EsrB negatively regulates expression of the glutamine sythetase GlnA in the fish pathogen Edwardsiella piscicida

EsrB negatively regulates expression of the glutamine sythetase GlnA in the fish pathogen... Abstract Edwardsiella piscicida is a gram-negative bacterial pathogen invading a wide range of fish species. Response regulator EsrB is essential for the activation of type III and type VI secretion systems (T3/T6SS). In this study, proteomes of the wild-type E. piscicida EIB202 and ΔesrB mutant strains were compared to identify the regulon components of EsrB cultured in DMEM allowing T3/T6SS expression. As a result, 19 proteins showed different expression, which were identified to be associated with T3/T6SS, related to amino acid transport and metabolism, and energy production. Particularly, GlnA, a glutamine synthetase essential for ammonia assimilation and glutamine biosynthesis from glutamate, was found to be regulated negatively by EsrB. Moreover, GlnA affected bacterial growth in vitro and bacterial colonization in vivo. Collectively, our results indicated that EsrB plays important roles in regulating the expression of metabolic pathways and virulence genes, including glutamine biosynthesis in E. piscicida during infection. comparative proteomics, EsrB, Edwardsiella piscicida, glnA INTRODUCTION As a member of Enterobacteriaceae family, Edwardsiella piscicida inhabits a broad range of hosts, such as fish, birds, reptiles, amphibians and humans (Abbott and Janda 2006; Abayneh, Colquhoun and Sørum 2013; Shao et al.2015). Symptoms of the infection caused by E. piscicida include liver abscess, gastroenteritis, meningitis, septicemia and wound infection (Mohanty and Sahoo 2007). Increasing outbreaks of edwardsiellosis caused by E. piscicida around the world lead to enormous losses to freshwater and marine aquaculture industries (Park, Aoki and Jung 2012). Two-component systems (TCSs) are essential for bacterial pathogens to sense and respond to stress signals from environments and hosts. EsrB is the response regulator (RR) of the TCS EsrA-EsrB in E. piscicida, homologous to SsrA-SsrB in Salmonella (Wang et al.2010; Lv et al.2012). In E. piscicida EIB202, a systematic analysis of phenotypes of RR mutants related to biofilm formation and virulence gene expression was carried out (Wang et al.2009a; Lv et al.2012; Yang et al.2012). For instance, EsrB regulates type III and type VI secretion systems (T3/T6SS), the important bacterial virulence determinants in E. piscicida in vivo and in vitro (Wang et al.2009b; Leung et al.2012; Park, Aoki and Jung 2012; Liu et al.2017b). Deletion mutants of esrA and esrB adhered more efficiently to epithelial cells and fishes but displayed lower virulence compared with the wild type (WT; Wang et al.2010; Yang et al.2012). Significantly impaired virulence in an esrB mutant suggests that the esrB gene merits as a potential target for a live attenuated vaccine construction (Mo et al.2007; Xiao et al.2013). RNA-seq analysis dissected the EsrB regulon, and systematic knocking out nine EsrB-regulated T3SS effectors abrogated the capacities of the bacterium to cause disease in a fish model (Liu et al.2017b). Therefore, EsrB plays critical roles in controlling the pathogenesis of E. piscicida. It would be interesting to decipher proteins regulated by EsrB during infection, which will lead to control of the bacterial disease. Glutamine synthetase (GS) plays an essential role in converting glutamate to glutamine. It is also involved in various regulatory mechanisms and chaperone activities in many microorganisms. GS consists of various subunits, including GlnA, GlnR, GlnL and GlnG. glnA is an important part of GS gene cluster, which uses the same promoter to regulate GS-related functions (Wang et al.2009a). Recently, GlnA has been revealed to participate in nitrogen metabolism and lysine acetylation of a forward autofeedback loop in actinomycetes (Kuhn et al.2014; Hentchel and Escalante-Semerena 2015; You et al.2016). In this study, we analyzed the different protein expression between a WT E. piscicida and an esrB mutant by proteomic investigation, ensuring genes regulated by EsrB. Then, electrophoretic mobility shift assay (EMSA) was used to determine whether EsrB regulates the expression of glnA, a gene involved in glutamine synthesis, by binding to the promoter of glnA. Finally, the effects on growth in vitro and colonization in vivo of glnA were determined. Our study facilitates a further comprehension of EsrB regulation of E. piscicida pathogenesis. MATERIALS AND METHODS Bacterial strains and culture conditions Bacterial strains and plasmids used in this study were provided in Table 1. For proteomic analysis, WT strain and the esrB mutant (ΔesrB) were statically cultured in 100 ml of Dulbecco's modified Eagle's medium (DMEM, Invitrogen, Grand Island, NY) at 28°C for 24 h (Lv et al.2012). The concentration of glutamine in DMEM (gln+) is 730 mg/L, which was 2-fold than that in DMEM. When required, antibiotics were added at the following final concentrations: kanamycin (Km), 50 μg ml−1; polymyxin B (Col), 10 μg ml−1. Table 1. Strains and plasmids used in this study. Strains or plasmids  Description  References  Edwardsiella piscicida      EIB202  WT, CCTCC no. M 208068, Colr, Cmr  Xiao et al.2009  EIB202 ΔP  EIB202, pEIB202 cured, Colr  Liu et al.2017a  ΔesrB  EIB202, in-frame deletion of esrB, Colr, Cmr  Lv et al.2012  ΔglnA  EIB202, in-frame deletion of glnA, Colr, Cmr  This study  Escherichia coli      DH5α λpir  Host for π requiring plasmids  Lv et al.2012  SM10 λpir  Host for π requiring plasmids, conjugal donor  Lv et al.2012  BL21(DE3)  Host strain for EsrB protein expression  Liu et al.2017b  Plasmids      pDMK  Suicide vector, pir dependent, R6K, SacBR, Kmr  Xiao et al.2009  Strains or plasmids  Description  References  Edwardsiella piscicida      EIB202  WT, CCTCC no. M 208068, Colr, Cmr  Xiao et al.2009  EIB202 ΔP  EIB202, pEIB202 cured, Colr  Liu et al.2017a  ΔesrB  EIB202, in-frame deletion of esrB, Colr, Cmr  Lv et al.2012  ΔglnA  EIB202, in-frame deletion of glnA, Colr, Cmr  This study  Escherichia coli      DH5α λpir  Host for π requiring plasmids  Lv et al.2012  SM10 λpir  Host for π requiring plasmids, conjugal donor  Lv et al.2012  BL21(DE3)  Host strain for EsrB protein expression  Liu et al.2017b  Plasmids      pDMK  Suicide vector, pir dependent, R6K, SacBR, Kmr  Xiao et al.2009  View Large Construction of the glnA deletion mutant The glnA deletion mutant (ΔglnA) was constructed by suicide plasmid pDMK according to site-directed mutagenesis procedures (Xiao et al.2009). PCR was performed to amplify sequences upstream and downstream of glnA. The primers used are listed in Table 2. The PCR products were cloned into the XbaI site of pDMK by isothermal assembly, as previously described (Yang et al.2017). The recombinant plasmid was conjugated into a WT EIB202 with selection for Km and Col. Then, the correct colony was screened for sucrose (12%) sensitivity, which typically indicates a double crossover event and thus, the occurrence of gene replacement. Additionally, the glnA deletion in the chromosome was confirmed by PCR and sequencing. Table 2. Primers used in this study. Name  Sequence (5΄-3΄)  glnA-P1  CCCCCCCGAGCTCAGGTTACCCGGATCTATGTGCGCAAT AATGGCGATGT  glnA-P2  GCCTGGCGTGCGTCGCGTTACATACTCTACTCCCGGT TTC  glnA-P3  GAAACCGGGAGTAGAGTATGTAACGCGACGCACGCC AGGC  glnA-P4  GAGTACGCGTCACTAGTGGGGCCCTTCTAGACCAGCATC ACCTCGTTGTC  glnA-P5  GAACGCCTTCTGGGTTACGA  glnA-P6  GTCCAGGGTTGAAAGCTCCA  glnA-P7  TTCGACGATATCCGCTTCGG  glnA-P8  CACCGGGATACGAATGGAGG  RT-eseB-F  CCCCTTTATCCAGCCCCTTG  RT-eseB-R  GCCAAGTTCAAGAAAGCGGG  RT-evpA-F  ATCTGTCATTCCGCACCGAG  RT-evpA-R  TTTTCAGGTCAGAGAGGCGG  RT-evpC-F  GGTAAGGCGATGATGTCGGT  RT-evpC-R  GTGGCCCCTGAGCATTGATA  RT-2758-F  CGACGCCCTGCTGAAAGATA  RT-2758-R  TCGTCATATTTCACCGCCGA  RT-1057-F  TGGAAAGGCAGGATGGCAG  RT-1057-R  CCTGCCCCTGACCATGAAAA  RT-glnA-F  CGGTTGATTCGGCTCAGGAT  RT-glnA-R  TCGTCCGCTTTCTTGGTCAT  RT-2186-F  CGGCAGGAGCGTGAACTC  RT-2186-R  ACCTCCTGACCGTTACGATAGA  RT-3492-F  CGCAGAACGGAGAGGTGTTA  RT-3492-R  TGCAACGTATCGAGACCGAC  Name  Sequence (5΄-3΄)  glnA-P1  CCCCCCCGAGCTCAGGTTACCCGGATCTATGTGCGCAAT AATGGCGATGT  glnA-P2  GCCTGGCGTGCGTCGCGTTACATACTCTACTCCCGGT TTC  glnA-P3  GAAACCGGGAGTAGAGTATGTAACGCGACGCACGCC AGGC  glnA-P4  GAGTACGCGTCACTAGTGGGGCCCTTCTAGACCAGCATC ACCTCGTTGTC  glnA-P5  GAACGCCTTCTGGGTTACGA  glnA-P6  GTCCAGGGTTGAAAGCTCCA  glnA-P7  TTCGACGATATCCGCTTCGG  glnA-P8  CACCGGGATACGAATGGAGG  RT-eseB-F  CCCCTTTATCCAGCCCCTTG  RT-eseB-R  GCCAAGTTCAAGAAAGCGGG  RT-evpA-F  ATCTGTCATTCCGCACCGAG  RT-evpA-R  TTTTCAGGTCAGAGAGGCGG  RT-evpC-F  GGTAAGGCGATGATGTCGGT  RT-evpC-R  GTGGCCCCTGAGCATTGATA  RT-2758-F  CGACGCCCTGCTGAAAGATA  RT-2758-R  TCGTCATATTTCACCGCCGA  RT-1057-F  TGGAAAGGCAGGATGGCAG  RT-1057-R  CCTGCCCCTGACCATGAAAA  RT-glnA-F  CGGTTGATTCGGCTCAGGAT  RT-glnA-R  TCGTCCGCTTTCTTGGTCAT  RT-2186-F  CGGCAGGAGCGTGAACTC  RT-2186-R  ACCTCCTGACCGTTACGATAGA  RT-3492-F  CGCAGAACGGAGAGGTGTTA  RT-3492-R  