Feed habituation alleviates decreased feed intake after feed replacement in broilers

Feed habituation alleviates decreased feed intake after feed replacement in broilers Abstract In the present study, 2 experiments were conducted to investigate the effect of replacing a mash diet with a pellet diet on the expression of genes related to appetite in the hypothalamus and gastrointestinal tract (GT) and to evaluate the attenuating effect of feed habituation on the disadvantage influence on feed consumption. In experiment 1, the mash diet of one group of 21-day-old chicks was replaced with a pellet diet (PD) with the same ingredient composition, while the other group of chicks was continued on the mash diet (control). In experiment 2, all the experimental chickens were divided into 3 treatments at 18 d of age. One treatment of birds was provided with feeders with pellet feed scattered on the surface of the mash diet (around one-third of feeder surface, MP) from d 18 to d 20, and they were provided with the PD on d 21. The other 2 treatments of chickens were either fed with the PD (PDF) or continued the mash diet (control) at 21 d of age. The results showed that replacing a mash diet with a PD decreased (P < 0.05) feed consumption. The intestinal morphology was not influenced (P > 0.05). The mRNA levels of cholecystokinin (CCK) in the jejunum were upregulated (P < 0.05) in the PD chickens. The expression of anorexia gene ghrelin, corticotropin-releasing hormone (CRH), and melanocortin receptor 4 (MCR-4) were significantly down-regulated (P < 0.05) in the hypothalamus of the MP and PDF chickens 4 h after feed replacement. The results indicated that feed replacement altered the expression of genes related to appetite in the GT and hypothalamus. Pellet changeover causes a short-term decrease in the feed intake of broilers, and feed habituation relieves the negative effects of feed replacement. INTRODUCTION Feeding a pellet diet (PD) increases weight gain and feed intake and improves the feed: gain ratio compared with feeding mash diets (Amerah et al., 2007; Serrano et al., 2013). The change of the digestive tract is one of the bird performance factors that PD feeding can improve. Feeding a PD changes the relative length and weight of the digestive tract (Amerah et al., 2007; Serrano et al., 2013). Moreover, the diet form and particle size affect the mast cell number and histamine content in the small intestine by regulating the stem cell factor concentration (Liu et al., 2006). In commercial broiler production, phase diets are formulated throughout the growing cycle of broiler chickens according to the requirements of market targets (Brewer et al., 2012a,b,c). A crumbled starter is commonly used in commercial broiler production (Choi et al., 1986) followed by pelleted grower and finisher diets. In practice, however, diet replacement of a mash or crumble starter with a pelleted grower diet results in the reduction of feed intake for a couple of d, which reduces the growth rate of chickens. In avian species, such as mammals, 2 primary populations of neurons in the hypothalamus are involved in appetite control by releasing signaling peptides, including orexigenic neuropeptides, such as neuropeptide Y (NPY) and agouti-related peptide (AgRP), and anorexigenic neuropeptides, such as pro-opiomelanocortin (POMC), amphetamine-regulated transcript (CART), corticotropin-releasing hormone (CRH), and melanocortin receptor 4 (MC4-R) (Schwartz et al., 2000; Richards, 2003). NPY can increase appetite in mammals and birds (Hahn et al., 1998; Boswell et al., 2002). Our previous study indicated that NPY is associated with glucocorticoid-induced appetite in birds (Liu et al., 2014, 2017). In contrast, CRH and CART play an inhibitory role in the regulation of feed intake in birds (Greenstein and Wood, 2006; Kaiya et al., 2009). The melanocortin system coordinates the maintenance of energy balance in mammals (Olszewski et al., 2007) and birds (Tachibana et al. 2001; Boswell and Takeuchi, 2005) through the regulation of both food intake and energy expenditure. Furthermore, many neuropeptides related to appetite control are expressed in the gastrointestinal tract (GT), e.g., ghrelin and cholecystokinin (CCK) (Richards and Proszkowiec-Weglarz, 2007). Unlike in mammals, ghrelin suppresses appetite by interacting with CRH in chickens (Saito et al., 2002, 2005). CCK is a gut peptide that has long been established as a postprandial satiety signal and an appetite suppressant in avian species (Panchanathan et al., 2006). CCK is also a potent inhibitor of gastric emptying of chickens (Martinez et al., 1993a). Hence, we hypothesized that the expression levels of genes related to appetite control may be involved in the decreased feed consumption induced by feed replacement. The changeover to pellets induces a transient reduction in feed intake (Lecuelle et al., 2010). However, early visual experience cannot reduce the transient reduction in feed intake caused by changeover from crumbles to pellets in growing turkeys (Lecuelle et al., 2011). Hence, whether the transitory suppression of feed intake due to feed replacement could be alleviated by food habituation remains to be elucidated. Two experiments were conducted to investigate the effect of replacing a mash diet with PD on food habituation and the expression of genes related to appetite in the hypothalamus and GT. To avoid the possible influence of body weight on feed consumption, we used male broilers in our experiments. Moreover, as stress, particle size and diet form could affect the morphology of the small intestine (Liu et al., 2006; Santos et al., 2015); the intestinal morphology and the enzyme activity in the intestinal tissues were tested as well. MATERIALS AND METHODS Animals One-day-old male broiler chicks (Arbor Acres) were obtained from a local hatchery (Dabao Breeding Ltd, Taian, P. R. China) and housed in an environmentally controlled room. The brooding temperature was maintained at 35°C for the first 2 d and then was gradually decreased to 21°C by d 21 and maintained as such thereafter. All chicks received a starter diet maintained at 21% crude protein and 12.3 MJ/kg of metabolizable energy (Zhao et al., 2012). The composition and nutrient levels of the experimental diets (1 to 21 d) are listed in Suppl. Table 3. Chickens were reared in floor pens (2 m × 2 m) using new rice hulls as litter. Each pen was equipped with tube feeders (the feeder space per bird was 2.5 cm) and a nipple waterline (12 birds per nipple). All birds had free access to food and water during the rearing period. The light regimen was 23 L:1 D (5 Lux), and the dark period was from 0:00 to 01:00 a.m. (Zhao et al., 2012). The study was approved by the Ethics Committee of the Shandong Agricultural University and carried out in accordance with the “Guidelines for Experimental Animals” from the Ministry of Science and Technology (Beijing, P. R. China). Experiment Design Experiment 1 Two hundred chicks were randomly allotted according to the catching order to 2 groups with 4 replicates (pens) of 25 birds each. All the birds were fed with a mash diet until 20 d of age. At 21 d of age, one group of chicks was provided with a PD (4 mm, PD), while the other group of chicks was continued on the mash diet (control) at 8:00 a.m. The mash diet has the same ingredient composition and the same nutrient concentration (mentioned above) as the PD. Feed consumption was recorded every h for the initial 8 h and was thereafter recorded at 12, 24, 48, and 72 h by weighing the tube feeder. Throughout the experimental period, the health of the experimental birds was monitored, and the dead or culled birds, if any, were removed and weighed and omitted from the feed consumption calculation. Experiment 2 Their hundred chicks were randomly allotted to 3 treatments with 4 replicates (pens) of 25 birds each. All the chickens were fed with a mash diet until 17 d of age. At 18 d of age (3 d before the normal changeover time), one treatment of birds was fed a mash diet covered with PD feed on the surface (around one-third of the feeder surface, MP) from d 18 to d 20. Starting at 8:00 a.m. (7 h after lights were turned on), the feeders were checked every 2 h to maintain the same amount of PD on the surface of the mash diet. On d 21, the chickens were provided with a PD (MP treatment) at 08:00 a.m. The other 2 treatments of chickens continued to be fed with a mash diet until 20 d old, and thereafter one group of chickens received a PD feeding (PDF) at 8:00 a.m., while another treatment of chickens continued to be fed with a mash diet (control). Feed consumption was recorded every 2 h for 24 hours. According to the feed intake data, at 6, 12, and 24 h after treatment in experiment 1 and at 6 and 24 h after treatment in experiment 2, 2 broilers of approximately mean body weight were randomly collected from each replicate. Each of the selected broilers was gently caught by the same broiler keeper to avoid stress and disturbance to the other broilers. The broilers were brought to a separate sampling room. A blood sample was obtained by drawing from a wing vein using a heparinized syringe within 30 s after the bird was caught and collected in pre-cooled tubes. Plasma was obtained after centrifugation at 400 × g for 10 min at 4°C to avoid the influence of blood cell metabolism and was stored at −20°C for the analysis of corticosterone (CORT). Immediately after the blood sample was obtained, the chicken was sacrificed by exsanguination (Close, 1997), and tissue samples were obtained. During sampling, the experimenters were divided into 2 or 3 groups to ensure that the birds from each treatment were sampled in the same time interval. Tissue samples of the proventriculus, duodenum, jejunum, and ileum were collected according to the descriptions by Awad et al. (2006) as follows: samples of the whole intestinal tract were removed, and segments of approximately 2 cm were taken from the crop near the esophageal junction, the midpoint of the proventriculus, the midpoint of the duodenum (duodenum), the midpoint between the bile duct entry and Meckel's diverticulum (jejunum), the proximal cecum, and the rectum. The hypothalamus was dissected from the ventral surface of the brain according to the method described in our previous studies (Liu et al., 2014, 2017). In brief, 2 transverse cuts were made at the apex of the optic chiasm and the rostral margin of the mammillary bodies. Next, 2-mm bilateral cuts were made on either side of the midline, and the whole hypothalamus was removed according to the method described in Kuenzel and Masson (1988) and Yuan et al. (2009). After being shock-frozen in liquid nitrogen, the tissue samples were stored at −80°C for RNA extraction. Histological Analysis The duodenum and jejunum tissues were fixed in 4% paraformaldehyde (P1110–500 mL, Solarbio, Beijing, China), embedded in paraffin, and sectioned to a thickness of 4 μm. The paraffin sections were stained with hematoxylin and eosin. The villus height (VH) and crypt depth (CD) of the duodenum and jejunum were measured using an Image-Pro Plus as described by Touchette et al. (2002), and then the VH: CD ratio (VCR) was calculated. Measurement of CORT Plasma CORT was measured using a sensitive and highly specific RIA kit (IDS Inc, Boldon, UK) with a sensitivity of 0.39 ng/mL and a low cross-reaction with aldosterone (0.20%), cortisol (0.40%), and deoxycorticosterone (3.30%). This approach has been used in a previous study (Malheiros et al., 2003). Before the assay was conducted, the plasma samples were heated to 80°C for 10 min to inactivate CORT-binding proteins. The intra-assay variability was 3.8%. Measurement of Antioxidant Enzymes The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-Px) of the duodenum were measured spectrophotometrically with commercial diagnostic kits (Jiancheng Bioengineering Institute, Nanjing, P. R. China), and this approach has been successfully used in a previous poultry study (Huang et al., 2015). RNA Isolation and Analysis The expression of genes in the hypothalamus, glandular stomach, duodenum, jejunum, and ileum was quantified using quantitative real-time polymerase chain reaction (qPCR) with SYBR Green I labeling (0,491,391,4001, Roche, Switzerland). Total RNA was isolated by the guanidinium isothiocyanate method with Trizol Reagent (15,596–026, Invitrogen, San Diego, CA). The quality of RNA after DNase treatment was tested by electrophoresis on an agarose gel, and the quantity of RNA was determined using a biophotometer (Eppendorf, Germany). Then, 1 μg of total RNA was used for reverse transcription with a PrimeScript RT reagent kit (0,489,703,0001, Roche, Switzerland) to prepare the cDNA. The primer sequences are shown in Table 1. Real-time PCR analysis was conducted using an Applied Biosystems 7500 Real-time PCR System (Applied Biosystems, Foster, CA). Each RT-reaction served as the template in a 20 μL PCR reaction volume containing 0.2 μmol/L of each primer and SYBR Green I labeling (0,491,391,4001, Roche, Switzerland). SYBR green fluorescence was detected at the end of each cycle to monitor the amount of PCR product. Real-time PCR was performed at 95°C for 10 s, followed by 40 cycles at 95°C for 5 s and 60°C for 40 seconds. SYBR green fluorescence was detected at the end of each cycle to monitor the amount of PCR product. A standard curve was plotted to calculate the efficiency of the real-time PCR primers. Table 1. Gene-specific primers used for the analysis of chicken gene expression. Gene  GenBank accession no.  