Exposure to cuticular bacteria can alter host behavior in a funnel-weaving spider

Exposure to cuticular bacteria can alter host behavior in a funnel-weaving spider Contact with environmental microbes are arguably the most common species interaction in which any animal participates. Studies have noted diverse relationships between hosts and resident mi- crobes, which can have strong consequences for host development, physiology, and behavior. Many of these studies focus specifically on pathogens or beneficial microbes, while the benign mi- crobes, of which the majority of bacteria could be described, are often ignored. Here, we explore the nature of the relationships between the grass spider Agelenopsis pennsylvanica and bacteria collected from their cuticles in situ. First, using culture-based methods, we identified a portion of the cuticular bacterial communities that are naturally associated with these spiders. Then, we topic- ally exposed spiders to a subset of these bacterial monocultures to estimate how bacterial expos- ure may alter 3 host behavioral traits: boldness, aggressiveness, and activity level. We conducted these behavioral assays 3 times before and 3 times after topical application, and compared the changes observed in each trait with spiders that were exposed to a sterile control treatment. We identified 9 species of bacteria from the cuticles of 36 spiders and exposed groups of 20 spiders to 1 of 4 species of cuticular bacteria. We found that exposure to Dermacoccus nishinomiyaensis and Staphylococcus saprophyticus was associated with a 10-fold decrease in the foraging aggressive- ness of spiders toward prey in their web. Since bacterial exposure did not have survival consequences for hosts, these data suggest that interactions with cuticular bacteria, even non- pathogenic bacteria, could alter host behavior. Key words: Agelenopsis pennsylvanica, aggressiveness, Araneae, cuticular bacteria, personality V C The Author (2017). Published by Oxford University Press. 1 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zox064/4636542 by guest on 13 July 2018 2 Current Zoology, 2017, Vol. 00, No. 00 Animals are constantly subject to microbes from their environment, into round (diameter¼ 12 cm), opaque, sterile plastic housing con- many of which develop important relationships with their host, tainers. Spiders were maintained in an environment chamber at altering host physiology, health, and behavior. Extensive research 25 C and a 16 h:8 h light:dark cycle. Spiders were restricted to a has probed the myriad roles that certain microbes play in the func- maintenance diet of one 2-week-old cricket per week and were pro- tioning of the endocrine, digestive, immune, circulatory, and ner- vided water by misting the web with a spray bottle. We estimated in- vous system of their hosts (McFall-Ngai et al. 2013). Although dividuals’ body size by measuring their prosoma width (millimeter) interactions between hosts and environmental bacteria have classic- and body mass (gram) with digital calipers and a digital scale. ally been overlooked in the field of behavioral ecology, contempor- ary research has linked members of host-associated microbial Bacterial isolation and identification communities with important host behaviors like reproduction, habi- One week after collection and storage in a sterile housing container, tat selection, and foraging (Grenham et al. 2011; Ezenwa et al. 36 spiders were chosen haphazardly and each transferred to a sterile 2012). Most of these studies focus on either pathogenic or beneficial 15 mL conical tube containing 1 mL sterile LB broth (Fisher microbes that reside in the host gut. For example, Lactobacillus gut Scientific, Asheville, NC, USA), then subsequently shaken by a vor- bacteria attenuate anxiety-related behaviors in both mice (Bravo tex (700  g) for 10 s. Spiders were then returned to their original et al. 2011) and zebrafish (Davis et al. 2016), whereas infection by housing container using forceps. Four 10-fold serial dilutions were Trichuris muris increases the expression of these behaviors (Bercik made from this stock solution and 100 mL of each dilution was et al. 2010). In German cockroaches, exposure to commensal gut spread onto LB agar plates. Plates were incubated at room tempera- microbiota stimulates the production of volatile carboxylic acids ture for 24–72 h, until bacterial growth was evident. Unique individ- which increases aggregation tendencies, indicating that gut bacteria ual bacterial colonies (by color and morphology) were re-streaked may act as a mediator of insect–insect communication (Wada- using sterile inoculating loops onto new LB agar plates 3–4 times to Katsumata et al. 2015). Fewer studies, however, have sought to link ensure that cultures were monospecific. Although LB agar is a nutri- hosts’ behavioral traits with exposure to potentially benign mi- ent rich medium, not all environmental bacteria are able to readily crobes, which constitute the majority of bacteria with which an ani- grow under its conditions. Thus, only a subset of the spiders’ cuticu- mal interacts (Nishiguchi et al. 2008; Dinan et al. 2015). lar bacterial community were likely to be cultured in this way. Host cuticles represent the first physical barrier between the Bacterial identification was performed by PCR amplification of a body and exogenous microbes. Although many members of the skin 1500 bp region of the prokaryotic 16 S ribosomal RNA gene using microbiome are considered benign and unlikely to influence import- illustra PuReTaq Ready-To-Go PCR Beads (GE Healthcare Life ant host traits (Grice and Segre 2011), evidence suggests that some Sciences, Pittsburgh, PA, USA) and sent for sanger sequencing cuticular bacteria can play important roles in host behavior. For in- (GeneWiz, South Plainfield, NJ, USA). See the Appendix for primer stance, the harvester ant Pogonomyrmex barbatus uses colony- details. Bacterial identification was determined by manually aligning specific cuticular microbial communities to recognize nest mates sequences in FinchTV BLAST software (Geospiza, Inc., Seattle, WA, (Dosmann et al. 2016). Research on the social spider Stegodyphus USA). We used a cutoff of 99% identity for identifications at the dumicola has revealed nuanced relationships between hosts and cu- species level, and 97% identity for identifications at the genus ticular bacteria (Keiser et al. 2016a), where increases in cuticular level. All bacterial strains were stored at 80 C in 25% glycerol bacterial load (i.e., abundance) can alter colonies’ collective foraging and are available upon request. behavior (Keiser et al. 2016b). Taken together, these examples illus- trate that seemingly benign cuticular bacteria can play a role in host’s behavior. Behavioral assays Here, we investigate whether, and to what degree, exposure to We performed 3 behavioral assays to characterize each spider’s be- cuticular bacterial can alter important behaviors and survivorship in havioral phenotype before versus after experimental exposure to the grass spider Agelenopsis pennsylvanica. Although A. pennsyl- bacteria: boldness, activity, and aggressiveness. These represent im- vanica are predominantly solitary, spiders may share cuticular bac- portant behaviors for the natural history of Agelenopsis spiders that teria via shared environments (e.g., silk or soil) or during are regularly subject to ongoing natural and sexual selection interactions with conspecifics (e.g., antagonistic interactions or mat- (Berning et al. 2012; e.g., antipredator behavior and mating; ing). We collected spiders from urban and suburban habitats and Riechert and Hedrick 1990). Each assay was conducted 3 times per collected bacteria from their cuticles to (1) characterize some of bac- spider before