TGCAACGTATCGAGACCGAC  View Large Identification of proteins regulated by EsrB using two-dimensional gel electrophoresis Whole cell lysated protein isolation and two-dimensional gel electrophoresis (2-DGE), as well as matrix-assisted laser desorption/ionization time-of-flight/time-of-flight tandem mass (MALDI TOF/TOF) spectrometry were carried out as previously described (Lv et al.2013; Wang et al.2013). Moreover, samples were analyzed with triplicated 2-DGE at the same time. Verification of gene expression using quantitative real-time PCR Quantitative real-time PCR (qRT-PCR) was performed on the 7500 Real-Time PCR system under the following conditions: 95°C for 10 min, 40 cycles of 95°C for 15 s and 60°C for 1 min (Lv et al.2013). The genes and the primers were listed in Table 2. The comparative CT (2−ΔΔCT) method was used to quantitatively determine the transcriptional levels with the housekeeping gyrB gene as an internal standard in each strain (Livak and Schmittgen 2001). Turbot fish maintenance and competition index analysis Healthy turbot weighing 30 ± 5 g were chosen, and acclimatized for 2 weeks with a continuous flow of sand-filtered seawater at 14°C–16°C, using an aerated tank. Competitive index (CI) was determined using WT, WT(ΔP), ΔesrB and ΔglnA strains. The above strains were mixed into three groups: WT/WT(ΔP), WT/ΔesrB and WT/ΔglnA, and the infection dose was 105 CFU/fish. Liver from five turbot in each group was sampled after 5 days of infection and plated in deoxycholate hydrogen sulfide lactose agar (Eiken, Tokyo, Japan) containing 70 μg/ml chloramphenicol (Cm). Plates were cultured at 30°C overnight and the numbers of bacteria colonies were counted for CI determination. Purification of EsrB and EMSA Full-length 6His-tagged EsrB was purified using BL21 strains, harboring pET28a plasmid (Liu et al.2017b). In EMSA experiment, the 6His-tagged EsrB was mixed to Cy5-labled DNA probes firstly. Various concentrations of purified EsrB protein, 20 ng Cy5-DNA, 0.5 μl poly(dI:dC), 4 μl binding buffer and ddH2O were added and reached a total volume of 20 μl in each reaction mixture. After incubating the mixture at 25°C for 30 min, 6% polyacrylamide gel on ice was used to resolve the sample in 0.5 × TBE buffer (Tris/boric/EDTA) at 100 V for 120 min. Finally, a Typhoon FLA 9500 (GE Healthcare, Pittsburgh, PA, USA) was used for scan. Statistics Statistical analyses were performed using GraphPad Prism version 5.01 for Windows (GraphPad Software). A two-tailed Student's unpaired t-test was used to compare gene expression or densitometric reads between the groups with P < 0.05 as the significant difference. RESULTS Overview of the comparative proteomes between WT and ΔesrB strains In order to analyze the proteomes difference between WT and the ΔesrB strains, 2-DGE assay was used for whole-cell protein determination. A difference of at least 2-fold in spot intensity volume (P < 0.05) was considered as differential expression. As a result, approximately 880 protein spots were identified and 19 spots showed significantly different expression between WT and ΔesrB strains based on the criteria (Fig. 1a and b). Among these, 12 proteins showed upregulated expression, but 7 proteins showed downregulation in ΔesrB strain (Fig. 1c). Then, the 19 spots were cut out for MALDI TOF/TOF MS/MS analysis. Finally, each protein was successfully identified and classified according to the Clusters of Orthologous Groups (COG) system (Fig. 1d) (Wang et al.2009a). Figure 1. View largeDownload slide 2-DGE analysis of the differentially expressed proteomes in E. piscicida. Protein profiles of WT (a) and ΔesrB (b), which were static cultured in DMEM under 28°C, respectively. The labeled spots represented significantly differentially expressed proteins between WT and ΔesrB strains (P < 0.05) and analyzed with MALDI TOF/TOF MS/MS. (c) Decreased expression level of EvpC, EvpA and EseB and increased expression level of GlnA, YihK, and YaeT in ΔesrB. (d) Classification of 19 differentially expressed proteins according to COG. Figure 1. View largeDownload slide 2-DGE analysis of the differentially expressed proteomes in E. piscicida. Protein profiles of WT (a) and ΔesrB (b), which were static cultured in DMEM under 28°C, respectively. The labeled spots represented significantly differentially expressed proteins between WT and ΔesrB strains (P < 0.05) and analyzed with MALDI TOF/TOF MS/MS. (c) Decreased expression level of EvpC, EvpA and EseB and increased expression level of GlnA, YihK, and YaeT in ΔesrB. (d) Classification of 19 differentially expressed proteins according to COG. Among the seven proteins with decreased expression in ΔesrB, spot A1 was identified as transthyretin-like protein (spot A1), which was associated with energy production and conversion. Spot A3 was hypothesized to be connected to amino acid transport and metabolism, while spot A5 identified as thioredoxin (H-type, TRX-H) was associated with post-translational modification, protein turnover and chaperones. Besides, two proteins involved in type VI secretion system were identified: spot A4 for EvpC and spot A6 for EvpA. Moreover, two proteins including putative ribonuclease, T2 family (spot A2) and EspA family secreted protein (EseB, spot A7) were classified as function unknown based on COG classification. Of the 12 upregulated proteins, three proteins were related to amino acid transport and metabolism, including GS (GlnA, spot B4), glycine hydroxymethyltransferase (spot B11) and oligopeptide permease A (OppA, spot B12). Two proteins were involved in nucleotide transport and metabolism, including phosphoribosylformylglycinamidine cyclo-ligase (PurM, spot B1) and bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase (PurH, spot B8). Moreover, varieties of the overexpressed proteins showed that EsrB participates in a wide range of pathways in E. piscicida, such as energy production and conversion (putative iron-containing alcohol dehydrogenase, glycerol dehydrogenase [GldA, spot B3] and dihydrolipoamide dehydrogenase [LpdA, spot B9]), cell wall/membrane/envelope blogenesis (ADP-L-glycero-D-manno-heptose-6-epimerase [RfaD, spot B2]), signal transduction mechanisms (GTP-binding protein [YihK, spot B5]), carbohydrate transport and metabolism (transaldolase [TalB, spot B7]) and transcription (transcription antiterminator [NusG, spot B10]). The conserved outer membrane protein (YaeT, spot B6) had unknown function (Table 3). Taken together, these data indicated that EsrB was involved in various processes in E. piscicida during growth in DMEM. Table 3. Differentially expressed proteins between E. tarda WT and ΔesrB. Spot no.  Locus  Protein  NCBI accession no.  Protein description  Theor. MW (kDa)/pI  Score  Peptides matched  Fold change  A1  ETAE_1057    YP_003295113.1  Transthyretin-like protein  14.6/8.04  340  7  W  A2  ETAE_2758    YP_003296802.1  Ribonuclease, T2 family  27.5/7.56  475  11  –3.3  A3  ETAE_2757    YP_003296801.1  Hypothetical protein  33.7/5.37  467  16  –2.1  A4  ETAE_2431  EvpC  YP_003296477.1  T6SS protein EvpC  18.1/5.71  319  7  W  A5  ETAE_2186  Trx-H  YP_003296232.1  Thioredoxin (TRX-H)  14.0/8.71  354  5  W  A6  ETAE_2429  EvpA  YP_003296475.1  T6SS protein EvpA  19.4/5.29  895  15  W  A7  ETAE_0872  EseB  YP_003294928.1  T3SS protein EseB  21.8/5.51  536  10  W  B1  ETAE_1086  PurM  YP_003295142.1  Phosphoribosylformylglycinamidine cycloligase  37.2/5.03  185  9  2  B2  ETAE_0083  RfaD  YP_003294141.1  ADP-L-glycero-D-manno- heptose-6-epimerase  35.0/5.12  694  23  2.1  B3  ETAE_0899  GldA  YP_003294955.1  Glycerol dehydrogenase  39.0/5.12  414  5  2.2  B4  ETAE_3493  GlnA  YP_003297535.1  Glutamine synthetase  51.9/5.15  341  13  2.8  B5  ETAE_3492  YihK  YP_003297534.1  GTP-binding protein  67.3/5.18  223  10  Δ  B6  ETAE_0754  YaeT  YP_003294801.1  Outer membrane protein  88.2/5.47  623  25  2.3  B7  ETAE_0570  TalB  YP_003294628.1  Transaldolase B  35.0/5.61  678  20  2.1  B8  ETAE_0186  PurH  YP_003294244.1  IMP cyclohydrolase  57.7/5.6  403  15  2.4  B9  ETAE_0662  LpdA  YP_003294720.1  LpdA gene product  52.6/6.08  726  19  2.5  B10  ETAE_0171  NusG  YP_003294229.1  Transcription antiterminator  20.6/6.34  538  10  Δ  B11  ETAE_2821    YP_003296865.1  Glycine hydroxymethyltransferase  45.5/6.4  677  16  2.1  B12  ETAE_1512  OppA  YP_003295564.1  Oligopeptide permease A  61.5/6.54  545  19  2.2  Spot no.  Locus  Protein  NCBI accession no.  