Primer sequences (5΄-3΄)  Orientation  Product size (bp)  GAPDH  NM_204,305  ACATGGCATCCAAGGAGTGAG GGGGAGACAGAAGGGAACAGA  Forward reverse  266  NPY  M87294  TGCTGACTTTCGCCTTGTCG GTGATGAGGTTGATGTAGTGCC  Forward reverse  148  AgRP  NM_0,010,31457  GGAACCGCAGGCATTGTC GTAGCAGAAGGCGTTGAAGAA  Forward reverse  163  CRH  NM_0,011,23031  CTCCCTGGACCTGACTTTCC TGTTGCTGTGGGCTTGCT  Forward reverse  86  Ghrelin  AB075215  CCTTGGGACAGAAACTGCTC CACCAATTTCAAAAGGAACG  Forward reverse  203  POMC  NM_0,010,31098  CGCTACGGCGGCTTCA TCTTGTAGGCGCTTTTGACGAT  Forward reverse  88  CART  BI394769  CCGCACTACGAGAAGAAG AGGCACTTGAGA AGA AAGG  Forward reverse  146  CCK  NM_0,010,01741  GATGGCAGCTTCGAGCAGAG GTCATTTATCCTGTGTGGGATCA  Forward reverse  141  MCR-4  XM426042  ACACTCCAGCCTCTCCATTTCT TGTTCATAGCAGCCTCCCGA  Forward reverse  101  Gene  GenBank accession no.  Primer sequences (5΄-3΄)  Orientation  Product size (bp)  GAPDH  NM_204,305  ACATGGCATCCAAGGAGTGAG GGGGAGACAGAAGGGAACAGA  Forward reverse  266  NPY  M87294  TGCTGACTTTCGCCTTGTCG GTGATGAGGTTGATGTAGTGCC  Forward reverse  148  AgRP  NM_0,010,31457  GGAACCGCAGGCATTGTC GTAGCAGAAGGCGTTGAAGAA  Forward reverse  163  CRH  NM_0,011,23031  CTCCCTGGACCTGACTTTCC TGTTGCTGTGGGCTTGCT  Forward reverse  86  Ghrelin  AB075215  CCTTGGGACAGAAACTGCTC CACCAATTTCAAAAGGAACG  Forward reverse  203  POMC  NM_0,010,31098  CGCTACGGCGGCTTCA TCTTGTAGGCGCTTTTGACGAT  Forward reverse  88  CART  BI394769  CCGCACTACGAGAAGAAG AGGCACTTGAGA AGA AAGG  Forward reverse  146  CCK  NM_0,010,01741  GATGGCAGCTTCGAGCAGAG GTCATTTATCCTGTGTGGGATCA  Forward reverse  141  MCR-4  XM426042  ACACTCCAGCCTCTCCATTTCT TGTTCATAGCAGCCTCCCGA  Forward reverse  101  View Large The relative amount of mRNA of a gene was calculated according to the method of Livak and Schmittgen (2001). The mRNA levels of these genes were normalized to glyceraldehydes-3-phosphate dehydrogenase (GAPDH) levels (ΔCT). The ΔCT was calibrated against an average of the control chickens. The linear amount of target molecules relative to the calibrator was calculated by 2−ΔΔCT. Therefore, all gene transcription results are reported as the n-fold difference relative to the calibrator. The specificity of the amplification product was verified by the standard curve and dissolution curve. Statistical Analysis Data are presented as the means ± standard error of the mean (SEM). The homogeneity and normal distribution plots of variances among the treatments were confirmed using Bartlett's test. For the feed intake variable, a one-way ANOVA model was used to estimate the main effect of feeding treatment on a per-pen basis (SAS version 8e, SAS Institute, 1998). For the variables gene expression, enzymatic activity, and plasma corticosterone, a one-way ANOVA model was used to estimate the main effect of feeding treatment for individual broiler. For the data in experiment 2, when the main effect of the feeding treatment was significant, multiple comparisons were conducted by Duncan's multiple range analysis. P < 0.05 was considered statistically significant. RESULTS Experiment 1 The replacement of mash with a pelleted diet significantly decreased feed intake (P < 0.05) during the initial 5 h, and thereafter there was no significant difference between the PD and control group, though the trend was remained at 24 h (P > 0.05, Figure 1). The mRNA expression of ghrelin in the proventriculus (Figure 2A) was slightly increased in the PD treatment 6, 12, and 24 h after treatment compared to the control ones, and the difference was significant only 12 h after treatment. The mRNA level of CCK was not different between the PD treatment and control in the proventriculus or GT at 6 h (Figure 2B). A significant increase (P = 0.014) in CCK mRNA in the jejunum was found in our result 12 h after the PD treatment (Figure 2C), whereas no difference between PD treatment and control in CCK expression in the proventriculus and GT was observed at 24 h (Figure 2D). Figure 1. View largeDownload slide Effect of pellet diet (PD) and mash diet (control) on cumulative feed intake of 21-day-old male broilers 1 to 72 h after replacement of mash with pellets. Data were presented as the mean ± SEM (error bars, n = 4); *: 1 h: P < 0.0001 (F1,6 = 162.47); 2 h: P = 0.002 (F1,6 = 28.26); 3 h: P = 0.011 (F1,6 = 13.29); 4 h: P = 0.026 (F1,6 = 8.68); 5 h: P = 0.040 (F1,6 = 6.87). The F values at other time points are as follows: 6 h: P = 0.052 (F1,6 = 5.85); 7 h: P = 0.080 (F1,6 = 4.42); 8 h: P = 0.091 (F1,6 = 4.05); 12 h: P = 0.051 (F1,6 = 5.93). Figure 1. View largeDownload slide Effect of pellet diet (PD) and mash diet (control) on cumulative feed intake of 21-day-old male broilers 1 to 72 h after replacement of mash with pellets. Data were presented as the mean ± SEM (error bars, n = 4); *: 1 h: P < 0.0001 (F1,6 = 162.47); 2 h: P = 0.002 (F1,6 = 28.26); 3 h: P = 0.011 (F1,6 = 13.29); 4 h: P = 0.026 (F1,6 = 8.68); 5 h: P = 0.040 (F1,6 = 6.87). The F values at other time points are as follows: 6 h: P = 0.052 (F1,6 = 5.85); 7 h: P = 0.080 (F1,6 = 4.42); 8 h: P = 0.091 (F1,6 = 4.05); 12 h: P = 0.051 (F1,6 = 5.93). Figure 2. View largeDownload slide Effect of pellet diet (PD) and mash diet (control) on the transcriptional levels of ghrelin (A) in proventriculus and cholecystokinin (CCK) in proventriculus and gastrointestinal tract (GT) of 21-day-old male broilers 6, 12, and 24 h after replacement of mash with pellets. Data were presented as the mean ± SEM (error bars, n = 6); *: P = 0.014 (F1,10 = 9.91). Figure 2. View largeDownload slide Effect of pellet diet (PD) and mash diet (control) on the transcriptional levels of ghrelin (A) in proventriculus and cholecystokinin (CCK) in proventriculus and gastrointestinal tract (GT) of 21-day-old male broilers 6, 12, and 24 h after replacement of mash with pellets. Data were presented as the mean ± SEM (error bars, n = 6); *: P = 0.014 (F1,10 = 9.91). The PD treatment had no significant influence (P > 0.05) on the VH, CD, or VCR in the duodenum and jejunum or the activities of SOD, CAT or GSH-Px in the duodenum after 24 h of feeding (Suppl. Table 1, 2). Experiment 2 Compared with the control, the PDF chickens consumed significantly (P < 0.05) less feed during the 24 h after the feed changeover (Figure 3). The MP chickens, however, consumed a similar amount of feed as the PDF chickens (P > 0.05) during the first 4 h after feed replacement and thereafter consumed significantly (P < 0.05) more feed than the PDF chickens, except at 12 h (P = 0.006). After 12 of h of treatment, there was no difference in feed consumption between the MP and the control group fed with the mash diet (P > 0.05). Figure 3. View largeDownload slide Effect of replacing mash diet (control) with pellet diet with (MP) or without (PDF) a 3-day habituation period on cumulative feed intake after feed changeover of broilers from 2 to 24 h after treatment. Data were presented as the mean ± SEM (error bars, n = 4); a-c: 2 h: P < 0.0001 (F2,9 = 101.29); 4 h: P < 0.0001 (F2,9 = 77.71); 6 h: P < 0.0001 (F2,9 = 57.66); 8 h: P < 0.0001 (F2,9 = 30.45); 12 h: P = 0.006 (F2,9 = 9.60); 24 h: P = 0.060 (F2,9 = 3.91). Figure 3. View largeDownload slide Effect of replacing mash diet (control) with pellet diet with (MP) or without (PDF) a 3-day habituation period on cumulative feed intake after feed changeover of broilers from 2 to 24 h after treatment. Data were presented as the mean ± SEM (error bars, n = 4); a-c: 2 h: P < 0.0001 (F2,9 = 101.29); 4 h: P < 0.0001 (F2,9 = 77.71); 6 h: P < 0.0001 (F2,9 = 57.66); 8 h: P < 0.0001 (F2,9 = 30.45); 12 h: P = 0.006 (F2,9 = 9.60); 24 h: P = 0.060 (F2,9 = 3.91). Compared with that in the control group, the mRNA level of AgRP was significantly upregulated in MP chickens at 6 h after treatment (Figure 4A). In contrast, the mRNA expressions of ghrelin (P = 0.040), CRH (P = 0.003), and MC4-R (P = 0.004) were significantly down-regulated in both the PDF and MP chickens compared to the control (Figure 4B). There was no detectable difference (P > 0.05) between the PDF and MP groups in the gene expression of all the investigated genes. We further determined the transcriptional levels of CRH, MC4-R, and AgRP at 24 h, and the results showed clear changes at 6 h after treatment. The results showed that the AgRP mRNA level was lower in the PDF chickens compared with the control group (P = 0.054), whereas there was no difference between the MP and PDF or MP and control group chickens (P > 0.05). There was no difference in the expression of CRH (P = 0.670) or MC4-R (P = 0.116) among the 3 treatments (Figure 4C). Figure 4. View largeDownload slide Effect of replacing mash diet (control) with pellet diet with (MP) or without (PDF) a 3-day habituation period on the transcriptional levels of neuropeptide Y (NPY), pro-opiomelanocortin (POMC), cocaine- and amphetamine-regulated transcript (CART) and agouti-related peptide (AgRP) (A) at 6 h; ghrelin, corticotropin-releasing hormone (CRH) and melanocortin receptor 4 (MC4-R) (B) at 6 h; and CRH, MC4R and AgRP (C) at 24 h in hypothalamus of male broilers after feed changeover. Data were presented as the mean ± SEM (error bars, n = 6); *: 6 h: AgRP: P = 0.044 (F2,15 = 5.49); ghrelin: Control vs. MP: P = 0.052 (F1,10 = 5.20), Control vs. PDF: P = 0.046 (F1,10 = 5.36); CRH: Control vs. MP: P = 0.006 (F1,10 = 13.06), Control vs. PDF: P = 0.041 (F1,10 = 5.68); MC4R: Control vs. MP: P = 0.004 (F1,10 = 14.44), Control vs. PDF: P = 0.037 (F1,10 = 5.98); AgRP: Control vs. PDF: P = 0.016 (F1,10 = 9.87). Figure 4. View largeDownload slide Effect of replacing mash diet (control) with pellet diet with (MP) or without (PDF) a 3-day habituation period on the transcriptional levels of neuropeptide Y (NPY), pro-opiomelanocortin (POMC), cocaine- and amphetamine-regulated transcript (CART) and agouti-related peptide (AgRP) (A) at 6 h; ghrelin, corticotropin-releasing hormone (CRH) and melanocortin receptor 4 (MC4-R) (B) at 6 h; and CRH, MC4R and AgRP (C) at 24 h in hypothalamus of male broilers after feed changeover. Data were presented as the mean ± SEM (error bars, n = 6); *: 6 h: AgRP: P = 0.044 (F2,15 = 5.49); ghrelin: Control vs. MP: P = 0.052 (F1,10 = 5.20), Control vs. PDF: P = 0.046 (F1,10 = 5.36); CRH: Control vs. MP: P = 0.006 (F1,10 = 13.06), Control vs. PDF: P = 0.041 (F1,10 = 5.68); MC4R: Control vs. MP: P = 0.004 (F1,10 = 14.44), Control vs. PDF: P = 0.037 (F1,10 = 5.98); AgRP: Control vs. PDF: P = 0.016 (F1,10 = 9.87). At 6 h, the mRNA level of ghrelin in the proventriculus was significantly increased (P = 0.012) in the PDF treatment group compared with either the control or MP chickens (Figure 5A). In contrast, no significant difference was detected at 24 h after treatment (P = 0.758, Figure 5B). Figure 5. View largeDownload slide Effect of replacing mash diet (control) with pellet diet with (MP) or without (PDF) a 3-day habituation period on the transcriptional level of ghrelin at 6 h (A) and 24 h (B) after feed changeover in proventriculus of broilers. Data were presented as the mean ± SEM (error bars, n = 6); *: 6 h: Ghrelin: MP vs. PDF: P = 0.020 (F1,10 = 8.43), PDF vs. Control: P = 0.044 (F1,10 = 5.30). Figure 5. View largeDownload slide Effect of replacing mash diet (control) with pellet diet with (MP) or without (PDF) a 3-day habituation period on the transcriptional level of ghrelin at 6 h (A) and 24 h (B) after feed changeover in proventriculus of broilers. Data were presented as the mean ± SEM (error bars, n = 6); *: 6 h: Ghrelin: MP vs. PDF: P = 0.020 (F1,10 = 8.43), PDF vs. Control: P = 0.044 (F1,10 = 5.30). Compared to the control, plasma concentrations of CORT were influenced by MP (+152.7%) or PDF treatment (+74.7%, Figure 6). However, this effect was not significant and exhibited a larger variance (MP, 23.7%; PD, 38.9%). Figure 6. View largeDownload slide Effects of replacing mash diet (control) with (MF) or without (PDF) a 3-day habituation period on plasma concentrations of corticosterone (nmol/L) of broilers at 6 h after feed changeover. Data were presented as the means ± SEM (error bars, n = 6). Figure 6. View largeDownload slide Effects of replacing mash diet (control) with (MF) or without (PDF) a 3-day habituation period on plasma concentrations of corticosterone (nmol/L) of broilers at 6 h after feed changeover. Data were presented as the means ± SEM (error bars, n = 6). DISCUSSION Gastrointestinal Appetite-Regulating Peptides Involved in the Suppressed Feed Intake Induced by Feed Replacement Feeding a PD improves the growth performance and feed conversion ratio of broilers (Engberg et al., 2002; McKinney and Teeter, 2004; Svihus et al., 2004). However, the diet replacement of a mash or a crumble starter with a pellet grower at 21 d of age usually causes decreased feed consumption, and in turn, impaired growth performance (Serrano et al., 2012). In the present study, 2 experiments were conducted and indicated that the transition from a mash diet to a PD significantly decreased the feed consumption of broilers. As the dietary ingredients may influence the feed intake of broilers (Toghyani et al., 2016), the same basal diet was used to prepare the mash and PD used in this study. Hence, the abrupt feed changeover seems to be at least partially responsible for the decreased feed consumption in PD feeding chickens. The decrease in feed intake following the transition from mash to pellets may be caused by the unfavorable physical stimulation of the GT. The particle size and diet form affect the mast cell number and histamine content in the small intestine (Liu et al., 2006), suggesting that feed structure affects intestinal function in broiler chickens. Acute stress (feed withdrawal or heat stress) can cause changes in the intestinal epithelial structure and oxidative damage (Burkholder et al., 2008). In experiment 1, we first investigated the morphology of the duodenum and jejunum at 24 h after feed replacement. In the present study, VH, CD, and VCR were not changed by feed replacement. In heat stress-challenged broilers, villus denudation and crypt damage were observed simultaneously with an increase in glutathione peroxidase activity and a decreased antioxidant capacity (Santos et al., 2015). Hence, we further determined the activity of antioxidant enzymes. The unchanged SOD, CAT, and GSH-Px in the duodenum indicated that oxidative stress was not induced by feed replacement. Therefore, the result suggests that sudden replacement of a mash diet with PD had no direct harmful influence on intestinal morphology. We further investigated the expression of genes related to appetite control in the GT. It is well known that there are ghrelin immuno-positive cells in the hypothalamus and GT of birds (Ahmed and Harvey, 2002; Wada et al., 2003; Neglia et al., 2004, 2005; Yamato et al., 2005). Chicken ghrelin, a peptide with 26 amino acids, is predominantly expressed in the proventriculus and is absent in the gizzard (Kaiya et al., 2002). Contrary to the orectic effect in mammals, ghrelin functions as an anorexia factor in chicken. Both intracerebroventricular (i.c.v.) and peripheral injection of ghrelin inhibits feed intake in chicks (Furuse et al., 2001; Saito et al., 2002; Geelissen et al., 2005; Saito et al., 2005) and Japanese quail (Shousha et al., 2005). In the present study, pellet-fed chickens had higher mRNA levels of ghrelin in the proventriculus at 12 h after feed replacement. This result coincided with the trend of reduced feed intake of PD chickens at 12 h after feed replacement. This result was also in line with previous results indicating that the ghrelin mRNA levels in the proventriculus were significantly increased by fasting (Chen et al., 2007; Kaiya et al., 2007). Hence, the upregulated ghrelin expression seemed to be the result of reduced feed consumption. This speculation is supported by the observation that there was no detectable difference in ghrelin mRNA levels between the PD and control chickens at 24 h after feed replacement when the feed consumption was matched in PD chickens against the controls. CCK was the first gut hormone found to reduce food intake in rats (Gibbs et al., 1973). Intraperitoneal or i.c.v. injection of CCK decreased feed intake in chicks (Savory and Gentle, 1983; Tachibana et al., 2012). Meanwhile, CCK is also known as a potent inhibitor of gastric emptying of chickens (Martinez et al., 1993a,b). In the present study, the upregulation of CCK gene expression in the jejunum at 12 h in the PD chickens indicated that CCK may be involved in suppressed feed consumption due to PD feeding. In the modern line of broilers, the suppressive effect of CCK on appetite is weakened in the fast-growing strains of chickens compared to the relatively slow-growing strains of chickens (Dunn et al., 2013). Hence, the present result also may imply that feed replacement potentially reduced feed consumption by suppressing gastric emptying. Feed Habituation Attenuates the Reduced Feed Consumption Induced by Feed Replacement In previous studies, the reduced feed intake by feed changeover from crumble to pellet could not be alleviated by early visual experience (Lecuelle et al., 2010, 2011). In this study, we hypothesized that the novel feeding type could alleviate the unfavorable effects caused by feed replacement. In the present study, MP chickens had a 3-day acclimation period, and the feeder was scattered with pellets over the surface of mash diet (approximately 30%) and kept as such for 3 days. The MP chickens consumed more feed than the PDF chickens after feed replacement; the difference between the treatments was significant only from 6 h onwards. Moreover, the cumulative feed consumption showed no significant difference between the MP and control chickens at 24 h after treatment. The results suggest that MP improves the consumption of a PD after feed replacement. NPY is a very potent orexigenic peptide in mammals (Hanson and Dallman, 1995) and in birds (Kuenzel et al., 1987). As an antagonist of MC4-R, AgRP plays a similar role as NPY in regulating appetite (Tachibana et al., 2001; Boswell et al., 2002). I.c.v. injection of AgRP attenuates the anorexigenic effect of the alpha-melanocyte-stimulating hormone in neonatal broilers and layer-type chicks (Tachibana et al., 2001). In the present study, the expression of NPY was unaltered, and a significant increase in AgRP mRNA was found, which implies that the MP chickens have higher appetites compared with the control chickens. In contrast, there was no clear difference between the PDF and MP chickens in terms of NPY and AgRP gene expressions. The role of orexigenic genes in suppressed food consumption due to feed changeover needs to be investigated further. CART plays an inhibitory role in the regulation of feed intake in birds when injected centrally (Tachibana et al., 2003). The melanocortin system coordinates the maintenance of energy balance in mammals (Olszewski et al., 2007) and birds (Tachibana et al., 2001; Boswell and Takeuchi, 2005). In the present study, the gene expression of POMC and CART was not altered, while the expression of the ghrelin, CRH, and MC4-R genes was down-regulated in both the PDF and MP chickens compared with the control group, suggesting that anorexigenic genes are not associated with inhibited feed consumption. Moreover, although MP treatment improved pellet diet consumption, there was no detectable difference in the appetite-related genes between the MP and PDF chickens. The results indicate that a 3-day acclimation period to PD ameliorated feed consumption without significantly altering the expression of appetite-regulating genes, suggesting that hypothalamic appetite-related genes are not responsible for the suppressed feed consumption due to PD changeover. Ghrelin has an anorexigenic effect when injected intracerebroventricularly (Saito et al., 2002). In mammals, it has been suggested that the orexigenic effect of ghrelin is mediated via NPY/AgRP-containing neurons in the arcuate nucleus (ARC) of the hypothalamus (Luquet and Magnan, 2009). In birds, however, centrally injected ghrelin inhibits feed intake by interacting with the endogenous CRH (Saito et al., 2005). In the present study, there was a similar trend in the expression of CRH and ghrelin in the hypothalamus, both of which were down-regulated in the MP and PDF chickens at 6 h after treatment compared with the control group, suggesting their coincident influences on the appetites of PDF and MP chickens. Thereafter, we investigated the gene expression in the GT. In contrast to that in the hypothalamus, the upregulated expression of ghrelin in the proventriculus of the PDF chickens at 6 h after treatment was in line with the result in experiment 1, indicating the relative starvation in PDF chickens compared with the MP and control chickens. This effect was not observed at 24 h, although the PDF chickens still consumed less feed compared to the MP and control chickens. Taken together, the results suggest that appetite-related genes play a less important role in suppressed food consumption due to feed replacement. We further determined the circulating CORT level. The unaffected CORT level in the PDF and MP chickens compared to the controls may indicate that feed replacement cannot evoke a significant stress response. The elevated secretion of CORT can trigger behavioral responses, and there is a clear glucocorticoid response when Japanese quail are subjected to the presentation of a novel object (Richard et al., 2008). In contrast, novel objects cause no significant glucocorticoid response in European starlings (Apfelbeck and Raess, 2008). The relationship between physiological stress response and behavioral response to novelty is a complex network (Lendvai et al., 2011). However, when the novel object was placed over the food dishes, birds approached their dishes more slowly once exposed to a novel object, even though a stress response was not evoked (Fischer et al., 2016). In summary, the results indicated that feed replacement transitorily suppressed the anorexigenic genes ghrelin, CRH, and MC4-R in the hypothalamus and upregulated ghrelin expression in the proventriculus. Pellet changeover causes a short-term decrease in feed intake, and feed habituation facilitates a dietary change from mash to pellets. SUPPLEMENTARY DATA Supplementary data are available at Poultry Science online. Suppl. Table 1. Effect of pellet diet (PD) and mash diet (control) on the villus height (VH), crypt depth (CD), and VH: CD ratio (VCR) in the duodenum and jejunum of 21-day-old male broilers 24 h after replacement of mash with pellets. Suppl. Table 2. Effects of pellet diet (PD) and mash diet (control) on duodenum enzyme activity of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-PX) of male broilers 24 h after treatment. Suppl. Table 3. The composition and nutrient levels of the experimental diets (1 to 21 d). ACKNOWLEDGEMENTS This research was supported by funds earmarked for the Modern Agro-industry Technology Research System, National Natural Science Foundation of China (No. 31072045 and 31172226), Agricultural Engineering Program of Improved Variety Breeding in Shandong Province and the Taishan Scholars Program (No. 201511023). The authors declare that they have no conflicts of interest. We greatly thank the reviewers for their valuable comments and suggestions on the paper. REFERENCES Ahmed S., Harvey S.. 2002. Ghrelin: A hypothalamic GH-releasing factor in domestic fowl (Gallus domesticus). J. Endocrinol . 172: 117– 125. Google Scholar CrossRef Search ADS PubMed  Amerah A. M., Ravindran V., Lentle R. G., Thomas D. G.. 2007. Influence of feed particle size and feed form on the performance, energy utilization, digestive tract development, and digesta parameters of broiler starters. Poult. Sci.  86: 2615– 2623. Google Scholar CrossRef Search ADS PubMed  Apfelbeck B., Raess M.. 2008. Behavioural and hormonal effects of social isolation and neophobia in a gregarious bird species, the European starling (Sturnus vulgaris). Horm. Behav . 54: 435– 441. Google Scholar CrossRef Search ADS PubMed  Awad W. A., Böhm J., Razzazi-Fazeli E., Ghareeb K., Zentek J.. 2006. Effect of addition of a probiotic microorganism to broiler diets contaminated with deoxynivalenolon performance and histological alterations of histological alterations of intestinal villi of broiler chickens. Poult. Sci.  85: 974– 979. Google Scholar CrossRef Search ADS PubMed  Boswell T., Takeuchi S.. 2005. Recent developments in our understanding of the avian melanocortin system: Its involvement in the regulation of pigmentation and energy homeostasis. Peptides . 26: 1733– 1743. Google Scholar CrossRef Search ADS PubMed  Boswell T., Li Q., Takeuchi S.. 2002. Neurons expressing neuropeptide Y mRNA in the infundibular hypothalamus of Japanese quail are activated by fasting and co-express agouti-related protein mRNA. Brain. Res. Mol. Brain. Res . 100: 31– 42. Google Scholar CrossRef Search ADS PubMed  Brewer V. B., Emmert J. L., Meullenet J. F., Owens C. M.. 2012a. Small bird programs: Effect of phase-feeding, strain, sex, and debone time on meat quality of broilers. Poult. Sci . 91: 499– 504. Google Scholar CrossRef Search ADS   Brewer V. B., Owens C. M., Emmert J. L.. 2012b. Phase feeding in a big-bird production scenario: Effect on growth performance, yield, and fillet dimension. Poult. Sci . 91: 1256– 1261. Google Scholar CrossRef Search ADS   Brewer V. B., Owens C. M., Emmert J. L.. 2012c. Phase feeding in a small-bird production scenario: Effect on growth performance, yield, and fillet dimension. Poult. Sci . 91: 1262– 1268. Google Scholar CrossRef Search ADS   Burkholder K. M., Thompson K. L., Einstein M. E., Applegate T. J., Patterson J. A.. 2008. Influence of stressors on normal intestinal microbiota, intestinal morphology, and susceptibility to salmonella enteritidis colonization in broilers. Poult. Sci.  87: 1734– 1741. Google Scholar CrossRef Search ADS PubMed  Chen L. L., Jiang Q. Y., Zhu X. T., Shu G., Bin Y. F., Wang X. Q., Gao P., Zhang Y. L.. 2007. Ghrelin ligand-receptor mRNA expression in hypothalamus, proventriculus and liver of chicken (Gallus gallus domesticus): studies on ontogeny and feeding condition. Comp. Biochem. Physiol. A. Mol. Integr. Physiol.  