activities in LECs, which is pertinent to its ability to suppress THBS1 and SERPINE1. In agreement, the ability of miR-221 to suppress THBS1 and promote endothelial cell survival and their angiogenic properties was also shown in HUVECs’ response to irradiation [14]. These previous reports suggest that the effect of miR-221 in ECs is context-dependent, varying with cell environment and the developmental stage. The current study provides strong evidence for the involvement of miR-221 in the regulation of THBS1 by FGF2 and TGFB1 in LECs. We found that FGF2, which negatively regulates THBS1 [3], was able to increase miR-221 expression in LECs. In contrast, TGFB1’s upregulation of THBS1 [4] significantly reduced miR-221 in LECs. Moreover, FGF2 treatment enhanced the suppression of THBS1 caused by the miR-221 mimic, and prevented the increase of THBS1 induced by miR-221 inhibitor. TGFB1, on the other hand, reversed the inhibitory effect of miR-221 mimic on THBS1, and enhanced the upregulation of THBS1 induced by miR-221 inhibitor. Thus, miR-221 seems to functionally link several key luteal genes: THBS1, FGF2, TGFB1, and SERPINE1. The expression of these genes is modulated by PGF2a, in a luteal stage-dependent manner [4, 5, 36]. On day 4 of the cycle, only FGF2 exhibited a strong and sustained stimulation in response to PGF2a. However, THBS1 and SERPINE1 were only slightly and transiently elevated. The involvement of miR-221 can explain this pattern of gene expression. Elevated FGF2 in young CL is expected to upregulate miR-221, thus resulting in suppressed THBS1 and consequently, SERPINE1. This gene expression profile may contribute to angiogenesis in early CL and its resistance to luteolysis. In contrast, in the regressing CL, increased FGF2 is negligible, whereas THBS1, TGFB1, and SERPINE1 mRNAs were all strikingly induced 4 h and 24 h after PGF2a administration [4, 5, 36]. Based on in vitro findings shown here, it can be proposed that elevated TGFB1 inhibits miR-221 expression, thus enabling THBS1 and SERPINE1 upregulation. However, direct proof, demonstrating alteration of miR-221 levels in the CL in response to PGF2a, is still lacking. Yet, data available from transcriptomic analyses support the general contention of miR-221 being varied in the CL in a manner that is consistent with the data presented here, i.e., high in early CL and low in late CL. MiR-221 increased in early sheep CL relative to dominant follicle (about 2-fold) and was reduced in late CL [37]. In addition, in bovine plasma, miR-221 was lower on day 16 of the bovine estrous cycle, compared with an earlier time point, day 8 [38]. Taken together, the findings reported here advance our understanding of miR-221 in luteal vascular function. These in vitro findings suggest that miR-221 is regulated in LECs in a physiologically significant manner; it is stimulated by FGF2—highly expressed in early CL [5, 36] and suppressed by TGFB1, which is elevated during luteal regression [36, 39]. A recent publication [40] measuring miRNA profile in cyclic bovine CL, demonstrated that miR-221/222 levels were indeed lower in late and regressed bovine CL relative to their abundance in early CL, supporting the above mentioned propositions. Thus, dynamic regulation of miR-221, altering the levels of THBS1 and SERPINE1, can modulate vascular function in the CL, shifting from angiogenesis in young CL to vascular instability in late-cycle CL. References 1. Adams JC, Lawler J. The thrombospondins. Cold Spring Harb Perspect Biol  2011; 3: a009712– a009712. Google Scholar CrossRef Search ADS PubMed  2. Bornstein P. Thrombospondins as matricellular modulators of cell function. J Clin Invest  2001; 107: 929– 934. Google Scholar CrossRef Search ADS PubMed  3. Farberov S, Meidan R. Functions and transcriptional regulation of thrombospondins and their interrelationship with fibroblast growth factor-2 in bovine luteal cells1. Biol Reprod  2014; 91: 58. Google Scholar CrossRef Search ADS PubMed  4. Farberov S, Meidan R. Thrombospondin-1 affects bovine luteal function via transforming growth factor-beta1-dependent and independent actions. Biol Reprod  2016; 94: 25. Google Scholar CrossRef Search ADS PubMed  5. Zalman Y, Klipper E, Farberov S, Mondal M, Wee G, Folger JK, Smith GW, Meidan R. Regulation of angiogenesis-related prostaglandin F2alpha-induced genes in the bovine corpus luteum. Biol Reprod  2012; 86: 92. Google Scholar CrossRef Search ADS PubMed  6. Romero JJ, Antoniazzi AQ, Smirnova NP, Webb BT, Yu F, Davis JS, Hansen TR. Pregnancy-associated genes contribute to antiluteolytic mechanisms in ovine corpus luteum. Physiol Genom  2013; 45: 1095– 1108. Google Scholar CrossRef Search ADS   7. Lawrence D, Ginsburg D. Plasminogen activator inhibitors. In high KA, Roberts HR (eds). Molecular Basis of Thrombosis and Hemostasis . New York: Marcel Dekker; 1995: 517. 8. Pepper MS. Role of the matrix metalloproteinase and plasminogen activator-plasmin systems in angiogenesis. Arterioscler Thromb Vasc Biol  2001; 21: 1104– 1117. Google Scholar CrossRef Search ADS PubMed  9. Deng G, Curriden SA, Wang S, Rosenberg S, Loskutoff DJ. Is plasminogen activator inhibitor-1 the molecular switch that governs urokinase receptor-mediated cell adhesion and release? J Cell Biol  1996; 134: 1563– 1571. Google Scholar CrossRef Search ADS PubMed  10. Stefansson S, Lawrence DA. The serpin PAI-1 inhibits cell migration by blocking integrin alpha v beta 3 binding to vitronectin. Nature  1996; 383: 441– 443. Google Scholar CrossRef Search ADS PubMed  11. Meredith JE Jr., Schwartz MA. Integrins, adhesion and apoptosis. Trends Cell Biol  1997; 7: 146– 150. Google Scholar CrossRef Search ADS PubMed  12. Kuehbacher A, Urbich C, Zeiher AM, Dimmeler S. Role of dicer and drosha for endothelial microRNA expression and angiogenesis. Circ Res  2007; 101: 59– 68. Google Scholar CrossRef Search ADS PubMed  13. Dogar AM, Semplicio G, Guennewig B, Hall J. Multiple microRNAs derived from chemically synthesized precursors regulate thrombospondin 1 expression. Nucleic Acid Ther  2014; 24: 149– 159. Google Scholar CrossRef Search ADS PubMed  14. Vincenti S, Brillante N, Lanza V, Bozzoni I, Presutti C, Chiani F, Etna MP, Negri R. HUVEC respond to radiation by inducing the expression of pro-angiogenic microRNAs. Radiat Res  2011; 175: 535– 546. Google Scholar CrossRef Search ADS PubMed  15. Feng N, Wang Z, Zhang Z, He X, Wang C, Zhang L. miR-487b promotes human umbilical vein endothelial cell proliferation, migration, invasion and tube formation through regulating THBS1. Neurosci Lett  2015; 591: 1– 7. Google Scholar CrossRef Search ADS PubMed  16. Wang JM, Tao J, Chen DD, Cai JJ, Irani K, Wang Q, Yuan H, Chen AF. MicroRNA miR-27b rescues bone marrow-derived angiogenic cell function and accelerates wound healing in type 2 diabetes mellitus. Arterioscler Thromb Vasc Biol  2014; 34: 99– 109. Google Scholar CrossRef Search ADS PubMed  17. Meidan R, Girsh E, Blum O, Aberdam E. In vitro differentiation of bovine theca and granulosa cells into small and large luteal-like cells: morphological and functional characteristics. Biol Reprod  1990; 43: 913– 921. Google Scholar CrossRef Search ADS PubMed  18. Levy N, Gordin M, Mamluk R, Yanagisawa M, Smith MF, Hampton JH, Meidan R. Distinct cellular localization and regulation of endothelin-1 and endothelin-converting enzyme-1 expression in the bovine corpus luteum: implications for luteolysis. Endocrinology  2001; 142: 5254– 5260. Google Scholar CrossRef Search ADS PubMed  19. Klipper E, Tatz E, Kisliouk T, Vlodavsky I, Moallem U, Schams D, Lavon Y, Wolfenson D, Meidan R. Induction of heparanase in bovine granulosa cells by luteinizing hormone: possible role during the ovulatory process. Endocrinology  2009; 150: 413– 421. Google Scholar CrossRef Search ADS PubMed  20. Friedman RC, Farh KK, Burge CB, Bartel DP. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res  2009; 19: 92– 105. Google Scholar CrossRef Search ADS PubMed  21. Stefansson S, Petitclerc E, Wong MK, McMahon GA, Brooks PC, Lawrence DA. Inhibition of Angiogenesis in vivo by plasminogen activator inhibitor-1. J Biol Chem  2001; 276: 8135– 8141. Google Scholar CrossRef Search ADS PubMed  22. Garside SA, Harlow CR, Hillier SG, Fraser HM, Thomas FH. Thrombospondin-1 inhibits angiogenesis and promotes follicular atresia in a novel in vitro angiogenesis assay. Endocrinology  2010; 151: 1280– 1289. Google Scholar CrossRef Search ADS PubMed  23. Garside SA, Henkin J, Morris KD, Norvell SM, Thomas FH, Fraser HM. A thrombospondin-mimetic peptide, ABT-898, suppresses angiogenesis and promotes follicular atresia in pre- and early-antral follicles in vivo. Endocrinology  2010; 151: 5905– 5915. Google Scholar CrossRef Search ADS PubMed  24. Osz K, Ross M, Petrik J. The thrombospondin-1 receptor CD36 is an important mediator of ovarian angiogenesis and folliculogenesis. Reprod Biol Endocrinol  2014; 12: 21. Google Scholar CrossRef Search ADS PubMed  25. Czekay R-P, Aertgeerts K, Curriden SA, Loskutoff DJ. Plasminogen activator inhibitor-1 detaches cells from extracellular matrices by inactivating integrins. J Cell Biol  2003; 160: 781– 791. Google Scholar CrossRef Search ADS PubMed  26. Davis BN, Hilyard AC, Nguyen PH, Lagna G, Hata A. Induction of microRNA-221 by platelet-derived growth factor signaling is critical for modulation of vascular smooth muscle phenotype. J Biol Chem  2009; 284: 3728– 3738. Google Scholar CrossRef Search ADS PubMed  27. Kuehbacher A, Urbich C, Dimmeler S. Targeting microRNA expression to regulate angiogenesis. Trends Pharmacol Sci  2008; 29: 12– 15. Google Scholar CrossRef Search ADS PubMed  28. Rippe C, Blimline M, Magerko KA, Lawson BR, LaRocca TJ, Donato AJ, Seals DR. MicroRNA changes in human arterial endothelial cells with senescence: relation to apoptosis, eNOS and inflammation. Exp Gerontol  2012; 47: 45– 51. Google Scholar CrossRef Search ADS PubMed  29. Song Z, Li G. Role of specific microRNAs in regulation of vascular smooth muscle cell differentiation and the response to injury. J Cardiovasc Trans Res  2010; 3: 246– 250. Google Scholar CrossRef Search ADS   30. Zhu N, Zhang D, Chen S, Liu X, Lin L, Huang X, Guo Z, Liu J, Wang Y, Yuan W, Qin Y. Endothelial enriched microRNAs regulate angiotensin II-induced endothelial inflammation and migration. Atherosclerosis  2011; 215: 286– 293. Google Scholar CrossRef Search ADS PubMed  31. Wang C, Wang S, Zhao P, Wang X, Wang J, Wang Y, Song L, Zou Y, Hui R. MiR-221 promotes cardiac hypertrophy in vitro through the modulation of p27 expression. J Cell Biochem  2012; 113: 2040– 2046. Google Scholar CrossRef Search ADS PubMed  32. Mackenzie N, Staines K, Zhu D, Genever P, Macrae V. miRNA-221 and miRNA-222 synergistically function to promote vascular calcification. Cell Biochem Funct  2014; 32: 209– 216. Google Scholar CrossRef Search ADS PubMed  33. Poliseno L, Tuccoli A, Mariani L, Evangelista M, Citti L, Woods K, Mercatanti A, Hammond S, Rainaldi G. MicroRNAs modulate the angiogenic properties of HUVECs. Blood  2006; 108: 3068– 3071. Google Scholar CrossRef Search ADS PubMed  34. Nicoli S, Knyphausen CP, Zhu LJ, Lakshmanan A, Lawson ND. miR-221 is required for endothelial tip cell behaviors during vascular development. Dev Cell  2012; 22: 418– 429. Google Scholar CrossRef Search ADS PubMed  35. Nicoli S, Standley C, Walker P, Hurlstone A, Fogarty KE, Lawson ND. MicroRNA-mediated integration of haemodynamics and Vegf signalling during angiogenesis. Nature  2010; 464: 1196– 1200. Google Scholar CrossRef Search ADS PubMed  36. Mondal M, Schilling B, Folger J, Steibel JP, Buchnick H, Zalman Y, Ireland JJ, Meidan R, Smith GW. Deciphering the luteal transcriptome: potential mechanisms mediating stage-specific luteolytic response of the corpus luteum to prostaglandin F(2)alpha. Physiol Genomics  2011; 43: 447– 456. Google Scholar CrossRef Search ADS PubMed  37. McBride D, Carre W, Sontakke SD, Hogg CO, Law A, Donadeu FX, Clinton M. Identification of miRNAs associated with the follicular-luteal transition in the ruminant ovary. Reproduction  2012; 144: 221– 233. Google Scholar CrossRef Search ADS PubMed  38. Ioannidis J, Donadeu FX. Circulating microRNA profiles during the bovine oestrous cycle. PLoS One  2016; 11: e0158160. Google Scholar CrossRef Search ADS PubMed  39. Maroni D, Davis JS. TGFB1 disrupts the angiogenic potential of microvascular endothelial cells of the corpus luteum. J Cell Sci  2011; 124: 2501– 2510. Google Scholar CrossRef Search ADS PubMed  40. Gecaj RM, Schanzenbach CI, Kirchner B, Pfaffl MW, Riedmaier I, Tweedie-Cullen RYet al.   The dynamics of microRNA transcriptome in bovine corpus luteum during its formation, function, and regression. Frontiers in Genetics  2017; 8: (article 213). © The Author(s) 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Biology of Reproduction Oxford University Press

Fibroblast growth factor-2 and transforming growth factor-beta1 oppositely regulate miR-221 that targets thrombospondin-1 in bovine luteal endothelial cells

Loading next page...
 
/lp/ou_press/fibroblast-growth-factor-2-and-transforming-growth-factor-beta1-1y70yrF7Ul
Publisher
Society for the Study of Reproduction
Copyright
© The Author(s) 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
0006-3363
eISSN
1529-7268
D.O.I.
10.1093/biolre/iox167
Publisher site
See Article on Publisher Site

Abstract

Abstract Thrombospondin-1 (THBS1) affects corpus luteum (CL) regression. Highly induced during luteolysis, it acts as a natural anti-angiogenic, proapoptotic compound. THBS1 expression is regulated in bovine luteal endothelial cells (LECs) by fibroblast growth factor-2 (FGF2) and transforming growth factor-beta1 (TGFB1) acting in an opposite manner. Here we sought to identify specific microRNAs (miRNAs) targeting THBS1 and investigate their possible involvement in FGF2 and TGFB1-mediated THBS1 expression. Several miRNAs predicted to target THBS1 mRNA (miR-1, miR-18a, miR-144, miR-194, and miR-221) were experimentally tested. Of these, miR-221 was shown to efficiently target THBS1 expression and function in LECs. We found that this miRNA is highly expressed in luteal cells and in mid-cycle CL. Consistent with the inhibition of THBS1 function, miR-221 also reduced Serpin Family E Member 1 [SERPINE1] in LECs and promoted angiogenic characteristics of LECs. Plasminogen activator inhibitor-1 (PAI-1), the gene product of SERPINE1, inhibited cell adhesion, suggesting that PAI-1, like THBS1, has anti-angiogenic properties. Importantly, FGF2, which negatively regulates THBS1, elevates miR-221. Conversely, TGFB1 that stimulates THBS1, significantly reduces miR-221. Furthermore, FGF2 enhances the suppression of THBS1 caused by miR-221 mimic, and prevents the increase in THBS1 induced by miR-221 inhibitor. In contrast, TGFB1 reverses the inhibitory effect of miR-221 mimic on THBS1, and enhances the upregulation of THBS1 induced by miR-221 inhibitor. These data support the contention that FGF2 and TGFB1 modulate THBS1 via miR-221. These in vitro data propose that dynamic regulation of miR-221 throughout the cycle, affecting THBS1 and SERPINE1, can modulate vascular function in the CL. Introduction Thrombospondin-1 (THBS1) is a large matricellular glycoprotein; its multifaceted actions depend on its ability to interact with different ligands, including structural components of the extracellular matrix (ECM), other matricellular proteins, cell receptors, growth factors, cytokines, and proteases [1, 2]. Our previous reports depicted THBS1 as a central player in luteolysis, acting as an efficient proapoptotic antiangiogenic factor [3–5]. THBS1 also affected two other vital luteal factors: fibroblast growth factor-2 (FGF2) and transforming growth factor-beta1 (TGFB1). It inhibited FGF2 expression and its angiogenic activities [3, 5]. On the other hand, it activated latent TGFB1 in luteal endothelial cells (LECs), thus enabling TGFB1 signaling (SMAD2 phosphorylation) and action (serpin family E member 1 [SERPINE1]) [4]. In the bovine corpus luteum (CL), THBS1 is specifically induced during natural luteolysis or induced by prostaglandin F2 alpha (PGF2a) administration at midcycle [4, 5]. In agreement, a study in ewes also showed an increase in THBS1 mRNA in regressing CL, which was inhibited by early pregnancy [6]. Like THBS1, SERPINE1 expression was characterized by luteal stage-specific expression with extensive responses observed in regressing CL [4]. The SERPINE1 gene encodes endothelial plasminogen activator inhibitor-1 (PAI-1). PAI-1 is the primary inhibitor of tissue plasminogen activator (tPA) and urokinase plasminogen activator (uPA), which convert plasminogen to plasmin [7]. The tPA, uPA, and plasmin directly degrade ECM proteins and activate latent matrix metalloproteinases [8]. Thus, by impairing ECM degradation and remodeling, PAI-1 can significantly alter organ fibrogenesis. PAI-1 also has plasmin-independent actions, such as binding to vitronectin (VN). Cells adhere to VN by engaging both integrins and uPA receptor (uPAR) [9]. The binding of PAI-1 to VN directly blocks uPAR-VN and integrin-VN-mediated cell adhesion required for cell survival [10, 11]. Therefore, PAI-1, because of its profibrotic and proapoptoic actions, may promote the transition of active CL to corpus albicans. We recently reported that THBS1 is hormonally regulated in luteal cells; it is stimulated by luteolytic PGF2a and inhibited by luteinizing signals (LH and insulin) in luteinized granulosa cells (LGCs) [3]. In addition, in LECs THBS1 expression is tightly controlled by FGF2 and TGFB1, which act in an opposite manner. FGF2 suppressed THBS1, whereas TGFB1 elevated THBS1 [3, 4]. Silencing of Dicer and Drosha, key components of the microRNA (miRNA) biogenesis machinery, was reported to elevate THBS1 levels in human umbilical vein endothelial cells (HUVEC) cells, suggesting that multiple miRNAs may regulate THBS1 [12]. Several studies have identified a number of miRNAs that can target THBS1 in different types of cells [13–16], but whether miRNAs play a role in regulating THBS1 in luteal cells remains to be elucidated. The aim of this study was to identify specific miRNAs that target THBS1 expression, investigate their involvement in FGF2 and TGFB1-mediated THBS1 regulation, and understand the biological importance of these miRNAs in LEC function. Materials and methods CL collection Bovine CL was collected at a local slaughterhouse; luteal stage was determined by macroscopic examination. For studies involving luteal RNA extractions, CL in midluteal phase (day 9–14) was frozen in liquid N2 immediately after slaughter. Isolation of granulosa cells Ovaries were collected at a local slaughterhouse as previously described [17]. Only large follicles (1.2–1.5 cm in diameter) containing ≥4 million cells were used. Briefly, granulosa cells (GCs) were gently scraped with a glass stick and placed in Dulbecco modified Eagle medium (DMEM)-F12 containing 1% L-Glutamine and 1% penicillin/streptomycin (Biological Industries, Kibbutz Beit Haemek, Israel), 10 μg/ml of DNAse, hyaluronidase, and collagenase (Sigma-Aldrich, St. Louis, MO). Isolated GCs were cultured and allowed to luteinize, giving rise to luteinized granulosa cells (LGCs). Isolation and culture of LECs The procedure for LECs enrichment was previously described in detail [18]. Briefly, midcycle CL was dispersed using sequential incubations with collagenase. Then, cells were incubated with BS-1-coated magnetic beads. The adherent cells were washed and concentrated using a magnet until the supernatant was free of cells. Next, BS-1-positive cells (with an enriched LECs fraction) were plated in DMEM/F-12 containing 1% L-Glutamine and 1% penicillin/streptomycin (Biological Industries) with 10% fetal calf serum (FCS; Biological Industries) on collagen type I-coated plates (Surecoat; Advanced BioMatrix, San Diego, CA). Colonies of LECs were trypsinized with 1% crystalline trypsin (Biological Industries), collected, and reseeded; this process was repeated until homogenous cell cultures were visualized. Cell identity was verified using endothelial cells (ECs) markers (CD31, EDN1), and the lack of contamination by smooth muscle cells (ACTA2 expression), fibroblasts (COL1A1 expression), and steroidogenic cells (STAR, CYP11A1) was evaluated. Cells of passages 4–10 were utilized in this study. LEC used for these studies were from three cows obtained at different occasions. Cell transfection Small interfering RNA: LECs were trypsinized, seeded in 12-well plates, and cultured for 24 h in DMEM/F-12 medium containing 10% FCS. Then, cells were transfected with 10 nM siRNA constructs (GeneCust, Luxembourg) targeting THBS1 (siTHBS1) or with scrambled siRNA (NC siRNA) (Table 1) using INTERFERin reagent (Polyplus, Illkirch, France) in 1% FCS according to the manufacturer’s protocol. After 24 h of transfection, the medium was replaced with 1% FCS. Total RNA or proteins were then extracted from cells 48 and 72 h after transfection (for determining mRNA and protein levels, respectively). Table 1. siRNA constructs. Name  Sequence  siTHBS1  sense: CUCAGUUACCAUCUGCAAAdTdT    antisense: UUUGCAGAUGGUAACUGAG  NC siRNA  sense: UUCUCCGAACGUGUCACGUdTdT    antisense: ACGUGACACGUUCGGAGAAdTdT  Name  Sequence  siTHBS1  sense: CUCAGUUACCAUCUGCAAAdTdT    antisense: UUUGCAGAUGGUAACUGAG  NC siRNA  sense: UUCUCCGAACGUGUCACGUdTdT    antisense: ACGUGACACGUUCGGAGAAdTdT  View Large MicroRNAs, namely, miR-1, miR-18a, miR-144, miR-194, miR-221-mimic, and miR-221 inhibitor as well as their negative control oligonucleotides were obtained from Bioneer (Daejeon, Republic of Korea). LECs were plated in 12-well plates 24 h before transfection. Cells were then transfected with either mimic miRNAs (20 nM) or inhibitor miRNAs (50 nM) or their respective negative control (miR-NC or miR-iNC) in 1% FCS for 24 h using INTERFERin reagent (Polyplus) according to the manufacturer’s recommended protocol. After 24 h of transfection, the medium was replaced with 1% FCS, and cells were harvested for RNA and protein determinations, 48 h and 72 h post transfection, respectively. Messenger RNA and miRNA quantification Total RNA was isolated using Tri-reagent (Molecular Research Center, Cincinnati, OH, USA). This reagent allows for mRNA and miRNA extraction. Total cDNA was synthesized as previously described [4]. MicroRNA cDNA was synthesized from the purified total RNA using the qScript miRNA Synthesis Kit (Quanta Biosciences, Inc., USA). Quantitative PCRs (q-PCR) for gene expression were performed using the LightCycler 96 system (Roche Diagnostics, USA), with Platinum SYBR Green (SuperMix, Invitrogen, USA) and for miRNAs with PerfeCTa SYBR Green SuperMix, Low ROX (Quanta Biosciences, Inc., USA). The PerfeCTa miRNA assay included Universal Primer, specific miRNA Primer, and small nucleolar RNA, C/D Box 44 (SNORD44) serves as positive control primer used to quantitate ubiquitously expressed small nucleolar RNA. The glyceraldehyde 3-phosphate dehydrogenase (GPDH) gene was used as the housekeeping gene for gene expression. Sequences of primers used for q-PCR are listed in Table 2. Primers were designed using Oligo Primer analysis software (Molecular Biology Insights, Inc. Colorado Springs, USA) based on the available bovine sequences and span an intron to prevent amplification of genomic DNA. Dissociation curve analysis was performed after each real-time experiment to confirm the presence of only one product and the absence of the formation of primer dimers. The threshold cycle number (CT) for each tested gene X was used to quantify the relative abundance of the gene; arbitrary units were calculated as: 2−ΔCt = 2− (Ct target gene X−Ct housekeeping gene). Sequences of the miRNA primers used are listed in Table 3. Table 2. Primer list. Gene name  Primer  Sequence (5΄-3΄)  Accession no.  GPDH  Forward  GTCTTCACTACCATGGAGAAGG  NM_001034034    Reverse  TCATGGATGACCTTGGCCAG    SERPINE1  Forward  CAGAAGGTGAAGATTGAGGTG  NM_174137    Reverse  GGCCCATGAACAGGACAGTTCC    THBS1  Forward  ATCATGGCTGACTCAGGAC  NM_174196    Reverse  TAAGCCCATGGTTCCAGAA    TGFB1  Forward  CAGGACCTTGCTGTACTGTG  NM_001166068    Reverse  GAGCCCTGGACACCAACTAC    FGF2  Forward  TGTCTCCCCCTCACTCTGGTA  NM_174056    Reverse  ACTCCCTGTATAGCCAAAGGTCTG    Gene name  Primer  Sequence (5΄-3΄)  Accession no.  GPDH  Forward  GTCTTCACTACCATGGAGAAGG  NM_001034034    Reverse  TCATGGATGACCTTGGCCAG    SERPINE1  Forward  CAGAAGGTGAAGATTGAGGTG  NM_174137    Reverse  GGCCCATGAACAGGACAGTTCC    THBS1  Forward  ATCATGGCTGACTCAGGAC  NM_174196    Reverse  TAAGCCCATGGTTCCAGAA    TGFB1  Forward  CAGGACCTTGCTGTACTGTG  NM_001166068    Reverse  GAGCCCTGGACACCAACTAC    FGF2  Forward  TGTCTCCCCCTCACTCTGGTA  NM_174056    Reverse  ACTCCCTGTATAGCCAAAGGTCTG    View Large Table 3. MiRNA primers. ID  Sequence  Accession number  SNORD44  5΄CCUGGAUGAUGAUAAGCAAAUGCUGACUGAACAUGAAGGUCUUAAUUAGCUCUAACUGACU 3΄  NR_002750.2  hsa-miR-1-3p  UGGAAUGUAAAGAAGUAUGUAU  MIMAT0000416  hsa-miR-194-5p  UGUAACAGCAACUCCAUGUGGA  MIMAT0000460  hsa-miR-221-3p  AGCUACAUUGUCUGCUGGGUUU  MIMAT0000278  ID  Sequence  Accession number  SNORD44  5΄CCUGGAUGAUGAUAAGCAAAUGCUGACUGAACAUGAAGGUCUUAAUUAGCUCUAACUGACU 3΄  NR_002750.2  hsa-miR-1-3p  UGGAAUGUAAAGAAGUAUGUAU  MIMAT0000416  hsa-miR-194-5p  UGUAACAGCAACUCCAUGUGGA  MIMAT0000460  hsa-miR-221-3p  AGCUACAUUGUCUGCUGGGUUU  MIMAT0000278  hsa-miR-1-3p, hsa-miR-194-5p, and hsa-miR-221-3p have 100% similarity to bta-miR sequences. View Large Western blot analyses Proteins were extracted by adding sample buffer (×2), separated by 7.5% SDS-PAGE, and subsequently transferred to nitrocellulose membranes as we previously reported [5]. Membranes were blocked for 1 h in TBST (20 mmol/L Tris, 150 mmol/L NaCl, and 0.1% Tween 20; pH 7.6) containing 5% low-fat milk, and then incubated overnight at 4°C with mouse anti-THBS1; (1:500; ab1823, Abcam) or rabbit anti-p44/42 total mitogen-activated protein kinase (MAPK) (1:50 000, Sigma) in 1% low-fat milk. The membranes were incubated with peroxidase-conjugated goat anti-rabbit IgG or goat anti-mouse IgG (H + L) for 1 h at room temperature. A chemiluminescent signal was generated with SuperSignal (Thermo Fisher Scientific, Rockford, IL). The signal was analyzed using the Gel-Pro 32 program and normalized to total p44/42 MAPK. Cell adhesion and determination of viable cells numbers Microtiter wells (0.32 cm2/96 wells/plate) were coated with 1 μg/ml of vitronectin (VN, PeproTech Asia, Rehovot, Israel) by incubation overnight at 4°C. The wells were then washed with 1% bovine serum albumin (BSA) in phosphate buffered saline (PBS) and blocked by incubation for 1 h at room temperature with 200 μl of 3% BSA in PBS. Then wells were washed twice with 1% BSA in PBS. Cells were seeded onto the coated wells (15 000 cells/well) in serum-free medium alone (control) or with varying concentrations of PAI-1 variants 50–500 nM (PAI-1-14-1b—an active stable mutant, PAI-1-R—a mutant lacking anti-uPA/tPA activity, PAI-1-AK—a mutant defective in VN binding). All PAI-1 molecules were kindly provided by Professor D. Lawrence, University of Michigan Medical School, Ann Arbor, MI. After 2 h of incubation at 37°C, the floating cells were removed by washing, and the number of remaining attached cells was determined by using the XTT kit (Biological Industries), as previously described [19]. XTT was added according to the manufacturer’s instructions. Plates were incubated at 37°C for 2 h. The absorbance was read at 450 nm (reference absorbance, 630 nm). XTT was also used to determine number of cells transfected with miRNA. Scratch/wound healing assays LECs were seeded in 12-well plates. At 24 h after transfection with a negative control or miR-221 mimic, LEC monolayer was wounded by using a 200-μl tip. Cells were washed and microphotographs (original magnification ×10) were taken 0 h and 16 h after wounding. Cell coverage of the scratched area was analyzed with NIH image software. Cell treatments LECs were seeded in 12-well dishes (45 000 cells/well) and cultured overnight in DMEM/F-12 medium containing 10% FCS. The next day, the cells were transferred to starvation medium (0.5% BSA, 0.1% FCS) for 24 h and were then incubated with 10 ng/ml of recombinant human FGF2 basic (FGF2, PeproTech Asia, Rehovot, Israel) or 1 ng/ml of recombinant human TGFB1 (TGFB1, ProSpec-Tany TechnoGene Ltd, Rehovot, Israel) for 24 h. Total RNA was extracted, and gene expression or miRNA quantitation was analyzed by q-PCR as described before. Cells without treatments were used as a control. Transfected LECs with miR-221 mimic or inhibitor and their negative control were treated 24 h post transfection with 10 ng/ml FGF2 or 1 ng/ml TGFB1. After 24 h of treatment, total RNA was extracted and gene expression was analyzed by q-PCR as described above. Untreated cells were used as a control. Statistical analyses Data are presented as means ± SEM; experiments were repeated at least three times. Statistical analyses were performed using Student t-test or one-way ANOVA, followed by Bonferroni multiple comparison tests, when appropriate. In all analyses, a value of P < 0.05 was considered significant. Statistical analysis of the experimental data was performed using SigmaPlot Systat software. Asterisks represent significant differences from their respective controls. *P < 0.05, **P < 0.01, *** P < 0.001. Results Screening of miRNAs targeting the THBS1 3΄ untranslated region The THBS1 gene has 3΄ untranslated region (UTR) with several predicted binding sites for multiple miRNAs. TargetScan prediction tool (Whitehead Institute for Biomedical Research, Cambridge, MA) was used to identify candidate miRNAs (Figure 1). It showed several potential binding sites for miRNAs conserved among vertebrates, of which we selected five miRNAs with the highest aggregate PCT value (the probability of conserved targeting, as described in Friedman et al., is presented in Table 4 [20]): miR-1, miR-18a, miR-144, miR-194, and miR-221. Figure 1. View largeDownload slide In silico screening for thrombospondin-1 (THBS1) regulatory miRNAs. Schematic representation of the conserved binding sites of miRNAs in the THBS1 3΄UTR predicted by TargetScan. Five miRNAs conserved in vertebrates were chosen for investigation (marked by an amber rectangle). Figure 1. View largeDownload slide In silico screening for thrombospondin-1 (THBS1) regulatory miRNAs. Schematic representation of the conserved binding sites of miRNAs in the THBS1 3΄UTR predicted by TargetScan. Five miRNAs conserved in vertebrates were chosen for investigation (marked by an amber rectangle). Table 4. TargetScan-predicted miRNAs targeting THBS1 3΄UTR broadly conserved among vertebrates. Table entries were sorted by aggregate PCT. ID  Conserved sites  Position in the 3΄UTR  Aggregate PCT  miR-1/206  1  920–926  0.84  miR-18  1  48–54  0.81  miR-144  2  1396–1402  0.70      1591–1597    miR-221/222  2  796–790  0.65      805–812    miR-194  1  514–521  0.47  ID  Conserved sites  Position in the 3΄UTR  Aggregate PCT  miR-1/206  1  920–926  0.84  miR-18  1  48–54  0.81  miR-144  2  1396–1402  0.70      1591–1597    miR-221/222  2  796–790  0.65      805–812    miR-194  1  514–521  0.47  View Large To experimentally validate these five potential THBS1-targeting miRNAs, their miRNA mimics were overexpressed in LECs as described in Materials and Methods. A negative control miRNA mimic was used as a control. In addition, we transfected THBS1 siRNA as a positive control (Figure 2) [3]. Overexpression of miR-1, miR-194, and miR-221 significantly decreased THBS1 to levels ∼60% lower than in the control, whereas miR-18a and miR-144 did not affect THBS1 expression (Figure 2A). Western blot analysis revealed that miR-1, miR-194, and miR-221 also markedly suppressed THBS1 protein levels in LECs, supporting gene expression results (Figure 2B). Figure 2. View largeDownload slide THBS1 mRNA (A) and protein (B) expression in LECs transfected with negative control (NC), miRNAs mimics, and siTHBS1. Samples were harvested 48 h post-transfection. The threshold cycle number (Ct) for each tested gene X was used to quantify the relative abundance of the gene; arbitrary units were calculated as 2−ΔCt = 2–(Ct target gene X–Ct reference gene). Negative control was designated as 100%. The results are presented as means ± SEM. Significance was calculated using two-tailed Student t-test *P < 0.05, **P < 0.01, ***P < 0.0001 (as compared to NC). (B) THBS1 protein was determined by western blotting and normalized relative to the abundance of total MAPK (p44/42). A representative western blot is shown. Figure 2. View largeDownload slide THBS1 mRNA (A) and protein (B) expression in LECs transfected with negative control (NC), miRNAs mimics, and siTHBS1. Samples were harvested 48 h post-transfection. The threshold cycle number (Ct) for each tested gene X was used to quantify the relative abundance of the gene; arbitrary units were calculated as 2−ΔCt = 2–(Ct target gene X–Ct reference gene). Negative control was designated as 100%. The results are presented as means ± SEM. Significance was calculated using two-tailed Student t-test *P < 0.05, **P < 0.01, ***P < 0.0001 (as compared to NC). (B) THBS1 protein was determined by western blotting and normalized relative to the abundance of total MAPK (p44/42). A representative western blot is shown. To determine whether miR-1, miR-194, and miR-221 were endogenously expressed in luteal cells, their expression was determined by q-PCR using total RNA from mature CL, LGCs, and LECs (Figure 3). MiR-1 was detected at very low levels in either whole CL or luteal cell types. Expression of miR-194 was readily detectable in both cell types and in total CL, with higher expression levels in whole CL tissue. Levels of miR-221 were the most highly expressed, compared with miR-1 and miR-194 in luteal cells and CL tissue alike. Figure 3. View largeDownload slide Endogenous expression of miR-1, miR-194, and miR-221 in midcycle CL, LGCs, and LECs. The levels of miRNA expression were measured by q-PCR. The results are presented as means ± SEM from four samples. Data were normalized relative to the abundance of SNORD expression in the same samples. Figure 3. View largeDownload slide Endogenous expression of miR-1, miR-194, and miR-221 in midcycle CL, LGCs, and LECs. The levels of miRNA expression were measured by q-PCR. The results are presented as means ± SEM from four samples. Data were normalized relative to the abundance of SNORD expression in the same samples. THBS1-targeting miRNAs affect the expression of SERPINE1 and FGF2 The data presented in Figure 4A show that SERPINE1 expression in miRNA-transfected cells mirrored that of THBS1. It was strongly reduced by miR-221 similar to the reduction induced by siTHBS1 (about 50%). These data further support the essential role of THBS1 in SERPINE1 expression [4]. MiR-1 and miR-18a induced a moderate decrease in SERPINE1 mRNA. Overexpression of miR-194 and miR-144 did not affect SERPINE1 mRNA (Figure 2). Figure 4. View largeDownload slide Effect of miRNAs on SERPINE1 and FGF2 mRNA. SERPINE1 (A) and FGF2 (B) mRNA levels in LECs transfected with miR-1, miR-18a, miR-144, miR-194, miR-221 mimics, or siTHBS1. Samples were harvested 48 h post-transfection. Negative control was designated as 100%. The results are presented as means ± SEM. Significance was calculated using two-tailed Student t-test (*P < 0.05, **P < 0.01, ***P < 0.0001). Figure 4. View largeDownload slide Effect of miRNAs on SERPINE1 and FGF2 mRNA. SERPINE1 (A) and FGF2 (B) mRNA levels in LECs transfected with miR-1, miR-18a, miR-144, miR-194, miR-221 mimics, or siTHBS1. Samples were harvested 48 h post-transfection. Negative control was designated as 100%. The results are presented as means ± SEM. Significance was calculated using two-tailed Student t-test (*P < 0.05, **P < 0.01, ***P < 0.0001). Our previous studies indicated that THBS1 inhibits FGF2 gene expression [3]; it was therefore interesting to find out if miRNAs targeting THBS1 will also affect FGF2. Indeed, we observed that the expression of FGF2 was elevated by miR-221 and miR-144, similar to the effects exerted by siTHBS1 (Figure 4B). Overexpression of miR-1, miR-18a, and miR-194 in LECs did not have an appreciable effect on FGF2 expression. Inhibition of miR-221 restores THBS1 expression Among the five miRNAs that we investigated, miR-221 is highly expressed in CL tissue and luteal cells (Figure 3). Furthermore, the overexpression of miR-221 strongly inhibited THBS1 (Figure 2) and affected the levels of SERPINE1 and FGF2 similar to siTHBS1 (Figure 4). Therefore, in the subsequent experiments we focused on miR-221. To determine whether the endogenously expressed miR-221 regulates THBS1 expression, we transfected LECs with miR-221 inhibitor (anti-miR-221). Transfection of miR-221 inhibitor markedly elevated THBS1 levels in LECs by approximately 40%, as compared with its negative control (Figure 5). As expected, this effect was opposite to that induced by the miRNA mimic (Figure 2). Importantly, together with THBS1 expression, levels of SERPINE1 mRNA were also upregulated by anti-miR-221 (Figure 5). Figure 5. View largeDownload slide Transfection with miR-221 inhibitor (anti-miR-221) increased the expression of THBS1 and SERPINE1 mRNA. Samples were harvested 48 h post-transfection. Negative control was designated as 100%. The results are presented as means ± SEM. Data are from five independent experiments. Significance was calculated using two-tailed Student t-test (***P < 0.0001). Figure 5. View largeDownload slide Transfection with miR-221 inhibitor (anti-miR-221) increased the expression of THBS1 and SERPINE1 mRNA. Samples were harvested 48 h post-transfection. Negative control was designated as 100%. The results are presented as means ± SEM. Data are from five independent experiments. Significance was calculated using two-tailed Student t-test (***P < 0.0001). MiR-221 expression is regulated by FGF2 and TGFB1 in an opposite manner Having established that miR-221 targets THBS1 in LECs and since FGF2 and TGFB1 control THBS1 oppositely [3, 4], we next examined whether incubation of LECs with FGF2 or TGFB1 could influence miR-221 expression (Figure 6). We observed that incubation of LECs with FGF2 for 24 h significantly elevated miR-221 expression (1.4-fold higher as compared with the control, P < 0.001). In contrast, TGFB1 significantly downregulated miR-221 in these cells (2-fold less than the control, P < 0.001; Figure 6). Figure 6. View largeDownload slide Inverse regulation of miR-221 by FGF2 and TGFB1. LECs were incubated with 10 ng/ml of FGF2 or 1 ng/ml of TGFB1. After 24 h of treatment, cells were harvested for RNA extraction and endogenous miR-221 expression levels were measured. Untreated cells were designated as control (100%). The results are presented as means ± SEM. Asterisks indicate significant differences from the control group (***P < 0.001). The data were from five independent experiments. Figure 6. View largeDownload slide Inverse regulation of miR-221 by FGF2 and TGFB1. LECs were incubated with 10 ng/ml of FGF2 or 1 ng/ml of TGFB1. After 24 h of treatment, cells were harvested for RNA extraction and endogenous miR-221 expression levels were measured. Untreated cells were designated as control (100%). The results are presented as means ± SEM. Asterisks indicate significant differences from the control group (***P < 0.001). The data were from five independent experiments. Next, to assess the role of miR-221 in FGF2 and TGFB1-mediated THBS1 expression, we treated the cells with miR-221 mimic or miR-221 inhibitor together with FGF2 or TGFB1 (Figure 7). Treatment with FGF2 reduced THBS1 levels by 30%, compared with the negative control without treatment, in accordance with our previous report [3]. Overexpression of miR-221 inhibited THBS1, as also shown in Figure 2. However, treatment of miR-221, together with FGF2 (inducing endogenous miR-221, Figure 6), further reduced THBS1 (Figure 7A). MiR-221 inhibitor alone elevated THBS1 as expected from data presented in Figure 5; the addition of FGF2, which can antagonize this effect by elevating miR-221 (Figure 6), prevented the increase of THBS1 (Figure 7A). Figure 7. View largeDownload slide Role of miR-221 in FGF2 and TGFB1-mediated THBS1 expression. LECs were transfected with miR-221 mimic or the anti-miR along with their negative controls. At 24 h post-transfection, cells were treated with 10 ng/ml FGF2 (A) or 1 ng/ml TGFB1 (B). At 24 h later, cells were harvested for RNA extraction and the levels of THBS1 mRNA were measured. Results are presented as means ± SEM. The data were from five independent experiments. Different letters indicate significant differences of P < 0.05 or more. Figure 7. View largeDownload slide Role of miR-221 in FGF2 and TGFB1-mediated THBS1 expression. LECs were transfected with miR-221 mimic or the anti-miR along with their negative controls. At 24 h post-transfection, cells were treated with 10 ng/ml FGF2 (A) or 1 ng/ml TGFB1 (B). At 24 h later, cells were harvested for RNA extraction and the levels of THBS1 mRNA were measured. Results are presented as means ± SEM. The data were from five independent experiments. Different letters indicate significant differences of P < 0.05 or more. TGFB1 had opposite effects (Figure 7B). TGFB1 alone significantly increased THBS1 mRNA to 180%, compared with a negative control [4]. TGFB1, which can reduce miR-221 levels (Figure 6), also reversed the inhibitory effect of miR-221 mimic on THBS1. Inhibition of miR-221 by anti-miR, together with TGFB1, further increased THBS1, as compared with the miRNA inhibitor alone. This most probably resulted from the combined miR-221 suppression by anti-miR and TGFB1. Biological functions of miR-221 in LECs Cells transfected with miR-221 exhibited a marked increase in their cell proliferation rate compared with control oligonucleotide-transfected cells (Figure 8A). We also evaluated effects of miR-221 on LEC migration. Cells transfected with miR-221 exhibited a much higher migration rate than did control cells (Figure 8B). Figure 8. View largeDownload slide Effects of miR-221 mimic transfection on the proliferation and migration of LECs. (A) Cells were transfected with negative control (NC) or miR-221 mimic. At 24 h post-transfection, the number of cells was determined by XTT. Data represent the means ± SEM from three independent experiments. Asterisks indicate significant differences from the NC group (**P < 0.01). (B) Scratch assay in LECs transfected with NC or miR-221. At 24 h after transfection, the LEC monolayer was wounded by a 200-μl tip. Wound closure after 16 h is shown (original magnification ×10). Red dotted lines denote the edge of the wound at the beginning of the experiment. Representative images are shown. Figure 8. View largeDownload slide Effects of miR-221 mimic transfection on the proliferation and migration of LECs. (A) Cells were transfected with negative control (NC) or miR-221 mimic. At 24 h post-transfection, the number of cells was determined by XTT. Data represent the means ± SEM from three independent experiments. Asterisks indicate significant differences from the NC group (**P < 0.01). (B) Scratch assay in LECs transfected with NC or miR-221. At 24 h after transfection, the LEC monolayer was wounded by a 200-μl tip. Wound closure after 16 h is shown (original magnification ×10). Red dotted lines denote the edge of the wound at the beginning of the experiment. Representative images are shown. Data presented in Figure 4A show that miR-221 targeting THBS1 also markedly reduced SERPINE1 levels in LECs. Therefore, assessing the activity of PAI-1 protein encoded by the SERPINE1 gene can advance our understanding of the biological functions produced by miR-221 in LECs. We tested the effects of the three PAI-1 variants [21] (described in the M&M section) on cell adhesion (Figure 9). Cell adhesion was inhibited by all three PAI-1 variants (Figure 9). PAI-1-AK and PAI-1-R reduced cell adhesion in dose-dependent manner and were more potent than mutant 14-1b (which blocks both uPA/tPA and integrin-mediated binding to VN) in the high concentration (more than 200 nM). Nevertheless, mutant 14-1b was more effective at the lowest concentration. Figure 9. View largeDownload slide Effects of recombinant PAI-1s on LECs adhesion. Microtiter wells were coated with vitronectin and then blocked with BSA for 2 h as described in Materials and Methods. Cells were seeded onto the coated wells in serum-free medium with varying concentrations of PAI-1 variants 50–500 nM (PAI-1-14-1b—an active stable mutant, PAI-1-R—a mutant lacking anti-uPA/tPA activity, PAI-1-AK—a mutant defective in VN binding). After 2 h of incubation, the floating cells were removed by washing, and the number of remaining attached cells was determined. Cells without treatments were designated as control (100%). Data are from four independent experiments. Results are presented as means ± SEM. Asterisks indicate significant differences from the control group (*P < 0.05, **P < 0.01, ***P < 0.001). Figure 9. View largeDownload slide Effects of recombinant PAI-1s on LECs adhesion. Microtiter wells were coated with vitronectin and then blocked with BSA for 2 h as described in Materials and Methods. Cells were seeded onto the coated wells in serum-free medium with varying concentrations of PAI-1 variants 50–500 nM (PAI-1-14-1b—an active stable mutant, PAI-1-R—a mutant lacking anti-uPA/tPA activity, PAI-1-AK—a mutant defective in VN binding). After 2 h of incubation, the floating cells were removed by washing, and the number of remaining attached cells was determined. Cells without treatments were designated as control (100%). Data are from four independent experiments. Results are presented as means ± SEM. Asterisks indicate significant differences from the control group (*P < 0.05, **P < 0.01, ***P < 0.001). Discussion This study identified miR-221 as a key regulator of THBS1 expression and function in bovine LECs. Highly expressed in luteal cells and bovine CL, miR-221 effectively suppressed THBS1 levels. TGFB1 and FGF2 inversely modulated miR-221 levels, providing a possible explanation for their opposite control of THBS1 mRNA expression. Furthermore, consistent with THBS1 and consequent SERPINE1 inhibitions, miR-221 induced LECs migration, proliferation, and survival, suggesting that it plays a role in luteal angiogenesis (Figure 10). Figure 10. View largeDownload slide Proposed role of miR-221 in luteal angiogenesis. Highly expressed in luteal cells and in bovine CL, miR-221 effectively suppressed antiangiogenic THBS1. This miRNA also suppressed SERPINE1, whose expression is dependent on TGFB1 activation by THBS1 [4]. TGFB1 and FGF2 inversely modulated miR-221 levels, providing a possible explanation for their opposite control of THBS1 expression observed before [3, 4]. Consistent with THBS1 and consequent SERPINE1 inhibitions, miR-221 induced LEC migration, proliferation, and survival, thus demonstrating its proangiogenic role. Figure 10. View largeDownload slide Proposed role of miR-221 in luteal angiogenesis. Highly expressed in luteal cells and in bovine CL, miR-221 effectively suppressed antiangiogenic THBS1. This miRNA also suppressed SERPINE1, whose expression is dependent on TGFB1 activation by THBS1 [4]. TGFB1 and FGF2 inversely modulated miR-221 levels, providing a possible explanation for their opposite control of THBS1 expression observed before [3, 4]. Consistent with THBS1 and consequent SERPINE1 inhibitions, miR-221 induced LEC migration, proliferation, and survival, thus demonstrating its proangiogenic role. Both THBS1 and SERPINE1 are induced in the CL during luteal regression and these two genes are widely implicated in vascular biology. Although the impact of THBS1 on ovarian vascular functions was extensively demonstrated before [3–5, 22–24], much less is known about the roles of SERPINE1-encoded protein PAI-1. Here, we examined the role of PAI-1 using three mutants that allowed us to distinguish between PAI-1 protease inhibitory activity and its VN-binding properties [21]. PAI-1-R (devoid of antiprotease activity) and PAI-1-AK (defective in VN binding domain) reduced LECs adhesion to VN similarly. Thus, our results suggest that PAI-1 can block LEC-VN interactions either by the VN binding domain or through antiprotease activity. The existence of such a VN-independent, uPA-uPAR-dependent mechanism by which PAI-1 induces cell detachment was also reported in other cell types [25]. Thus, it appears that PAI-1, like THBS1, is an antiangiogenic factor. Numerous reports have shown that the miR-221/222 cluster plays a significant role in vascular biology [26–32]. Both pro- and antiangiogenic effects were reported for this miRNA. In human venous or lymphatic ECs, miR-221/222 exhibit strictly antiangiogenic properties by inhibiting factors such as C-KIT [33] and Ets1, Ets2 [30]. In contrast, in embryonic ECs, miR-221 was shown to promote proliferation and migration of tip ECs in sprouting vessels [34]. Likewise, miR-221 deficiency blocked ECs proliferation in zebrafish embryos [35]. These effects were mediated by repression of two distinct target transcripts: CDKN1B and PI3KR1 [34]. Our data suggest that miR-221 has proangiogenic activities in LECs, which is pertinent to its ability to suppress THBS1 and SERPINE1. In agreement, the ability of miR-221 to suppress THBS1 and promote endothelial cell survival and their angiogenic properties was also shown in HUVECs’ response to irradiation [14]. These previous reports suggest that the effect of miR-221 in ECs is context-dependent, varying with cell environment and the developmental stage. The current study provides strong evidence for the involvement of miR-221 in the regulation of THBS1 by FGF2 and TGFB1 in LECs. We found that FGF2, which negatively regulates THBS1 [3], was able to increase miR-221 expression in LECs. In contrast, TGFB1’s upregulation of THBS1 [4] significantly reduced miR-221 in LECs. Moreover, FGF2 treatment enhanced the suppression of THBS1 caused by the miR-221 mimic, and prevented the increase of THBS1 induced by miR-221 inhibitor. TGFB1, on the other hand, reversed the inhibitory effect of miR-221 mimic on THBS1, and enhanced the upregulation of THBS1 induced by miR-221 inhibitor. Thus, miR-221 seems to functionally link several key luteal genes: THBS1, FGF2, TGFB1, and SERPINE1. The expression of these genes is modulated by PGF2a, in a luteal stage-dependent manner [4, 5, 36]. On day 4 of the cycle, only FGF2 exhibited a strong and sustained stimulation in response to PGF2a. However, THBS1 and SERPINE1 were only slightly and transiently elevated. The involvement of miR-221 can explain this pattern of gene expression. Elevated FGF2 in young CL is expected to upregulate miR-221, thus resulting in suppressed THBS1 and consequently, SERPINE1. This gene expression profile may contribute to angiogenesis in early CL and its resistance to luteolysis. In contrast, in the regressing CL, increased FGF2 is negligible, whereas THBS1, TGFB1, and SERPINE1 mRNAs were all strikingly induced 4 h and 24 h after PGF2a administration [4, 5, 36]. Based on in vitro findings shown here, it can be proposed that elevated TGFB1 inhibits miR-221 expression, thus enabling THBS1 and SERPINE1 upregulation. However, direct proof, demonstrating alteration of miR-221 levels in the CL in response to PGF2a, is still lacking. Yet, data available from transcriptomic analyses support the general contention of miR-221 being varied in the CL in a manner that is consistent with the data presented here, i.e., high in early CL and low in late CL. MiR-221 increased in early sheep CL relative to dominant follicle (about 2-fold) and was reduced in late CL [37]. In addition, in bovine plasma, miR-221 was lower on day 16 of the bovine estrous cycle, compared with an earlier time point, day 8 [38]. Taken together, the findings reported here advance our understanding of miR-221 in luteal vascular function. These in vitro findings suggest that miR-221 is regulated in LECs in a physiologically significant manner; it is stimulated by FGF2—highly expressed in early CL [5, 36] and suppressed by TGFB1, which is elevated during luteal regression [36, 39]. A recent publication [40] measuring miRNA profile in cyclic bovine CL, demonstrated that miR-221/222 levels were indeed lower in late and regressed bovine CL relative to their abundance in early CL, supporting the above mentioned propositions. Thus, dynamic regulation of miR-221, altering the levels of THBS1 and SERPINE1, can modulate vascular function in the CL, shifting from angiogenesis in young CL to vascular instability in late-cycle CL. References 1. Adams JC, Lawler J. The thrombospondins. Cold Spring Harb Perspect Biol  2011; 3: a009712– a009712. Google Scholar CrossRef Search ADS PubMed  2. Bornstein P. Thrombospondins as matricellular modulators of cell function. J Clin Invest  2001; 107: 929– 934. Google Scholar CrossRef Search ADS PubMed  3. Farberov S, Meidan R. Functions and transcriptional regulation of thrombospondins and their interrelationship with fibroblast growth factor-2 in bovine luteal cells1. Biol Reprod  2014; 91: 58. Google Scholar CrossRef Search ADS PubMed  4. Farberov S, Meidan R. Thrombospondin-1 affects bovine luteal function via transforming growth factor-beta1-dependent and independent actions. Biol Reprod  2016; 94: 25. Google Scholar CrossRef Search ADS PubMed  5. Zalman Y, Klipper E, Farberov S, Mondal M, Wee G, Folger JK, Smith GW, Meidan R. Regulation of angiogenesis-related prostaglandin F2alpha-induced genes in the bovine corpus luteum. Biol Reprod  2012; 86: 92. Google Scholar CrossRef Search ADS PubMed  6. Romero JJ, Antoniazzi AQ, Smirnova NP, Webb BT, Yu F, Davis JS, Hansen TR. Pregnancy-associated genes contribute to antiluteolytic mechanisms in ovine corpus luteum. Physiol Genom  2013; 45: 1095– 1108. Google Scholar CrossRef Search ADS   7. Lawrence D, Ginsburg D. Plasminogen activator inhibitors. In high KA, Roberts HR (eds). Molecular Basis of Thrombosis and Hemostasis . New York: Marcel Dekker; 1995: 517. 8. Pepper MS. Role of the matrix metalloproteinase and plasminogen activator-plasmin systems in angiogenesis. Arterioscler Thromb Vasc Biol  2001; 21: 1104– 1117. Google Scholar CrossRef Search ADS PubMed  9. Deng G, Curriden SA, Wang S, Rosenberg S, Loskutoff DJ. Is plasminogen activator inhibitor-1 the molecular switch that governs urokinase receptor-mediated cell adhesion and release? J Cell Biol  1996; 134: 1563– 1571. Google Scholar CrossRef Search ADS PubMed  10. Stefansson S, Lawrence DA. The serpin PAI-1 inhibits cell migration by blocking integrin alpha v beta 3 binding to vitronectin. Nature  1996; 383: 441– 443. Google Scholar CrossRef Search ADS PubMed  11. Meredith JE Jr., Schwartz MA. Integrins, adhesion and apoptosis. Trends Cell Biol  1997; 7: 146– 150. Google Scholar CrossRef Search ADS PubMed  12. Kuehbacher A, Urbich C, Zeiher AM, Dimmeler S. Role of dicer and drosha for endothelial microRNA expression and angiogenesis. Circ Res  2007; 101: 59– 68. Google Scholar CrossRef Search ADS PubMed  13. Dogar AM, Semplicio G, Guennewig B, Hall J. Multiple microRNAs derived from chemically synthesized precursors regulate thrombospondin 1 expression. Nucleic Acid Ther  2014; 24: 149– 159. Google Scholar CrossRef Search ADS PubMed  14. Vincenti S, Brillante N, Lanza V, Bozzoni I, Presutti C, Chiani F, Etna MP, Negri R. HUVEC respond to radiation by inducing the expression of pro-angiogenic microRNAs. Radiat Res  2011; 175: 535– 546. Google Scholar CrossRef Search ADS PubMed  15. Feng N, Wang Z, Zhang Z, He X, Wang C, Zhang L. miR-487b promotes human umbilical vein endothelial cell proliferation, migration, invasion and tube formation through regulating THBS1. Neurosci Lett  2015; 591: 1– 7. Google Scholar CrossRef Search ADS PubMed  16. Wang JM, Tao J, Chen DD, Cai JJ, Irani K, Wang Q, Yuan H, Chen AF. MicroRNA miR-27b rescues bone marrow-derived angiogenic cell function and accelerates wound healing in type 2 diabetes mellitus. Arterioscler Thromb Vasc Biol  2014; 34: 99– 109. Google Scholar CrossRef Search ADS PubMed  17. Meidan R, Girsh E, Blum O, Aberdam E. In vitro differentiation of bovine theca and granulosa cells into small and large luteal-like cells: morphological and functional characteristics. Biol Reprod  1990; 43: 913– 921. Google Scholar CrossRef Search ADS PubMed  18. Levy N, Gordin M, Mamluk R, Yanagisawa M, Smith MF, Hampton JH, Meidan R. Distinct cellular localization and regulation of endothelin-1 and endothelin-converting enzyme-1 expression in the bovine corpus luteum: implications for luteolysis. Endocrinology  2001; 142: 5254– 5260. Google Scholar CrossRef Search ADS PubMed  19. Klipper E, Tatz E, Kisliouk T, Vlodavsky I, Moallem U, Schams D, Lavon Y, Wolfenson D, Meidan R. Induction of heparanase in bovine granulosa cells by luteinizing hormone: possible role during the ovulatory process. Endocrinology  2009; 150: 413– 421. Google Scholar CrossRef Search ADS PubMed  20. Friedman RC, Farh KK, Burge CB, Bartel DP. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res  2009; 19: 92– 105. Google Scholar CrossRef Search ADS PubMed  21. Stefansson S, Petitclerc E, Wong MK, McMahon GA, Brooks PC, Lawrence DA. Inhibition of Angiogenesis in vivo by plasminogen activator inhibitor-1. J Biol Chem  2001; 276: 8135– 8141. Google Scholar CrossRef Search ADS PubMed  22. Garside SA, Harlow CR, Hillier SG, Fraser HM, Thomas FH. Thrombospondin-1 inhibits angiogenesis and promotes follicular atresia in a novel in vitro angiogenesis assay. Endocrinology  2010; 151: 1280– 1289. Google Scholar CrossRef Search ADS PubMed  23. Garside SA, Henkin J, Morris KD, Norvell SM, Thomas FH, Fraser HM. A thrombospondin-mimetic peptide, ABT-898, suppresses angiogenesis and promotes follicular atresia in pre- and early-antral follicles in vivo. Endocrinology  2010; 151: 5905– 5915. Google Scholar CrossRef Search ADS PubMed  24. Osz K, Ross M, Petrik J. The thrombospondin-1 receptor CD36 is an important mediator of ovarian angiogenesis and folliculogenesis. Reprod Biol Endocrinol  2014; 12: 21. Google Scholar CrossRef Search ADS PubMed  25. Czekay R-P, Aertgeerts K, Curriden SA, Loskutoff DJ. Plasminogen activator inhibitor-1 detaches cells from extracellular matrices by inactivating integrins. J Cell Biol  2003; 160: 781– 791. Google Scholar CrossRef Search ADS PubMed  26. Davis BN, Hilyard AC, Nguyen PH, Lagna G, Hata A. Induction of microRNA-221 by platelet-derived growth factor signaling is critical for modulation of vascular smooth muscle phenotype. J Biol Chem  2009; 284: 3728– 3738. Google Scholar CrossRef Search ADS PubMed  27. Kuehbacher A, Urbich C, Dimmeler S. Targeting microRNA expression to regulate angiogenesis. Trends Pharmacol Sci  2008; 29: 12– 15. Google Scholar CrossRef Search ADS PubMed  28. Rippe C, Blimline M, Magerko KA, Lawson BR, LaRocca TJ, Donato AJ, Seals DR. MicroRNA changes in human arterial endothelial cells with senescence: relation to apoptosis, eNOS and inflammation. Exp Gerontol  2012; 47: 45– 51. Google Scholar CrossRef Search ADS PubMed  29. Song Z, Li G. Role of specific microRNAs in regulation of vascular smooth muscle cell differentiation and the response to injury. J Cardiovasc Trans Res  2010; 3: 246– 250. Google Scholar CrossRef Search ADS   30. Zhu N, Zhang D, Chen S, Liu X, Lin L, Huang X, Guo Z, Liu J, Wang Y, Yuan W, Qin Y. Endothelial enriched microRNAs regulate angiotensin II-induced endothelial inflammation and migration. Atherosclerosis  2011; 215: 286– 293. Google Scholar CrossRef Search ADS PubMed  31. Wang C, Wang S, Zhao P, Wang X, Wang J, Wang Y, Song L, Zou Y, Hui R. MiR-221 promotes cardiac hypertrophy in vitro through the modulation of p27 expression. J Cell Biochem  2012; 113: 2040– 2046. Google Scholar CrossRef Search ADS PubMed  32. Mackenzie N, Staines K, Zhu D, Genever P, Macrae V. miRNA-221 and miRNA-222 synergistically function to promote vascular calcification. Cell Biochem Funct  2014; 32: 209– 216. Google Scholar CrossRef Search ADS PubMed  33. Poliseno L, Tuccoli A, Mariani L, Evangelista M, Citti L, Woods K, Mercatanti A, Hammond S, Rainaldi G. MicroRNAs modulate the angiogenic properties of HUVECs. Blood  2006; 108: 3068– 3071. Google Scholar CrossRef Search ADS PubMed  34. Nicoli S, Knyphausen CP, Zhu LJ, Lakshmanan A, Lawson ND. miR-221 is required for endothelial tip cell behaviors during vascular development. Dev Cell  2012; 22: 418– 429. Google Scholar CrossRef Search ADS PubMed  35. Nicoli S, Standley C, Walker P, Hurlstone A, Fogarty KE, Lawson ND. MicroRNA-mediated integration of haemodynamics and Vegf signalling during angiogenesis. Nature  2010; 464: 1196– 1200. Google Scholar CrossRef Search ADS PubMed  36. Mondal M, Schilling B, Folger J, Steibel JP, Buchnick H, Zalman Y, Ireland JJ, Meidan R, Smith GW. Deciphering the luteal transcriptome: potential mechanisms mediating stage-specific luteolytic response of the corpus luteum to prostaglandin F(2)alpha. Physiol Genomics  2011; 43: 447– 456. Google Scholar CrossRef Search ADS PubMed  37. McBride D, Carre W, Sontakke SD, Hogg CO, Law A, Donadeu FX, Clinton M. Identification of miRNAs associated with the follicular-luteal transition in the ruminant ovary. Reproduction  2012; 144: 221– 233. Google Scholar CrossRef Search ADS PubMed  38. Ioannidis J, Donadeu FX. Circulating microRNA profiles during the bovine oestrous cycle. PLoS One  2016; 11: e0158160. Google Scholar CrossRef Search ADS PubMed  39. Maroni D, Davis JS. TGFB1 disrupts the angiogenic potential of microvascular endothelial cells of the corpus luteum. J Cell Sci  2011; 124: 2501– 2510. Google Scholar CrossRef Search ADS PubMed  40. Gecaj RM, Schanzenbach CI, Kirchner B, Pfaffl MW, Riedmaier I, Tweedie-Cullen RYet al.   The dynamics of microRNA transcriptome in bovine corpus luteum during its formation, function, and regression. Frontiers in Genetics  2017; 8: (article 213). © The Author(s) 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Journal

Biology of ReproductionOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off