Protein description  Theor. MW (kDa)/pI  Score  Peptides matched  Fold change  A1  ETAE_1057    YP_003295113.1  Transthyretin-like protein  14.6/8.04  340  7  W  A2  ETAE_2758    YP_003296802.1  Ribonuclease, T2 family  27.5/7.56  475  11  –3.3  A3  ETAE_2757    YP_003296801.1  Hypothetical protein  33.7/5.37  467  16  –2.1  A4  ETAE_2431  EvpC  YP_003296477.1  T6SS protein EvpC  18.1/5.71  319  7  W  A5  ETAE_2186  Trx-H  YP_003296232.1  Thioredoxin (TRX-H)  14.0/8.71  354  5  W  A6  ETAE_2429  EvpA  YP_003296475.1  T6SS protein EvpA  19.4/5.29  895  15  W  A7  ETAE_0872  EseB  YP_003294928.1  T3SS protein EseB  21.8/5.51  536  10  W  B1  ETAE_1086  PurM  YP_003295142.1  Phosphoribosylformylglycinamidine cycloligase  37.2/5.03  185  9  2  B2  ETAE_0083  RfaD  YP_003294141.1  ADP-L-glycero-D-manno- heptose-6-epimerase  35.0/5.12  694  23  2.1  B3  ETAE_0899  GldA  YP_003294955.1  Glycerol dehydrogenase  39.0/5.12  414  5  2.2  B4  ETAE_3493  GlnA  YP_003297535.1  Glutamine synthetase  51.9/5.15  341  13  2.8  B5  ETAE_3492  YihK  YP_003297534.1  GTP-binding protein  67.3/5.18  223  10  Δ  B6  ETAE_0754  YaeT  YP_003294801.1  Outer membrane protein  88.2/5.47  623  25  2.3  B7  ETAE_0570  TalB  YP_003294628.1  Transaldolase B  35.0/5.61  678  20  2.1  B8  ETAE_0186  PurH  YP_003294244.1  IMP cyclohydrolase  57.7/5.6  403  15  2.4  B9  ETAE_0662  LpdA  YP_003294720.1  LpdA gene product  52.6/6.08  726  19  2.5  B10  ETAE_0171  NusG  YP_003294229.1  Transcription antiterminator  20.6/6.34  538  10  Δ  B11  ETAE_2821    YP_003296865.1  Glycine hydroxymethyltransferase  45.5/6.4  677  16  2.1  B12  ETAE_1512  OppA  YP_003295564.1  Oligopeptide permease A  61.5/6.54  545  19  2.2  View Large Transcriptional analysis of differentially expressed genes qRT-PCR analysis was used to characterize the expression levels of mRNAs for differentially expressed proteins. Seven out of the 19 identified proteins were selected for verification, including T3SS gene eseB; T6SS genes evpA and evpC; GS family gene glnA; other genes encoding various functions ETAE_1057, ETAE_2758, and ETAE_2186, with the housekeeping gene gyrB as the internal control (Fig. 2a). Given the resolution limitation of the 2-DGE proteomics analysis that precluded detecting all the possible differentially expressed protein spots, NtrB and NtrC were not observed as the differentially expressed proteins in our assays. As ntrBC resides in the same operon as glnA (Fig. 2b), qRT-PCR analysis shall further verify that their transcription is under the control of EsrB. Similarly, due to the low expression level of EsrB and the positive autoregulation of EsrB (Liu et al.2017b), we use qRT-PCR to detect esrB transcription as a control. As the results shown in Fig. 2a, all selected genes showed at least 2-fold change expression between WT and ΔesrB, suggesting that similar up- and downregulation of the differentially expressed proteins were observed at the transcriptional level. Figure 2. View largeDownload slide Genes regulated by EsrB. (a) Transcriptional variations of selected genes between WT and ΔesrB. (b) The potential binding box of EsrB in the promoter of glnA-ntrBC region (PglnA) in EIB202. Conserved 7-4-7΄ structure in the EsrB binding sequence was shown. (c) EsrB directly binding to PglnA according to EMSA. ORF region of glnA gene was used as a negative control. The experiments were performed in triplicates and repeated three times at least. Figure 2. View largeDownload slide Genes regulated by EsrB. (a) Transcriptional variations of selected genes between WT and ΔesrB. (b) The potential binding box of EsrB in the promoter of glnA-ntrBC region (PglnA) in EIB202. Conserved 7-4-7΄ structure in the EsrB binding sequence was shown. (c) EsrB directly binding to PglnA according to EMSA. ORF region of glnA gene was used as a negative control. The experiments were performed in triplicates and repeated three times at least. EsrB directly regulates the transcription of glnA As was shown in results of 2-DGE and qRT-PCR analysis (Figs 1c and 2a), expression of GlnA in WT and ΔesrB strains was significantly different. We hypothesized that EsrB might bind directly to the promoter of glnA. Indeed, a potential binding motif of EsrB was identified in the glnA promoter region through the gene sequence alignment using the previously reported binding box (Liu et al.2017b) (Fig. 2b). EMSA demonstrated that EsrB bound to the promoter of glnA, as the mobility of glnA promoter probe was retarded with the addition of EsrB proteins in the presence of an excess non-specific competitor DNA poly(dI:dC), and the shift could be counteracted with the addition of non-labeled glnA promoter probe. Furthermore, no shift was observed in the reaction mixture of EsrB and a DNA probe from the glnA open reading frame (ORF) region (Fig. 2c). These data demonstrated that EsrB represses the expression of GlnA through directly binding to the promoter region of glnA. EsrB regulation of glutamine synthesis affects growth in vitro To investigate the function of gene glnA, a glnA deletion mutant (ΔglnA) was constructed. Growth levels of WT, ΔesrB and ΔglnA strains were analyzed under four culture conditions: DMEM, DMEM gln− (without addition of glutamine), DMEM gln+ (excess addition of glutamine) and DMEM gln− glu− (without addition of glutamine and glutamate), at 28°C for 24 h. As a result, growth of ΔglnA in DMEM displayed a longer lag phase than WT strain and grew slowly (Fig. 3a), indicating that glnA is essential for growth. However, ΔesrB grew faster and showed a shorter lag phase, which could be resulted from the upregulation of GlnA. As the precursor of glutamine, no significant growth of the three stains was observed in the absence of glutamine and glutamate. In addition, ΔglnA strain barely grow in DMEM glutamine−, while a growth level close to that of WT strain was obtained in DMEM gln+. Figure 3. View largeDownload slide The effects of glnA on growth in vitro and in vivo. (a) Growth of WT, ΔesrB and ΔglnA in DMEM, DMEM (gln−, without addition of glutamine), DMEM (gln+, excess addition of glutamine) and DMEM (gln−, glu−, without addition of glutamine and glutamate). An asterisk indicates statistically significant difference in mean values as compared to the WT treated with the same conditions, by an unpaired, two-tailed Student's t-test (P value < 0.001). (b) ΔglnA was significantly impaired in its colonization to turbot fish according to CI assays. No significant difference was observed between ΔglnA and ΔesrB. Figure 3. View largeDownload slide The effects of glnA on growth in vitro and in vivo. (a) Growth of WT, ΔesrB and ΔglnA in DMEM, DMEM (gln−, without addition of glutamine), DMEM (gln+, excess addition of glutamine) and DMEM (gln−, glu−, without addition of glutamine and glutamate). An asterisk indicates statistically significant difference in mean values as compared to the WT treated with the same conditions, by an unpaired, two-tailed Student's t-test (P value < 0.001). (b) ΔglnA was significantly impaired in its colonization to turbot fish according to CI assays. No significant difference was observed between ΔglnA and ΔesrB. ΔglnA was attenuated in its colonization in vivo To further explore whether glnA influences the infection in vivo, CI experiment was performed using turbot, which were the natural host of E. piscicida. As was shown in Fig. 3b, ΔglnA strain was strongly outcompeted by WT at least 2 logs, indicating the growth defect of ΔglnA in vivo. DISCUSSION RR EsrB has been established to be a global regulator in E. piscicida and is essential for virulence regulation (Leung et al.2012; Lv et al.2012; Park, Aoki and Jung 2012; Liu et al.2017b). However, the regulatory functions of EsrB other than virulence pathways are still unclear. In this study, protein expression profiles were analyzed to define potential target proteins affected by EsrB in E. piscicida cultured in DMEM. A total of 19 proteins were identified as being expressed in an EsrB-dependent manner. Twelve proteins were found to be repressed by EsrB, while seven proteins were positively regulated. These proteins were associated with a variety of processes, such as cellular processes, signaling information storage processes and metabolism processes. Besides the already known regulons (EseB, EvpA and EvpC; Wang et al.2010), some core-genome-encoded proteins such as GlnA, PurM, and OppA (Wang et al.2009a; Tomljenovic-Berube et al.2010) were also identified. Homology with SsrA-SsrB in Salmonella, EsrA-EsrB was horizontally acquired by E. piscicida along with T3SS during the long-term evolution (Leung et al.2012; Shao et al.2015). It is indicated in this study that EsrA-EsrB not only participates in the regulation of horizontally transferred genes, but also plays important roles in regulating the expression of core-genome genes, e.g. amino acids biosynthesis pathways. GlnA is a part of GS, which is an essential enzyme in ammonia assimilation and glutamine biosynthesis pathways. According to 2-DGE assays, GlnA exhibited a higher expression level in ΔesrB compared with that in WT cells grown in DMEM. Similarly, when cultured in DMEM at 28°C, WT exhibited a higher growth rate than ΔglnA, but a lower rate than ΔesrB, and it could be partly eliminated by the addition of glutamine. This phenomenon corroborated the 2-DGE results, and also indicated that the growth rate differences between WT and ΔesrB were not only because of the different expression level of GlnA, but also because of other metabolism-related proteins regulated