147: 893– 902. Google Scholar CrossRef Search ADS PubMed  Choi J. H., So B. S., Ryu K. S., Kang S. L.. 1986. Effects of pelleted or crumbled diets on the performance and the development of the digestive organs of broilers. Poult. Sci.  65: 594– 597. Google Scholar CrossRef Search ADS PubMed  Close T. J. 1997. Dehydrins: A commonalty in the response of plants to dehydration and low temperature. Physiol. Plant.  100: 291– 296. Google Scholar CrossRef Search ADS   Dunn I. C., Meddle S. L., Wilson P. W., Wardle C. A., Law A. S., Bishop V. R., Hindar C., Robertson G. W., Burt D. W., Ellison S. J., Morrice D. M., Hocking P. M.. 2013. Decreased expression of the satiety signal receptor CCKAR is responsible for increased growth and body weight during the domestication of chickens. Am. J. Physiol. Endocrinol. Metab.  304: E909– 21. Google Scholar CrossRef Search ADS PubMed  Engberg R. M., Hedemann M. S., Jensen B. B.. 2002. The influence of grinding and pelleting of feed on the microbial composition and activity in the digestive tract of broiler chickens. Br. Poult. Sci.  43: 569– 579. Google Scholar CrossRef Search ADS PubMed  Fischer C. P., Franco L. A., Romero L. M.. 2016. Are novel objects perceived as stressful? The effect of novelty on heart rate. Physiol. Behav.  161: 7– 14. Google Scholar CrossRef Search ADS PubMed  Furuse M., Tachibana T., Ohgushi A., Ando R., Yoshimatsu T., Denbow D. M.. 2001. Intracerebroventricular injection of ghrelin and growth hormone releasing factor inhibits food intake in neonatal chicks. Neurosci. Lett.  301: 123– 126. Google Scholar CrossRef Search ADS PubMed  Geelissen S. M. E., Geelissen S. M. E., Swennen Q., Geyten Van der S., Kuhn E. R., Kaiya H., Kangawa K., Decuypere E., Buyse J., Darras V. M.. 2005. Peripheral ghrelin reduces food intake and respiratory quotient in chicken. Domes. Anim. Endocrinol.  30: 108– 116. Google Scholar CrossRef Search ADS   Gibbs J., Young R. C., Smith G. P.. 1973. Cholecystokinin decreases food intake in rats. J. Comp. Physiol. Psychol.  84: 488– 495. Google Scholar CrossRef Search ADS PubMed  Greenstein B., Wood D.. 2006. The endocrine system at a glance , 2th ed. Unipart House, Garsington Road, Cowley. Oxford, OX 2PG, UK. Hahn T. M., Breininger J. F., Baskin D. G., Schwartz M. W.. 1998. Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons. Nat. Neurosci . 1: 271– 272. Google Scholar CrossRef Search ADS PubMed  Hanson E. S., Dallman M. F.. 1995. Neuropeptide Y (NPY) may integrate responses of hypothalamic feeding systems and the hypothalamo-pituitary- adrenal axis. Neuroendocrinol . 7: 273– 279. Google Scholar CrossRef Search ADS   Huang C., Jiao H., Song Z., Zhao J., Wang X., Lin H.. 2015. Heat stress impairs mitochondria functions and induces oxidative injury in broiler chickens. J. Anim. Sci.  93: 2144– 2153. Google Scholar CrossRef Search ADS PubMed  Kaiya H., Furuse M., Miyazato M., Kangawa K.. 2009. Current knowledge of the roles of ghrelin in regulating food intake and energy balance in birds. Gen. Comp. Endocrinol.  163: 33– 38. Google Scholar CrossRef Search ADS PubMed  Kaiya H., Saito E. S., Tachibana T., Furuse M., Kangawa K.. 2007. Changes in ghrelin levels of plasma and proventriculus and ghrelin mRNA of proventriculus in fasted and refed layer chicks. Domest. Anim. Endocrinol.  32: 247– 259. Google Scholar CrossRef Search ADS PubMed  Kaiya H., Van der Geyten S., Kojima M., Hosoda H., Kitajimam Y., Matsumoto M., Geelissen S., Darras V. M., Kangawa K.. 2002. Chicken ghrelin: puriWcation cDNA cloning and biological activity. Endocrinology . 143: 3454– 3463. Google Scholar CrossRef Search ADS PubMed  Kuenzel W. J., Masson M.. 1988. A Stereotaxic Atlas of the Brain of the Chick (Gallus domesticus) . Johns Hopkins University Press, Baltimore, MD. Kuenzel W. J., Douglass L. W., Davison B. A.. 1987. Robust feeding following central administration of neuropeptide Y or peptide YY in chicks, Gallus domesticus. Peptides . 8: 823– 828. Google Scholar CrossRef Search ADS PubMed  Lecuelle S., Bouvarel I., Chagneau A. M., Laviron F., Lescoat P., Leterrier C.. 2010. Feeding behaviour in turkeys with a change-over from crumbs to pellets. Appl. Anim. Behav. Sci.  125: 132– 142. Google Scholar CrossRef Search ADS   Lecuelle S., Bouvarel I., Chagneau A. M., Laviron F., Lescoat P., Leterrier C.. 2011. Early visual experience of food does not appear to reduce subsequent feed neophobia in turkeys. Poult. Sci.  90: 1– 9. Google Scholar CrossRef Search ADS PubMed  Lendvai A. Z., Bokony V., Chastel O.. 2011. Coping with novelty and stress in free-living house sparrows. J. Exp. Biol.  214: 821– 828. Google Scholar CrossRef Search ADS PubMed  Liu L., Song Z., Jiao H., Lin H.. 2014. Glucocorticoids increase NPY gene expression via hypothalamic AMPK signaling in broiler chicks. Endocrinology . 155: 2190– 2198. Google Scholar CrossRef Search ADS PubMed  Liu L., Wang X., Jiao H., Lin H.. 2017. Glucocorticoids induced high fat diet preference via activating hypothalamic AMPK signaling in chicks. Gen. Comp. Endocrinol . pii: S0016-6480: 30409– 30409. Liu Y. H., Piao X. S., Ou D. Y., Cao Y. H., Huang D. S., Li D. F.. 2006. Effects of particle size and physical form of diets on mast cell numbers, histamine, and stem cell factor concentration in the small intestine of broiler chickens. Poult. Sci.  85: 2149– 2155. Google Scholar CrossRef Search ADS PubMed  Livak K. J., Schmittgen T. D.. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods . 25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Luquet S., Magnan C.. 2009. The central nervous system at the core of the regulation of energy homeostasis. Front. Biosci.  1: 448– 465. Google Scholar CrossRef Search ADS   Malheiros R. D., Moraes V. M., Collin A., Decuypere E., Buyse J.. 2003. Free diet selection by broilers as influenced by dietary macronutrient ratio and corticosterone supplementation. 1. Diet selection, organ weights, and plasma metabolites. Poult. Sci.  82: 123– 131. Google Scholar CrossRef Search ADS PubMed  Martinez V., Jiménez M., Goñalons E., Vergara P.. 1993. Effects of cholecystokinin and gastrin on gastroduodenal motility and coordination in chickens. Life. Sci.  52: 191– 198. Google Scholar CrossRef Search ADS PubMed  Martinez V., Jimenez M., Goñalons E., Vergara P.. 1993. Mechanism of action of CCK in avian gastroduodenal motility: evidence for nitric oxide involvement. Am. J. Physiol.  265: 842– 850. Google Scholar CrossRef Search ADS   McKinney L. J., Teeter R. G.. 2004. Predicting effective caloric value of non-nutritive factors: I. Pellet quality and II. Prediction of consequential formulation dead zones. Poult. Sci.  83: 1165– 1174. Google Scholar CrossRef Search ADS PubMed  Neglia S., Arcamone N., Esposito V., Gargiulo G., de Girolamo P.. 2005. Presence and distribution of ghrelin-immunopositive cells in the chicken gastrointestinal tract. Acta. Histochem.  107: 3– 9. Google Scholar CrossRef Search ADS PubMed  Neglia S., Arcamone N., Esposito V., Gargiulo G.. 2004. Ghrelin in the gatroenteric tract of birds: Immunoreactivity expression. Vet. Res. Commun.  28: 213– 215. Google Scholar CrossRef Search ADS PubMed  Olszewski P. K., Bomberg E. M., Grace M. K., Levine A. S.. 2007. Alpha-melanocyte stimulating hormone and ghrelin: central interaction in feeding control. Peptides . 28: 2084– 2089. Google Scholar CrossRef Search ADS PubMed  Panchanathan V., Chaudhri G., Karupiah G.. 2006. Protective immunity against secondary poxvirus infection is dependent on antibody but not on CD4 or CD8 T-cell function. J. Virol.  80: 6333– 6338. Google Scholar CrossRef Search ADS PubMed  Richards M. P., Proszkowiec-Weglarz M.. 2007. Mechanisms regulating feed intake, energy expenditure and body weight in poultry. Poult. Sci . 86: 1478– 1490. Google Scholar CrossRef Search ADS PubMed  Richard S., Wacrenier-Cere N., Hazard D., Saint-Dizier H., Arnould C., Faure J. M.. 2008. Behavioural and endocrine fear responses in Japanese quail upon presentation of a novel object in the home cage. Behav. Process.  77: 313– 319. Google Scholar CrossRef Search ADS   Richards M. P. 2003. Genetic regulation of feed intake and energy balance in poultry. Poult. Sci . 82: 907– 916. Google Scholar CrossRef Search ADS PubMed  Saito E. S., Kaiya H., Tachibana T., Tomonaga S., Denbow D. M., Kangawa K., Furuse M.. 2005. Inhibitory eVect of ghrelin on food intake is mediated by the corticotrophin-releasing factor system in neonatal chicks. Regul. peptides.  125: 201– 208. Google Scholar CrossRef Search ADS   Saito E. S., Kaiya H., Takagi T., Yamasaki I., Denbow D. M., Kangawa K., Furuse M.. 2002. Chicken ghrelin and growth hormone-releasing peptide-2 inhibit food intake of neonatal chicks. Eur. J. Pharmacol.  453: 75– 79. Google Scholar CrossRef Search ADS PubMed  Santos R. R., Awati A., Roubos-van den Hil P. J., Tersteeg-Zijderveld M. H., Koolmees P. A., Fink-Gremmels J.. 2015. Quantitative histo-morphometric analysis of heat-stress-related damage in the small intestines of broiler chickens. Avian. Pathol.  44: 19– 22. Google Scholar CrossRef Search ADS PubMed  SAS Institute. 1998. User's Guide: Statistics . SAS Inst. Inc., Cary, NC. Savory C. J., Gentle M. J.. 1983. Effects of food deprivation, strain, diet and age on feeding responses of fowls to intravenous injections of cholecystokinin. Appetite . 4: 165– 176. Google Scholar CrossRef Search ADS PubMed  Schwartz M. W., Woods S. C., Porte D., Seeley R. J. Jr., Baskin D. G.. 2000. Central nervous system control of food intake. Nature . 404: 661– 671. Google Scholar CrossRef Search ADS PubMed  Serrano M. P., Valencia D. G., Méndez J., Mateos G. G.. 2012. Influence of feed form and source of soybean meal of the diet on growth performance of broilers from 1 to 42 days of age. 1. Floor pen study. Poult. Sci.  91: 2838– 2844. Google Scholar CrossRef Search ADS PubMed  Serrano M. P., Frikha M., Corchero J., Mateos G. G.. 2013. Influence of feed form and source of soybean meal on growth performance, nutrient retention, and digestive organ size of broilers. 2. Battery study. Poult. Sci.  92: 693– 708. Google Scholar CrossRef Search ADS PubMed  Shousha S., Nakahara K., Kojima M., Miyazato M., Hosoda H., Kangawa K., Murakami N.. 2005. Different effects of peripheral and central ghrelin on regulation of food intake in the Japanese quail. Gen. Comp. Endocrinol.  141: 178– 183. Google Scholar CrossRef Search ADS PubMed  Svihus B., Kløvstad K. H., Perez V., Zimonja O., Sahlstrom S., Schuller R. B., Jeksrud W. K., Prestløkken E.. 2004. Physical and nutritional effects of pelleting of broiler chicken diets made from wheat ground to different coarsenesses by the use of roller mill and hammer mill. Anim. Feed. Sci. Technol.  117: 281– 293. Google Scholar CrossRef Search ADS   Tachibana T., Matsuda K., Kawamura M., Ueda H., Khan M. S., Cline M. A.. 2012. Feeding-suppressive mechanism of sulfated cholecystokinin (26-33) in chicks. Comp. Biochem. Physiol. A. Mol. Integr. Physiol.  161: 372– 378. Google Scholar CrossRef Search ADS PubMed  Tachibana T., Sugahara K., Ohgushi A., Ando R., Kawakami S., Yoshimatsu T., Furuse M.. 2001. Intracerebroventricular injection of agouti-related protein attenuates the anorexigenic effect of alpha-melanocyte stimulating hormone in neonatal chicks. Neurosci. Lett.  305: 131– 134. Google Scholar CrossRef Search ADS PubMed  Tachibana T., Takagi T., Tomonaga S., Ohgushi A., Ando R., Denbow D. M., Furuse M.. 2003. Central administration of cocaine- and amphetamine-regulated transcript inhibits food intake in chicks. Neurosci. Lett.  337: 131– 134. Google Scholar CrossRef Search ADS PubMed  Toghyani M., Girish C. K., Wu S. B., Iji P. A., Swick R. A.. 2016. Effect of elevated dietary amino acid levels in high canola meal diets on productive traits and cecal microbiota population of broiler chickens in a pair-feeding study. Poult. Sci.  pii: pew388. Touchette K. J., Carroll J. A., Allee G. L., Matteri R. L., Dyer C. J., Beausang L. A., Zannelli M. E.. 2002. Effect of spray-dried plasma and lipopolysaccharide exposure on weaned pigs: I. Effects on the immune axis of weaned pigs. J. Anim. Sci.  80: 494– 501. Google Scholar CrossRef Search ADS PubMed  Wada R., Sakata I., Kaiya H., Nakamura K., Hayashi Y., Kangawa K., Sakai T.. 2003. Existence of ghrelin-immunopositive and expressing cells in the proventriculus of the hatching and adult chicken. Regul. Peptides.  111: 123– 128. Google Scholar CrossRef Search ADS   Yamato M., Sakata I., Wada R., Hiroyuki K., Sakai T.. 2005. Exogenous administration of octanoic acid accelerates octanoylated ghrelin production in the proventriculus of neonatal chicks. Biochem. Biophys. Res.  333: 583– 589. Google Scholar CrossRef Search ADS   Yuan L., Ni Y., Barth S., Wang Y., Grossmann R., Zhao R.. 2009. Layer and broiler chicks exhibit similar hypothalamic expression of orexigenic neuropeptides but distinct expression of genes related to energy homeostasis and obesity. Brain Res . 1273: 18– 28. Google Scholar CrossRef Search ADS PubMed  Zhao J. P., Jiao H. C., Jiang Y. B., Song Z. G., Wang X. J., Lin H.. 2012. Cool perch availability improves the performance and welfare status of broiler chickens in hot weather. Poult. Sci.  91: 1775– 1784. Google Scholar CrossRef Search ADS PubMed  © 2017 Poultry Science Association Inc. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Feed habituation alleviates decreased feed intake after feed replacement in broilers

Loading next page...