and after bacterial exposure for a total of 6 trials teria with which these animals likely interact, and (Good et al. (2 sets of 3 trials). Behavioral assays were all performed on the same 2012) identify the degree to which exposing spiders to these bacteria days in the following order: boldness, activity, and aggressiveness. might alter their behavior. Spiders that were vortexed to collect bacterial samples were not included in the subsequent behavioral assays or bacterial exposures. Boldness assay: Boldness is a behavioral trait defined as an indi- Materials and Methods viduals’ propensity to engage in risky behavior (Sloan Wilson et al. Collection and maintenance 1994) and is often measured as an individual’s latency to resume Agelenopsis pennsylvanica (N¼ 120) both male and female spiders normal activity following an antagonistic stimulus (Riechert and were collected by locating their funnel-shaped webs in bushes and Hedrick 1993). To assess spiders’ boldness, we opened the lid to spi- hedges in Pittsburgh, PA in Oakland, Squirrel Hill, and Lewisburg ders’ home containers and allowed a 30-s acclimation period, after suburbs. One 2-week-old cricket was placed at the opening of the which 2 rapid puffs of air were administered to the anterior prosoma funnel using tweezers. When the spider emerged from the back of using a plastic transfer pipette bulb. This causes the animal to either the web to attack the cricket, the spider was quickly scooped into a flee rapidly from the stimulus or to perform a “death feign” and re- plastic container and transferred directly to a sterile 50 mL conical main motionless. We recorded whether or not the spider fled from tube. Spiders were transported back to the laboratory and isolated the stimulus, and the latency in seconds for the spider to resume Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zox064/4636542 by guest on 13 July 2018 PARKS et al.: Spiders, bacteria, and behavior 3 Table 1. Bacteria collected from the cuticles of A. pennsylvanica spiders Bacteria Characteristics References Dermacoccus nishinomiyaensis Catalase positive, Gram-positive, aerobic. Found widely in environment in Stackebrandt et al. (1995) including: water, soil, and occasionally on mammalian skin. Serratia marcescens Catalase positive, Gram-negative, facultative anaerobe, motile. Found in many Hejazi and Falkiner (1997) infections including respiratory tract infections, urinary tract infections, and wound infections. Some strains are facultatively pathogenic in insects. Klebsiella pneumoniae Catalase positive, Gram-negative, facultative anaerobe, non-motile. Common (Insua et al. 2013; Yang and in soil and plants; has also been shown to elicit an immune response in Chen 2016) arthropods. Staphylococcus saprophyticus Catalase positive, Gram-positive, aerobic, and motile. Found in normal flora Raz et al. (2005) of female genital tract, can cause urinary tract infections. Common patho- gen that is often found in the environment. Staphylococcus gallinarum Catalase positive, Gram-positive, anaerobic. Found on the skin of poultry, not Yu et al. (2008) usually pathogenic, but has been isolated from some human wound infections. Pseudomonas psychrotolerans Catalase positive, Gram-negative, aerobic, motile. Most often found in soil Hauser et al. (2004) and water. Curtobacterium sp. Catalase positive, Gram-positive, and aerobic. Common soil bacteria and can Funke et al. (2005) be a plant pathogen. Pseudomonas sp. Catalase positive, Gram-negative, aerobic, and motile. Depending on sp., can be Holt et al. (1994) pathogenic in plants, arthropods or humans. Mainly found in water and plants. Dermacoccus sp. Catalase positive, Gram-positive, aerobic, and non-motile. Rarely pathogenic, Holt et al. (1994) often found in water and human flora. Denotes bacteria that were used to experimentally expose spiders. normal movement about the web. Bolder spiders resume activity of 1 OD in 0.005% Triton-X. Spiders were randomly separated into faster, and shyer spiders remain motionless for longer. If the spider either the bacterial exposure (N¼ 41) or control group (N¼ 43). To had not resumed activity within 300 s, the trial was terminated and expose spiders to their assigned cuticular bacteria, 5 mL of a bacterial the spider was scored with the maximum value of 300 s. monoculture solution (i.e., approximately 4 10 CFUs) was applied to the spider directly above the pedicel using a micropipette. Similar Activity assay: To assess spiders’ activity level, we transferred methods have been used previously to incease cuticular bacterial loads the spider to a clean, plastic container (diameter¼ 12 cm) and placed on spiders (e.g., Keiser et al. 2016a, 2016b). The spiders in the bacter- a black plastic dish over the spider. After 30 s acclimation, the black ial exposure group were only inoculated with 1 of the 4 isolated dish was removed and the proportion of time that each spider spent strains, resulting in experimental groups with approximately 10 spiders moving around the container was measured in seconds over a 300 s per strain. For spiders in the control groups, 5 microliters of autoclaved period using a stopwatch. 0.005% Triton-X solution was administered atop the pedicel. Spiders Aggressiveness assay: To assess spiders’ foraging aggressiveness were then placed back into their housing container until behavioral toward prey items, we removed the spider’s home container lid and assays recommenced 7 days later. The survival of all spiders was moni- allowed a 30 s acclimation period. After which, a single 2-week-old tored for the following 3 weeks. cricket was placed in the center of the web using tweezers. We meas- ured the latency for the spider to attack the cricket. More aggressive spiders attack prey faster. If the spider did not attack the cricket Statistical analyses within 300 s, the assay was terminated and the spider was scored We calculated the change in average behavioral trait values (bold- with the maximum value of 300 s. ness, aggressiveness, and activity) by subtracting the average value of the 3 post-exposure trials from the average value of the 3 pre-ex- posure trials. Thus, because boldness and aggressiveness are latency Bacterial exposure values, a positive calculated value conveys an increase in aggressive- Bacterial liquid monocultures were grown by picking an individual ness or boldness after bacterial exposure while a negative value de- bacterial colony from an LB plate and placing it in 3 mL of sterile LB notes a decrease. A positive value in charge in activity, however, broth. After 24 h shaking at room temperature, we centrifuged the so- represents a decrease in activity post exposure. We compared the lution at 4,000  g for 5 min, removed the supernatant, and suspended change in each behavioral value between exposed spiders and cor- the bacteria in 1 mL of 0.005% Triton-X solution (Sigma Aldrich, St. responding control spiders using generalized linear mixed models Louis, MO, USA). This surfactant allows liquids to be applied topically (identity link function; after verifying model assumptions) with the to spiders’ hydrophobic cuticles. In 2 side experiments, we inoculated following independent variables: spider sex, bacterial exposure (bac- LB plates with 40lL of bacterial monocultures in either phosphate- teria vs. control), and spider body condition. Body condition is esti- buffered saline or 0.005% Triton-X and found that Triton-X does not mated as the residual values from a regression of individuals’ body reduce bacterial growth. Then, we exposed 5 adult A. pennsylvanica mass and prosoma width (Jakob et al. 1996). Spider survival (alive/ to 0.005% Triton-X and saw no mortality over the remainder of the dead) after 3 weeks was analyzed with nominal logistic regressions