by EsrB, such as the ones identified in this study. Besides acting as an enzyme, GlnA could also function as a chaperon and participate in regulation actions. Recently, GlnA has been identified as a chaperon of GlnR, a regulator affecting gene expression globally to nitrogen metabolism. Accompanying with GlnA, GlnR could regulate glnA operon efficiently (Kuhn et al.2014; Hentchel and Escalante-Semerena 2015; You et al.2016). Since no GlnR was identified in E. piscicida, and EsrB was herein identified as a repressor of GlnA, we suggested that EsrB might play the same role as GlnR in E. piscicida. Similarly, GlnA might be a chaperon of EsrB, and could influence the activities of EsrB, which invites further investigation in the future. Little nutrition was found in macrophages, especially the carbon and nitrogen sources. Previously, we found that the deletion of esrB significantly attenuated the virulence of E. piscicida; however, ΔesrB could exist in macrophage for a longer time than that of WT (Liu et al.2017b). Here, high level of GlnA in ΔesrB might lead to the effective use of limited nitrogen sources, which was beneficial for ΔesrB to survive in macrophages. But it might not be the only reason to explain this phenomenon, enhanced reactive oxygen species resistance of ΔesrB can also be a reason for the high survival rate in macrophages (Yin et al.2017). Precisely, EsrB plays an important role in bacterial infection and survival processes in vitro. With a saturated transposon insertion library, we recently analyzed the conditional essential gene sets of the bacteria during in vivo conditional selection in turbot (Yang et al.2017). We discovered that glnA was a conditional essential gene as T3/T6SS genes (Yang et al.2017). CI analysis also revealed that the deletion of glnA significantly impaired the colonization in fish to the similar level in ΔesrB (Fig. 3b). However, there remains a question that why EsrB represses the expression of essential gene glnA. In conclusion, 19 proteins influenced by EsrB in E. piscicida were identified, with 7 proteins downregulated and 12 proteins upregulated. In particular, GlnA, a GS essential for ammonia assimilation and glutamine biosynthesis from glutamate, was negatively regulated by EsrB. Our study highlighted the regulatory function of EsrB on the nitrogen metabolism pathway in E. piscicida, which will further facilitate the understanding of pathogenesis of this bacterium. FUNDING The study was supported by National Natural Science Foundation of China, Nos. 31430090 (YXZ), 31602200 (XHL) and 31400122 (MJY), the Ministry of Agriculture of China, No. CARS-47 (QYW), and Shanghai Pujiang Program, No. 16PJD018 (QYW). Conflict of interest. None declared. REFERENCES Abayneh T, Colquhoun DJ, Sørum H. Edwardsiella piscicida sp. nov., a novel species pathogenic to fish. J Appl Microbiol  2013; 114: 644– 54. Google Scholar CrossRef Search ADS PubMed  Abbott SL, Janda JM. The genus Edwardsiella. In: The Prokaryotes, Proteobacteria: Gamma Class , 3rd edn, 6. New York: Springer, 2006, 72– 89. Google Scholar CrossRef Search ADS   Hentchel KL, Escalante-Semerena JC. Acylation of biomolecules in prokaryotes: a widespread strategy for the control of biological function and metabolic stress. Microbiol Mol Biol Rev  2015; 79: 321– 46. Google Scholar CrossRef Search ADS PubMed  Kuhn ML, Zemaitaitis B, Hu L et al.   Structural, kinetic and proteomic characterization of acetyl phosphate-dependent bacterial protein acetylation. PLoS One  2014; 9: e94816. Google Scholar CrossRef Search ADS PubMed  Leung KY, Siame BA, Tenkink BJ et al. Edwardsiella tarda: virulence mechanisms of an emerging gastroenteritis pathogen. Microbes Infect  2012; 14: 26– 34. Google Scholar CrossRef Search ADS PubMed  Liu Y, Gao YN, Liu XH et al.   Transposon insertion sequencing reveals T4SS as the major genetic trait for conjugation transfer of multi-drug resistance pEIB202 from Edwardsiella. BMC Microbiol  2017a; 17: 112. Google Scholar CrossRef Search ADS   Liu Y, Zhao LY, Yang MJ et al.   Transcriptomic dissection of the horizontally acquired response regulator EsrB reveals its global regulatory roles in the physiological adaptation and activation of T3SS and the cognate effector repertoire in Edwardsiella piscicida during infection toward turbot. Virulence  2017b; 8: 1355– 77. Google Scholar CrossRef Search ADS   Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods  2001; 25: 402– 8. Google Scholar CrossRef Search ADS PubMed  Lv YZ, Xiao JF, Liu Q et al.   Systematic mutation analysis of two-component signal transduction systems reveals EsrA-EsrB and PhoP-PhoQ as the major virulence regulators in Edwardsiella tarda. Vet Microbiol  2012; 157: 190– 9. Google Scholar CrossRef Search ADS PubMed  Lv YZ, Yin KY, Shao S et al.   Comparative proteomic analysis reveals new components of the PhoP regulon and highlights a role for PhoP in the regulation of genes encoding the F1F0 ATP synthase in Edwardsiella tarda. Microbiol  2013; 159: 1340– 51. Google Scholar CrossRef Search ADS   Mo ZL, Peng X, Xiang MY et al.   Construction and characterization of a live, attenuated esrB mutant of Edwardsiella tarda and its potential as a vaccine against the haemorrhagic septicaemia in turbot, Scophthamus maximus (L.). Fish Shellfish Immunol  2007; 23: 521– 30. Google Scholar CrossRef Search ADS PubMed  Mohanty BR, Sahoo PK. Edwardsiellosisin fish: a brief review. J Biosci  2007; 32: 1331– 44. Google Scholar CrossRef Search ADS PubMed  Park SB, Aoki T, Jung TS. Pathogenesis of and strategies for preventing Edwardsiella tarda infection in fish. Vet Res  2012; 43: 1– 11. Google Scholar CrossRef Search ADS PubMed  Shao S, Lai QL, Liu Q et al.   Phylogenomics characterization of a highly virulent Edwardsiella strain ET080813T encoding two distinct T3SS and three T6SS geneclusters: Propose a novel species as Edwardsiella anguillarum sp. nov. Syst Appl Microbiol  2015; 38: 36– 47. Google Scholar CrossRef Search ADS PubMed  Tomljenovic-Berube AM, Mulder DT, Whiteside MD et al.   Identification of the regulatory logic controlling Salmonella pathoadaptation by the SsrA-SsrB two-component system. PLoS Genet  2010; 6: e1000875. Google Scholar CrossRef Search ADS PubMed  Wang QY, Yang MJ, Xiao JF et al.   Genome sequence of the versatile fish pathogen Edwardsiella tarda provides insights into its adaptation to broad host ranges and intracellular niches. PLoS One  2009a; 4: e7646. Google Scholar CrossRef Search ADS   Wang X, Wang QY, Xiao JF et al. Edwardsiella tarda T6SS component evpP is regulated by esrB and iron and plays essential roles in the invasion of fish. Fish Shellfish Immunol  2009b; 27: 469– 77. Google Scholar CrossRef Search ADS   Wang X, Wang QY, Xiao JF et al.   Hemolysin EthA in Edwardsiella tarda is essential for fish invasion in vivo and in vitro and regulated by two-component system EsrA-EsrB and nucleoid protein HhaEt. Fish Shellfish Immunol  2010; 29: 1082– 91. Google Scholar CrossRef Search ADS PubMed  Wang YM, Wang QY, Yang MJ et al.   Proteomic analysis of a twin-arginine translocation-deficient mutant unravel its functions involved in stress adaptation andvirulence in fish pathogen Edwardsiella tarda. FEMS Microbiol Lett  2013; 343: 145– 55. Google Scholar CrossRef Search ADS PubMed  Xiao JF, Chen T, Liu B et al. Edwardsiella tarda mutant disrupted in type III secretion system and chorismic acid synthesis and cured of a plasmid as a live attenuated vaccine in turbot. Fish Shellfish Immunol  2013; 35: 632– 41. Google Scholar CrossRef Search ADS PubMed  Xiao JF, Wang QY, Liu Q et al.   Characterization of Edwardsiella tarda rpoS: effect on serum resistance, chondroitinase activity, biofilm formation, and autoinducer synthetases expression. Appl Microbiol Biot  2009; 83: 151– 60. Google Scholar CrossRef Search ADS   Yang GH, Billings G, Hubbard TP et al.   Time-resolved transposon insertion sequencing reveals genome-wide fitness dynamics during infection. mBio  2017; 8: e01581– 17. Google Scholar PubMed  Yang MJ, Lv YZ, Xiao JF et al. Edwardsiella comparative phylogenomics reveal the new intra/inter-species taxonomic relationships virulence evolution and niche adaptation mechanisms. PLoS One  2012; 7: e36987. Google Scholar CrossRef Search ADS PubMed  Yin KY, Wang QY, Xiao JF et al.   Comparative proteomic analysis unravels a role for EsrB in the regulation of reactive oxygen species stress responses in Edwardsiella piscicida. FEMS Microbiol Lett  2017; 364: fnw269. Google Scholar CrossRef Search ADS PubMed  You D, Yin BC, Li ZH et al.   Sirtuin-dependent reversible lysine acetylation of glutamine synthetases reveals an autofeedback loop in nitrogen metabolism. P Natl Acad Sci USA  2016; 113: 6653– 8. Google Scholar CrossRef Search ADS   © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png FEMS Microbiology Letters Oxford University Press

EsrB negatively regulates expression of the glutamine sythetase GlnA in the fish pathogen Edwardsiella piscicida

Loading next page...
 
/lp/ou_press/esrb-negatively-regulates-expression-of-the-glutamine-sythetase-glna-1VEnMOuMwY
Publisher
Oxford University Press
Copyright
© FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
0378-1097
eISSN
1574-6968
D.O.I.
10.1093/femsle/fny007
Publisher site
See Article on Publisher Site

Abstract

Abstract Edwardsiella piscicida is a gram-negative bacterial pathogen invading a wide range of fish species. Response regulator EsrB is essential for the activation of type III and type VI secretion systems (T3/T6SS). In this study, proteomes of the wild-type E. piscicida EIB202 and ΔesrB mutant strains were compared to identify the regulon components of EsrB cultured in DMEM allowing T3/T6SS expression. As a result, 19 proteins showed different expression, which were identified to be associated with T3/T6SS, related to amino acid transport and metabolism, and energy production. Particularly, GlnA, a glutamine synthetase essential for ammonia assimilation and glutamine biosynthesis from glutamate, was found to be regulated negatively by EsrB. Moreover, GlnA affected bacterial growth in vitro and bacterial colonization in vivo. Collectively, our results indicated that EsrB plays important roles in regulating the expression of metabolic pathways and virulence genes, including glutamine biosynthesis in E. piscicida during infection. comparative proteomics, EsrB, Edwardsiella piscicida, glnA INTRODUCTION As a member of Enterobacteriaceae family, Edwardsiella piscicida inhabits a broad range of hosts, such as fish, birds, reptiles, amphibians and humans (Abbott and Janda 2006; Abayneh, Colquhoun and Sørum 2013; Shao et al.2015). Symptoms of the infection caused by E. piscicida include liver abscess, gastroenteritis, meningitis, septicemia and wound infection (Mohanty and Sahoo 2007). Increasing outbreaks of edwardsiellosis caused by E. piscicida around the world lead to enormous losses to freshwater and marine aquaculture industries (Park, Aoki and Jung 2012). Two-component systems (TCSs) are essential for bacterial pathogens to sense and respond to stress signals from environments and hosts. EsrB is the response regulator (RR) of the TCS EsrA-EsrB in E. piscicida, homologous to SsrA-SsrB in Salmonella (Wang et al.2010; Lv et al.2012). In E. piscicida EIB202, a systematic analysis of phenotypes of RR mutants related to biofilm formation and virulence gene expression was carried out (Wang et al.2009a; Lv et al.2012; Yang et al.2012). For instance, EsrB regulates type III and type VI secretion systems (T3/T6SS), the important bacterial virulence determinants in E. piscicida in vivo and in vitro (Wang et al.2009b; Leung et al.2012; Park, Aoki and Jung 2012; Liu et al.2017b). Deletion mutants of esrA and esrB adhered more efficiently to epithelial cells and fishes but displayed lower virulence compared with the wild type (WT; Wang et al.2010; Yang et al.2012). Significantly impaired virulence in an esrB mutant suggests that the esrB gene merits as a potential target for a live attenuated vaccine construction (Mo et al.2007; Xiao et al.2013). RNA-seq analysis dissected the EsrB regulon, and systematic knocking out nine EsrB-regulated T3SS effectors abrogated the capacities of the bacterium to cause disease in a fish model (Liu et al.2017b). Therefore, EsrB plays critical roles in controlling the pathogenesis of E. piscicida. It would be interesting to decipher proteins regulated by EsrB during infection, which will lead to control of the bacterial disease. Glutamine synthetase (GS) plays an essential role in converting glutamate to glutamine. It is also involved in various regulatory mechanisms and chaperone activities in many microorganisms. GS consists of various subunits, including GlnA, GlnR, GlnL and GlnG. glnA is an important part of GS gene cluster, which uses the same promoter to regulate GS-related functions (Wang et al.2009a). Recently, GlnA has been revealed to participate in nitrogen metabolism and lysine acetylation of a forward autofeedback loop in actinomycetes (Kuhn et al.2014; Hentchel and Escalante-Semerena 2015; You et al.2016). In this study, we analyzed the different protein expression between a WT E. piscicida and an esrB mutant by proteomic investigation, ensuring genes regulated by EsrB. Then, electrophoretic mobility shift assay (EMSA) was used to determine whether EsrB regulates the expression of glnA, a gene involved in glutamine synthesis, by binding to the promoter of glnA. Finally, the effects on growth in vitro and colonization in vivo of glnA were determined. Our study facilitates a further comprehension of EsrB regulation of E. piscicida pathogenesis. MATERIALS AND METHODS Bacterial strains and culture conditions Bacterial strains and plasmids used in this study were provided in Table 1. For proteomic analysis, WT strain and the esrB mutant (ΔesrB) were statically cultured in 100 ml of Dulbecco's modified Eagle's medium (DMEM, Invitrogen, Grand Island, NY) at 28°C for 24 h (Lv et al.2012). The concentration of glutamine in DMEM (gln+) is 730 mg/L, which was 2-fold than that in DMEM. When required, antibiotics were added at the following final concentrations: kanamycin (Km), 50 μg ml−1; polymyxin B (Col), 10 μg ml−1. Table 1. Strains and plasmids used in this study. Strains or plasmids  Description  References  Edwardsiella piscicida      EIB202  WT, CCTCC no. M 208068, Colr, Cmr  Xiao et al.2009  EIB202 ΔP  EIB202, pEIB202 cured, Colr  Liu et al.2017a  ΔesrB  EIB202, in-frame deletion of esrB, Colr, Cmr  Lv et al.2012  ΔglnA  EIB202, in-frame deletion of glnA, Colr, Cmr  This study  Escherichia coli      DH5α λpir  Host for π requiring plasmids  Lv et al.2012  SM10 λpir  Host for π requiring plasmids, conjugal donor  Lv et al.2012  BL21(DE3)  Host strain for EsrB protein expression  Liu et al.2017b  Plasmids      pDMK  Suicide vector, pir dependent, R6K, SacBR, Kmr  Xiao et al.2009  Strains or plasmids  Description  References  Edwardsiella piscicida      EIB202  WT, CCTCC no. M 208068, Colr, Cmr  Xiao et al.2009  EIB202 ΔP  EIB202, pEIB202 cured, Colr  Liu et al.2017a  ΔesrB  EIB202, in-frame deletion of esrB, Colr, Cmr  Lv et al.2012  ΔglnA  EIB202, in-frame deletion of glnA, Colr, Cmr  This study  Escherichia coli      DH5α λpir  Host for π requiring plasmids  Lv et al.2012  SM10 λpir  Host for π requiring plasmids, conjugal donor  Lv et al.2012  BL21(DE3)  Host strain for EsrB protein expression  Liu et al.2017b  Plasmids      pDMK  Suicide vector, pir dependent, R6K, SacBR, Kmr  Xiao et al.2009  View Large Construction of the glnA deletion mutant The glnA deletion mutant (ΔglnA) was constructed by suicide plasmid pDMK according to site-directed mutagenesis procedures (Xiao et al.2009). PCR was performed to amplify sequences upstream and downstream of glnA. The primers used are listed in Table 2. The PCR products were cloned into the XbaI site of pDMK by isothermal assembly, as previously described (Yang et al.2017). The recombinant plasmid was conjugated into a WT EIB202 with selection for Km and Col. Then, the correct colony was screened for sucrose (12%) sensitivity, which typically indicates a double crossover event and thus, the occurrence of gene replacement. Additionally, the glnA deletion in the chromosome was confirmed by PCR and sequencing. Table 2. Primers used in this study. Name  Sequence (5΄-3΄)  glnA-P1  CCCCCCCGAGCTCAGGTTACCCGGATCTATGTGCGCAAT AATGGCGATGT  glnA-P2  GCCTGGCGTGCGTCGCGTTACATACTCTACTCCCGGT TTC  glnA-P3  GAAACCGGGAGTAGAGTATGTAACGCGACGCACGCC AGGC  glnA-P4  GAGTACGCGTCACTAGTGGGGCCCTTCTAGACCAGCATC ACCTCGTTGTC  glnA-P5  GAACGCCTTCTGGGTTACGA  glnA-P6  GTCCAGGGTTGAAAGCTCCA  glnA-P7  TTCGACGATATCCGCTTCGG  glnA-P8  CACCGGGATACGAATGGAGG  RT-eseB-F  CCCCTTTATCCAGCCCCTTG  RT-eseB-R  GCCAAGTTCAAGAAAGCGGG  RT-evpA-F  ATCTGTCATTCCGCACCGAG  RT-evpA-R  TTTTCAGGTCAGAGAGGCGG  RT-evpC-F  GGTAAGGCGATGATGTCGGT  RT-evpC-R  GTGGCCCCTGAGCATTGATA  RT-2758-F  CGACGCCCTGCTGAAAGATA  RT-2758-R  TCGTCATATTTCACCGCCGA  RT-1057-F  TGGAAAGGCAGGATGGCAG  RT-1057-R  CCTGCCCCTGACCATGAAAA  RT-glnA-F  CGGTTGATTCGGCTCAGGAT  RT-glnA-R  TCGTCCGCTTTCTTGGTCAT  RT-2186-F  CGGCAGGAGCGTGAACTC  RT-2186-R  ACCTCCTGACCGTTACGATAGA  RT-3492-F  CGCAGAACGGAGAGGTGTTA  RT-3492-R  TGCAACGTATCGAGACCGAC  Name  Sequence (5΄-3΄)  glnA-P1  CCCCCCCGAGCTCAGGTTACCCGGATCTATGTGCGCAAT AATGGCGATGT  glnA-P2  GCCTGGCGTGCGTCGCGTTACATACTCTACTCCCGGT TTC  glnA-P3  GAAACCGGGAGTAGAGTATGTAACGCGACGCACGCC AGGC  glnA-P4  GAGTACGCGTCACTAGTGGGGCCCTTCTAGACCAGCATC ACCTCGTTGTC  glnA-P5  GAACGCCTTCTGGGTTACGA  glnA-P6  GTCCAGGGTTGAAAGCTCCA  glnA-P7  TTCGACGATATCCGCTTCGG  glnA-P8  CACCGGGATACGAATGGAGG  RT-eseB-F  CCCCTTTATCCAGCCCCTTG  RT-eseB-R  GCCAAGTTCAAGAAAGCGGG  RT-evpA-F  ATCTGTCATTCCGCACCGAG  RT-evpA-R  TTTTCAGGTCAGAGAGGCGG  RT-evpC-F  GGTAAGGCGATGATGTCGGT  RT-evpC-R  GTGGCCCCTGAGCATTGATA  RT-2758-F  CGACGCCCTGCTGAAAGATA  RT-2758-R  TCGTCATATTTCACCGCCGA  RT-1057-F  TGGAAAGGCAGGATGGCAG  RT-1057-R  CCTGCCCCTGACCATGAAAA  RT-glnA-F  CGGTTGATTCGGCTCAGGAT  RT-glnA-R  TCGTCCGCTTTCTTGGTCAT  RT-2186-F  CGGCAGGAGCGTGAACTC  RT-2186-R  ACCTCCTGACCGTTACGATAGA  RT-3492-F  CGCAGAACGGAGAGGTGTTA  RT-3492-R  TGCAACGTATCGAGACCGAC  View Large Identification of proteins regulated by EsrB using two-dimensional gel electrophoresis Whole cell lysated protein isolation and two-dimensional gel electrophoresis (2-DGE), as well as matrix-assisted laser desorption/ionization time-of-flight/time-of-flight tandem mass (MALDI TOF/TOF) spectrometry were carried out as previously described (Lv et al.2013; Wang et al.2013). Moreover, samples were analyzed with triplicated 2-DGE at the same time. Verification of gene expression using quantitative real-time PCR Quantitative real-time PCR (qRT-PCR) was performed on the 7500 Real-Time PCR system under the following conditions: 95°C for 10 min, 40 cycles of 95°C for 15 s and 60°C for 1 min (Lv et al.2013). The genes and the primers were listed in Table 2. The comparative CT (2−ΔΔCT) method was used to quantitatively determine the transcriptional levels with the housekeeping gyrB gene as an internal standard in each strain (Livak and Schmittgen 2001). Turbot fish maintenance and competition index analysis Healthy turbot weighing 30 ± 5 g were chosen, and acclimatized for 2 weeks with a continuous flow of sand-filtered seawater at 14°C–16°C, using an aerated tank. Competitive index (CI) was determined using WT, WT(ΔP), ΔesrB and ΔglnA strains. The above strains were mixed into three groups: WT/WT(ΔP), WT/ΔesrB and WT/ΔglnA, and the infection dose was 105 CFU/fish. Liver from five turbot in each group was sampled after 5 days of infection and plated in deoxycholate hydrogen sulfide lactose agar (Eiken, Tokyo, Japan) containing 70 μg/ml chloramphenicol (Cm). Plates were cultured at 30°C overnight and the numbers of bacteria colonies were counted for CI determination. Purification of EsrB and EMSA Full-length 6His-tagged EsrB was purified using BL21 strains, harboring pET28a plasmid (Liu et al.2017b). In EMSA experiment, the 6His-tagged EsrB was mixed to Cy5-labled DNA probes firstly. Various concentrations of purified EsrB protein, 20 ng Cy5-DNA, 0.5 μl poly(dI:dC), 4 μl binding buffer and ddH2O were added and reached a total volume of 20 μl in each reaction mixture. After incubating the mixture at 25°C for 30 min, 6% polyacrylamide gel on ice was used to resolve the sample in 0.5 × TBE buffer (Tris/boric/EDTA) at 100 V for 120 min. Finally, a Typhoon FLA 9500 (GE Healthcare, Pittsburgh, PA, USA) was used for scan. Statistics Statistical analyses were performed using GraphPad Prism version 5.01 for Windows (GraphPad Software). A two-tailed Student's unpaired t-test was used to compare gene expression or densitometric reads between the groups with P < 0.05 as the significant difference. RESULTS Overview of the comparative proteomes between WT and ΔesrB strains In order to analyze the proteomes difference between WT and the ΔesrB strains, 2-DGE assay was used for whole-cell protein determination. A difference of at least 2-fold in spot intensity volume (P < 0.05) was considered as differential expression. As a result, approximately 880 protein spots were identified and 19 spots showed significantly different expression between WT and ΔesrB strains based on the criteria (Fig. 1a and b). Among these, 12 proteins showed upregulated expression, but 7 proteins showed downregulation in ΔesrB strain (Fig. 1c). Then, the 19 spots were cut out for MALDI TOF/TOF MS/MS analysis. Finally, each protein was successfully identified and classified according to the Clusters of Orthologous Groups (COG) system (Fig. 1d) (Wang et al.2009a). Figure 1. View largeDownload slide 2-DGE analysis of the differentially expressed proteomes in E. piscicida. Protein profiles of WT (a) and ΔesrB (b), which were static cultured in DMEM under 28°C, respectively. The labeled spots represented significantly differentially expressed proteins between WT and ΔesrB strains (P < 0.05) and analyzed with MALDI TOF/TOF MS/MS. (c) Decreased expression level of EvpC, EvpA and EseB and increased expression level of GlnA, YihK, and YaeT in ΔesrB. (d) Classification of 19 differentially expressed proteins according to COG. Figure 1. View largeDownload slide 2-DGE analysis of the differentially expressed proteomes in E. piscicida. Protein profiles of WT (a) and ΔesrB (b), which were static cultured in DMEM under 28°C, respectively. The labeled spots represented significantly differentially expressed proteins between WT and ΔesrB strains (P < 0.05) and analyzed with MALDI TOF/TOF MS/MS. (c) Decreased expression level of EvpC, EvpA and EseB and increased expression level of GlnA, YihK, and YaeT in ΔesrB. (d) Classification of 19 differentially expressed proteins according to COG. Among the seven proteins with decreased expression in ΔesrB, spot A1 was identified as transthyretin-like protein (spot A1), which was associated with energy production and conversion. Spot A3 was hypothesized to be connected to amino acid transport and metabolism, while spot A5 identified as thioredoxin (H-type, TRX-H) was associated with post-translational modification, protein turnover and chaperones. Besides, two proteins involved in type VI secretion system were identified: spot A4 for EvpC and spot A6 for EvpA. Moreover, two proteins including putative ribonuclease, T2 family (spot A2) and EspA family secreted protein (EseB, spot A7) were classified as function unknown based on COG classification. Of the 12 upregulated proteins, three proteins were related to amino acid transport and metabolism, including GS (GlnA, spot B4), glycine hydroxymethyltransferase (spot B11) and oligopeptide permease A (OppA, spot B12). Two proteins were involved in nucleotide transport and metabolism, including phosphoribosylformylglycinamidine cyclo-ligase (PurM, spot B1) and bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase (PurH, spot B8). Moreover, varieties of the overexpressed proteins showed that EsrB participates in a wide range of pathways in E. piscicida, such as energy production and conversion (putative iron-containing alcohol dehydrogenase, glycerol dehydrogenase [GldA, spot B3] and dihydrolipoamide dehydrogenase [LpdA, spot B9]), cell wall/membrane/envelope blogenesis (ADP-L-glycero-D-manno-heptose-6-epimerase [RfaD, spot B2]), signal transduction mechanisms (GTP-binding protein [YihK, spot B5]), carbohydrate transport and metabolism (transaldolase [TalB, spot B7]) and transcription (transcription antiterminator [NusG, spot B10]). The conserved outer membrane protein (YaeT, spot B6) had unknown function (Table 3). Taken together, these data indicated that EsrB was involved in various processes in E. piscicida during growth in DMEM. Table 3. Differentially expressed proteins between E. tarda WT and ΔesrB. Spot no.  Locus  Protein  NCBI accession no.  Protein description  Theor. MW (kDa)/pI  Score  Peptides matched  Fold change  A1  ETAE_1057    YP_003295113.1  Transthyretin-like protein  14.6/8.04  340  7  W  A2  ETAE_2758    YP_003296802.1  Ribonuclease, T2 family  27.5/7.56  475  11  –3.3  A3  ETAE_2757    YP_003296801.1  Hypothetical protein  33.7/5.37  467  16  –2.1  A4  ETAE_2431  EvpC  YP_003296477.1  T6SS protein EvpC  18.1/5.71  319  7  W  A5  ETAE_2186  Trx-H  YP_003296232.1  Thioredoxin (TRX-H)  14.0/8.71  354  5  W  A6  ETAE_2429  EvpA  YP_003296475.1  T6SS protein EvpA  19.4/5.29  895  15  W  A7  ETAE_0872  EseB  YP_003294928.1  T3SS protein EseB  21.8/5.51  536  10  W  B1  ETAE_1086  PurM  YP_003295142.1  Phosphoribosylformylglycinamidine cycloligase  37.2/5.03  185  9  2  B2  ETAE_0083  RfaD  YP_003294141.1  ADP-L-glycero-D-manno- heptose-6-epimerase  35.0/5.12  694  23  2.1  B3  ETAE_0899  GldA  YP_003294955.1  Glycerol dehydrogenase  39.0/5.12  414  5  2.2  B4  ETAE_3493  GlnA  YP_003297535.1  Glutamine synthetase  51.9/5.15  341  13  2.8  B5  ETAE_3492  YihK  YP_003297534.1  GTP-binding protein  67.3/5.18  223  10  Δ  B6  ETAE_0754  YaeT  YP_003294801.1  Outer membrane protein  88.2/5.47  623  25  2.3  B7  ETAE_0570  TalB  YP_003294628.1  Transaldolase B  35.0/5.61  678  20  2.1  B8  ETAE_0186  PurH  YP_003294244.1  IMP cyclohydrolase  57.7/5.6  403  15  2.4  B9  ETAE_0662  LpdA  YP_003294720.1  LpdA gene product  52.6/6.08  726  19  2.5  B10  ETAE_0171  NusG  YP_003294229.1  Transcription antiterminator  20.6/6.34  538  10  Δ  B11  ETAE_2821    YP_003296865.1  Glycine hydroxymethyltransferase  45.5/6.4  677  16  2.1  B12  ETAE_1512  OppA  YP_003295564.1  Oligopeptide permease A  61.5/6.54  545  19  2.2  Spot no.  Locus  Protein  NCBI accession no.  Protein description  Theor. MW (kDa)/pI  Score  Peptides matched  Fold change  A1  ETAE_1057    YP_003295113.1  Transthyretin-like protein  14.6/8.04  340  7  W  A2  ETAE_2758    YP_003296802.1  Ribonuclease, T2 family  27.5/7.56  475  11  –3.3  A3  ETAE_2757    YP_003296801.1  Hypothetical protein  33.7/5.37  467  16  –2.1  A4  ETAE_2431  EvpC  YP_003296477.1  T6SS protein EvpC  18.1/5.71  319  7  W  A5  ETAE_2186  Trx-H  YP_003296232.1  Thioredoxin (TRX-H)  14.0/8.71  354  5  W  A6  ETAE_2429  EvpA  YP_003296475.1  T6SS protein EvpA  19.4/5.29  895  15  W  A7  ETAE_0872  EseB  YP_003294928.1  T3SS protein EseB  21.8/5.51  536  10  W  B1  ETAE_1086  PurM  YP_003295142.1  Phosphoribosylformylglycinamidine cycloligase  37.2/5.03  185  9  2  B2  ETAE_0083  RfaD  YP_003294141.1  ADP-L-glycero-D-manno- heptose-6-epimerase  35.0/5.12  694  23  2.1  B3  ETAE_0899  GldA  YP_003294955.1  Glycerol dehydrogenase  39.0/5.12  414  5  2.2  B4  ETAE_3493  GlnA  YP_003297535.1  Glutamine synthetase  51.9/5.15  341  13  2.8  B5  ETAE_3492  YihK  YP_003297534.1  GTP-binding protein  67.3/5.18  223  10  Δ  B6  ETAE_0754  YaeT  YP_003294801.1  Outer membrane protein  88.2/5.47  623  25  2.3  B7  ETAE_0570  TalB  YP_003294628.1  Transaldolase B  35.0/5.61  678  20  2.1  B8  ETAE_0186  PurH  YP_003294244.1  IMP cyclohydrolase  57.7/5.6  403  15  2.4  B9  ETAE_0662  LpdA  YP_003294720.1  LpdA gene product  52.6/6.08  726  19  2.5  B10  ETAE_0171  NusG  YP_003294229.1  Transcription antiterminator  20.6/6.34  538  10  Δ  B11  ETAE_2821    YP_003296865.1  Glycine hydroxymethyltransferase  45.5/6.4  677  16  2.1  B12  ETAE_1512  OppA  YP_003295564.1  Oligopeptide permease A  61.5/6.54  545  19  2.2  View Large Transcriptional analysis of differentially expressed genes qRT-PCR analysis was used to characterize the expression levels of mRNAs for differentially expressed proteins. Seven out of the 19 identified proteins were selected for verification, including T3SS gene eseB; T6SS genes evpA and evpC; GS family gene glnA; other genes encoding various functions ETAE_1057, ETAE_2758, and ETAE_2186, with the housekeeping gene gyrB as the internal control (Fig. 2a). Given the resolution limitation of the 2-DGE proteomics analysis that precluded detecting all the possible differentially expressed protein spots, NtrB and NtrC were not observed as the differentially expressed proteins in our assays. As ntrBC resides in the same operon as glnA (Fig. 2b), qRT-PCR analysis shall further verify that their transcription is under the control of EsrB. Similarly, due to the low expression level of EsrB and the positive autoregulation of EsrB (Liu et al.2017b), we use qRT-PCR to detect esrB transcription as a control. As the results shown in Fig. 2a, all selected genes showed at least 2-fold change expression between WT and ΔesrB, suggesting that similar up- and downregulation of the differentially expressed proteins were observed at the transcriptional level. Figure 2. View largeDownload slide Genes regulated by EsrB. (a) Transcriptional variations of selected genes between WT and ΔesrB. (b) The potential binding box of EsrB in the promoter of glnA-ntrBC region (PglnA) in EIB202. Conserved 7-4-7΄ structure in the EsrB binding sequence was shown. (c) EsrB directly binding to PglnA according to EMSA. ORF region of glnA gene was used as a negative control. The experiments were performed in triplicates and repeated three times at least. Figure 2. View largeDownload slide Genes regulated by EsrB. (a) Transcriptional variations of selected genes between WT and ΔesrB. (b) The potential binding box of EsrB in the promoter of glnA-ntrBC region (PglnA) in EIB202. Conserved 7-4-7΄ structure in the EsrB binding sequence was shown. (c) EsrB directly binding to PglnA according to EMSA. ORF region of glnA gene was used as a negative control. The experiments were performed in triplicates and repeated three times at least. EsrB directly regulates the transcription of glnA As was shown in results of 2-DGE and qRT-PCR analysis (Figs 1c and 2a), expression of GlnA in WT and ΔesrB strains was significantly different. We hypothesized that EsrB might bind directly to the promoter of glnA. Indeed, a potential binding motif of EsrB was identified in the glnA promoter region through the gene sequence alignment using the previously reported binding box (Liu et al.2017b) (Fig. 2b). EMSA demonstrated that EsrB bound to the promoter of glnA, as the mobility of glnA promoter probe was retarded with the addition of EsrB proteins in the presence of an excess non-specific competitor DNA poly(dI:dC), and the shift could be counteracted with the addition of non-labeled glnA promoter probe. Furthermore, no shift was observed in the reaction mixture of EsrB and a DNA probe from the glnA open reading frame (ORF) region (Fig. 2c). These data demonstrated that EsrB represses the expression of GlnA through directly binding to the promoter region of glnA. EsrB regulation of glutamine synthesis affects growth in vitro To investigate the function of gene glnA, a glnA deletion mutant (ΔglnA) was constructed. Growth levels of WT, ΔesrB and ΔglnA strains were analyzed under four culture conditions: DMEM, DMEM gln− (without addition of glutamine), DMEM gln+ (excess addition of glutamine) and DMEM gln− glu− (without addition of glutamine and glutamate), at 28°C for 24 h. As a result, growth of ΔglnA in DMEM displayed a longer lag phase than WT strain and grew slowly (Fig. 3a), indicating that glnA is essential for growth. However, ΔesrB grew faster and showed a shorter lag phase, which could be resulted from the upregulation of GlnA. As the precursor of glutamine, no significant growth of the three stains was observed in the absence of glutamine and glutamate. In addition, ΔglnA strain barely grow in DMEM glutamine−, while a growth level close to that of WT strain was obtained in DMEM gln+. Figure 3. View largeDownload slide The effects of glnA on growth in vitro and in vivo. (a) Growth of WT, ΔesrB and ΔglnA in DMEM, DMEM (gln−, without addition of glutamine), DMEM (gln+, excess addition of glutamine) and DMEM (gln−, glu−, without addition of glutamine and glutamate). An asterisk indicates statistically significant difference in mean values as compared to the WT treated with the same conditions, by an unpaired, two-tailed Student's t-test (P value < 0.001). (b) ΔglnA was significantly impaired in its colonization to turbot fish according to CI assays. No significant difference was observed between ΔglnA and ΔesrB. Figure 3. View largeDownload slide The effects of glnA on growth in vitro and in vivo. (a) Growth of WT, ΔesrB and ΔglnA in DMEM, DMEM (gln−, without addition of glutamine), DMEM (gln+, excess addition of glutamine) and DMEM (gln−, glu−, without addition of glutamine and glutamate). An asterisk indicates statistically significant difference in mean values as compared to the WT treated with the same conditions, by an unpaired, two-tailed Student's t-test (P value < 0.001). (b) ΔglnA was significantly impaired in its colonization to turbot fish according to CI assays. No significant difference was observed between ΔglnA and ΔesrB. ΔglnA was attenuated in its colonization in vivo To further explore whether glnA influences the infection in vivo, CI experiment was performed using turbot, which were the natural host of E. piscicida. As was shown in Fig. 3b, ΔglnA strain was strongly outcompeted by WT at least 2 logs, indicating the growth defect of ΔglnA in vivo. DISCUSSION RR EsrB has been established to be a global regulator in E. piscicida and is essential for virulence regulation (Leung et al.2012; Lv et al.2012; Park, Aoki and Jung 2012; Liu et al.2017b). However, the regulatory functions of EsrB other than virulence pathways are still unclear. In this study, protein expression profiles were analyzed to define potential target proteins affected by EsrB in E. piscicida cultured in DMEM. A total of 19 proteins were identified as being expressed in an EsrB-dependent manner. Twelve proteins were found to be repressed by EsrB, while seven proteins were positively regulated. These proteins were associated with a variety of processes, such as cellular processes, signaling information storage processes and metabolism processes. Besides the already known regulons (EseB, EvpA and EvpC; Wang et al.2010), some core-genome-encoded proteins such as GlnA, PurM, and OppA (Wang et al.2009a; Tomljenovic-Berube et al.2010) were also identified. Homology with SsrA-SsrB in Salmonella, EsrA-EsrB was horizontally acquired by E. piscicida along with T3SS during the long-term evolution (Leung et al.2012; Shao et al.2015). It is indicated in this study that EsrA-EsrB not only participates in the regulation of horizontally transferred genes, but also plays important roles in regulating the expression of core-genome genes, e.g. amino acids biosynthesis pathways. GlnA is a part of GS, which is an essential enzyme in ammonia assimilation and glutamine biosynthesis pathways. According to 2-DGE assays, GlnA exhibited a higher expression level in ΔesrB compared with that in WT cells grown in DMEM. Similarly, when cultured in DMEM at 28°C, WT exhibited a higher growth rate than ΔglnA, but a lower rate than ΔesrB, and it could be partly eliminated by the addition of glutamine. This phenomenon corroborated the 2-DGE results, and also indicated that the growth rate differences between WT and ΔesrB were not only because of the different expression level of GlnA, but also because of other metabolism-related proteins regulated by EsrB, such as the ones identified in this study. Besides acting as an enzyme, GlnA could also function as a chaperon and participate in regulation actions. Recently, GlnA has been identified as a chaperon of GlnR, a regulator affecting gene expression globally to nitrogen metabolism. Accompanying with GlnA, GlnR could regulate glnA operon efficiently (Kuhn et al.2014; Hentchel and Escalante-Semerena 2015; You et al.2016). Since no GlnR was identified in E. piscicida, and EsrB was herein identified as a repressor of GlnA, we suggested that EsrB might play the same role as GlnR in E. piscicida. Similarly, GlnA might be a chaperon of EsrB, and could influence the activities of EsrB, which invites further investigation in the future. Little nutrition was found in macrophages, especially the carbon and nitrogen sources. Previously, we found that the deletion of esrB significantly attenuated the virulence of E. piscicida; however, ΔesrB could exist in macrophage for a longer time than that of WT (Liu et al.2017b). Here, high level of GlnA in ΔesrB might lead to the effective use of limited nitrogen sources, which was beneficial for ΔesrB to survive in macrophages. But it might not be the only reason to explain this phenomenon, enhanced reactive oxygen species resistance of ΔesrB can also be a reason for the high survival rate in macrophages (Yin et al.2017). Precisely, EsrB plays an important role in bacterial infection and survival processes in vitro. With a saturated transposon insertion library, we recently analyzed the conditional essential gene sets of the bacteria during in vivo conditional selection in turbot (Yang et al.2017). We discovered that glnA was a conditional essential gene as T3/T6SS genes (Yang et al.2017). CI analysis also revealed that the deletion of glnA significantly impaired the colonization in fish to the similar level in ΔesrB (Fig. 3b). However, there remains a question that why EsrB represses the expression of essential gene glnA. In conclusion, 19 proteins influenced by EsrB in E. piscicida were identified, with 7 proteins downregulated and 12 proteins upregulated. In particular, GlnA, a GS essential for ammonia assimilation and glutamine biosynthesis from glutamate, was negatively regulated by EsrB. Our study highlighted the regulatory function of EsrB on the nitrogen metabolism pathway in E. piscicida, which will further facilitate the understanding of pathogenesis of this bacterium. FUNDING The study was supported by National Natural Science Foundation of China, Nos. 31430090 (YXZ), 31602200 (XHL) and 31400122 (MJY), the Ministry of Agriculture of China, No. CARS-47 (QYW), and Shanghai Pujiang Program, No. 16PJD018 (QYW). Conflict of interest. None declared. REFERENCES Abayneh T, Colquhoun DJ, Sørum H. Edwardsiella piscicida sp. nov., a novel species pathogenic to fish. J Appl Microbiol  2013; 114: 644– 54. Google Scholar CrossRef Search ADS PubMed  Abbott SL, Janda JM. The genus Edwardsiella. In: The Prokaryotes, Proteobacteria: Gamma Class , 3rd edn, 6. New York: Springer, 2006, 72– 89. Google Scholar CrossRef Search ADS   Hentchel KL, Escalante-Semerena JC. Acylation of biomolecules in prokaryotes: a widespread strategy for the control of biological function and metabolic stress. Microbiol Mol Biol Rev  2015; 79: 321– 46. Google Scholar CrossRef Search ADS PubMed  Kuhn ML, Zemaitaitis B, Hu L et al.   Structural, kinetic and proteomic characterization of acetyl phosphate-dependent bacterial protein acetylation. PLoS One  2014; 9: e94816. Google Scholar CrossRef Search ADS PubMed  Leung KY, Siame BA, Tenkink BJ et al. Edwardsiella tarda: virulence mechanisms of an emerging gastroenteritis pathogen. Microbes Infect  2012; 14: 26– 34. Google Scholar CrossRef Search ADS PubMed  Liu Y, Gao YN, Liu XH et al.   Transposon insertion sequencing reveals T4SS as the major genetic trait for conjugation transfer of multi-drug resistance pEIB202 from Edwardsiella. BMC Microbiol  2017a; 17: 112. Google Scholar CrossRef Search ADS   Liu Y, Zhao LY, Yang MJ et al.   Transcriptomic dissection of the horizontally acquired response regulator EsrB reveals its global regulatory roles in the physiological adaptation and activation of T3SS and the cognate effector repertoire in Edwardsiella piscicida during infection toward turbot. Virulence  2017b; 8: 1355– 77. Google Scholar CrossRef Search ADS   Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods  2001; 25: 402– 8. Google Scholar CrossRef Search ADS PubMed  Lv YZ, Xiao JF, Liu Q et al.   Systematic mutation analysis of two-component signal transduction systems reveals EsrA-EsrB and PhoP-PhoQ as the major virulence regulators in Edwardsiella tarda. Vet Microbiol  2012; 157: 190– 9. Google Scholar CrossRef Search ADS PubMed  Lv YZ, Yin KY, Shao S et al.   Comparative proteomic analysis reveals new components of the PhoP regulon and highlights a role for PhoP in the regulation of genes encoding the F1F0 ATP synthase in Edwardsiella tarda. Microbiol  2013; 159: 1340– 51. Google Scholar CrossRef Search ADS   Mo ZL, Peng X, Xiang MY et al.   Construction and characterization of a live, attenuated esrB mutant of Edwardsiella tarda and its potential as a vaccine against the haemorrhagic septicaemia in turbot, Scophthamus maximus (L.). Fish Shellfish Immunol  2007; 23: 521– 30. Google Scholar CrossRef Search ADS PubMed  Mohanty BR, Sahoo PK. Edwardsiellosisin fish: a brief review. J Biosci  2007; 32: 1331– 44. Google Scholar CrossRef Search ADS PubMed  Park SB, Aoki T, Jung TS. Pathogenesis of and strategies for preventing Edwardsiella tarda infection in fish. Vet Res  2012; 43: 1– 11. Google Scholar CrossRef Search ADS PubMed  Shao S, Lai QL, Liu Q et al.   Phylogenomics characterization of a highly virulent Edwardsiella strain ET080813T encoding two distinct T3SS and three T6SS geneclusters: Propose a novel species as Edwardsiella anguillarum sp. nov. Syst Appl Microbiol  2015; 38: 36– 47. Google Scholar CrossRef Search ADS PubMed  Tomljenovic-Berube AM, Mulder DT, Whiteside MD et al.   Identification of the regulatory logic controlling Salmonella pathoadaptation by the SsrA-SsrB two-component system. PLoS Genet  2010; 6: e1000875. Google Scholar CrossRef Search ADS PubMed  Wang QY, Yang MJ, Xiao JF et al.   Genome sequence of the versatile fish pathogen Edwardsiella tarda provides insights into its adaptation to broad host ranges and intracellular niches. PLoS One  2009a; 4: e7646. Google Scholar CrossRef Search ADS   Wang X, Wang QY, Xiao JF et al. Edwardsiella tarda T6SS component evpP is regulated by esrB and iron and plays essential roles in the invasion of fish. Fish Shellfish Immunol  2009b; 27: 469– 77. Google Scholar CrossRef Search ADS   Wang X, Wang QY, Xiao JF et al.   Hemolysin EthA in Edwardsiella tarda is essential for fish invasion in vivo and in vitro and regulated by two-component system EsrA-EsrB and nucleoid protein HhaEt. Fish Shellfish Immunol  2010; 29: 1082– 91. Google Scholar CrossRef Search ADS PubMed  Wang YM, Wang QY, Yang MJ et al.   Proteomic analysis of a twin-arginine translocation-deficient mutant unravel its functions involved in stress adaptation andvirulence in fish pathogen Edwardsiella tarda. FEMS Microbiol Lett  2013; 343: 145– 55. Google Scholar CrossRef Search ADS PubMed  Xiao JF, Chen T, Liu B et al. Edwardsiella tarda mutant disrupted in type III secretion system and chorismic acid synthesis and cured of a plasmid as a live attenuated vaccine in turbot. Fish Shellfish Immunol  2013; 35: 632– 41. Google Scholar CrossRef Search ADS PubMed  Xiao JF, Wang QY, Liu Q et al.   Characterization of Edwardsiella tarda rpoS: effect on serum resistance, chondroitinase activity, biofilm formation, and autoinducer synthetases expression. Appl Microbiol Biot  2009; 83: 151– 60. Google Scholar CrossRef Search ADS   Yang GH, Billings G, Hubbard TP et al.   Time-resolved transposon insertion sequencing reveals genome-wide fitness dynamics during infection. mBio  2017; 8: e01581– 17. Google Scholar PubMed  Yang MJ, Lv YZ, Xiao JF et al. Edwardsiella comparative phylogenomics reveal the new intra/inter-species taxonomic relationships virulence evolution and niche adaptation mechanisms. PLoS One  2012; 7: e36987. Google Scholar CrossRef Search ADS PubMed  Yin KY, Wang QY, Xiao JF et al.   Comparative proteomic analysis unravels a role for EsrB in the regulation of reactive oxygen species stress responses in Edwardsiella piscicida. FEMS Microbiol Lett  2017; 364: fnw269. Google Scholar CrossRef Search ADS PubMed  You D, Yin BC, Li ZH et al.   Sirtuin-dependent reversible lysine acetylation of glutamine synthetases reveals an autofeedback loop in nitrogen metabolism. P Natl Acad Sci USA  2016; 113: 6653– 8. Google Scholar CrossRef Search ADS   © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Journal

FEMS Microbiology LettersOxford University Press

Published: Feb 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off