 
/lp/ou_press/feed-habituation-alleviates-decreased-feed-intake-after-feed-IkfJDn9t0d
Publisher
Oxford University Press
Copyright
© 2017 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pex358
Publisher site
See Article on Publisher Site

Abstract

Abstract In the present study, 2 experiments were conducted to investigate the effect of replacing a mash diet with a pellet diet on the expression of genes related to appetite in the hypothalamus and gastrointestinal tract (GT) and to evaluate the attenuating effect of feed habituation on the disadvantage influence on feed consumption. In experiment 1, the mash diet of one group of 21-day-old chicks was replaced with a pellet diet (PD) with the same ingredient composition, while the other group of chicks was continued on the mash diet (control). In experiment 2, all the experimental chickens were divided into 3 treatments at 18 d of age. One treatment of birds was provided with feeders with pellet feed scattered on the surface of the mash diet (around one-third of feeder surface, MP) from d 18 to d 20, and they were provided with the PD on d 21. The other 2 treatments of chickens were either fed with the PD (PDF) or continued the mash diet (control) at 21 d of age. The results showed that replacing a mash diet with a PD decreased (P < 0.05) feed consumption. The intestinal morphology was not influenced (P > 0.05). The mRNA levels of cholecystokinin (CCK) in the jejunum were upregulated (P < 0.05) in the PD chickens. The expression of anorexia gene ghrelin, corticotropin-releasing hormone (CRH), and melanocortin receptor 4 (MCR-4) were significantly down-regulated (P < 0.05) in the hypothalamus of the MP and PDF chickens 4 h after feed replacement. The results indicated that feed replacement altered the expression of genes related to appetite in the GT and hypothalamus. Pellet changeover causes a short-term decrease in the feed intake of broilers, and feed habituation relieves the negative effects of feed replacement. INTRODUCTION Feeding a pellet diet (PD) increases weight gain and feed intake and improves the feed: gain ratio compared with feeding mash diets (Amerah et al., 2007; Serrano et al., 2013). The change of the digestive tract is one of the bird performance factors that PD feeding can improve. Feeding a PD changes the relative length and weight of the digestive tract (Amerah et al., 2007; Serrano et al., 2013). Moreover, the diet form and particle size affect the mast cell number and histamine content in the small intestine by regulating the stem cell factor concentration (Liu et al., 2006). In commercial broiler production, phase diets are formulated throughout the growing cycle of broiler chickens according to the requirements of market targets (Brewer et al., 2012a,b,c). A crumbled starter is commonly used in commercial broiler production (Choi et al., 1986) followed by pelleted grower and finisher diets. In practice, however, diet replacement of a mash or crumble starter with a pelleted grower diet results in the reduction of feed intake for a couple of d, which reduces the growth rate of chickens. In avian species, such as mammals, 2 primary populations of neurons in the hypothalamus are involved in appetite control by releasing signaling peptides, including orexigenic neuropeptides, such as neuropeptide Y (NPY) and agouti-related peptide (AgRP), and anorexigenic neuropeptides, such as pro-opiomelanocortin (POMC), amphetamine-regulated transcript (CART), corticotropin-releasing hormone (CRH), and melanocortin receptor 4 (MC4-R) (Schwartz et al., 2000; Richards, 2003). NPY can increase appetite in mammals and birds (Hahn et al., 1998; Boswell et al., 2002). Our previous study indicated that NPY is associated with glucocorticoid-induced appetite in birds (Liu et al., 2014, 2017). In contrast, CRH and CART play an inhibitory role in the regulation of feed intake in birds (Greenstein and Wood, 2006; Kaiya et al., 2009). The melanocortin system coordinates the maintenance of energy balance in mammals (Olszewski et al., 2007) and birds (Tachibana et al. 2001; Boswell and Takeuchi, 2005) through the regulation of both food intake and energy expenditure. Furthermore, many neuropeptides related to appetite control are expressed in the gastrointestinal tract (GT), e.g., ghrelin and cholecystokinin (CCK) (Richards and Proszkowiec-Weglarz, 2007). Unlike in mammals, ghrelin suppresses appetite by interacting with CRH in chickens (Saito et al., 2002, 2005). CCK is a gut peptide that has long been established as a postprandial satiety signal and an appetite suppressant in avian species (Panchanathan et al., 2006). CCK is also a potent inhibitor of gastric emptying of chickens (Martinez et al., 1993a). Hence, we hypothesized that the expression levels of genes related to appetite control may be involved in the decreased feed consumption induced by feed replacement. The changeover to pellets induces a transient reduction in feed intake (Lecuelle et al., 2010). However, early visual experience cannot reduce the transient reduction in feed intake caused by changeover from crumbles to pellets in growing turkeys (Lecuelle et al., 2011). Hence, whether the transitory suppression of feed intake due to feed replacement could be alleviated by food habituation remains to be elucidated. Two experiments were conducted to investigate the effect of replacing a mash diet with PD on food habituation and the expression of genes related to appetite in the hypothalamus and GT. To avoid the possible influence of body weight on feed consumption, we used male broilers in our experiments. Moreover, as stress, particle size and diet form could affect the morphology of the small intestine (Liu et al., 2006; Santos et al., 2015); the intestinal morphology and the enzyme activity in the intestinal tissues were tested as well. MATERIALS AND METHODS Animals One-day-old male broiler chicks (Arbor Acres) were obtained from a local hatchery (Dabao Breeding Ltd, Taian, P. R. China) and housed in an environmentally controlled room. The brooding temperature was maintained at 35°C for the first 2 d and then was gradually decreased to 21°C by d 21 and maintained as such thereafter. All chicks received a starter diet maintained at 21% crude protein and 12.3 MJ/kg of metabolizable energy (Zhao et al., 2012). The composition and nutrient levels of the experimental diets (1 to 21 d) are listed in Suppl. Table 3. Chickens were reared in floor pens (2 m × 2 m) using new rice hulls as litter. Each pen was equipped with tube feeders (the feeder space per bird was 2.5 cm) and a nipple waterline (12 birds per nipple). All birds had free access to food and water during the rearing period. The light regimen was 23 L:1 D (5 Lux), and the dark period was from 0:00 to 01:00 a.m. (Zhao et al., 2012). The study was approved by the Ethics Committee of the Shandong Agricultural University and carried out in accordance with the “Guidelines for Experimental Animals” from the Ministry of Science and Technology (Beijing, P. R. China). Experiment Design Experiment 1 Two hundred chicks were randomly allotted according to the catching order to 2 groups with 4 replicates (pens) of 25 birds each. All the birds were fed with a mash diet until 20 d of age. At 21 d of age, one group of chicks was provided with a PD (4 mm, PD), while the other group of chicks was continued on the mash diet (control) at 8:00 a.m. The mash diet has the same ingredient composition and the same nutrient concentration (mentioned above) as the PD. Feed consumption was recorded every h for the initial 8 h and was thereafter recorded at 12, 24, 48, and 72 h by weighing the tube feeder. Throughout the experimental period, the health of the experimental birds was monitored, and the dead or culled birds, if any, were removed and weighed and omitted from the feed consumption calculation. Experiment 2 Their hundred chicks were randomly allotted to 3 treatments with 4 replicates (pens) of 25 birds each. All the chickens were fed with a mash diet until 17 d of age. At 18 d of age (3 d before the normal changeover time), one treatment of birds was fed a mash diet covered with PD feed on the surface (around one-third of the feeder surface, MP) from d 18 to d 20. Starting at 8:00 a.m. (7 h after lights were turned on), the feeders were checked every 2 h to maintain the same amount of PD on the surface of the mash diet. On d 21, the chickens were provided with a PD (MP treatment) at 08:00 a.m. The other 2 treatments of chickens continued to be fed with a mash diet until 20 d old, and thereafter one group of chickens received a PD feeding (PDF) at 8:00 a.m., while another treatment of chickens continued to be fed with a mash diet (control). Feed consumption was recorded every 2 h for 24 hours. According to the feed intake data, at 6, 12, and 24 h after treatment in experiment 1 and at 6 and 24 h after treatment in experiment 2, 2 broilers of approximately mean body weight were randomly collected from each replicate. Each of the selected broilers was gently caught by the same broiler keeper to avoid stress and disturbance to the other broilers. The broilers were brought to a separate sampling room. A blood sample was obtained by drawing from a wing vein using a heparinized syringe within 30 s after the bird was caught and collected in pre-cooled tubes. Plasma was obtained after centrifugation at 400 × g for 10 min at 4°C to avoid the influence of blood cell metabolism and was stored at −20°C for the analysis of corticosterone (CORT). Immediately after the blood sample was obtained, the chicken was sacrificed by exsanguination (Close, 1997), and tissue samples were obtained. During sampling, the experimenters were divided into 2 or 3 groups to ensure that the birds from each treatment were sampled in the same time interval. Tissue samples of the proventriculus, duodenum, jejunum, and ileum were collected according to the descriptions by Awad et al. (2006) as follows: samples of the whole intestinal tract were removed, and segments of approximately 2 cm were taken from the crop near the esophageal junction, the midpoint of the proventriculus, the midpoint of the duodenum (duodenum), the midpoint between the bile duct entry and Meckel's diverticulum (jejunum), the proximal cecum, and the rectum. The hypothalamus was dissected from the ventral surface of the brain according to the method described in our previous studies (Liu et al., 2014, 2017). In brief, 2 transverse cuts were made at the apex of the optic chiasm and the rostral margin of the mammillary bodies. Next, 2-mm bilateral cuts were made on either side of the midline, and the whole hypothalamus was removed according to the method described in Kuenzel and Masson (1988) and Yuan et al. (2009). After being shock-frozen in liquid nitrogen, the tissue samples were stored at −80°C for RNA extraction. Histological Analysis The duodenum and jejunum tissues were fixed in 4% paraformaldehyde (P1110–500 mL, Solarbio, Beijing, China), embedded in paraffin, and sectioned to a thickness of 4 μm. The paraffin sections were stained with hematoxylin and eosin. The villus height (VH) and crypt depth (CD) of the duodenum and jejunum were measured using an Image-Pro Plus as described by Touchette et al. (2002), and then the VH: CD ratio (VCR) was calculated. Measurement of CORT Plasma CORT was measured using a sensitive and highly specific RIA kit (IDS Inc, Boldon, UK) with a sensitivity of 0.39 ng/mL and a low cross-reaction with aldosterone (0.20%), cortisol (0.40%), and deoxycorticosterone (3.30%). This approach has been used in a previous study (Malheiros et al., 2003). Before the assay was conducted, the plasma samples were heated to 80°C for 10 min to inactivate CORT-binding proteins. The intra-assay variability was 3.8%. Measurement of Antioxidant Enzymes The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-Px) of the duodenum were measured spectrophotometrically with commercial diagnostic kits (Jiancheng Bioengineering Institute, Nanjing, P. R. China), and this approach has been successfully used in a previous poultry study (Huang et al., 2015). RNA Isolation and Analysis The expression of genes in the hypothalamus, glandular stomach, duodenum, jejunum, and ileum was quantified using quantitative real-time polymerase chain reaction (qPCR) with SYBR Green I labeling (0,491,391,4001, Roche, Switzerland). Total RNA was isolated by the guanidinium isothiocyanate method with Trizol Reagent (15,596–026, Invitrogen, San Diego, CA). The quality of RNA after DNase treatment was tested by electrophoresis on an agarose gel, and the quantity of RNA was determined using a biophotometer (Eppendorf, Germany). Then, 1 μg of total RNA was used for reverse transcription with a PrimeScript RT reagent kit (0,489,703,0001, Roche, Switzerland) to prepare the cDNA. The primer sequences are shown in Table 1. Real-time PCR analysis was conducted using an Applied Biosystems 7500 Real-time PCR System (Applied Biosystems, Foster, CA). Each RT-reaction served as the template in a 20 μL PCR reaction volume containing 0.2 μmol/L of each primer and SYBR Green I labeling (0,491,391,4001, Roche, Switzerland). SYBR green fluorescence was detected at the end of each cycle to monitor the amount of PCR product. Real-time PCR was performed at 95°C for 10 s, followed by 40 cycles at 95°C for 5 s and 60°C for 40 seconds. SYBR green fluorescence was detected at the end of each cycle to monitor the amount of PCR product. A standard curve was plotted to calculate the efficiency of the real-time PCR primers. Table 1. Gene-specific primers used for the analysis of chicken gene expression. Gene  GenBank accession no.  