experiment (data not shown). We measured the optical density of each with the same independent variables as above. The collection loca- monoculture at 600 nm and diluted each solution to an optical density tion in the city from which spiders were collected was included as a Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zox064/4636542 by guest on 13 July 2018 4 Current Zoology, 2017, Vol. 00, No. 00 random effect in all models. All statistical analyses were performed Table 2. Results of 3 general linear models predicting the change in behavioral traits of individual spiders after experimental exposure in JMP Pro version 12.1. to bacteria Bacterial exposure Effect df v P-value Results Serratia Change in boldness Bacterial identification Marcescens Spider sex 1 5.04 0.03* We identified 9 unique bacteria from the cuticles of A. pennsylvan- Body condition 1 1.43 0.23 ica (Table 1). Many of these were common environmental bacteria Bacterial exposure 1 3.69 0.06 found in soil, water, or on plant surfaces. Three of our identified Change in aggressiveness bacteria had previously been described as pathogenic in arthropods Spider sex 1 2.04 0.15 (Serratia marcescens, Pseudomonas, and Klebsiella pneumoniae; Body condition 1 2.13 0.14 Table 1). Bacterial exposure 1 1.04 0.31 Change in activity Spider sex 1 3.34 0.07 Changes in spider behavior Body condition 1 0.06 0.80 The sex of the host spider was not associated with changes in Bacterial exposure 1 1.58 0.21 any behavioral traits (all P> 0.11; Table 2). Spiders’ body condi- Klebsiella Change in boldness tions were associated with their change in behavior in some expos- pneumonia Spider sex 1 4.66 0.03* ure cases (e.g., when spiders were exposed to Staphylococcus Body condition 1 8.61 0.003* saprophyticus and Klebsiella pneumoniae; Table 2). Exposure to Bacterial exposure 1 11.19 0.0008* Dermacoccus nishinomiyaensis (v ¼ 5.62, P¼ 0.01; Figure 1A) Change in aggressiveness and S. saprophyticus (v ¼ 9.06, P ¼ 0.003; Figure 2)was both Spider sex 1 5.96 0.01* associated with over a 10-fold decrease in spiders’ foraging aggres- Body condition 1 3.99 0.05* Bacterial exposure 1 1.70 0.19 siveness toward prey whereas control spiders showed no change in Change in activity aggressiveness. Spiders, on average, showed an increase in their la- Spider sex 1 1.26 0.26 tency to resume activity (i.e., became less “bold”) over time in the Body condition 1 10.69 0.001* absensce of bacterial exposure (F ¼ 8.87, P¼ 0.01). However, 1,12.6 Bacterial exposure 1 4.19 0.06 spiders that were exposed to K. pneumoniae showed no difference Dermacoccus Change in boldness in boldness after bacterial exposure (Figure 3) while spiders nishinomiyaensis Spider sex — — — that were exposed to D. nishinomiyaensis showed a increase in la- Body condition 1 0.20 0.65 tency to resume activity (v ¼ 6.44, P ¼ 0.01; Figure 1B). Spiders Bacterial exposure 1 6.44 0.01* that were exposed to bacteria did not differ in their survival rates Change in aggressiveness 3 weeks post exposure when compared with control spiders (all Spider sex — — — Body condition 1 1.42 0.23 P> 0.22), though males were more likely to have died compared Bacterial exposure 1 5.62 0.01* with females, regardless of treatment group (v ¼ 11.29, df ¼ 1, Change in activity P¼ 0.0008). Spider sex — — — Body condition 1 0.10 0.75 Bacterial exposure 1 0.61 0.43 Discussion Staphylococcus Change in boldness Countless studies have identified important relationships between Saprophyticus Spider sex 1 0.52 0.47 pathogenic and beneficial microbiota and the physiology and health Body condition 1 0.11 0.73 of their host. Fewer studies, however, have identified links between Bacterial exposure 1 0.64 0.42 Change in aggressiveness environmental, exogenous microbes and hosts’ behavioral traits. Spider sex 1 1.86 0.17 This is despite the fact that these bacteria interact with hosts con- Body condition 1 10.95 0.0009* stantly. We investigated here whether the behavior of the grass spi- Bacterial exposure 1 9.06 0.003* der A. pennsylvanica is altered by being exposed to an increased Change in activity abundance of bacteria collected from conspecifics’ cuticles in situ. Spider sex 1 0.07 0.78 We focused on 3 important host behavioral traits (boldness, aggres- Body condition 1 5.06 0.02* siveness, and activity level) and found that exposure to cuticular Bacterial exposure 1 0.87 0.35 bacteria had the strongest influences on spiders foraging aggressive- ness toward prey, though we found no evidence that increased cu- Notes: Significant effects are denoted with an asterisk. Empty values represent effects where comparisons could not be made due to uneven distribution of ticular bacterial load was actually harmful to spiders, at least in male and female spiders in that group. terms of survival rates. The 9 bacteria collected from spiders’ cuticles were mostly envir- body through the spiracles (Basset et al. 2000) or via grooming onmental bacteria often found in soil, water, or on plant surfaces. (Forster 1977). Pseudomonas was also collected from 2 spider cu- Thus, spiders likely acquire these microbes while moving around ticles, and the pathogenicity of P. aeruginosa has been confirmed in their environment during dispersal, web construction, foraging, and a wolf spider (Gilbert et al. 2016). A study by Gilbert and Uetz possibly mating. Notably, the widespread arthropod pathogen (2016) further demonstrated that P. aeruginosa can be horizontally S. marcescens was isolated from 2 different spiders. We propose that transmitted during spider mating. Thus, there is impetus to believe future studies might examine if external exposure to pathogenic bac- that contact between conspecifics during mating, parental care, or teria could lead to invasion into the host body cavity and cause in- territorial interactions could result in the transmission of both fection. It is possible that cuticular bacteria might invade a spider’s Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zox064/4636542 by guest on 13 July 2018 PARKS et al.: Spiders, bacteria, and behavior 5 Figure 3. Control spiders, on average, showed an increase in their latency to resume activity over time. However, spiders that were exposed to K. pneumo- niae showed no difference in boldness after bacterial exposure. forage and defend their territory from intruding conspecifics (Pruitt and Husak 2010). Further, exposure to D. nishinomiyaensis and K. pneumoniae resulted in either an increase in spiders’ latency to re- sume activity after an aversive stimulus or no change relative to con- trol spiders, respectively. If these cuticular bacteria can enter the body via grooming, resulting in activation of their immune system Figure 1. Exposure to D. nishinomiyaensis was associated (A) with over a 10- (Zhukovskaya et al. 2013), which could explain the spiders latency fold decrease in spiders’ foraging aggressiveness toward a prey item in their to resume activity, future studies should test whether spiders in- web and (B) an increase in latency to resume activity after an aversive crease grooming behavior after exposure and if there is an increase stimulus. in bacterial CFUs in the gut/hemolymph after grooming. Although we found no evidence that bacterial exposure altered spider sur- vivorship in the laboratory, we reason that stable abiotic conditions and ample access to prey may have reduced the opportunity to ob- serve effects on spider performance. Although there is obvious still much to discover in these system, data like these hint that inter- actions between spiders and their microbes are likely to have large effects on host traits. Acknowledgments We thank Abby Cliffton, Kaitlyn Dodson, Matthew Hughes, Ailsa Luce, Henry Rice, Jenna Sigado, Taylor Smith, Corey Stefan, Elizabeth Veley, Ferial Behboody, Alexandria Cooper, Ellen Gerasimek, Rebecca Hayes, and Eric Schneider for assistance with experimental protocols. We also thank Graham F. Hatfull for guidance in course development. Figure 2. Exposure to S. saprophyticus was associated with, on average, a 10-fold decrease in spiders’ foraging aggressiveness toward a prey item in their web. Funding Funding for this experiment was provided by the Howard Hughes Medical pathogenic and benign environmental microbes in this and other Institute Science Education Alliance. systems. We found that cuticular exposure to D. nishinomiyaensis and S. References saprophyticus, 2 common soil bacteria, were associated with over a 10-fold decrease in spiders’ foraging aggressiveness toward prey. Basset A, Khush RS, Braun A, Gardan L, Boccard F et al., 2000. The phytopa- thogenic bacteria erwinia carotovora infects Drosophila and activates an Spiders that were exposed to these 2 bacteria attacked prey, on aver- immune response. Proc Natl Acad Sci USA 97:3376–3381. age, over 60 s more slowly than control spiders. Neither bacterium Bercik P, Verdu EF, Foster JA, Macri J, Potter M et al., 2010. Chronic gastro- is known to produce secondary metabolites which could plausibly intestinal inflammation induces anxiety-like behavior and alters central ner- cause such effects. Regardless of the mechanism, a reduction in for- vous system biochemistry in mice. Gastroenterology 139:2102–2112, aging aggressiveness is likely to have fitness consequences in these e2101. animals in situ. Members of the genus Agelenopsis create sheet-like Berning AW, Gadd RD, Sweeney K, MacDonald L, Eng RY et al., 2012. non-sticky capture webs and therefore rely on high burst speeds to Sexual cannibalism is associated with female behavioural type, hunger state capitalize on time-sensitive foraging opportunities (Turnbull 1965; and increased hatching success. Anim Behav 84:715–721. Hedrick and Riechert 1989). If such reduced burst speeds translate Bravo JA, Forsythe P, Chew MV, Escaravage E, Savignac HM et al., 2011. to poor locomotor performance, this could limit spiders’ ability to Ingestion of lactobacillus strain regulates emotional behavior and central Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zox064/4636542 by guest on 13 July 2018 6 Current Zoology, 2017, Vol. 00, No. 00 gaba receptor expression in a mouse via the vagus nerve. Proc Natl Acad Sci Keiser CN, Shearer TA, DeMarco AE, Brittingham HA, Knutson KA et al., USA 108:16050–16055. 2016a. Cuticular bacteria appear detrimental to social spiders in mixed but Davis DJ, Bryda EC, Gillespie CH, Ericsson AC, 2016. Microbial modulation not monoculture exposure. Curr Zool 62:377–384. of behavior and stress responses in zebrafish larvae. Behav Brain Res 311: Keiser CN, Wright CM, Pruitt JN, 2016b. Increased bacterial load can reduce 219–227. or negate the effects of keystone individuals on group collective behaviour. Dinan TG, Stilling RM, Stanton C, Cryan JF, 2015. Collective unconscious: Anim Behav 114:211–218. how gut microbes shape human behavior. J Psychiatr Res 63:1–9. McFall-Ngai M, Hadfield MG, Bosch TC, Carey HV, Domazet-Lo so T et al., Dosmann A, Bahet N, Gordon DM, 2016. Experimental modulation of exter- 2013. Animals in a bacterial world, a new imperative for the life sciences. nal microbiome affects nestmate recognition in harvester ants Proc Natl Acad Sci USA 110:3229–3236. Pogonomyrmex barbatus. PeerJ 4: e1566. Nishiguchi M, Hirsch A, Devinney R, Vedantam G, Riley M et al., 2008. Ezenwa VO, Gerardo NM, Inouye DW, Medina M, Xavier JB, 2012. Animal Deciphering evolutionary mechanisms between mutualistic and pathogenic behavior and the microbiome. Science 338:198–199. symbioses. Vie et Milieu (Paris, France: 1980) 58:87. Forster LM, 1977. A qualitative analysis of hunting behaviour in jumping spi- Pruitt JN, Husak JF, 2010. Context-dependent running speed in funnel-web ders (Araneae: Salticidae). NZ J Zool 4:51–62. spiders from divergent populations Functional Ecology 24:165–171. Funke G, Aravena-Roman M, Frodl R, 2005. First description of Raz R, Colodner R, Kunin CM, 2005. Who are you—Staphylococcus sapro- Curtobacterium spp. isolated from human clinical specimens. J Clin phyticus? Clin Infect Dis 40:896–898. Microbiol 43:1032–1036. Riechert SE, Hedrick AV, 1990. Levels of predation and genetically based Gilbert R, Karp RD, Uetz GW, 2016. Effects of juvenile infection on adult immun- anti-predator behaviour in the spider Agelenopsis aperta. Anim Behav 40: ity and secondary sexual characters in a wolf spider. Behav Ecol 27:946–954. 679–687. Gilbert R, Uetz GW, 2016. Courtship and male ornaments as honest indicators Riechert SE, Hedrick AV, 1993. A test for correlations among fitness-linked of immune function. Anim Behav 117:97–103. behavioural traits in the spider Agelenopsis aperta (Araneae, Agelenidae). Good M, Siggers RH, Sodhi CP, Afrazi A, Alkhudari F et al., 2012. Amniotic Anim Behav 46:669–675. fluid inhibits toll-like receptor 4 signaling in the fetal and neonatal intestinal Sloan Wilson D, Clark AB, Coleman K, Dearstyne T, 1994. Shyness and bold- epithelium. Proc Natl Acad Sci USA 109:11330–11335. ness in humans and other animals. Trends Ecol Evol 9:442–446. Grenham S, Clarke G, Cryan JF, Dinan TG, 2011. Brain–gut–microbe com- Stackebrandt E, Koch C, Gvozdiak O, Schumann P, 1995. Taxonomic dis- munication in health and disease. Front Physiol 2:94. section of the genus Micrococcus: Kocuria gen. Nov., Nesterenkonia Grice EA, Segre JA, 2011. The skin microbiome. Nat Rev Microbiol 9: gen. Nov., Kytococcus gen. Nov., Dermacoccus gen. Nov., and 244–253. Micrococcus cohn 1872 gen. Emend. Int J Syst Evol Microbiol 45: Hauser E, Ka ¨ mpfer P, Busse H-J, 2004. Pseudomonas psychrotolerans sp. 682–692. Nov. Int J Syst Evol Microbiol 54:1633–1637. Turnbull A, 1965. Effects of prey abundance on the development of the spider Hedrick AV, Riechert SE, 1989. Genetically-based variation between two spi- Agelenopsis potteri (Blackwall) (Araneae: Agelenidae). Can Entomol 97: der populations in foraging behavior. Oecologia 80:533–539. 141–147. Hejazi A, Falkiner F, 1997. Serratia marcescens. J Med Microbiol 46: Wada-Katsumata A, Zurek L, Nalyanya G, Roelofs WL, Zhang A et al., 2015. 903–912. Gut bacteria mediate aggregation in the german cockroach. Proc Natl Acad Holt JG, Krieg NR, Sneath PH, Staley JT, Williams ST, 1994. Bergey’s Sci USA 112:15678–15683. Manual of Determinate Bacteriology. Baltimore (MD): Williams & Yang T-T, Chen Y-C, 2016. Klebsiella pneumoniae necrotizing fasciitis. QJM Wilkins. 829. Insua JL, Llobet E, Moranta D, Pe ´ rez-Gutie ´ rrez C, Toma ´ s A et al., 2013. Yu D, Chen Y, Pan Y, Li H, McCormac MA et al., 2008. Staphylococcus galli- Modeling Klebsiella pneumoniae pathogenesis by infection of the wax moth narum bacteremia in a patient with chronic hepatitis b virus infection. Ann Galleria mellonella. Infect Immun 81:3552–3565. Clin Lab Sci 38:401–404. Jakob EM, Marshall SD, Uetz GW, 1996. Estimating fitness: a comparison of Zhukovskaya M, Yanagawa A, Forschler BT, 2013. Grooming behavior as a body condition indices. Oikos 77:61–67. mechanism of insect disease defense. Insects 4:609–630. Appendix Table A1. PCR primer information 0 0 0 0 Gene Primer Forward sequence (5 ! 3 ) Reverse sequence (5 ! 3 ) Amplicon size (bp) 16S ribosomal Illustra PuReTaq Ready-To-Go GAGTTTGATCCTGGCTCA ACGGCTAACTTGTTACGACT 143 subunit PCR Bead Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zox064/4636542 by guest on 13 July 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Current Zoology Oxford University Press

Loading next page...
 
/lp/ou_press/exposure-to-cuticular-bacteria-can-alter-host-behavior-in-a-funnel-gAXc0wDKAH
Publisher
Editorial Office
Copyright
© The Author (2017). Published by Oxford University Press.