Primer sequences (5΄-3΄)  Orientation  Product size (bp)  GAPDH  NM_204,305  ACATGGCATCCAAGGAGTGAG GGGGAGACAGAAGGGAACAGA  Forward reverse  266  NPY  M87294  TGCTGACTTTCGCCTTGTCG GTGATGAGGTTGATGTAGTGCC  Forward reverse  148  AgRP  NM_0,010,31457  GGAACCGCAGGCATTGTC GTAGCAGAAGGCGTTGAAGAA  Forward reverse  163  CRH  NM_0,011,23031  CTCCCTGGACCTGACTTTCC TGTTGCTGTGGGCTTGCT  Forward reverse  86  Ghrelin  AB075215  CCTTGGGACAGAAACTGCTC CACCAATTTCAAAAGGAACG  Forward reverse  203  POMC  NM_0,010,31098  CGCTACGGCGGCTTCA TCTTGTAGGCGCTTTTGACGAT  Forward reverse  88  CART  BI394769  CCGCACTACGAGAAGAAG AGGCACTTGAGA AGA AAGG  Forward reverse  146  CCK  NM_0,010,01741  GATGGCAGCTTCGAGCAGAG GTCATTTATCCTGTGTGGGATCA  Forward reverse  141  MCR-4  XM426042  ACACTCCAGCCTCTCCATTTCT TGTTCATAGCAGCCTCCCGA  Forward reverse  101  Gene  GenBank accession no.  Primer sequences (5΄-3΄)  Orientation  Product size (bp)  GAPDH  NM_204,305  ACATGGCATCCAAGGAGTGAG GGGGAGACAGAAGGGAACAGA  Forward reverse  266  NPY  M87294  TGCTGACTTTCGCCTTGTCG GTGATGAGGTTGATGTAGTGCC  Forward reverse  148  AgRP  NM_0,010,31457  GGAACCGCAGGCATTGTC GTAGCAGAAGGCGTTGAAGAA  Forward reverse  163  CRH  NM_0,011,23031  CTCCCTGGACCTGACTTTCC TGTTGCTGTGGGCTTGCT  Forward reverse  86  Ghrelin  AB075215  CCTTGGGACAGAAACTGCTC CACCAATTTCAAAAGGAACG  Forward reverse  203  POMC  NM_0,010,31098  CGCTACGGCGGCTTCA TCTTGTAGGCGCTTTTGACGAT  Forward reverse  88  CART  BI394769  CCGCACTACGAGAAGAAG AGGCACTTGAGA AGA AAGG  Forward reverse  146  CCK  NM_0,010,01741  GATGGCAGCTTCGAGCAGAG GTCATTTATCCTGTGTGGGATCA  Forward reverse  141  MCR-4  XM426042  ACACTCCAGCCTCTCCATTTCT TGTTCATAGCAGCCTCCCGA  Forward reverse  101  View Large The relative amount of mRNA of a gene was calculated according to the method of Livak and Schmittgen (2001). The mRNA levels of these genes were normalized to glyceraldehydes-3-phosphate dehydrogenase (GAPDH) levels (ΔCT). The ΔCT was calibrated against an average of the control chickens. The linear amount of target molecules relative to the calibrator was calculated by 2−ΔΔCT. Therefore, all gene transcription results are reported as the n-fold difference relative to the calibrator. The specificity of the amplification product was verified by the standard curve and dissolution curve. Statistical Analysis Data are presented as the means ± standard error of the mean (SEM). The homogeneity and normal distribution plots of variances among the treatments were confirmed using Bartlett's test. For the feed intake variable, a one-way ANOVA model was used to estimate the main effect of feeding treatment on a per-pen basis (SAS version 8e, SAS Institute, 1998). For the variables gene expression, enzymatic activity, and plasma corticosterone, a one-way ANOVA model was used to estimate the main effect of feeding treatment for individual broiler. For the data in experiment 2, when the main effect of the feeding treatment was significant, multiple comparisons were conducted by Duncan's multiple range analysis. P < 0.05 was considered statistically significant. RESULTS Experiment 1 The replacement of mash with a pelleted diet significantly decreased feed intake (P < 0.05) during the initial 5 h, and thereafter there was no significant difference between the PD and control group, though the trend was remained at 24 h (P > 0.05, Figure 1). The mRNA expression of ghrelin in the proventriculus (Figure 2A) was slightly increased in the PD treatment 6, 12, and 24 h after treatment compared to the control ones, and the difference was significant only 12 h after treatment. The mRNA level of CCK was not different between the PD treatment and control in the proventriculus or GT at 6 h (Figure 2B). A significant increase (P = 0.014) in CCK mRNA in the jejunum was found in our result 12 h after the PD treatment (Figure 2C), whereas no difference between PD treatment and control in CCK expression in the proventriculus and GT was observed at 24 h (Figure 2D). Figure 1. View largeDownload slide Effect of pellet diet (PD) and mash diet (control) on cumulative feed intake of 21-day-old male broilers 1 to 72 h after replacement of mash with pellets. Data were presented as the mean ± SEM (error bars, n = 4); *: 1 h: P < 0.0001 (F1,6 = 162.47); 2 h: P = 0.002 (F1,6 = 28.26); 3 h: P = 0.011 (F1,6 = 13.29); 4 h: P = 0.026 (F1,6 = 8.68); 5 h: P = 0.040 (F1,6 = 6.87). The F values at other time points are as follows: 6 h: P = 0.052 (F1,6 = 5.85); 7 h: P = 0.080 (F1,6 = 4.42); 8 h: P = 0.091 (F1,6 = 4.05); 12 h: P = 0.051 (F1,6 = 5.93). Figure 1. View largeDownload slide Effect of pellet diet (PD) and mash diet (control) on cumulative feed intake of 21-day-old male broilers 1 to 72 h after replacement of mash with pellets. Data were presented as the mean ± SEM (error bars, n = 4); *: 1 h: P < 0.0001 (F1,6 = 162.47); 2 h: P = 0.002 (F1,6 = 28.26); 3 h: P = 0.011 (F1,6 = 13.29); 4 h: P = 0.026 (F1,6 = 8.68); 5 h: P = 0.040 (F1,6 = 6.87). The F values at other time points are as follows: 6 h: P = 0.052 (F1,6 = 5.85); 7 h: P = 0.080 (F1,6 = 4.42); 8 h: P = 0.091 (F1,6 = 4.05); 12 h: P = 0.051 (F1,6 = 5.93). Figure 2. View largeDownload slide Effect of pellet diet (PD) and mash diet (control) on the transcriptional levels of ghrelin (A) in proventriculus and cholecystokinin (CCK) in proventriculus and gastrointestinal tract (GT) of 21-day-old male broilers 6, 12, and 24 h after replacement of mash with pellets. Data were presented as the mean ± SEM (error bars, n = 6); *: P = 0.014 (F1,10 = 9.91). Figure 2. View largeDownload slide Effect of pellet diet (PD) and mash diet (control) on the transcriptional levels of ghrelin (A) in proventriculus and cholecystokinin (CCK) in proventriculus and gastrointestinal tract (GT) of 21-day-old male broilers 6, 12, and 24 h after replacement of mash with pellets. Data were presented as the mean ± SEM (error bars, n = 6); *: P = 0.014 (F1,10 = 9.91). The PD treatment had no significant influence (P > 0.05) on the VH, CD, or VCR in the duodenum and jejunum or the activities of SOD, CAT or GSH-Px in the duodenum after 24 h of feeding (Suppl. Table 1, 2). Experiment 2 Compared with the control, the PDF chickens consumed significantly (P < 0.05) less feed during the 24 h after the feed changeover (Figure 3). The MP chickens, however, consumed a similar amount of feed as the PDF chickens (P > 0.05) during the first 4 h after feed replacement and thereafter consumed significantly (P < 0.05) more feed than the PDF chickens, except at 12 h (P = 0.006). After 12 of h of treatment, there was no difference in feed consumption between the MP and the control group fed with the mash diet (P > 0.05). Figure 3. View largeDownload slide Effect of replacing mash diet (control) with pellet diet with (MP) or without (PDF) a 3-day habituation period on cumulative feed intake after feed changeover of broilers from 2 to 24 h after treatment. Data were presented as the mean ± SEM (error bars, n = 4); a-c: 2 h: P < 0.0001 (F2,9 = 101.29); 4 h: P < 0.0001 (F2,9 = 77.71); 6 h: P < 0.0001 (F2,9 = 57.66); 8 h: P < 0.0001 (F2,9 = 30.45); 12 h: P = 0.006 (F2,9 = 9.60); 24 h: P = 0.060 (F2,9 = 3.91). Figure 3. View largeDownload slide Effect of replacing mash diet (control) with pellet diet with (MP) or without (PDF) a 3-day habituation period on cumulative feed intake after feed changeover of broilers from 2 to 24 h after treatment. Data were presented as the mean ± SEM (error bars, n = 4); a-c: 2 h: P < 0.0001 (F2,9 = 101.29); 4 h: P < 0.0001 (F2,9 = 77.71); 6 h: P < 0.0001 (F2,9 = 57.66); 8 h: P < 0.0001 (F2,9 = 30.45); 12 h: P = 0.006 (F2,9 = 9.60); 24 h: P = 0.060 (F2,9 = 3.91). Compared with that in the control group, the mRNA level of AgRP was significantly upregulated in MP chickens at 6 h after treatment (Figure 4A). In contrast, the mRNA expressions of ghrelin (P = 0.040), CRH (P = 0.003), and MC4-R (P = 0.004) were significantly down-regulated in both the PDF and MP chickens compared to the control (Figure 4B). There was no detectable difference (P > 0.05) between the PDF and MP groups in the gene expression of all the investigated genes. We further determined the transcriptional levels of CRH, MC4-R, and AgRP at 24 h, and the results showed clear changes at 6 h after treatment. The results showed that the AgRP mRNA level was lower in the PDF chickens compared with the control group (P = 0.054), whereas there was no difference between the MP and PDF or MP and control group chickens (P > 0.05). There was no difference in the expression of CRH (P = 0.670) or MC4-R (P = 0.116) among the 3 treatments (Figure 4C). Figure 4. View largeDownload slide Effect of replacing mash diet (control) with pellet diet with (MP) or without (PDF) a 3-day habituation period on the transcriptional levels of neuropeptide Y (NPY), pro-opiomelanocortin (POMC), cocaine- and amphetamine-regulated transcript (CART) and agouti-related peptide (AgRP) (A) at 6 h; ghrelin, corticotropin-releasing hormone (CRH) and melanocortin receptor 4 (MC4-R) (B) at 6 h; and CRH, MC4R and AgRP (C) at 24 h in hypothalamus of male broilers after feed changeover. Data were presented as the mean ± SEM (error bars, n = 6); *: 6 h: AgRP: P = 0.044 (F2,15 = 5.49); ghrelin: Control vs. MP: P = 0.052 (F1,10 = 5.20), Control vs. PDF: P = 0.046 (F1,10 = 5.36); CRH: Control vs. MP: P = 0.006 (F1,10 = 13.06), Control vs. PDF: P = 0.041 (F1,10 = 5.68); MC4R: Control vs. MP: P = 0.004 (F1,10 = 14.44), Control vs. PDF: P = 0.037 (F1,10 = 5.98); AgRP: Control vs. PDF: P = 0.016 (F1,10 = 9.87). Figure 4. View largeDownload slide Effect of replacing mash diet (control) with pellet diet with (MP) or without (PDF) a 3-day habituation period on the transcriptional levels of neuropeptide Y (NPY), pro-opiomelanocortin (POMC), cocaine- and amphetamine-regulated transcript (CART) and agouti-related peptide (AgRP) (A) at 6 h; ghrelin, corticotropin-releasing hormone (CRH) and melanocortin receptor 4 (MC4-R) (B) at 6 h; and CRH, MC4R and AgRP (C) at 24 h in hypothalamus of male broilers after feed changeover. Data were presented as the mean ± SEM (error bars, n = 6); *: 6 h: AgRP: P = 0.044 (F2,15 = 5.49); ghrelin: Control vs. MP: P = 0.052 (F1,10 = 5.20), Control vs. PDF: P = 0.046 (F1,10 = 5.36); CRH: Control vs. MP: P = 0.006 (F1,10 = 13.06), Control vs. PDF: P = 0.041 (F1,10 = 5.68); MC4R: Control vs. MP: P = 0.004 (F1,10 = 14.44), Control vs. PDF: P = 0.037 (F1,10 = 5.98); AgRP: Control vs. PDF: P = 0.016 (F1,10 = 9.87). At 6 h, the mRNA level of ghrelin in the proventriculus was significantly increased (P = 0.012) in the PDF treatment group compared with either the control or MP chickens (Figure 5A). In contrast, no significant difference was detected at 24 h after treatment (P = 0.758, Figure 5B). Figure 5. View largeDownload slide Effect of replacing mash diet (control) with pellet diet with (MP) or without (PDF) a 3-day habituation period on the transcriptional level of ghrelin at 6 h (A) and 24 h (B) after feed changeover in proventriculus of broilers. Data were presented as the mean ± SEM (error bars, n = 6); *: 6 h: Ghrelin: MP vs. PDF: P = 0.020 (F1,10 = 8.43), PDF vs. Control: P = 0.044 (F1,10 = 5.30). Figure 5. View largeDownload slide Effect of replacing mash diet (control) with pellet diet with (MP) or without (PDF) a 3-day habituation period on the transcriptional level of ghrelin at 6 h (A) and 24 h (B) after feed changeover in proventriculus of broilers. Data were presented as the mean ± SEM (error bars, n = 6); *: 6 h: Ghrelin: MP vs. PDF: P = 0.020 (F1,10 = 8.43), PDF vs. Control: P = 0.044 (F1,10 = 5.30). Compared to the control, plasma concentrations of CORT were influenced by MP (+152.7%) or PDF treatment (+74.7%, Figure 6). However, this effect was not significant and exhibited a larger variance (MP, 23.7%; PD, 38.9%). Figure 6. View largeDownload slide Effects of replacing mash diet (control) with (MF) or without (PDF) a 3-day habituation period on plasma concentrations of corticosterone (nmol/L) of broilers at 6 h after feed changeover. Data were presented as the means ± SEM (error bars, n = 6). Figure 6. View largeDownload slide Effects of replacing mash diet (control) with (MF) or without (PDF) a 3-day habituation period on plasma concentrations of corticosterone (nmol/L) of broilers at 6 h after feed changeover. Data were presented as the means ± SEM (error bars, n = 6). DISCUSSION Gastrointestinal Appetite-Regulating Peptides Involved in the Suppressed Feed Intake Induced by Feed Replacement Feeding a PD improves the growth performance and feed conversion ratio of broilers (Engberg et al., 2002; McKinney and Teeter, 2004; Svihus et al., 2004). However, the diet replacement of a mash or a crumble starter with a pellet grower at 21 d of age usually causes decreased feed consumption, and in turn, impaired growth performance (Serrano et al., 2012). In the present study, 2 experiments were conducted and indicated that the transition from a mash diet to a PD significantly decreased the feed consumption of