ISSN
1674-5507
eISSN
2396-9814
D.O.I.
10.1093/cz/zox064
Publisher site
See Article on Publisher Site

Abstract

Contact with environmental microbes are arguably the most common species interaction in which any animal participates. Studies have noted diverse relationships between hosts and resident mi- crobes, which can have strong consequences for host development, physiology, and behavior. Many of these studies focus specifically on pathogens or beneficial microbes, while the benign mi- crobes, of which the majority of bacteria could be described, are often ignored. Here, we explore the nature of the relationships between the grass spider Agelenopsis pennsylvanica and bacteria collected from their cuticles in situ. First, using culture-based methods, we identified a portion of the cuticular bacterial communities that are naturally associated with these spiders. Then, we topic- ally exposed spiders to a subset of these bacterial monocultures to estimate how bacterial expos- ure may alter 3 host behavioral traits: boldness, aggressiveness, and activity level. We conducted these behavioral assays 3 times before and 3 times after topical application, and compared the changes observed in each trait with spiders that were exposed to a sterile control treatment. We identified 9 species of bacteria from the cuticles of 36 spiders and exposed groups of 20 spiders to 1 of 4 species of cuticular bacteria. We found that exposure to Dermacoccus nishinomiyaensis and Staphylococcus saprophyticus was associated with a 10-fold decrease in the foraging aggressive- ness of spiders toward prey in their web. Since bacterial exposure did not have survival consequences for hosts, these data suggest that interactions with cuticular bacteria, even non- pathogenic bacteria, could alter host behavior. Key words: Agelenopsis pennsylvanica, aggressiveness, Araneae, cuticular bacteria, personality V C The Author (2017). Published by Oxford University Press. 1 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zox064/4636542 by guest on 13 July 2018 2 Current Zoology, 2017, Vol. 00, No. 00 Animals are constantly subject to microbes from their environment, into round (diameter¼ 12 cm), opaque, sterile plastic housing con- many of which develop important relationships with their host, tainers. Spiders were maintained in an environment chamber at altering host physiology, health, and behavior. Extensive research 25 C and a 16 h:8 h light:dark cycle. Spiders were restricted to a has probed the myriad roles that certain microbes play in the func- maintenance diet of one 2-week-old cricket per week and were pro- tioning of the endocrine, digestive, immune, circulatory, and ner- vided water by misting the web with a spray bottle. We estimated in- vous system of their hosts (McFall-Ngai et al. 2013). Although dividuals’ body size by measuring their prosoma width (millimeter) interactions between hosts and environmental bacteria have classic- and body mass (gram) with digital calipers and a digital scale. ally been overlooked in the field of behavioral ecology, contempor- ary research has linked members of host-associated microbial Bacterial isolation and identification communities with important host behaviors like reproduction, habi- One week after collection and storage in a sterile housing container, tat selection, and foraging (Grenham et al. 2011; Ezenwa et al. 36 spiders were chosen haphazardly and each transferred to a sterile 2012). Most of these studies focus on either pathogenic or beneficial 15 mL conical tube containing 1 mL sterile LB broth (Fisher microbes that reside in the host gut. For example, Lactobacillus gut Scientific, Asheville, NC, USA), then subsequently shaken by a vor- bacteria attenuate anxiety-related behaviors in both mice (Bravo tex (700  g) for 10 s. Spiders were then returned to their original et al. 2011) and zebrafish (Davis et al. 2016), whereas infection by housing container using forceps. Four 10-fold serial dilutions were Trichuris muris increases the expression of these behaviors (Bercik made from this stock solution and 100 mL of each dilution was et al. 2010). In German cockroaches, exposure to commensal gut spread onto LB agar plates. Plates were incubated at room tempera- microbiota stimulates the production of volatile carboxylic acids ture for 24–72 h, until bacterial growth was evident. Unique individ- which increases aggregation tendencies, indicating that gut bacteria ual bacterial colonies (by color and morphology) were re-streaked may act as a mediator of insect–insect communication (Wada- using sterile inoculating loops onto new LB agar plates 3–4 times to Katsumata et al. 2015). Fewer studies, however, have sought to link ensure that cultures were monospecific. Although LB agar is a nutri- hosts’ behavioral traits with exposure to potentially benign mi- ent rich medium, not all environmental bacteria are able to readily crobes, which constitute the majority of bacteria with which an ani- grow under its conditions. Thus, only a subset of the spiders’ cuticu- mal interacts (Nishiguchi et al. 2008; Dinan et al. 2015). lar bacterial community were likely to be cultured in this way. Host cuticles represent the first physical barrier between the Bacterial identification was performed by PCR amplification of a body and exogenous microbes. Although many members of the skin 1500 bp region of the prokaryotic 16 S ribosomal RNA gene using microbiome are considered benign and unlikely to influence import- illustra PuReTaq Ready-To-Go PCR Beads (GE Healthcare Life ant host traits (Grice and Segre 2011), evidence suggests that some Sciences, Pittsburgh, PA, USA) and sent for sanger sequencing cuticular bacteria can play important roles in host behavior. For in- (GeneWiz, South Plainfield, NJ, USA). See the Appendix for primer stance, the harvester ant Pogonomyrmex barbatus uses colony- details. Bacterial identification was determined by manually aligning specific cuticular microbial communities to recognize nest mates sequences in FinchTV BLAST software (Geospiza, Inc., Seattle, WA, (Dosmann et al. 2016). Research on the social spider Stegodyphus USA). We used a cutoff of 99% identity for identifications at the dumicola has revealed nuanced relationships between hosts and cu- species level, and 97% identity for identifications at the genus ticular bacteria (Keiser et al. 2016a), where increases in cuticular level. All bacterial strains were stored at 80 C in 25% glycerol bacterial load (i.e., abundance) can alter colonies’ collective foraging and are available upon request. behavior (Keiser et al. 2016b). Taken together, these examples illus- trate that seemingly benign cuticular bacteria can play a role in host’s behavior. Behavioral assays Here, we investigate whether, and to what degree, exposure to We performed 3 behavioral assays to characterize each spider’s be- cuticular bacterial can alter important behaviors and survivorship in havioral phenotype before versus after experimental exposure to the grass spider Agelenopsis pennsylvanica. Although A. pennsyl- bacteria: boldness, activity, and aggressiveness. These represent im- vanica are predominantly solitary, spiders may share cuticular bac- portant behaviors for the natural history of Agelenopsis spiders that teria via shared environments (e.g., silk or soil) or during are regularly subject to ongoing natural and sexual selection interactions with conspecifics (e.g., antagonistic interactions or mat- (Berning et al. 2012; e.g., antipredator behavior and mating; ing). We collected spiders from urban and suburban habitats and Riechert and Hedrick 1990). Each assay was conducted 3 times per collected bacteria from their cuticles to (1) characterize some of bac- spider before and after bacterial exposure for a total of 6 trials teria with which these animals likely interact, and (Good et al. (2 sets of 3 trials). Behavioral assays were all performed on the same 2012) identify the degree to which exposing spiders to these bacteria days in the following order: boldness, activity, and aggressiveness. might alter their behavior. Spiders that were vortexed to collect bacterial samples were not included in the subsequent behavioral assays or bacterial exposures. Boldness assay: Boldness is a behavioral trait defined as an indi- Materials and Methods viduals’ propensity to engage in risky behavior (Sloan Wilson et al. Collection and maintenance 1994) and is often measured as an individual’s latency to resume Agelenopsis pennsylvanica (N¼ 120) both male and female spiders normal activity following an antagonistic stimulus (Riechert and were collected by locating their funnel-shaped webs in bushes and Hedrick 1993). To assess spiders’ boldness, we opened the lid to spi- hedges in Pittsburgh, PA in Oakland, Squirrel Hill, and Lewisburg ders’ home containers and allowed a 30-s acclimation period, after suburbs. One 2-week-old cricket was placed at the opening of the which 2 rapid puffs of air were administered to the anterior prosoma funnel using tweezers. When the spider emerged from the back of using a plastic transfer pipette bulb. This causes the animal to either the web to attack the cricket, the spider was quickly scooped into a flee rapidly from the stimulus or to perform a “death feign” and re- plastic container and transferred directly to a sterile 50 mL conical main motionless. We recorded whether or not the spider fled from tube. Spiders were transported back to the laboratory and isolated the stimulus, and the latency in seconds for the spider to resume Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zox064/4636542 by guest on 13 July 2018 PARKS et al.: Spiders, bacteria, and behavior 3 Table 1. Bacteria collected from the cuticles of A. pennsylvanica spiders Bacteria Characteristics References Dermacoccus nishinomiyaensis Catalase positive, Gram-positive, aerobic. Found widely in environment in Stackebrandt et al. (1995) including: water, soil, and occasionally on mammalian skin. Serratia marcescens Catalase positive, Gram-negative, facultative anaerobe, motile. Found in many Hejazi and Falkiner (1997) infections including respiratory tract infections, urinary tract infections, and wound infections. Some strains are facultatively pathogenic in insects. Klebsiella pneumoniae Catalase positive, Gram-negative, facultative anaerobe, non-motile. Common (Insua et al. 2013; Yang and in soil and plants; has also been shown to elicit an immune response in Chen 2016) arthropods. Staphylococcus saprophyticus Catalase positive, Gram-positive, aerobic, and motile. Found in normal flora Raz et al. (2005) of female genital tract, can cause urinary tract infections. Common patho- gen that is often found in the environment. Staphylococcus gallinarum Catalase positive, Gram-positive, anaerobic. Found on the skin of poultry, not Yu et al. (2008) usually pathogenic, but has been isolated from some human wound infections. Pseudomonas psychrotolerans Catalase positive, Gram-negative, aerobic, motile. Most often found in soil Hauser et al. (2004) and water. Curtobacterium sp. Catalase positive, Gram-positive, and aerobic. Common soil bacteria and can Funke et al. (2005) be a plant pathogen. Pseudomonas sp. Catalase positive, Gram-negative, aerobic, and motile. Depending on sp., can be Holt et al. (1994) pathogenic in plants, arthropods or humans. Mainly found in water and plants. Dermacoccus sp. Catalase positive, Gram-positive, aerobic, and non-motile. Rarely pathogenic, Holt et al. (1994) often found in water and human flora. Denotes bacteria that were used to experimentally expose spiders. normal movement about the web. Bolder spiders resume activity of 1 OD in 0.005% Triton-X. Spiders were randomly separated into faster, and shyer spiders remain motionless for longer. If the spider either the bacterial exposure (N¼ 41) or control group (N¼ 43). To had not resumed activity within 300 s, the trial was terminated and expose spiders to their assigned cuticular bacteria, 5 mL of a bacterial the spider was scored with the maximum value of 300 s. monoculture solution (i.e., approximately 4 10 CFUs) was applied to the spider directly above the pedicel using a micropipette. Similar Activity assay: To assess spiders’ activity level, we transferred methods have been used previously to incease cuticular bacterial loads the spider to a clean, plastic container (diameter¼ 12 cm) and placed on spiders (e.g., Keiser et al. 2016a, 2016b). The spiders in the bacter- a black plastic dish over the spider. After 30 s acclimation, the black ial exposure group were only inoculated with 1 of the 4 isolated dish was removed and the proportion of time that each spider spent strains, resulting in experimental groups with approximately 10 spiders moving around the container was measured in seconds over a 300 s per strain. For spiders in the control groups, 5 microliters of autoclaved period using a stopwatch. 0.005% Triton-X solution was administered atop the pedicel. Spiders Aggressiveness assay: To assess spiders’ foraging aggressiveness were then placed back into their housing container until behavioral toward prey items, we removed the spider’s home container lid and assays recommenced 7 days later. The survival of all spiders was moni- allowed a 30 s acclimation period. After which, a single 2-week-old tored for the following 3 weeks. cricket was placed in the center of the web using tweezers. We meas- ured the latency for the spider to attack the cricket. More aggressive spiders attack prey faster. If the spider did not attack the cricket Statistical analyses within 300 s, the assay was terminated and the spider was scored We calculated the change in average behavioral trait values (bold- with the maximum value of 300 s. ness, aggressiveness, and activity) by subtracting the average value of the 3 post-exposure trials from the average value of the 3 pre-ex- posure trials. Thus, because boldness and aggressiveness are latency Bacterial exposure values, a positive calculated value conveys an increase in aggressive- Bacterial liquid monocultures were grown by picking an individual ness or boldness after bacterial exposure while a negative value de- bacterial colony from an LB plate and placing it in 3 mL of sterile LB notes a decrease. A positive value in charge in activity, however, broth. After 24 h shaking at room temperature, we centrifuged the so- represents a decrease in activity post exposure. We compared the lution at 4,000  g for 5 min, removed the supernatant, and suspended change in each behavioral value between exposed spiders and cor- the bacteria in 1 mL of 0.005% Triton-X solution (Sigma Aldrich, St. responding control spiders using generalized linear mixed models Louis, MO, USA). This surfactant allows liquids to be applied topically (identity link function; after verifying model assumptions) with the to spiders’ hydrophobic cuticles. In 2 side experiments, we inoculated following independent variables: spider sex, bacterial exposure (bac- LB plates with 40lL of bacterial monocultures in either phosphate- teria vs. control), and spider body condition. Body condition is esti- buffered saline or 0.005% Triton-X and found that Triton-X does not mated as the residual values from a regression of individuals’ body reduce bacterial growth. Then, we exposed 5 adult A. pennsylvanica mass and prosoma width (Jakob et al. 1996). Spider survival (alive/ to 0.005% Triton-X and saw no mortality over the remainder of the dead) after 3 weeks was analyzed with nominal logistic regressions experiment (data not shown). We measured the optical density of each with the same independent variables as above. The collection loca- monoculture at 600 nm and diluted each solution to an optical density tion in the city from which spiders were collected was included as a Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zox064/4636542 by guest on 13 July 2018 4 Current Zoology, 2017, Vol. 00, No. 00 random effect in all models. All statistical analyses were performed Table 2. Results of 3 general linear models predicting the change in behavioral traits of individual spiders after experimental exposure in JMP Pro version 12.1. to bacteria Bacterial exposure Effect df v P-value Results Serratia Change in boldness Bacterial identification Marcescens Spider sex 1 5.04 0.03* We identified 9 unique bacteria from the cuticles of A. pennsylvan- Body condition 1 1.43 0.23 ica (Table 1). Many of these were common environmental bacteria Bacterial exposure 1 3.69 0.06 found in soil, water, or on plant surfaces. Three of our identified Change in aggressiveness bacteria had previously been described as pathogenic in arthropods Spider sex 1 2.04 0.15 (Serratia marcescens, Pseudomonas, and Klebsiella pneumoniae; Body condition 1 2.13 0.14 Table 1). Bacterial exposure 1 1.04 0.31 Change in activity Spider sex 1 3.34 0.07 Changes in spider behavior Body condition 1 0.06 0.80 The sex of the host spider was not associated with changes in Bacterial exposure 1 1.58 0.21 any behavioral traits (all P> 0.11; Table 2). Spiders’ body condi- Klebsiella Change in boldness tions were associated with their change in behavior in some expos- pneumonia Spider sex 1 4.66 0.03* ure cases (e.g., when spiders were exposed to Staphylococcus Body condition 1 8.61 0.003* saprophyticus and Klebsiella pneumoniae; Table 2). Exposure to Bacterial exposure 1 11.19 0.0008* Dermacoccus nishinomiyaensis (v ¼ 5.62, P¼ 0.01; Figure 1A) Change in aggressiveness and S. saprophyticus (v ¼ 9.06, P ¼ 0.003; Figure 2)was both Spider sex 1 5.96 0.01* associated with over a 10-fold decrease in spiders’ foraging aggres- Body condition 1 3.99 0.05* Bacterial exposure 1 1.70 0.19 siveness toward prey whereas control spiders showed no change in Change in activity aggressiveness. Spiders, on average, showed an increase in their la- Spider sex 1 1.26 0.26 tency to resume activity (i.e., became less “bold”) over time in the Body condition 1 10.69 0.001* absensce of bacterial exposure (F ¼ 8.87, P¼ 0.01). However, 1,12.6 Bacterial exposure 1 4.19 0.06 spiders that were exposed to K. pneumoniae showed no difference Dermacoccus Change in boldness in boldness after bacterial exposure (Figure 3) while spiders nishinomiyaensis Spider sex — — — that were exposed to D. nishinomiyaensis showed a increase in la- Body condition 1 0.20 0.65 tency to resume activity (v ¼ 6.44, P ¼ 0.01; Figure 1B). Spiders Bacterial exposure 1 6.44 0.01* that were exposed to bacteria did not differ in their survival rates Change in aggressiveness 3 weeks post exposure when compared with control spiders (all Spider sex — — — Body condition 1 1.42 0.23 P> 0.22), though males were more likely to have died compared Bacterial exposure 1 5.62 0.01* with females, regardless of treatment group (v ¼ 11.29, df ¼ 1, Change in activity P¼ 0.0008). Spider sex — — — Body condition 1 0.10 0.75 Bacterial exposure 1 0.61 0.43 Discussion Staphylococcus Change in boldness Countless studies have identified important relationships between Saprophyticus Spider sex 1 0.52 0.47 pathogenic and beneficial microbiota and the physiology and health Body condition 1 0.11 0.73 of their host. Fewer studies, however, have identified links between Bacterial exposure 1 0.64 0.42 Change in aggressiveness environmental, exogenous microbes and hosts’ behavioral traits. Spider sex 1 1.86 0.17 This is despite the fact that these bacteria interact with hosts con- Body condition 1 10.95 0.0009* stantly. We investigated here whether the behavior of the grass spi- Bacterial exposure 1 9.06 0.003* der A. pennsylvanica is altered by being exposed to an increased Change in activity abundance of bacteria collected from conspecifics’ cuticles in situ. Spider sex 1 0.07 0.78 We focused on 3 important host behavioral traits (boldness, aggres- Body condition 1 5.06 0.02* siveness, and activity level) and found that exposure to cuticular Bacterial exposure 1 0.87 0.35 bacteria had the strongest influences on spiders foraging aggressive- ness toward prey, though we found no evidence that increased cu- Notes: Significant effects are denoted with an asterisk. Empty values represent effects where comparisons could not be made due to uneven distribution of ticular bacterial load was actually harmful to spiders, at least in male and female spiders in that group. terms of survival rates. The 9 bacteria collected from spiders’ cuticles were mostly envir- body through the spiracles (Basset et al. 2000) or via grooming onmental bacteria often found in soil, water, or on plant surfaces. (Forster 1977). Pseudomonas was also collected from 2 spider cu- Thus, spiders likely acquire these microbes while moving around ticles, and the pathogenicity of P. aeruginosa has been confirmed in their environment during dispersal, web construction, foraging, and a wolf spider (Gilbert et al. 2016). A study by Gilbert and Uetz possibly mating. Notably, the widespread arthropod pathogen (2016) further demonstrated that P. aeruginosa can be horizontally S. marcescens was isolated from 2 different spiders. We propose that transmitted during spider mating. Thus, there is impetus to believe future studies might examine if external exposure to pathogenic bac- that contact between conspecifics during mating, parental care, or teria could lead to invasion into the host body cavity and cause in- territorial interactions could result in the transmission of both fection. It is possible that cuticular bacteria might invade a spider’s Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zox064/4636542 by guest on 13 July 2018 PARKS et al.: Spiders, bacteria, and behavior 5 Figure 3. Control spiders, on average, showed an increase in their latency to resume activity over time. However, spiders that were exposed to K. pneumo- niae showed no difference in boldness after bacterial exposure. forage and defend their territory from intruding conspecifics (Pruitt and Husak 2010). Further, exposure to D. nishinomiyaensis and K. pneumoniae resulted in either an increase in spiders’ latency to re- sume activity after an aversive stimulus or no change relative to con- trol spiders, respectively. If these cuticular bacteria can enter the body via grooming, resulting in activation of their immune system Figure 1. Exposure to D. nishinomiyaensis was associated (A) with over a 10- (Zhukovskaya et al. 2013), which could explain the spiders latency fold decrease in spiders’ foraging aggressiveness toward a prey item in their to resume activity, future studies should test whether spiders in- web and (B) an increase in latency to resume activity after an aversive crease grooming behavior after exposure and if there is an increase stimulus. in bacterial CFUs in the gut/hemolymph after grooming. Although we found no evidence that bacterial exposure altered spider sur- vivorship in the laboratory, we reason that stable abiotic conditions and ample access to prey may have reduced the opportunity to ob- serve effects on spider performance. Although there is obvious still much to discover in these system, data like these hint that inter- actions between spiders and their microbes are likely to have large effects on host traits. Acknowledgments We thank Abby Cliffton, Kaitlyn Dodson, Matthew Hughes, Ailsa Luce, Henry Rice, Jenna Sigado, Taylor Smith, Corey Stefan, Elizabeth Veley, Ferial Behboody, Alexandria Cooper, Ellen Gerasimek, Rebecca Hayes, and Eric Schneider for assistance with experimental protocols. We also thank Graham F. Hatfull for guidance in course development. Figure 2. Exposure to S. saprophyticus was associated with, on average, a 10-fold decrease in spiders’ foraging aggressiveness toward a prey item in their web. Funding Funding for this experiment was provided by the Howard Hughes Medical pathogenic and benign environmental microbes in this and other Institute Science Education Alliance. systems. We found that cuticular exposure to D. nishinomiyaensis and S. References saprophyticus, 2 common soil bacteria, were associated with over a 10-fold decrease in spiders’ foraging aggressiveness toward prey. Basset A, Khush RS, Braun A, Gardan L, Boccard F et al., 2000. The phytopa- thogenic bacteria erwinia carotovora infects Drosophila and activates an Spiders that were exposed to these 2 bacteria attacked prey, on aver- immune response. Proc Natl Acad Sci USA 97:3376–3381. age, over 60 s more slowly than control spiders. Neither bacterium Bercik P, Verdu EF, Foster JA, Macri J, Potter M et al., 2010. Chronic gastro- is known to produce secondary metabolites which could plausibly intestinal inflammation induces anxiety-like behavior and alters central ner- cause such effects. Regardless of the mechanism, a reduction in for- vous system biochemistry in mice. Gastroenterology 139:2102–2112, aging aggressiveness is likely to have fitness consequences in these e2101. animals in situ. Members of the genus Agelenopsis create sheet-like Berning AW, Gadd RD, Sweeney K, MacDonald L, Eng RY et al., 2012. non-sticky capture webs and therefore rely on high burst speeds to Sexual cannibalism is associated with female behavioural type, hunger state capitalize on time-sensitive foraging opportunities (Turnbull 1965; and increased hatching success. Anim Behav 84:715–721. Hedrick and Riechert 1989). If such reduced burst speeds translate Bravo JA, Forsythe P, Chew MV, Escaravage E, Savignac HM et al., 2011. to poor locomotor performance, this could limit spiders’ ability to Ingestion of lactobacillus strain regulates emotional behavior and central Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zox064/4636542 by guest on 13 July 2018 6 Current Zoology, 2017, Vol. 00, No. 00 gaba receptor expression in a mouse via the vagus nerve. Proc Natl Acad Sci Keiser CN, Shearer TA, DeMarco AE, Brittingham HA, Knutson KA et al., USA 108:16050–16055. 2016a. Cuticular bacteria appear detrimental to social spiders in mixed but Davis DJ, Bryda EC, Gillespie CH, Ericsson AC, 2016. Microbial modulation not monoculture exposure. Curr Zool 62:377–384. of behavior and stress responses in zebrafish larvae. Behav Brain Res 311: Keiser CN, Wright CM, Pruitt JN, 2016b. Increased bacterial load can reduce 219–227. or negate the effects of keystone individuals on group collective behaviour. Dinan TG, Stilling RM, Stanton C, Cryan JF, 2015. Collective unconscious: Anim Behav 114:211–218. how gut microbes shape human behavior. J Psychiatr Res 63:1–9. McFall-Ngai M, Hadfield MG, Bosch TC, Carey HV, Domazet-Lo so T et al., Dosmann A, Bahet N, Gordon DM, 2016. Experimental modulation of exter- 2013. Animals in a bacterial world, a new imperative for the life sciences. nal microbiome affects nestmate recognition in harvester ants Proc Natl Acad Sci USA 110:3229–3236. Pogonomyrmex barbatus. PeerJ 4: e1566. Nishiguchi M, Hirsch A, Devinney R, Vedantam G, Riley M et al., 2008. Ezenwa VO, Gerardo NM, Inouye DW, Medina M, Xavier JB, 2012. Animal Deciphering evolutionary mechanisms between mutualistic and pathogenic behavior and the microbiome. Science 338:198–199. symbioses. Vie et Milieu (Paris, France: 1980) 58:87. Forster LM, 1977. A qualitative analysis of hunting behaviour in jumping spi- Pruitt JN, Husak JF, 2010. Context-dependent running speed in funnel-web ders (Araneae: Salticidae). NZ J Zool 4:51–62. spiders from divergent populations Functional Ecology 24:165–171. Funke G, Aravena-Roman M, Frodl R, 2005. First description of Raz R, Colodner R, Kunin CM, 2005. Who are you—Staphylococcus sapro- Curtobacterium spp. isolated from human clinical specimens. J Clin phyticus? Clin Infect Dis 40:896–898. Microbiol 43:1032–1036. Riechert SE, Hedrick AV, 1990. Levels of predation and genetically based Gilbert R, Karp RD, Uetz GW, 2016. Effects of juvenile infection on adult immun- anti-predator behaviour in the spider Agelenopsis aperta. Anim Behav 40: ity and secondary sexual characters in a wolf spider. Behav Ecol 27:946–954. 679–687. Gilbert R, Uetz GW, 2016. Courtship and male ornaments as honest indicators Riechert SE, Hedrick AV, 1993. A test for correlations among fitness-linked of immune function. Anim Behav 117:97–103. behavioural traits in the spider Agelenopsis aperta (Araneae, Agelenidae). Good M, Siggers RH, Sodhi CP, Afrazi A, Alkhudari F et al., 2012. Amniotic Anim Behav 46:669–675. fluid inhibits toll-like receptor 4 signaling in the fetal and neonatal intestinal Sloan Wilson D, Clark AB, Coleman K, Dearstyne T, 1994. Shyness and bold- epithelium. Proc Natl Acad Sci USA 109:11330–11335. ness in humans and other animals. Trends Ecol Evol 9:442–446. Grenham S, Clarke G, Cryan JF, Dinan TG, 2011. Brain–gut–microbe com- Stackebrandt E, Koch C, Gvozdiak O, Schumann P, 1995. Taxonomic dis- munication in health and disease. Front Physiol 2:94. section of the genus Micrococcus: Kocuria gen. Nov., Nesterenkonia Grice EA, Segre JA, 2011. The skin microbiome. Nat Rev Microbiol 9: gen. Nov., Kytococcus gen. Nov., Dermacoccus gen. Nov., and 244–253. Micrococcus cohn 1872 gen. Emend. Int J Syst Evol Microbiol 45: Hauser E, Ka ¨ mpfer P, Busse H-J, 2004. Pseudomonas psychrotolerans sp. 682–692. Nov. Int J Syst Evol Microbiol 54:1633–1637. Turnbull A, 1965. Effects of prey abundance on the development of the spider Hedrick AV, Riechert SE, 1989. Genetically-based variation between two spi- Agelenopsis potteri (Blackwall) (Araneae: Agelenidae). Can Entomol 97: der populations in foraging behavior. Oecologia 80:533–539. 141–147. Hejazi A, Falkiner F, 1997. Serratia marcescens. J Med Microbiol 46: Wada-Katsumata A, Zurek L, Nalyanya G, Roelofs WL, Zhang A et al., 2015. 903–912. Gut bacteria mediate aggregation in the german cockroach. Proc Natl Acad Holt JG, Krieg NR, Sneath PH, Staley JT, Williams ST, 1994. Bergey’s Sci USA 112:15678–15683. Manual of Determinate Bacteriology. Baltimore (MD): Williams & Yang T-T, Chen Y-C, 2016. Klebsiella pneumoniae necrotizing fasciitis. QJM Wilkins. 829. Insua JL, Llobet E, Moranta D, Pe ´ rez-Gutie ´ rrez C, Toma ´ s A et al., 2013. Yu D, Chen Y, Pan Y, Li H, McCormac MA et al., 2008. Staphylococcus galli- Modeling Klebsiella pneumoniae pathogenesis by infection of the wax moth narum bacteremia in a patient with chronic hepatitis b virus infection. Ann Galleria mellonella. Infect Immun 81:3552–3565. Clin Lab Sci 38:401–404. Jakob EM, Marshall SD, Uetz GW, 1996. Estimating fitness: a comparison of Zhukovskaya M, Yanagawa A, Forschler BT, 2013. Grooming behavior as a body condition indices. Oikos 77:61–67. mechanism of insect disease defense. Insects 4:609–630. Appendix Table A1. PCR primer information 0 0 0 0 Gene Primer Forward sequence (5 ! 3 ) Reverse sequence (5 ! 3 ) Amplicon size (bp) 16S ribosomal Illustra PuReTaq Ready-To-Go GAGTTTGATCCTGGCTCA ACGGCTAACTTGTTACGACT 143 subunit PCR Bead Downloaded from https://academic.oup.com/cz/advance-article-abstract/doi/10.1093/cz/zox064/4636542 by guest on 13 July 2018

Journal

Current ZoologyOxford University Press

Published: Nov 16, 2017

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off