broilers. As the dietary ingredients may influence the feed intake of broilers (Toghyani et al., 2016), the same basal diet was used to prepare the mash and PD used in this study. Hence, the abrupt feed changeover seems to be at least partially responsible for the decreased feed consumption in PD feeding chickens. The decrease in feed intake following the transition from mash to pellets may be caused by the unfavorable physical stimulation of the GT. The particle size and diet form affect the mast cell number and histamine content in the small intestine (Liu et al., 2006), suggesting that feed structure affects intestinal function in broiler chickens. Acute stress (feed withdrawal or heat stress) can cause changes in the intestinal epithelial structure and oxidative damage (Burkholder et al., 2008). In experiment 1, we first investigated the morphology of the duodenum and jejunum at 24 h after feed replacement. In the present study, VH, CD, and VCR were not changed by feed replacement. In heat stress-challenged broilers, villus denudation and crypt damage were observed simultaneously with an increase in glutathione peroxidase activity and a decreased antioxidant capacity (Santos et al., 2015). Hence, we further determined the activity of antioxidant enzymes. The unchanged SOD, CAT, and GSH-Px in the duodenum indicated that oxidative stress was not induced by feed replacement. Therefore, the result suggests that sudden replacement of a mash diet with PD had no direct harmful influence on intestinal morphology. We further investigated the expression of genes related to appetite control in the GT. It is well known that there are ghrelin immuno-positive cells in the hypothalamus and GT of birds (Ahmed and Harvey, 2002; Wada et al., 2003; Neglia et al., 2004, 2005; Yamato et al., 2005). Chicken ghrelin, a peptide with 26 amino acids, is predominantly expressed in the proventriculus and is absent in the gizzard (Kaiya et al., 2002). Contrary to the orectic effect in mammals, ghrelin functions as an anorexia factor in chicken. Both intracerebroventricular (i.c.v.) and peripheral injection of ghrelin inhibits feed intake in chicks (Furuse et al., 2001; Saito et al., 2002; Geelissen et al., 2005; Saito et al., 2005) and Japanese quail (Shousha et al., 2005). In the present study, pellet-fed chickens had higher mRNA levels of ghrelin in the proventriculus at 12 h after feed replacement. This result coincided with the trend of reduced feed intake of PD chickens at 12 h after feed replacement. This result was also in line with previous results indicating that the ghrelin mRNA levels in the proventriculus were significantly increased by fasting (Chen et al., 2007; Kaiya et al., 2007). Hence, the upregulated ghrelin expression seemed to be the result of reduced feed consumption. This speculation is supported by the observation that there was no detectable difference in ghrelin mRNA levels between the PD and control chickens at 24 h after feed replacement when the feed consumption was matched in PD chickens against the controls. CCK was the first gut hormone found to reduce food intake in rats (Gibbs et al., 1973). Intraperitoneal or i.c.v. injection of CCK decreased feed intake in chicks (Savory and Gentle, 1983; Tachibana et al., 2012). Meanwhile, CCK is also known as a potent inhibitor of gastric emptying of chickens (Martinez et al., 1993a,b). In the present study, the upregulation of CCK gene expression in the jejunum at 12 h in the PD chickens indicated that CCK may be involved in suppressed feed consumption due to PD feeding. In the modern line of broilers, the suppressive effect of CCK on appetite is weakened in the fast-growing strains of chickens compared to the relatively slow-growing strains of chickens (Dunn et al., 2013). Hence, the present result also may imply that feed replacement potentially reduced feed consumption by suppressing gastric emptying. Feed Habituation Attenuates the Reduced Feed Consumption Induced by Feed Replacement In previous studies, the reduced feed intake by feed changeover from crumble to pellet could not be alleviated by early visual experience (Lecuelle et al., 2010, 2011). In this study, we hypothesized that the novel feeding type could alleviate the unfavorable effects caused by feed replacement. In the present study, MP chickens had a 3-day acclimation period, and the feeder was scattered with pellets over the surface of mash diet (approximately 30%) and kept as such for 3 days. The MP chickens consumed more feed than the PDF chickens after feed replacement; the difference between the treatments was significant only from 6 h onwards. Moreover, the cumulative feed consumption showed no significant difference between the MP and control chickens at 24 h after treatment. The results suggest that MP improves the consumption of a PD after feed replacement. NPY is a very potent orexigenic peptide in mammals (Hanson and Dallman, 1995) and in birds (Kuenzel et al., 1987). As an antagonist of MC4-R, AgRP plays a similar role as NPY in regulating appetite (Tachibana et al., 2001; Boswell et al., 2002). I.c.v. injection of AgRP attenuates the anorexigenic effect of the alpha-melanocyte-stimulating hormone in neonatal broilers and layer-type chicks (Tachibana et al., 2001). In the present study, the expression of NPY was unaltered, and a significant increase in AgRP mRNA was found, which implies that the MP chickens have higher appetites compared with the control chickens. In contrast, there was no clear difference between the PDF and MP chickens in terms of NPY and AgRP gene expressions. The role of orexigenic genes in suppressed food consumption due to feed changeover needs to be investigated further. CART plays an inhibitory role in the regulation of feed intake in birds when injected centrally (Tachibana et al., 2003). The melanocortin system coordinates the maintenance of energy balance in mammals (Olszewski et al., 2007) and birds (Tachibana et al., 2001; Boswell and Takeuchi, 2005). In the present study, the gene expression of POMC and CART was not altered, while the expression of the ghrelin, CRH, and MC4-R genes was down-regulated in both the PDF and MP chickens compared with the control group, suggesting that anorexigenic genes are not associated with inhibited feed consumption. Moreover, although MP treatment improved pellet diet consumption, there was no detectable difference in the appetite-related genes between the MP and PDF chickens. The results indicate that a 3-day acclimation period to PD ameliorated feed consumption without significantly altering the expression of appetite-regulating genes, suggesting that hypothalamic appetite-related genes are not responsible for the suppressed feed consumption due to PD changeover. Ghrelin has an anorexigenic effect when injected intracerebroventricularly (Saito et al., 2002). In mammals, it has been suggested that the orexigenic effect of ghrelin is mediated via NPY/AgRP-containing neurons in the arcuate nucleus (ARC) of the hypothalamus (Luquet and Magnan, 2009). In birds, however, centrally injected ghrelin inhibits feed intake by interacting with the endogenous CRH (Saito et al., 2005). In the present study, there was a similar trend in the expression of CRH and ghrelin in the hypothalamus, both of which were down-regulated in the MP and PDF chickens at 6 h after treatment compared with the control group, suggesting their coincident influences on the appetites of PDF and MP chickens. Thereafter, we investigated the gene expression in the GT. In contrast to that in the hypothalamus, the upregulated expression of ghrelin in the proventriculus of the PDF chickens at 6 h after treatment was in line with the result in experiment 1, indicating the relative starvation in PDF chickens compared with the MP and control chickens. This effect was not observed at 24 h, although the PDF chickens still consumed less feed compared to the MP and control chickens. Taken together, the results suggest that appetite-related genes play a less important role in suppressed food consumption due to feed replacement. We further determined the circulating CORT level. The unaffected CORT level in the PDF and MP chickens compared to the controls may indicate that feed replacement cannot evoke a significant stress response. The elevated secretion of CORT can trigger behavioral responses, and there is a clear glucocorticoid response when Japanese quail are subjected to the presentation of a novel object (Richard et al., 2008). In contrast, novel objects cause no significant glucocorticoid response in European starlings (Apfelbeck and Raess, 2008). The relationship between physiological stress response and behavioral response to novelty is a complex network (Lendvai et al., 2011). However, when the novel object was placed over the food dishes, birds approached their dishes more slowly once exposed to a novel object, even though a stress response was not evoked (Fischer et al., 2016). In summary, the results indicated that feed replacement transitorily suppressed the anorexigenic genes ghrelin, CRH, and MC4-R in the hypothalamus and upregulated ghrelin expression in the proventriculus. Pellet changeover causes a short-term decrease in feed intake, and feed habituation facilitates a dietary change from mash to pellets. SUPPLEMENTARY DATA Supplementary data are available at Poultry Science online. Suppl. Table 1. Effect of pellet diet (PD) and mash diet (control) on the villus height (VH), crypt depth (CD), and VH: CD ratio (VCR) in the duodenum and jejunum of 21-day-old male broilers 24 h after replacement of mash with pellets. Suppl. Table 2. Effects of pellet diet (PD) and mash diet (control) on duodenum enzyme activity of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-PX) of male broilers 24 h after treatment. Suppl. Table 3. The composition and nutrient levels of the experimental diets (1 to 21 d). ACKNOWLEDGEMENTS This research was supported by funds earmarked for the Modern Agro-industry Technology Research System, National Natural Science Foundation of China (No. 31072045 and 31172226), Agricultural Engineering Program of Improved Variety Breeding in Shandong Province and the Taishan Scholars Program (No. 201511023). The authors declare that they have no conflicts of interest. We greatly thank the reviewers for their valuable comments and suggestions on the paper. REFERENCES Ahmed S., Harvey S.. 2002. Ghrelin: A hypothalamic GH-releasing factor in domestic fowl (Gallus domesticus). J. Endocrinol . 172: 117– 125. Google Scholar CrossRef Search ADS PubMed  Amerah A. M., Ravindran V., Lentle R. G., Thomas D. G.. 2007. Influence of feed particle size and feed form on the performance, energy utilization, digestive tract development, and digesta parameters of broiler starters. Poult. Sci.  86: 2615– 2623. Google Scholar CrossRef Search ADS PubMed  Apfelbeck B., Raess M.. 2008. Behavioural and hormonal effects of social isolation and neophobia in a gregarious bird species, the European starling (Sturnus vulgaris). Horm. Behav . 54: 435– 441. Google Scholar CrossRef Search ADS PubMed  Awad W. A., Böhm J., Razzazi-Fazeli E., Ghareeb K., Zentek J.. 2006. Effect of addition of a probiotic microorganism to broiler diets contaminated with deoxynivalenolon performance and histological alterations of histological alterations of intestinal villi of broiler chickens. Poult. Sci.  85: 974– 979. Google Scholar CrossRef Search ADS PubMed  Boswell T., Takeuchi S.. 2005. Recent developments in our understanding of the avian melanocortin system: Its involvement in the regulation of pigmentation and energy homeostasis. Peptides . 26: 1733– 1743. Google Scholar CrossRef Search ADS PubMed  Boswell T., Li Q., Takeuchi S.. 2002. Neurons expressing neuropeptide Y mRNA in the infundibular hypothalamus of Japanese quail are activated by fasting and co-express agouti-related protein mRNA. Brain. Res. Mol. Brain. Res . 100: 31– 42. Google Scholar CrossRef Search ADS PubMed  Brewer V. B., Emmert J. L., Meullenet J. F., Owens C. M.. 2012a. Small bird programs: Effect of phase-feeding, strain, sex, and debone time on meat quality of broilers. Poult. Sci . 91: 499– 504. Google Scholar CrossRef Search ADS   Brewer V. B., Owens C. M., Emmert J. L.. 2012b. Phase feeding in a big-bird production scenario: Effect on growth performance, yield, and fillet dimension. Poult. Sci . 91: 1256– 1261. Google Scholar CrossRef Search ADS   Brewer V. B., Owens C. M., Emmert J. L.. 2012c. Phase feeding in a small-bird production scenario: Effect on growth performance, yield, and fillet dimension. Poult. Sci . 91: 1262– 1268. Google Scholar CrossRef Search ADS   Burkholder K. M., Thompson K. L., Einstein M. E., Applegate T. J., Patterson J. A.. 2008. Influence of stressors on normal intestinal microbiota, intestinal morphology, and susceptibility to salmonella enteritidis colonization in broilers. Poult. Sci.  87: 1734– 1741. Google Scholar CrossRef Search ADS PubMed  Chen L. L., Jiang Q. Y., Zhu X. T., Shu G., Bin Y. F., Wang X. Q., Gao P., Zhang Y. L.. 2007. Ghrelin ligand-receptor mRNA expression in hypothalamus, proventriculus and liver of chicken (Gallus gallus domesticus): studies on ontogeny and feeding condition. Comp. Biochem. Physiol. A. Mol. Integr. Physiol.  147: 893– 902. Google Scholar CrossRef Search ADS PubMed  Choi J. H., So B. S., Ryu K. S., Kang S. L.. 1986. Effects of pelleted or crumbled diets on the performance and the development of the digestive organs of broilers. Poult. Sci.  65: 594– 597. Google Scholar CrossRef Search ADS PubMed  Close T. J. 1997. Dehydrins: A commonalty in the response of plants to dehydration and low temperature. Physiol. Plant.  100: 291– 296. Google Scholar CrossRef Search ADS   Dunn I. C., Meddle S. L., Wilson P. W., Wardle C. A., Law A. S., Bishop V. R., Hindar C., Robertson G. W., Burt D. W., Ellison S. J., Morrice D. M., Hocking P. M.. 2013. Decreased expression of the satiety signal receptor CCKAR is responsible for increased growth and body weight during the domestication of chickens. Am. J. Physiol. Endocrinol. Metab.  304: E909– 21. Google Scholar CrossRef Search ADS PubMed  Engberg R. M., Hedemann M. S., Jensen B. B.. 2002. The influence of grinding and pelleting of feed on the microbial composition and activity in the digestive tract of broiler chickens. Br. Poult. Sci.  43: 569– 579. Google Scholar CrossRef Search ADS PubMed  Fischer C. P., Franco L. A., Romero L. M.. 2016. Are novel objects perceived as stressful? The effect of novelty on heart rate. Physiol. Behav.  161: 7– 14. Google Scholar CrossRef Search ADS PubMed  Furuse M., Tachibana T., Ohgushi A., Ando R., Yoshimatsu T., Denbow D. M.. 2001. Intracerebroventricular injection of ghrelin and growth hormone releasing factor inhibits food intake in neonatal chicks. Neurosci. Lett.  301: 123– 126. Google Scholar CrossRef Search ADS PubMed  Geelissen S. M. E., Geelissen S. M. E., Swennen Q., Geyten Van der S., Kuhn E. R., Kaiya H., Kangawa K., Decuypere E., Buyse J., Darras V. M.. 2005. Peripheral ghrelin reduces food intake and respiratory quotient in chicken. Domes. Anim. Endocrinol.  30: 108– 116. Google Scholar CrossRef Search ADS   Gibbs J., Young R. C., Smith G. P.. 1973. Cholecystokinin decreases food intake in rats. J. Comp. Physiol. Psychol.  84: 488– 495. Google Scholar CrossRef Search ADS PubMed  Greenstein B., Wood D.. 2006. The endocrine system at a glance , 2th ed. Unipart House, Garsington Road, Cowley. Oxford, OX 2PG, UK. Hahn T. M., Breininger J. F., Baskin D. G., Schwartz M. W.. 1998. Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons. Nat. Neurosci . 1: 271– 272. Google Scholar CrossRef Search ADS PubMed  Hanson E. S., Dallman M. F.. 1995. Neuropeptide Y (NPY) may integrate responses of hypothalamic feeding systems and the hypothalamo-pituitary- adrenal axis. Neuroendocrinol . 7: 273– 279. Google Scholar CrossRef Search ADS   Huang C., Jiao H., Song Z., Zhao J., Wang X., Lin H.. 2015. Heat stress impairs mitochondria functions and induces oxidative injury in broiler chickens. J. Anim. Sci.  93: 2144– 2153. Google Scholar CrossRef Search ADS PubMed  Kaiya H., Furuse M., Miyazato M., Kangawa K.. 2009. Current knowledge of the roles of ghrelin in regulating food intake and energy balance in birds. Gen. Comp. Endocrinol.  163: 33– 38. Google Scholar CrossRef Search ADS PubMed  Kaiya H., Saito E. S., Tachibana T., Furuse M., Kangawa K.. 2007. Changes in ghrelin levels of plasma and proventriculus and ghrelin mRNA of proventriculus in fasted and refed layer chicks. Domest. Anim. Endocrinol.  32: 247– 259. Google Scholar CrossRef Search ADS PubMed  Kaiya H., Van der Geyten S., Kojima M., Hosoda H., Kitajimam Y., Matsumoto M., Geelissen S., Darras V. M., Kangawa K.. 2002. Chicken ghrelin: puriWcation cDNA cloning and biological activity. Endocrinology . 143: 3454– 3463. Google Scholar CrossRef Search ADS PubMed  Kuenzel W. J., Masson M.. 1988. A Stereotaxic Atlas of the Brain of the Chick (Gallus domesticus) . Johns Hopkins University Press, Baltimore, MD. Kuenzel W. J., Douglass L. W., Davison B. A.. 1987. Robust feeding following central administration of neuropeptide Y or peptide YY in chicks, Gallus domesticus. Peptides . 8: 823– 828. Google Scholar CrossRef Search ADS PubMed  Lecuelle S., Bouvarel I., Chagneau A. M., Laviron F., Lescoat P., Leterrier C.. 2010. Feeding behaviour in turkeys with a change-over from crumbs to pellets. Appl. Anim. Behav. Sci.  125: 132– 142. Google Scholar CrossRef Search ADS   Lecuelle S., Bouvarel I., Chagneau A. M., Laviron F., Lescoat P., Leterrier C.. 2011. Early visual experience of food does not appear to reduce subsequent feed neophobia in turkeys. Poult. Sci.  90: 1– 9. Google Scholar CrossRef Search ADS PubMed  Lendvai A. Z., Bokony V., Chastel O.. 2011. Coping with novelty and stress in free-living house sparrows. J. Exp. Biol.  214: 821– 828. Google Scholar CrossRef Search ADS PubMed  Liu L., Song Z., Jiao H., Lin H.. 2014. Glucocorticoids increase NPY gene expression via hypothalamic AMPK signaling in broiler chicks. Endocrinology . 155: 2190– 2198. Google Scholar CrossRef Search ADS PubMed  Liu L., Wang X., Jiao H., Lin H.. 2017. Glucocorticoids induced high fat diet preference via activating hypothalamic AMPK signaling in chicks. Gen. Comp. Endocrinol . pii: S0016-6480: 30409– 30409. Liu Y. H., Piao X. S., Ou D. Y., Cao Y. H., Huang D. S., Li D. F.. 2006. Effects of particle size and physical form of diets on mast cell numbers, histamine, and stem cell factor concentration in the small intestine of broiler chickens. Poult. Sci.  85: 2149– 2155. Google Scholar CrossRef Search ADS PubMed  Livak K. J., Schmittgen T. D.. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods . 25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Luquet S., Magnan C.. 2009. The central nervous system at the core of the regulation of energy homeostasis. Front. Biosci.  1: 448– 465. Google Scholar CrossRef Search ADS   Malheiros R. D., Moraes V. M., Collin A., Decuypere E., Buyse J.. 2003. Free diet selection by broilers as influenced by dietary macronutrient ratio and corticosterone supplementation. 1. Diet selection, organ weights, and plasma metabolites. Poult. Sci.  82: 123– 131. Google Scholar CrossRef Search ADS PubMed  Martinez V., Jiménez M., Goñalons E., Vergara P.. 1993. Effects of cholecystokinin and gastrin on gastroduodenal motility and coordination in chickens. Life. Sci.  52: 191– 198. Google Scholar CrossRef Search ADS PubMed  Martinez V., Jimenez M., Goñalons E., Vergara P.. 1993. Mechanism of action of CCK in avian gastroduodenal motility: evidence for nitric oxide involvement. Am. J. Physiol.  265: 842– 850. Google Scholar CrossRef Search ADS   McKinney L. J., Teeter R. G.. 2004. Predicting effective caloric value of non-nutritive factors: I. Pellet quality and II. Prediction of consequential formulation dead zones. Poult. Sci.  83: 1165– 1174. Google Scholar CrossRef Search ADS PubMed  Neglia S., Arcamone N., Esposito V., Gargiulo G., de Girolamo P.. 2005. Presence and distribution of ghrelin-immunopositive cells in the chicken gastrointestinal tract. Acta. Histochem.  107: 3– 9. Google Scholar CrossRef Search ADS PubMed  Neglia S., Arcamone N., Esposito V., Gargiulo G.. 2004. Ghrelin in the gatroenteric tract of birds: Immunoreactivity expression. Vet. Res. Commun.  28: 213– 215. Google Scholar CrossRef Search ADS PubMed  Olszewski P. K., Bomberg E. M., Grace M. K., Levine A. S.. 2007. Alpha-melanocyte stimulating hormone and ghrelin: central interaction in feeding control. Peptides . 28: 2084– 2089. Google Scholar CrossRef Search ADS PubMed  Panchanathan V., Chaudhri G., Karupiah G.. 2006. Protective immunity against secondary poxvirus infection is dependent on antibody but not on CD4 or CD8 T-cell function. J. Virol.  80: 6333– 6338. Google Scholar CrossRef Search ADS PubMed  Richards M. P., Proszkowiec-Weglarz M.. 2007. Mechanisms regulating feed intake, energy expenditure and body weight in poultry. Poult. Sci . 86: 1478– 1490. Google Scholar CrossRef Search ADS PubMed  Richard S., Wacrenier-Cere N., Hazard D., Saint-Dizier H., Arnould C., Faure J. M.. 2008. Behavioural and endocrine fear responses in Japanese quail upon presentation of a novel object in the home cage. Behav. Process.  77: 313– 319. Google Scholar CrossRef Search ADS   Richards M. P. 2003. Genetic regulation of feed intake and energy balance in poultry. Poult. Sci . 82: 907– 916. Google Scholar CrossRef Search ADS PubMed  Saito E. S., Kaiya H., Tachibana T., Tomonaga S., Denbow D. M., Kangawa K., Furuse M.. 2005. Inhibitory eVect of ghrelin on food intake is mediated by the corticotrophin-releasing factor system in neonatal chicks. Regul. peptides.  125: 201– 208. Google Scholar CrossRef Search ADS   Saito E. S., Kaiya H., Takagi T., Yamasaki I., Denbow D. M., Kangawa K., Furuse M.. 2002. Chicken ghrelin and growth hormone-releasing peptide-2 inhibit food intake of neonatal chicks. Eur. J. Pharmacol.  453: 75– 79. Google Scholar CrossRef Search ADS PubMed  Santos R. R., Awati A., Roubos-van den Hil P. J., Tersteeg-Zijderveld M. H., Koolmees P. A., Fink-Gremmels J.. 2015. Quantitative histo-morphometric analysis of heat-stress-related damage in the small intestines of broiler chickens. Avian. Pathol.  44: 19– 22. Google Scholar CrossRef Search ADS PubMed  SAS Institute. 1998. User's Guide: Statistics . SAS Inst. Inc., Cary, NC. Savory C. J., Gentle M. J.. 1983. Effects of food deprivation, strain, diet and age on feeding responses of fowls to intravenous injections of cholecystokinin. Appetite . 4: 165– 176. Google Scholar CrossRef Search ADS PubMed  Schwartz M. W., Woods S. C., Porte D., Seeley R. J. Jr., Baskin D. G.. 2000. Central nervous system control of food intake. Nature . 404: 661– 671. Google Scholar CrossRef Search ADS PubMed  Serrano M. P., Valencia D. G., Méndez J., Mateos G. G.. 2012. Influence of feed form and source of soybean meal of the diet on growth performance of broilers from 1 to 42 days of age. 1. Floor pen study. Poult. Sci.  91: 2838– 2844. Google Scholar CrossRef Search ADS PubMed  Serrano M. P., Frikha M., Corchero J., Mateos G. G.. 2013. Influence of feed form and source of soybean meal on growth performance, nutrient retention, and digestive organ size of broilers. 2. Battery study. Poult. Sci.  92: 693– 708. Google Scholar CrossRef Search ADS PubMed  Shousha S., Nakahara K., Kojima M., Miyazato M., Hosoda H., Kangawa K., Murakami N.. 2005. Different effects of peripheral and central ghrelin on regulation of food intake in the Japanese quail. Gen. Comp. Endocrinol.  141: 178– 183. Google Scholar CrossRef Search ADS PubMed  Svihus B., Kløvstad K. H., Perez V., Zimonja O., Sahlstrom S., Schuller R. B., Jeksrud W. K., Prestløkken E.. 2004. Physical and nutritional effects of pelleting of broiler chicken diets made from wheat ground to different coarsenesses by the use of roller mill and hammer mill. Anim. Feed. Sci. Technol.  117: 281– 293. Google Scholar CrossRef Search ADS   Tachibana T., Matsuda K., Kawamura M., Ueda H., Khan M. S., Cline M. A.. 2012. Feeding-suppressive mechanism of sulfated cholecystokinin (26-33) in chicks. Comp. Biochem. Physiol. A. Mol. Integr. Physiol.  161: 372– 378. Google Scholar CrossRef Search ADS PubMed  Tachibana T., Sugahara K., Ohgushi A., Ando R., Kawakami S., Yoshimatsu T., Furuse M.. 2001. Intracerebroventricular injection of agouti-related protein attenuates the anorexigenic effect of alpha-melanocyte stimulating hormone in neonatal chicks. Neurosci. Lett.  305: 131– 134. Google Scholar CrossRef Search ADS PubMed  Tachibana T., Takagi T., Tomonaga S., Ohgushi A., Ando R., Denbow D. M., Furuse M.. 2003. Central administration of cocaine- and amphetamine-regulated transcript inhibits food intake in chicks. Neurosci. Lett.  337: 131– 134. Google Scholar CrossRef Search ADS PubMed  Toghyani M., Girish C. K., Wu S. B., Iji P. A., Swick R. A.. 2016. Effect of elevated dietary amino acid levels in high canola meal diets on productive traits and cecal microbiota population of broiler chickens in a pair-feeding study. Poult. Sci.  pii: pew388. Touchette K. J., Carroll J. A., Allee G. L., Matteri R. L., Dyer C. J., Beausang L. A., Zannelli M. E.. 2002. Effect of spray-dried plasma and lipopolysaccharide exposure on weaned pigs: I. Effects on the immune axis of weaned pigs. J. Anim. Sci.  80: 494– 501. Google Scholar CrossRef Search ADS PubMed  Wada R., Sakata I., Kaiya H., Nakamura K., Hayashi Y., Kangawa K., Sakai T.. 2003. Existence of ghrelin-immunopositive and expressing cells in the proventriculus of the hatching and adult chicken. Regul. Peptides.  111: 123– 128. Google Scholar CrossRef Search ADS   Yamato M., Sakata I., Wada R., Hiroyuki K., Sakai T.. 2005. Exogenous administration of octanoic acid accelerates octanoylated ghrelin production in the proventriculus of neonatal chicks. Biochem. Biophys. Res.  333: 583– 589. Google Scholar CrossRef Search ADS   Yuan L., Ni Y., Barth S., Wang Y., Grossmann R., Zhao R.. 2009. Layer and broiler chicks exhibit similar hypothalamic expression of orexigenic neuropeptides but distinct expression of genes related to energy homeostasis and obesity. Brain Res . 1273: 18– 28. Google Scholar CrossRef Search ADS PubMed  Zhao J. P., Jiao H. C., Jiang Y. B., Song Z. G., Wang X. J., Lin H.. 2012. Cool perch availability improves the performance and welfare status of broiler chickens in hot weather. Poult. Sci.  91: 1775– 1784. Google Scholar CrossRef Search ADS PubMed  © 2017 Poultry Science Association Inc.

Journal

Poultry ScienceOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial