Epigenetic Therapy: Novel Translational Implications for Arrest of Environmental Dioxin-Induced Disease in Females

Epigenetic Therapy: Novel Translational Implications for Arrest of Environmental Dioxin-Induced... Abstract Increased toxicant exposure and resultant environmentally induced diseases are a tradeoff of industrial productivity. Dioxin [2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD)], a ubiquitous byproduct, is associated with a spectrum of diseases including endometriosis, a common, chronic disease in women. TCDD activates cytochrome (CYP) p450 metabolic enzymes that alter organ function to cause disease. In contrast, the transcription factor, Krüppel-like factor (KLF) 11, represses these enzymes via epigenetic mechanisms. In this study, we characterized these opposing mechanisms in vitro and in vivo as well as determining potential translational implications of epigenetic inhibitor therapy. KLF11 antagonized TCDD-mediated activation of CYP3A4 gene expression and function in endometrial cells. The repression was pharmacologically replicated by selective use of an epigenetic histone acetyltransferase inhibitor (HATI). We further showed phenotypic relevance of this mechanism using an animal model for endometriosis. Fibrotic extent in TCDD-exposed wild-type animals was similar to that previously observed in Klf11−/− animals. When TCDD-exposed animals were treated with a HATI, Cyp3 messenger RNA levels and protein expression decreased along with disease progression. Fibrotic progression is ubiquitous in environmentally induced chronic, untreatable diseases; this report shows that relentless disease progression can be arrested through targeted epigenetic modulation of protective mechanisms. Increased agricultural and industrial production commensurate with human civilizational advance has resulted in increased prevalence of diseases related to environmental exposure. Such diseases occur from biological interaction with an array of diverse environmental physical and chemical exposures in individuals of diverse susceptibility (1). Environmental agents commonly disrupt epigenetic regulatory mechanisms, resulting in altered gene expression, function, and disease (2). In contrast to gene mutations, dysfunctional epigenetic mechanisms are translationally more relevant and can be targeted and reversed by specific pharmacological inhibitors (3, 4). Diseases from environmental exposure commonly result from disruption of stabilizing, homeostatic mechanisms. The resultant cleavage of adaptive capacity enhances disease susceptibility. Dioxin, or 2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD), is a ubiquitous byproduct of herbicide and pesticide manufacturing, smelting, and chlorine bleaching. It is a widely distributed toxic environmental contaminant that belongs to a class of persistent organic pollutants known as polychlorinated biphenyls (5). Humans exposed to atmospheric and/or effluent dioxin, either at low accumulating doses or high concentrations, face various adverse health effects (6–10). Dioxin has been recognized as a carcinogen, teratogen, and endocrine disrupter (11–13). Endometriosis is an endocrine disease with vaguely understood pathophysiology. Exposure to TCDD may be one of the many mechanisms involved in disease pathogenesis (14–22). Endometriosis is a highly prevalent and chronic disease that affects at least 10% of reproductive-age women with pelvic pain, infertility, and sexual dysfunction (23). This recurrent and recalcitrant disease causes tremendous personal and societal morbidity, with annual health expenses exceeding $20 million in the United States alone (24). The association between TCDD and endometriosis was reported and experimentally induced in a primate colony previously exposed to TCDD (25, 26). The role of TCDD in the pathogenesis of endometriosis in humans is a focus of contemporary investigation. Whereas several reports have shown no link between TCDD and endometriosis in humans (27–31), there is also increasing evidence recognizing the relationship between TCDD and endometriosis (14–21). Dioxin-induced endometriosis in animal models therefore offers a robust mechanistic investigation of toxic endocrine disruption resulting in disease (32, 33). Dioxin critically affects homeostasis by activating cytochrome (CYP) enzymes that catalyze more than 75% of phase 1 metabolic reactions in diverse organs and tissues; metabolic dysregulation potentially enhances risk of disease therein (6, 34–36). CYP substrates include endogenous hormones such as estrogens and progesterone as well as exogenous pharmacological substrates, such as acetaminophen, xenobiotics, and toxins (34–36). In humans, CYP enzymes, primarily in the liver but also in the intestine and endometrium, metabolize estrogens into phase 1 metabolites: 2-hydroxy- and 4-hydroxyestrogens (37). Dysregulation of CYP enzyme-mediated metabolic reactions in endometrial tissue can therefore affect embryo implantation, fetal development, and have an impact on endometrial diseases. We have previously shown that altered endometrial metabolism results in endometriosis (38, 39). Krüppel-like factor 11 (KLF11) is a Sp/KLF family zinc finger transcription factor associated with several human endocrine, metabolic, and reproductive diseases (40–43). Although the C-terminal zinc finger DNA-binding domain is characteristically conserved, enabling its inclusion in the larger family, the N-terminal is unique and displays distinct epigenetic cofactor-binding domains (44). KLF11 binds distinct nuclear epigenetic coactivators and/or corepressors and thus recruits them to distinct promoter GC-motif elements located in the 5′ regulatory region of its target genes. The KLF/cofactor complex thus mediates directional target gene expression via modulation of the local chromatin configuration (45, 46). We have previously shown that KLF11 binds the promoters of various CYP isoforms to regulate steroidogenesis as well as metabolism (38). In particular, KLF11 is a repressor of endometrial CYP3A4 expression; this repression is mediated via recruitment of the epigenetic cofactor SIN3A/histone deacetylase (HDAC) (38, 39). Recruitment of SIN3A/HDAC by KLF11 to the CYP3A4 promoter results in localized chromatin compaction, which represses gene expression (38). Diverse environmental exposures to toxins and toxicants have been associated with epigenetic modifications resulting in disease; the ability to target and reverse such mechanisms remains an unmet need. In these studies, we characterize in vitro and in vivo disease progression mediated by TCDD, a common environmental endocrine disruptive chemical, as a result of epigenetic dysregulation of critical metabolic enzyme CYP3A4, a ubiquitous model endometrial metabolic enzyme that is differentially activated by TCDD and KLF11. We also aim to characterize a translationally relevant epigenetic mechanism that targets fibrosis in a well-characterized animal endometriosis model. Given the ubiquity of fibrosis as a pathogenic mechanism in a diversity of tissues, we expect these results to have relevance to a broad spectrum of chronic medical diseases. Materials and Methods Cell line and treatment Ishikawa cells were maintained in Dulbecco’s modified Eagle medium with 10% fetal bovine serum. The cells were transiently transfected with 2.5 µg of pcDNA3/HIS-KLF11, pcDNA3/HIS-KLF11EAPP, or pcDNA3/HIS empty vector (EV; Invitrogen, Carlsbad, CA) for 48 hours using lipofectamine per laboratory protocol (38). The cells were then treated with TCDD (Ultra Scientific, North Kingstown, RI; catalog no. RPE-029S) at various concentrations from 0.05 to 10 nM or 15 μM Garcinol [histone acetyltransferase inhibitor (HATI)] (Enzo Life Sciences, Farmingdale, NY) for 24 hours. RNA isolation and real-time polymerase chain reaction Standard laboratory protocols were used for RNA isolation and polymerase chain reaction (PCR) as previously described (38). Briefly, total RNA from one six-well plate of 80% confluent Ishikawa cells was extracted using an RNeasy kit (Qiagen Inc., Valencia, CA) per the manufacturer’s instructions. RNA yield was quantified using a Nanodrop (Thermo Fisher Scientific, Waltham, MA). Two micrograms of total RNA was used for subsequent complementary DNA synthesis. Oligo-dT primer was for complementary DNA synthesis in the SuperScript III first-strand synthesis system for reverse transcription (RT)-PCR per manufacturer’s protocol (Invitrogen). Quantitative –real-time PCR (qPCR) was performed using commercial primers for CYP3A4 (Qiagen), ΔΔCT was used to normalize expression against a panel of housekeeping controls: beta-2-microglobulin (B2M/B2m), glyceraldehyde 3-phosphate dehydrogenase (GAPDH/Gapdh), and hypoxanthine phosphoribosyltransferase 1 (HPRT1/Hprt1) (Qiagen). qPCR reactions were performed using the IQ-SYBR Green Supermix (Bio-Rad, Hercules, CA) in a PikoReal96 Real-Time PCR System (Thermo Fisher). Each experiment was performed in triplicate three independent times. Chromatin immunoprecipitation Chromatin immunoprecipitation (ChIP) was performed using E-Z ChIP per kit protocol (Millipore, Temecula, CA). Briefly, 2 million Ishikawa cells were treated with either dimethyl sulfoxide (DMSO), TCDD at 1 and 10 nM alone, or 15 µM HATI. Cells were lysed and sonicated to generate 200- to 600-bp fragments. Antiacetyl histone 3K9 antibody (1:250; Abcam, Cambridge, MA; catalog no. ab4441), or a species-specific control immunoglobulin G (IgG; Abcam catalog no. 171870) was used for overnight immunoprecipitation. Overlapping segments of the CYP3A4 regulatory regions spanning −1000 to +1 bp were previously evaluated for KLF11 binding using a series of primers (38). A well-characterized CYP3A4 promoter KLF11 binding element was evaluated here for differences in histone acetylation. Human CYP3A4 promoter region was amplified using primer sequences for ChIP as follows: region A forward/reverse, CTTGGACTCCCCAGTAACATTG/GATTGTTTATATGCTAGAGAAGGAGGC; region B forward/reverse, CTGGGTTTGGAAGGATGTGTAG/GGTTCTGGGTTCTTATCAGAAACTC; and region C forward/reverse, ATGACAGGGAATAAGACTAGACTATGCC/ACAGACAGAGCCTTCTCTTAGAGTCTT. PCR products representing these CYP3A4 promotor regions A, B, and C were examined on a 2% agarose gel. Luciferase reporter assay The pGL3-basic EV was purchased from Promega, Madison, WI. pGL3 basic promoter-reporter constructs each containing serial 200- to 400-bp GC-rich elements in the CYP3A4 promoter were generated as previously described. Ishikawa cells at 80% confluence were cotransfected with either 2.5 μg of pcDNA3/HIS EV (Invitrogen) or pcDNA3/HIS-KLF11 construct and 3 μg of a pGL3-CYP3A4-promoter-reporter construct −600 to +62, corresponding to the region evaluated by ChIP as previously described (38). Forty-eight hours after transfection, cells were lysed and reporter activity was read using the luciferase assay system (Promega) and a 20/20 luminometer (Turner Designs, San Jose, CA) per manufacturer protocol. Data in relative light units were normalized to lysate protein concentrations as characterized previously (41). Experiments were performed in triplicate, three independent times. Experimental animals All experiments were performed in accordance with the Guide for Care and Use of Laboratory Animals from the National Institutes of Health. These guidelines were incorporated into the study protocol which was also approved by the Institutional Animal Care and Use Committee, at the Mayo Clinic, Rochester, Minnesota. C57/BL6 wild-type (wt) mice were housed in specific pathogen-free conditions at the Mayo Clinic animal housing facility; only 8- to 10-week-old females were used throughout the experiment. TCDD at 3 μg/kg body weight or vehicle (DMSO) was administrated by gavage 3 weeks before surgery. Endometriosis was surgically induced for induction of endometriosis, a well-characterized and previously published surgical approach (32, 41). Briefly, one complete uterine horn was resected and two 5-mm everted uterine segments were transplanted by suture on to the parietal peritoneum. Eversion of uterine segments ensured that the endometrial aspect of each resected uterine segment was exposed to the peritoneal cavity as in human disease. Administration of TCDD or vehicle (DMSO) via oral gavage continued every 3 weeks and in addition to that mice were treated postoperatively with Garcinol (HATI: 0.2 mg/kg body weight) or DMSO (v/v) by intraperitoneal injection once a day for 9 weeks (N = 40; 10/treatment group). Doses and treatment regimens were based on previously published studies as well as our own dose-optimization studies to ensure nontoxic, therapeutic efficacy. At the end of 9 weeks, disease lesion size and extent were evaluated in all animals at necropsy. Phenotype was evaluated objectively by at least two independent investigators that were blinded to the treatment condition using a previously published fibrosis scoring system for murine endometriosis (41). Western blotting Whole-cell lysate was obtained from Ishikawa cells treated with DMSO, varying concentrations of TCDD alone, or TCDD + HATI. A total of 10 μg of protein was separated by 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis, transferred to a polyvinylidene fluoride membrane, and probed overnight with anti-CYP3A4 (1:500; Abcam #3572), anti-KLF11 (1:500; Abnova Walnut, CA; catalog no. H00008462-M01), and anti-β-tubulin (1:500; Sigma T2200, Ronkonkoma, NY) primary antibodies. Quantification of Western blots was performed using Image-J software (National Institutes of Health, Bethesda, MD). Immunohistochemistry For immunohistochemistry, standard laboratory protocols were followed as previously published (38, 41, 47). Briefly, deparaffinized and rehydrated sections underwent epitope retrieval by heating with 10 mM citrate buffer (pH 6.0). Peroxidase quenching using hydrogen peroxide/methanol was followed by avidin/biotin blocking (Vector Laboratories, Burlingame, CA) followed by blocking CAS solution (CAS Block; Invitrogen) blocking followed by overnight 4°C incubation with anti-CYP3A4 (1:100 dilution), which also detects murine Cyp3a4 orthologs. After overnight incubation, the tissue microarrays (TMAs) were incubated with secondary biotinylated horse antirabbit antibody (1:500, Vector Laboratories) for 30 minutes at room temperature followed by incubation with streptavidin (Invitrogen) and Nova Red (Vector Laboratories). Examination of the stained sections was conducted using a Nikon Labophot-2 microscope and Image-Pro Plus 5.0.1 acquisition software (Media Cybernetics, Bethesda, MD). For Masson trichrome staining, collagen was stained using the Trichrome Stain Kit (Newcomer Supply, Inc., Middleton, WI) per protocol (38, 41). Briefly, the samples were deparaffinized, hydrated, and fixed in Bouin’s fluid for 1 hour at 60°C. Subsequently, the sections were stained with Weigert iron hematoxylin for 10 minutes, Biebrich Scarlet-Acid Fuchsin for 2 minutes, and Aniline Blue solution for 5 minutes. Image capture was performed as described previously. Statistical analysis Results are expressed as means ± standard error of means. In vitro experiments were performed as three independent biological replicates, with results confirmed each time using three technical replicates. A t test for independence or χ2 tests was used as indicated by data type. The Bonferroni method was used to adjust statistically significant P values where multiple comparisons were used. All statistical tests were two-sided. Statistical analysis was performed using SAS software (SAS Institute, Cary, NC). Comparison between the murine groups was performed using analysis of variance. Experimental animal numbers were based on an expected effect size of at least 30% difference in the lesion measurement as well as clinically important difference in fibrosis scores such that each experimental group consisted of at least seven animals. This would provide 80% power to detect the stated effect size with a type I error level of 0.05 using two-tailed tests. Results Dioxin-activated CYP3A4 in an endometrial epithelial cell line To determine the effect of TCDD on endometrial cell CYP3A4 expression, we treated Ishikawa cells with increasing doses (0.05 to 10 nM) to replicate a range of exposures from typical to excessive. Compared with vehicle (DMSO)-treated controls, CYP3A4 messenger RNA (mRNA) expression was significantly increased by TCDD (Fig. 1A). This is seen at the lowest dose (0.05 nM), with expression levels increasing further at the intermediate dose (1 nM) and more than doubling at 10-nM levels (P < 0.0167 at all dosage points compared with control) (Fig. 1A). Increased mRNA transcription further resulted in elevated CYP3A4 enzyme levels, as is seen by the representative blots (Fig. 1B) and their quantification (P < 0.0167 at all dosage points compared with control; Fig. 1C). KLF11 expression in the cells remained unchanged at all TCDD doses (Supplemental Fig. 1). Figure 1. View largeDownload slide CYP3A4 expression in Ishikawa cells. (A) CYP3A4 mRNA expression levels were determined by qPCR in Ishikawa cells exposed to either vehicle control (DMSO) or increasing doses of TCDD (0.05, 1, and 10 nM). Increase in CYP3A4 expression was directly proportional to TCDD dose (*P < 0.0167 compared with control; based on mean values from three independent biological replicates). CYP3A4 mRNA levels were normalized to a panel of housekeeping genes: B2M, GAPDH, and HPRT1. (B and C) CYP3A4 protein expression was increased in Ishikawa cells treated at all three doses of TCDD (0.05, 1, and 10 nM) compared with DMSO control. β-tubulin was used as loading control. (B) Representative blots. (C) Quantification (*P < 0.0167 compared with control-adjusted P value after Bonferroni correction). Figure 1. View largeDownload slide CYP3A4 expression in Ishikawa cells. (A) CYP3A4 mRNA expression levels were determined by qPCR in Ishikawa cells exposed to either vehicle control (DMSO) or increasing doses of TCDD (0.05, 1, and 10 nM). Increase in CYP3A4 expression was directly proportional to TCDD dose (*P < 0.0167 compared with control; based on mean values from three independent biological replicates). CYP3A4 mRNA levels were normalized to a panel of housekeeping genes: B2M, GAPDH, and HPRT1. (B and C) CYP3A4 protein expression was increased in Ishikawa cells treated at all three doses of TCDD (0.05, 1, and 10 nM) compared with DMSO control. β-tubulin was used as loading control. (B) Representative blots. (C) Quantification (*P < 0.0167 compared with control-adjusted P value after Bonferroni correction). KLF11 antagonized dioxin-induced CYP3A4 expression via epigenetic SIN3A/HDAC-related mechanisms To determine the role of KLF11/SIN3A/HDAC at the CYP3A4 promoter in TCDD-exposed cells, we treated Ishikawa cells transfected with pcDNA3/HIS EV) pcDNA3/HIS-KLF11 (KLF11), or pcDNA3/HIS-KLF11EAPP (KLF11EAPP) with increasing doses of TCDD and evaluated promoter-luciferase activity at a previously characterized KLF11-responsive CYP3A4 regulatory element (Fig. 2A). In contrast to EV, KLF11 significantly repressed CYP3A4 promoter/luciferase activity in vehicle control (DMSO)-treated cells as well as those treated with low-dose (0.05 nM) TCDD (P < 0.0167) (Fig. 2A). At higher doses, there was nonsignificant repression and eventually no repression at 1 and 10 nM dosages, respectively. To confirm the regulatory role of SIN3A/HDAC, additional cells were transfected with KLF11EAPP, a well-characterized KLF11 mutant that does not bind SIN3A (48–51). CYP3A4 promoter/luciferase levels were increased to baseline in cells transfected with KLF11EAPP compared with wt-KLF11 as a result of derepression, irrespective of TCDD dosage (Fig. 2A). Because wt-KLF11–mediated repression was less pronounced at higher TCDD doses, the difference in CYP3A4 promoter/luciferase activity between wt-KLF11 and KLF11EAPP was also correspondingly diminished at higher levels. High-dose TCDD therefore activated the CYP3A4 promoter independently of KLF11/SIN3A/HDAC. CYP3A4 gene expression corresponded with promoter activity; accordingly, KLF11 repressed CYP3A4 mRNA expression at low (0.05 nM) but not higher doses of TCDD (1 and 10 nM; P < 0.0167) (Fig. 2B). As seen at the promoter, KLF11EAPP derepressed wt-KLF11–mediated CYP3A4 mRNA expression; the difference was substantial only in vehicle control and in 0.05 nM TCDD-treated cells, wherein wt-KLF11 was also a repressor (Fig. 2B). Figure 2. View largeDownload slide CYP3A4 expression is antagonized by KLF11 via epigenetic SIN3A/HDAC. (A) Ishikawa cells transfected with EV, KLF11, or a wt KLF11 SIN3A/HDAC nonbinding mutant (KLF11EAPP) were treated with either DMSO vehicle control (veh) or TCDD (0.05, 1, and 10 nM), and evaluated using a CYP3A4-promotor-luciferase reporter assay. KLF11 significantly repressed CYP3A4-luciferase expression compared with EV in control DMSO-treated cells and in cells treated with 0.05 nM of TCDD. In contrast, KLF11 did not repress CYP3A4-luciferase expression in cells treated with higher doses of TCDD (1 and 10 nM). Derepression of CYP3A4-luciferase expression was evident in cells transfected with KLF11EAPP irrespective of DMSO or TCDD treatment; the difference however was significant only in cells treated with vehicle control only (*P < 0.0167 adjusted P value after Bonferroni correction). (B) KLF11 repressed CYP3A4 mRNA expression in vehicle-treated cells as well as at low doses of TCDD (0.05 nM) but not higher doses (1 and 10 nM) (*P < 0.0167 adjusted P value after Bonferroni correction). KLF11EAPP derepressed wt-KLF11–mediated CYP3A4 mRNA expression in vehicle control and 0.05 nM TCDD treated cells (*P < 0.0167 adjusted P value after Bonferroni correction). Figure 2. View largeDownload slide CYP3A4 expression is antagonized by KLF11 via epigenetic SIN3A/HDAC. (A) Ishikawa cells transfected with EV, KLF11, or a wt KLF11 SIN3A/HDAC nonbinding mutant (KLF11EAPP) were treated with either DMSO vehicle control (veh) or TCDD (0.05, 1, and 10 nM), and evaluated using a CYP3A4-promotor-luciferase reporter assay. KLF11 significantly repressed CYP3A4-luciferase expression compared with EV in control DMSO-treated cells and in cells treated with 0.05 nM of TCDD. In contrast, KLF11 did not repress CYP3A4-luciferase expression in cells treated with higher doses of TCDD (1 and 10 nM). Derepression of CYP3A4-luciferase expression was evident in cells transfected with KLF11EAPP irrespective of DMSO or TCDD treatment; the difference however was significant only in cells treated with vehicle control only (*P < 0.0167 adjusted P value after Bonferroni correction). (B) KLF11 repressed CYP3A4 mRNA expression in vehicle-treated cells as well as at low doses of TCDD (0.05 nM) but not higher doses (1 and 10 nM) (*P < 0.0167 adjusted P value after Bonferroni correction). KLF11EAPP derepressed wt-KLF11–mediated CYP3A4 mRNA expression in vehicle control and 0.05 nM TCDD treated cells (*P < 0.0167 adjusted P value after Bonferroni correction). HATI reversed TCDD-induced activation of CYP3A4 activity We performed ChIP using an antiacetyl histone 3K9 on the CYP3A4 promoter KLF11-binding element in Ishikawa cells treated with DMSO (control), TCDD alone, or TCDD with a HATI (Fig. 3A). In contrast to cells treated with either vehicle or TCDD (0.05 or 10 nM) alone, those treated with the combination (0.05 or 10 nM + 15 µM HATI) displayed lower acetyl-histone-H3 levels in the vicinity of the CYP3A4 promoter KLF11-binding element, indicative of relative deacetylation (Fig. 3A). CYP3A4 mRNA levels were also increased in cells treated with increasing doses of TCDD compared with DMSO-treated controls (Fig. 3B). TCDD thus induced CYP3A4 mRNA levels in a dose-dependent manner. HATI treatment overcame this effect of TCDD across the entire tested TCDD dose range. HATI-mediated repression was greatest at higher TCDD doses (Fig. 3B). HATI-mediated gene repression was further seen in correspondingly decreased enzyme levels in cells treated with either vehicle or increasing doses of TCDD and HATI (Fig. 3C and 3D). To determine if HATI-mediated decreased enzyme expression also affected function, Ishikawa cells were treated with either DMSO (control) or TCDD (0.05, 1, or 10 nM) alone or with HATI (15 µM). Forty-eight hours posttreatment, a CYP3A4-specific substrate was added to assess isoform-specific metabolic activity by measurement of proportional metabolic product/luciferase activity. As shown previously with KLF11, HATI treatment repressed TCDD induced activation of CYP3A4 enzymatic activity at low doses (0.05 and 1 nM) doses of the toxin (Fig. 3E). Figure 3. View largeDownload slide HATI reversed TCDD-mediated increased CYP3A4 expression. (A) Promoter acetylation/deacetylation at the CYP3A4 promoter KLF11-binding site was evaluated by ChIP using antiacetyl histone 3K9 in Ishikawa cells treated with either DMSO (vehicle control), TCDD alone, or TCDD and HATI. Compared with DMSO, the CYP3A4 promoter was relatively hyperacetylated in TCDD (0.05 and 10 nM)-treated cells. In contrast, the CYP3A4 promoter was relatively deacetylated at the KLF11-binding site in cells additionally treated with 15 μM HATI. (B) CYP3A4 mRNA levels were diminished in cells treated with 0.05, 1, or 10 nM TCDD and 15 μM HATI compared with those treated with corresponding doses of TCDD alone. CYP3A4 mRNA levels were normalized to a panel of housekeeping genes: B2M, GAPDH, and HPRT1 (*P < 0.05 compared with TCDD alone). (C and D) Ishikawa cells cotreated with HATI and 0.05 and 1 nM TCDD also demonstrated diminished CYP3A4 enzyme expression compared with cells cotreated with HATI and DMSO. This association was statistically significant only at the lowest dose of TCDD (0.05 nM). In contract, HATI could not suppress CYP3A4 enzyme expression in cells exposed to the highest concentration of TCDD (10 nM). β-tubulin was used as loading control. (C) Representative blots; (D) quantification (*P < 0.0167 compared with control). (E) HATI treatment repressed TCDD-induced activation of CYP3A4 enzymatic activity in Ishikawa cells treated at low doses of TCDD (0.05 and 1 nM) (*P < 0.05, compared with TCDD alone). Figure 3. View largeDownload slide HATI reversed TCDD-mediated increased CYP3A4 expression. (A) Promoter acetylation/deacetylation at the CYP3A4 promoter KLF11-binding site was evaluated by ChIP using antiacetyl histone 3K9 in Ishikawa cells treated with either DMSO (vehicle control), TCDD alone, or TCDD and HATI. Compared with DMSO, the CYP3A4 promoter was relatively hyperacetylated in TCDD (0.05 and 10 nM)-treated cells. In contrast, the CYP3A4 promoter was relatively deacetylated at the KLF11-binding site in cells additionally treated with 15 μM HATI. (B) CYP3A4 mRNA levels were diminished in cells treated with 0.05, 1, or 10 nM TCDD and 15 μM HATI compared with those treated with corresponding doses of TCDD alone. CYP3A4 mRNA levels were normalized to a panel of housekeeping genes: B2M, GAPDH, and HPRT1 (*P < 0.05 compared with TCDD alone). (C and D) Ishikawa cells cotreated with HATI and 0.05 and 1 nM TCDD also demonstrated diminished CYP3A4 enzyme expression compared with cells cotreated with HATI and DMSO. This association was statistically significant only at the lowest dose of TCDD (0.05 nM). In contract, HATI could not suppress CYP3A4 enzyme expression in cells exposed to the highest concentration of TCDD (10 nM). β-tubulin was used as loading control. (C) Representative blots; (D) quantification (*P < 0.0167 compared with control). (E) HATI treatment repressed TCDD-induced activation of CYP3A4 enzymatic activity in Ishikawa cells treated at low doses of TCDD (0.05 and 1 nM) (*P < 0.05, compared with TCDD alone). TCDD exposure is associated with increased lesion size and disease progression in vivo To determine the role of TCDD in disease progression, we treated a well-characterized wt animal endometriosis model with either vehicle (oil + DMSO) or TCDD. Because HATI treatment arrested TCDD-induced CYP3A4 induction in vitro (Fig. 3), to determine the effect of such therapy on disease progression in vivo, we treated additional TCDD-exposed animals with vehicle (DMSO) or HATI. Compared with vehicle-treated control (oil + DMSO), TCDD treatment (oil + TCDD) resulted in increased fibrotic disease progression that was objectively quantified by increased fibrosis scores (Fig. 4A and 4B: representative fibrotic disease progression phenotypes; Fig. 4I: fibrotic score; *P < 0.008), as well as lesion size (Fig. 4E and 4F: representative lesions; Fig. 4J: lesion size; *P < 0.008). To determine the effect of HATI treatment on disease progression, TCDD-exposed animals were additionally treated with either HATI or corresponding vehicle (DMSO). Animals treated with TCDD and DMSO demonstrated further phenotypic progression (Fig. 4C, 4G, 4I, and 4J, *P < 0.008). In contrast, HATI treatment resulted in significant diminution of both fibrosis and lesion size compared with animals treated with either TCDD alone or TCDD and DMSO (Fig. 4D, 4H, 4I, and 4J; *P < 0.008). Figure 4. View largeDownload slide TCDD and HATI treatment in a murine endometriosis model. (A–D) Disease progression in wt animals treated with vehicle (oil + DMSO), TCDD (3 μg/kg), TCDD and DMSO, or TCDD and HATI (0.2 μg/kg). Representative images for each treatment condition are shown. (A) Endometriotic lesion (black arrow) without surrounding fibrosis from control vehicle (oil + DMSO)–treated mice. (B) Fibrotic adhesions connecting the endometriotic lesion to the bowel (white arrow) from mice treated with TCDD (oil + TCDD). (C) Extensive fibrotic adhesions connecting the endometriotic lesion and the peritoneum to the bowel (white arrow) from mice treated with TCDD + DMSO (vehicle for HATI). (D) Endometriotic lesion and lack of fibrosis (black arrow) in mice treated with TCDD and HATI. (E–H) Endometriotic lesion (circled) in mice treated with oil + DMSO, oil + TCDD, TCDD + DMSO, and TCDD + HATI, respectively; adhesions dissected completely or partially for clarity. Mice treated with TCDD (oil + TCDD) and TCDD + DMSO had larger lesions compared with mice treated with vehicle (oil + DMSO). In contrast, mice treated with TCDD + HATI had lesion sizes comparable to mice treated with vehicle (oil + DMSO). (I) Fibrosis score using a murine adhesion scoring system (41). The fibrosis score was higher in mice treated with TCDD [mean ± standard deviation (SD), 26.42 ± 9.5) compared with the vehicle (mean ±SD, 12.46 ± 0.9). An additive effect was seen in mice treated with TCDD + DMSO, as they had the highest overall fibrosis score (mean ± SD, 51 ± 38.1). Mice treated with TCDD + HATI had a significantly lower fibrosis score (mean ± SD, 15.5 ± 4.2) (*P < 0.008 adjusted P value after Bonferroni correction). (J) Lesion sizes increased in mice treated with TCDD alone (mean ± SD, 40.36 ± 3.2) and TCDD + DMSO (mean ± SD, 41.6 ± 7.8) as compared with vehicle control (oil + DMSO) (mean ± SD, 14.38 ± 3.1) and TCDD + HATI (mean ± SD, 6.85 ± 3.9). There was a significant decrease in lesion size (mean and SD) in mice treated with TCDD and HATI compared with mice treated with TCDD + DMSO and TCDD alone (*P < 0.008 adjusted P value after Bonferroni correction). Figure 4. View largeDownload slide TCDD and HATI treatment in a murine endometriosis model. (A–D) Disease progression in wt animals treated with vehicle (oil + DMSO), TCDD (3 μg/kg), TCDD and DMSO, or TCDD and HATI (0.2 μg/kg). Representative images for each treatment condition are shown. (A) Endometriotic lesion (black arrow) without surrounding fibrosis from control vehicle (oil + DMSO)–treated mice. (B) Fibrotic adhesions connecting the endometriotic lesion to the bowel (white arrow) from mice treated with TCDD (oil + TCDD). (C) Extensive fibrotic adhesions connecting the endometriotic lesion and the peritoneum to the bowel (white arrow) from mice treated with TCDD + DMSO (vehicle for HATI). (D) Endometriotic lesion and lack of fibrosis (black arrow) in mice treated with TCDD and HATI. (E–H) Endometriotic lesion (circled) in mice treated with oil + DMSO, oil + TCDD, TCDD + DMSO, and TCDD + HATI, respectively; adhesions dissected completely or partially for clarity. Mice treated with TCDD (oil + TCDD) and TCDD + DMSO had larger lesions compared with mice treated with vehicle (oil + DMSO). In contrast, mice treated with TCDD + HATI had lesion sizes comparable to mice treated with vehicle (oil + DMSO). (I) Fibrosis score using a murine adhesion scoring system (41). The fibrosis score was higher in mice treated with TCDD [mean ± standard deviation (SD), 26.42 ± 9.5) compared with the vehicle (mean ±SD, 12.46 ± 0.9). An additive effect was seen in mice treated with TCDD + DMSO, as they had the highest overall fibrosis score (mean ± SD, 51 ± 38.1). Mice treated with TCDD + HATI had a significantly lower fibrosis score (mean ± SD, 15.5 ± 4.2) (*P < 0.008 adjusted P value after Bonferroni correction). (J) Lesion sizes increased in mice treated with TCDD alone (mean ± SD, 40.36 ± 3.2) and TCDD + DMSO (mean ± SD, 41.6 ± 7.8) as compared with vehicle control (oil + DMSO) (mean ± SD, 14.38 ± 3.1) and TCDD + HATI (mean ± SD, 6.85 ± 3.9). There was a significant decrease in lesion size (mean and SD) in mice treated with TCDD and HATI compared with mice treated with TCDD + DMSO and TCDD alone (*P < 0.008 adjusted P value after Bonferroni correction). Endometriotic progression is associated with differential Cyp3a levels in lesions To determine if differential Cyp3a expression was associated with TCDD and HATI therapy, we evaluated mRNA expression levels from the lesions in TCDD- and HATI-treated animals (Fig. 5A). Compared with oil- and DMSO-treated controls, animals treated with oil and TCDD had elevated Cyp3a mRNA expression levels in the lesions (Fig. 5A). The levels were further increased in animals treated with TCDD and DMSO. In contrast, in HATI-treated animals, Cyp3a levels in the lesions were significantly diminished compared with those in TCDD- and TCDD + DMSO–treated animals (Fig. 5A). Disease progression and lesion size thus directly corresponded to Cyp3a mRNA expression levels in the lesions. We also determined expression of scar tissue Collagen1a1 (Col1a1) levels in the lesions, which we have previously shown to have translational relevance in endometriotic progression associated with loss of Klf11/epigenetic regulation (48). Col1a1 levels were increased in lesions from TCDD- and TCDD + DMSO–treated animals compared with oil- and DMSO-treated controls (Fig. 5B). In contrast, HATI therapy abrogated TCDD-associated increased Col1a1 expression (Fig. 5B) and fibrotic progression (Fig. 4). We further determined the expression of Cyp3a enzyme and Col1 in lesions from these animals (Fig. 5C–5J). Whereas CYP3A4/Cyp3a is expressed in endometrial epithelial cells in eutopic and ectopic endometrium (38), Col1 is deposited in extracellular stromal and subepithelial locations (48). Accordingly, we observed differential expression of Cyp3a in lesions from control, TCDD-, and TCDD + HATI–treated animals. Cyp3a was expressed in epithelial cells, as previously seen in human disease lesions; expression was minimal in controls (Fig. 5C), increased in TCDD-treated animals (Fig. 5D), and was maximal in animals treated with TCDD and DMSO (Fig. 5E). HATI treatment was associated with diminished expression of Cyp3a expression (Fig. 5F); overall, therefore, epithelial enzyme expression corresponded with mRNA expression levels (Fig. 5C–5F). Col1 expression also mirrored Cyp3a expression with maximal expression in TCDD- and DMSO-treated animals, and diminished expression with HATI therapy (Fig. 5G–5J). Col1 expression also corresponded phenotypically with fibrotic extent (Fig. 4A–4D). Figure 5. View largeDownload slide HATI therapy abrogated TCDD-induced Cyp3a and Col1 expression in murine endometrial implants. (A) Cyp3a mRNA expression levels were determined by qPCR in endometrial implants from wt mice exposed to vehicle control (oil + DMSO), TCDD (3 μg/kg), TCDD + DMSO, or TCDD + HATI (0.2 μg/kg). Cyp3a mRNA levels were normalized to a panel of housekeeping genes: B2M, GAPDH, and HPRT1. Cyp3a expression in endometrial implants increased twofold in mice exposed to TCDD and fivefold in mice treated with TCDD + DMSO compared with control. Endometrial implants from mice treated with TCDD + HATI had significantly decreased (0.6-fold) Cyp3a mRNA levels (*P < 0.008 adjusted P value after Bonferroni correction). (B) Col1a1 mRNA expression was increased in endometrial implants from mice treated with TCDD (fourfold) or TCDD + DMSO (sixfold). In contrast, Col1a1 expression was not increased in mice treated with TCDD and HATI. (C–F) Cyp3a enzyme expression in murine endometrial implants treated with oil +DMSO (control), TCDD, TCDD + DMSO, and TCDD + HATI is shown at magnification 200× (brown stain). (C) No enzyme expression was detected in tissue obtained from vehicle-treated control animals. (D and E) Epithelial Cyp3a expression was increased in lesions (D, black arrow) from mice treated with TCDD and (E, white and black arrows) even more so in mice treated with TCDD + DMSO. (F) Epithelial Cyp3a enzyme expression was diminished in lesions obtained from mice treated with TCDD + HATI (black arrow). (G–J) Endometriotic lesions in treated wt mice were also assessed for Col1 expression using Masson Trichome staining (blue stain), magnification 200×. (G) Vehicle-treated controls showed minimal Col1 protein expression. (H and I) Increased lesional Col1 staining was observed in mice treated with TCDD (H) and even more so for those treated with TCDD + DMSO (I). (J) Col1 expression was diminished in lesions of mice treated with TCDD + HATI. Figure 5. View largeDownload slide HATI therapy abrogated TCDD-induced Cyp3a and Col1 expression in murine endometrial implants. (A) Cyp3a mRNA expression levels were determined by qPCR in endometrial implants from wt mice exposed to vehicle control (oil + DMSO), TCDD (3 μg/kg), TCDD + DMSO, or TCDD + HATI (0.2 μg/kg). Cyp3a mRNA levels were normalized to a panel of housekeeping genes: B2M, GAPDH, and HPRT1. Cyp3a expression in endometrial implants increased twofold in mice exposed to TCDD and fivefold in mice treated with TCDD + DMSO compared with control. Endometrial implants from mice treated with TCDD + HATI had significantly decreased (0.6-fold) Cyp3a mRNA levels (*P < 0.008 adjusted P value after Bonferroni correction). (B) Col1a1 mRNA expression was increased in endometrial implants from mice treated with TCDD (fourfold) or TCDD + DMSO (sixfold). In contrast, Col1a1 expression was not increased in mice treated with TCDD and HATI. (C–F) Cyp3a enzyme expression in murine endometrial implants treated with oil +DMSO (control), TCDD, TCDD + DMSO, and TCDD + HATI is shown at magnification 200× (brown stain). (C) No enzyme expression was detected in tissue obtained from vehicle-treated control animals. (D and E) Epithelial Cyp3a expression was increased in lesions (D, black arrow) from mice treated with TCDD and (E, white and black arrows) even more so in mice treated with TCDD + DMSO. (F) Epithelial Cyp3a enzyme expression was diminished in lesions obtained from mice treated with TCDD + HATI (black arrow). (G–J) Endometriotic lesions in treated wt mice were also assessed for Col1 expression using Masson Trichome staining (blue stain), magnification 200×. (G) Vehicle-treated controls showed minimal Col1 protein expression. (H and I) Increased lesional Col1 staining was observed in mice treated with TCDD (H) and even more so for those treated with TCDD + DMSO (I). (J) Col1 expression was diminished in lesions of mice treated with TCDD + HATI. Discussion Humans are exposed to a diversity of toxins and toxicants, both chemical and biological, as a consequence of large-scale agricultural and industrial production. Such exposures are increasingly being recognized and implicated in the de novo appearance and/or increased incidence of environmentally implicated human diseases (52). Specifically, the common industrial effluent TCDD is associated with a spectrum of human diseases, including endometriosis, in several studies from diverse populations (6–9, 14–21). Although the association is recognized, it has yet to gain wide acceptance, and the mechanism of pathogenicity is unclear. The proposed intracellular mechanism of action of TCDD is via aryl hydrocarbon signaling (53). In this pathway, TCDD binds the cytosolic aryl hydrocarbon receptor (AhR), which translocates to the nucleus and binds the aryl hydrocarbon nuclear translocator (ARNT) (54). The AhR/ARNT dimer then binds to xenobiotic response elements located in the target gene promoters. Xenobiotic response elements are commonly encountered in the regulatory regions of genes that encode cytochrome p450 enzymes with resultant metabolic dysregulation in a diversity of tissues and organs, which therefore results in wide spectrum of disease (34). In this paper, we propose an alternate cell-intrinsic mechanism mediated by the Sp/KLF transcription factor KLF11 and its epigenetic binding partners SIN3A/HDAC that mitigate TCDD action. Together, KLF11/SIN3A/HDAC antagonize TCDD-mediated up-regulation of metabolic CYP enzymes (38). We show here in vitro that TCDD and KLF11 oppositely regulated the abundantly expressed endometrial metabolic enzyme CYP3A4. Moreover, KLF11-mediated CYP3A4 repression overcame TCDD-mediated activation in a dose-responsive manner; repression was robust at low but not high doses of toxin exposure (Fig. 2). KLF11 recruits and binds several specific epigenetic nuclear cofactors via well-defined domains. These include SIN3A/HDAC and histone methyl transferase (heterochromatin protein 1/histone methyl transferase) corepressors, as well as the CBP/p300/pCAF-histone acetyl transferase coactivators (40, 49, 55). Each epigenetic cofactor is an enzyme that catalyzes specific posttranslational reactions on distinct histone tail amino acid residues through addition or removal of reactive chemical groups (56, 57). Flux of reactive chemical groups induces alterations in local chromatin configuration, resulting in corresponding gene activation or silencing. As with mutations, epigenetic mechanisms can also profoundly affect gene expression; however, in contrast to the former, the latter is the outcome of chemical reactions that can be potentially reversed by targeted therapy. In these studies, we observed that treatment of cells with KLF11EAPP abrogated wt-KLF11–mediated CYP3A4 promoter repression (Fig. 2). KLF11EAPP is a well-characterized mutant of wt-KLF11 that does not bind SIN3A/HDAC; as a result, the CYP3A4 promoter in the vicinity of the KLF11 binding site was not deacetylated, resulting in unrepressed gene expression (38, 39). Histone tail amino acid residues are reversibly acetylated and deacetylated by histone acetyl transferases and HDACs, respectively (58). We used HATI to pharmacologically mimic histone deacetylation. HATI prevents histone acetylation; lack of de novo acetylation with unmitigated endogenous HDAC activity enables net deacetylation over time (48). We treated Ishikawa cells with different doses of TCDD and observed histone hyperacetylation in the vicinity of the CYP3A4 promoter KLF11 binding site. This site was deacetylated when the cells were additionally treated with HATI (Fig. 3A). Moreover, promoter site deacetylation resulted in corresponding repression of CYP3A4 RNA and protein expression (Fig. 3B–3D). In contrast to active histone deacetylation mediated by HDAC, this pharmacological approach using HATI to actively repress the opposite chemical reaction is passive. However, it is currently the most feasible therapeutic option. Moreover, Garcinol, the HATI used in these experiments, has been successfully used in diverse human cell lines, which indicates translational potential and viability of harnessing this agent for future therapeutic endeavors (59–61). To determine potential therapeutic efficacy of HATI in TCDD-induced disease, we investigated disease progression in a well-characterized TCDD-induced mouse model of endometriosis (Fig. 4). After surgical implantation of endometriosis lesions, the animals were treated with TCDD or TCDD and HATI. Compared with vehicle (DMSO)-exposed controls, animals exposed to TCDD demonstrated disease progression (Fig. 4). Women with progressive scarring that obliterates intra-abdominal and pelvic anatomy resulting in a “frozen pelvis” have a higher score and more advanced stage of endometriosis, according to the revised American Society for Reproductive Medicine scoring system for women with endometriosis (62). Disease progression in our animal models thus was a phenocopy of human disease with advanced lesion sizes and quantified fibrotic scarring (Fig. 4). Scarring was worsened by the additive effect of TCDD with DMSO; the exact mechanism is not known and remains a focus of further investigation. In contrast, when TCDD-treated animals were additionally administered the HATI, there was substantial amelioration in both lesion size and fibrotic progression (Fig. 4). Our findings therefore suggest that HATI therapy is effective at phenotypically arresting disease progression despite its purported passive mechanism of deacetylation. These findings are congruent with our in vitro findings in Ishikawa cells and are also associated with specific phenotypic changes in the animal model (Fig. 4). Although aryl hydrocarbon/xenobiotic signaling is the commonly implicated mechanism for TCDD-induced pathogenicity, we show here that parallel mechanisms may also be operative in exposed tissues. We used a well-characterized human endometrial cell line and an animal endometriosis model to comprehensively evaluate TCDD-induced pathogenicity and disease in vitro and in vivo. Similar mechanisms may be operative in other organs, tissues, and their cognate diseases as well, however (63, 64). TCDD commonly induces metabolic CYP450 enzymes; dysregulation of endometrial metabolism is likely an early event in establishment of endometriosis because cells displaced into an ectopic environment as the peritoneal cavity have to adapt to survive. Epithelial-stromal interactions are critical in endometrial physiology; they maintain precise, temporally coordinated differentiation, which results in coordinated peak epithelial secretion and stromal decidualization, necessary for the achievement of endometrial receptivity (65). Discordant interaction as a result of altered epithelial physiology and metabolism likely promotes aberrant stromal responses such as fibrosis in ectopic endometrial tissues. The animal model loss of Klf11 or TCDD exposure was associated with similar phenotypic progression of endometriosis (41). Disease progression in Klf11−/− mice was associated with increased Cyp3a expression in the lesions, from epigenetic dysregulation arising out of a failure to recruit and bind Sin3a/Hdac; further, disease progression was arrested by HATI therapy (48). In human endometriosis lesions, selective loss of KLF11 is also associated with increased CYP3A4 expression, which results in augmented proliferation (38). KLF11 represses multiple CYP enzymes; loss of KLF11/Klf11 is thus associated with increased CYP expression and endometriotic progression. In contrast to KLF11, TCDD is a known inducer of CYP450 enzymes, which we show here as being relevant in disease progression. We also show here that disease induction via TCDD exposure was mitigated by epigenetic therapy. It is likely that at high doses, TCDD operates predominantly via the AhR/ARNT pathway, which may not be responsive to epigenetic targeting. We found that HATI treatment repressed CYP3A4 mRNA but not protein suppression at higher doses of TCDD. This may be due to particular in vitro experimental conditions, modification of other acetylated histones besides H3K9, or via activation of other pathways that affect posttranscriptional signaling. In contrast, however, there was robust phenotypic repression in vivo. Our findings suggest that, at low exposure doses, it may be possible to reverse pathogenicity by recruiting alternative inhibitory pathways. This is important because environmental exposure is usually low dose, resulting in chronic disease. Many environmentally induced diseases result in scarring and fibrosis, as in our model, which impairs organ function (5, 66). We have previously shown that epigenetic therapy has the potential to ameliorate progressive fibrosis; the potential for therapeutic applicability is thus ample (48). KLF11 and TCDD are specifically associated with fibrotic progression and scarring. Scarring is a ubiquitous pathological mechanism in diseases affecting multiple organ systems, such as collagen vascular diseases. We have recently shown that KLF11-associated scarring and fibrosis can be replicated in a nonendometriosis animal model (67), which suggests that the findings generated here may have greater implications for diseases associated with fibrosis other than endometriosis. Elucidation of these mechanisms continues to be a focus of future investigations by our laboratory. Additionally, we plan to further mechanistically evaluate the relationship of TCDD and KLF11/epigenetic mechanisms and to collaboratively evaluate the role and translational relevance of this pathway in diseases of other dioxin-associated systemic disease. This is a report of successfully arresting chronic, toxin exposure–related progressive fibrosis in a relevant disease model using pharmacological agents that are being actively developed for use in human studies in a widening spectrum of disease. Appendix. Antibody Table Peptide/Protein Target  Antigen Sequence (if Known)  Name of Antibody  Manufacturer, Catalog No.  Species Raised in; Monoclonal or Polyclonal  Dilution Used  RRID  Anti-acetyl histone 3, lysine 9  ARTKQTAR(Ac)KSTG-C  Antiacetyl histone3K9 antibody  Abcam, 4441  Rabbit; polyclonal  1:250  AB_2118292  IgG  NA  Rabbit IgG, polyclonal - isotype control (ChIP grade)  Abcam, 171870  Rabbit; polyclonal  1:250  AB_2687657  Anti-CYP3A4  NA  Anti-cytochrome P450 3A4 antibody  Abcam, 3572  Rabbit; polyclonal  1:500 and 1:100  AB_303918  Anti-beta-tubulin III  NA  Anti-ß-tubulin-III antibody  Sigma, T2200  Rabbit; polyclonal  1:500  AB_262133  Anti-KLF11  NA  Anti-TIEG2 antibody  Abnova, H00008462-M01  Mouse; monoclonal  1:500  AB_894164  Peptide/Protein Target  Antigen Sequence (if Known)  Name of Antibody  Manufacturer, Catalog No.  Species Raised in; Monoclonal or Polyclonal  Dilution Used  RRID  Anti-acetyl histone 3, lysine 9  ARTKQTAR(Ac)KSTG-C  Antiacetyl histone3K9 antibody  Abcam, 4441  Rabbit; polyclonal  1:250  AB_2118292  IgG  NA  Rabbit IgG, polyclonal - isotype control (ChIP grade)  Abcam, 171870  Rabbit; polyclonal  1:250  AB_2687657  Anti-CYP3A4  NA  Anti-cytochrome P450 3A4 antibody  Abcam, 3572  Rabbit; polyclonal  1:500 and 1:100  AB_303918  Anti-beta-tubulin III  NA  Anti-ß-tubulin-III antibody  Sigma, T2200  Rabbit; polyclonal  1:500  AB_262133  Anti-KLF11  NA  Anti-TIEG2 antibody  Abnova, H00008462-M01  Mouse; monoclonal  1:500  AB_894164  Abbreviations: NA, not available; RRID, Research Resource Identifier. View Large Abbreviations: AhR aryl hydrocarbon receptor ARNT aryl hydrocarbon nuclear translocator ChIP chromatin immunoprecipitation CYP cytochrome DMSO dimethyl sulfoxide EV empty vector KLF Krüppel-like factor HATI histone acetyltransferase inhibitor HDAC histone deacetylase Ig immunoglobulin mRNA messenger RNA PCR polymerase chain reaction qPCR quantitative real-time polymerase chain reaction RT reverse transcription TCDD 2,3,7,8 tetrachlorodibenzo-p-dioxin wt wild-type. Acknowledgments Financial Support: This research was funded by Mayo Foundation’s Kathleen and Roger Penske Career Development Award (to G.S.D.). Disclosure Summary: The authors have nothing to disclose. References 1. Baccarelli A, Bollati V. Epigenetics and environmental chemicals. Curr Opin Pediatr . 2009; 21( 2): 243– 251. Google Scholar CrossRef Search ADS PubMed  2. Jirtle RL, Skinner MK. Environmental epigenomics and disease susceptibility. Nat Rev Genet . 2007; 8( 4): 253– 262. Google Scholar CrossRef Search ADS PubMed  3. Pera B, Tang T, Marullo R, Yang SN, Ahn H, Patel J, Elstrom R, Ruan J, Furman R, Leonard J, Cerchietti L, Martin P. Combinatorial epigenetic therapy in diffuse large B cell lymphoma pre-clinical models and patients. Clin Epigenetics . 2016; 8( 1): 79. Google Scholar CrossRef Search ADS PubMed  4. Yeo W, Chung HC, Chan SL, Wang LZ, Lim R, Picus J, Boyer M, Mo FK, Koh J, Rha SY, Hui EP, Jeung HC, Roh JK, Yu SC, To KF, Tao Q, Ma BB, Chan AW, Tong JH, Erlichman C, Chan AT, Goh BC. Epigenetic therapy using belinostat for patients with unresectable hepatocellular carcinoma: a multicenter phase I/II study with biomarker and pharmacokinetic analysis of tumors from patients in the Mayo Phase II Consortium and the Cancer Therapeutics Research Group. J Clin Oncol . 2012; 30( 27): 3361– 3367. Google Scholar CrossRef Search ADS PubMed  5. Han M, Liu X, Liu S, Su G, Fan X, Chen J, Yuan Q, Xu G. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) induces hepatic stellate cell (HSC) activation and liver fibrosis in C57BL6 mouse via activating Akt and NF-κB signaling pathways. Toxicol Lett . 2017; 273: 10– 19. Google Scholar CrossRef Search ADS PubMed  6. DeVito MJ, Birnbaum LS, Farland WH, Gasiewicz TA. Comparisons of estimated human body burdens of dioxinlike chemicals and TCDD body burdens in experimentally exposed animals. Environ Health Perspect . 1995; 103( 9): 820– 831. Google Scholar CrossRef Search ADS PubMed  7. Aoki Y. Polychlorinated biphenyls, polychlorinated dibenzo-p-dioxins, and polychlorinated dibenzofurans as endocrine disrupters--what we have learned from Yusho disease. Environ Res . 2001; 86( 1): 2– 11. Google Scholar CrossRef Search ADS PubMed  8. Patterson AT, Kaffenberger BH, Keller RA, Elston DM. Skin diseases associated with Agent Orange and other organochlorine exposures. J Am Acad Dermatol . 2016; 74( 1): 143– 170. Google Scholar CrossRef Search ADS PubMed  9. Huang CY, Wu CL, Wu JS, Chang JW, Cheng YY, Kuo YC, Yang YC, Lee CC, Guo HR. Association between blood dioxin level and chronic kidney disease in an endemic area of exposure. PLoS One . 2016; 11( 3): e0150248. Google Scholar CrossRef Search ADS PubMed  10. Fukushi J, Tokunaga S, Nakashima Y, Motomura G, Mitoma C, Uchi H, Furue M, Iwamoto Y. Effects of dioxin-related compounds on bone mineral density in patients affected by the Yusho incident. Chemosphere . 2016; 145: 25– 33. Google Scholar CrossRef Search ADS PubMed  11. Schlezinger JJ, Liu D, Farago M, Seldin DC, Belguise K, Sonenshein GE, Sherr DH. A role for the aryl hydrocarbon receptor in mammary gland tumorigenesis. Biol Chem . 2006; 387( 9): 1175– 1187. Google Scholar CrossRef Search ADS PubMed  12. Koliopanos A, Kleeff J, Xiao Y, Safe S, Zimmermann A, Büchler MW, Friess H. Increased arylhydrocarbon receptor expression offers a potential therapeutic target for pancreatic cancer. Oncogene . 2002; 21( 39): 6059– 6070. Google Scholar CrossRef Search ADS PubMed  13. Smarr MM, Kannan K, Buck Louis GM. Endocrine disrupting chemicals and endometriosis. Fertil Steril . 2016; 106( 4): 959– 966. Google Scholar CrossRef Search ADS PubMed  14. Reddy BS, Rozati R, Reddy S, Kodampur S, Reddy P, Reddy R. High plasma concentrations of polychlorinated biphenyls and phthalate esters in women with endometriosis: a prospective case control study. Fertil Steril . 2006; 85( 3): 775– 779. Google Scholar CrossRef Search ADS PubMed  15. Heilier JF, Nackers F, Verougstraete V, Tonglet R, Lison D, Donnez J. Increased dioxin-like compounds in the serum of women with peritoneal endometriosis and deep endometriotic (adenomyotic) nodules. Fertil Steril . 2005; 84( 2): 305– 312. Google Scholar CrossRef Search ADS PubMed  16. Hoffman CS, Small CM, Blanck HM, Tolbert P, Rubin C, Marcus M. Endometriosis among women exposed to polybrominated biphenyls. Ann Epidemiol . 2007; 17( 7): 503– 510. Google Scholar CrossRef Search ADS PubMed  17. Louis GM, Weiner JM, Whitcomb BW, Sperrazza R, Schisterman EF, Lobdell DT, Crickard K, Greizerstein H, Kostyniak PJ. Environmental PCB exposure and risk of endometriosis. Hum Reprod . 2005; 20( 1): 279– 285. Google Scholar CrossRef Search ADS PubMed  18. Martínez-Zamora MA, Mattioli L, Parera J, Abad E, Coloma JL, van Babel B, Galceran MT, Balasch J, Carmona F. Increased levels of dioxin-like substances in adipose tissue in patients with deep infiltrating endometriosis. Hum Reprod . 2015; 30( 5): 1059– 1068. Google Scholar CrossRef Search ADS PubMed  19. Porpora MG, Medda E, Abballe A, Bolli S, De Angelis I, di Domenico A, Ferro A, Ingelido AM, Maggi A, Panici PB, De Felip E. Endometriosis and organochlorinated environmental pollutants: a case-control study on Italian women of reproductive age. Environ Health Perspect . 2009; 117( 7): 1070– 1075. Google Scholar CrossRef Search ADS PubMed  20. Simsa P, Mihalyi A, Schoeters G, Koppen G, Kyama CM, Den Hond EM, Fülöp V, D’Hooghe TM. Increased exposure to dioxin-like compounds is associated with endometriosis in a case-control study in women. Reprod Biomed Online . 2010; 20( 5): 681– 688. Google Scholar CrossRef Search ADS PubMed  21. Cai LY, Izumi S, Suzuki T, Goya K, Nakamura E, Sugiyama T, Kobayashi H. Dioxins in ascites and serum of women with endometriosis: a pilot study. Hum Reprod . 2011; 26( 1): 117– 126. Google Scholar CrossRef Search ADS PubMed  22. Sofo V, Götte M, Laganà AS, Salmeri FM, Triolo O, Sturlese E, Retto G, Alfa M, Granese R, Abrão MS. Correlation between dioxin and endometriosis: an epigenetic route to unravel the pathogenesis of the disease. Arch Gynecol Obstet . 2015; 292( 5): 973– 986. Google Scholar CrossRef Search ADS PubMed  23. Giudice LC, Kao LC. Endometriosis. Lancet . 2004; 364( 9447): 1789– 1799. Google Scholar CrossRef Search ADS PubMed  24. Simoens S, Hummelshoj L, D’Hooghe T. Endometriosis: cost estimates and methodological perspective. Hum Reprod Update . 2007; 13( 4): 395– 404. Google Scholar CrossRef Search ADS PubMed  25. Rier SE, Martin DC, Bowman RE, Dmowski WP, Becker JL. Endometriosis in rhesus monkeys (Macaca mulatta) following chronic exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Fundam Appl Toxicol . 1993; 21( 4): 433– 441. Google Scholar CrossRef Search ADS PubMed  26. Rier SE, Turner WE, Martin DC, Morris R, Lucier GW, Clark GC. Serum levels of TCDD and dioxin-like chemicals in Rhesus monkeys chronically exposed to dioxin: correlation of increased serum PCB levels with endometriosis. Toxicol Sci . 2001; 59( 1): 147– 159. Google Scholar CrossRef Search ADS PubMed  27. Tsukino H, Hanaoka T, Sasaki H, Motoyama H, Hiroshima M, Tanaka T, Kabuto M, Niskar AS, Rubin C, Patterson DG, Jr, Turner W, Needham L, Tsugane S. Associations between serum levels of selected organochlorine compounds and endometriosis in infertile Japanese women. Environ Res . 2005; 99( 1): 118– 125. Google Scholar CrossRef Search ADS PubMed  28. Pauwels A, Schepens PJ, D’Hooghe T, Delbeke L, Dhont M, Brouwer A, Weyler J. The risk of endometriosis and exposure to dioxins and polychlorinated biphenyls: a case-control study of infertile women. Hum Reprod . 2001; 16( 10): 2050– 2055. Google Scholar CrossRef Search ADS PubMed  29. De Felip E, Porpora MG, di Domenico A, Ingelido AM, Cardelli M, Cosmi EV, Donnez J. Dioxin-like compounds and endometriosis: a study on Italian and Belgian women of reproductive age. Toxicol Lett . 2004; 150( 2): 203– 209. Google Scholar CrossRef Search ADS PubMed  30. Lebel G, Dodin S, Ayotte P, Marcoux S, Ferron LA, Dewailly E. Organochlorine exposure and the risk of endometriosis. Fertil Steril . 1998; 69( 2): 221– 228. Google Scholar CrossRef Search ADS PubMed  31. Niskar AS, Needham LL, Rubin C, Turner WE, Martin CA, Patterson DG, Jr, Hasty L, Wong LY, Marcus M. Serum dioxins, polychlorinated biphenyls, and endometriosis: a case-control study in Atlanta. Chemosphere . 2009; 74( 7): 944– 949. Google Scholar CrossRef Search ADS PubMed  32. Cummings AM, Metcalf JL. Induction of endometriosis in mice: a new model sensitive to estrogen. Reprod Toxicol . 1995; 9( 3): 233– 238. Google Scholar CrossRef Search ADS PubMed  33. Nayyar T, Bruner-Tran KL, Piestrzeniewicz-Ulanska D, Osteen KG. Developmental exposure of mice to TCDD elicits a similar uterine phenotype in adult animals as observed in women with endometriosis. Reprod Toxicol . 2007; 23( 3): 326– 336. Google Scholar CrossRef Search ADS PubMed  34. De Jongh J, DeVito M, Nieboer R, Birnbaum L, Van den Berg M. Induction of cytochrome P450 isoenzymes after toxicokinetic interactions between 2,3,7,8-tetrachlorodibenzo-p-dioxin and 2,2′,4,4′,5,5′-hexachlorobiphenyl in the liver of the mouse. Fundam Appl Toxicol . 1995; 25( 2): 264– 270. Google Scholar CrossRef Search ADS PubMed  35. DeVito MJ, Ma X, Babish JG, Menache M, Birnbaum LS. Dose-response relationships in mice following subchronic exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin: CYP1A1, CYP1A2, estrogen receptor, and protein tyrosine phosphorylation. Toxicol Appl Pharmacol . 1994; 124( 1): 82– 90. Google Scholar CrossRef Search ADS PubMed  36. Diliberto JJ, Akubue PI, Luebke RW, Birnbaum LS. Dose-response relationships of tissue distribution and induction of CYP1A1 and CYP1A2 enzymatic activities following acute exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in mice. Toxicol Appl Pharmacol . 1995; 130( 2): 197– 208. Google Scholar CrossRef Search ADS PubMed  37. Guengerich FP. Metabolism of 17 alpha-ethynylestradiol in humans. Life Sci . 1990; 47( 22): 1981– 1988. Google Scholar CrossRef Search ADS PubMed  38. Zheng Y, Tabbaa ZM, Khan Z, Schoolmeester JK, El-Nashar S, Famuyide A, Keeney GL, Daftary GS. Epigenetic regulation of uterine biology by transcription factor KLF11 via posttranslational histone deacetylation of cytochrome p450 metabolic enzymes. Endocrinology . 2014; 155( 11): 4507– 4520. Google Scholar CrossRef Search ADS PubMed  39. Correa LF, Zheng Y, Delaney AA, Khan Z, Shenoy CC, Daftary GS. TGF-β induces endometriotic progression via a noncanonical, KLF11-mediated mechanism. Endocrinology . 2016; 157( 9): 3332– 3343. Google Scholar CrossRef Search ADS PubMed  40. Bonnefond A, Lomberk G, Buttar N, Busiah K, Vaillant E, Lobbens S, Yengo L, Dechaume A, Mignot B, Simon A, Scharfmann R, Neve B, Tanyolaç S, Hodoglugil U, Pattou F, Cavé H, Iovanna J, Stein R, Polak M, Vaxillaire M, Froguel P, Urrutia R. Disruption of a novel Kruppel-like transcription factor p300-regulated pathway for insulin biosynthesis revealed by studies of the c.-331 INS mutation found in neonatal diabetes mellitus. J Biol Chem . 2011; 286( 32): 28414– 28424. Google Scholar CrossRef Search ADS PubMed  41. Daftary GS, Zheng Y, Tabbaa ZM, Schoolmeester JK, Gada RP, Grzenda AL, Mathison AJ, Keeney GL, Lomberk GA, Urrutia R. A novel role of the Sp/KLF transcription factor KLF11 in arresting progression of endometriosis. PLoS One . 2013; 8( 3): e60165. Google Scholar CrossRef Search ADS PubMed  42. Potapova A, Hasemeier B, Römermann D, Metzig K, Göhring G, Schlegelberger B, Länger F, Kreipe H, Lehmann U. Epigenetic inactivation of tumour suppressor gene KLF11 in myelodysplastic syndromes*. Eur J Haematol . 2010; 84( 4): 298– 303. Google Scholar CrossRef Search ADS PubMed  43. Yin P, Lin Z, Reierstad S, Wu J, Ishikawa H, Marsh EE, Innes J, Cheng Y, Pearson K, Coon JS V, Kim JJ, Chakravarti D, Bulun SE. Transcription factor KLF11 integrates progesterone receptor signaling and proliferation in uterine leiomyoma cells. Cancer Res . 2010; 70( 4): 1722– 1730. Google Scholar CrossRef Search ADS PubMed  44. Cook T, Gebelein B, Belal M, Mesa K, Urrutia R. Three conserved transcriptional repressor domains are a defining feature of the TIEG subfamily of Sp1-like zinc finger proteins. J Biol Chem . 1999; 274( 41): 29500– 29504. Google Scholar CrossRef Search ADS PubMed  45. Daftary GS, Lomberk GA, Buttar NS, Allen TW, Grzenda A, Zhang J, Zheng Y, Mathison AJ, Gada RP, Calvo E, Iovanna JL, Billadeau DD, Prendergast FG, Urrutia R. Detailed structural-functional analysis of the Krüppel-like factor 16 (KLF16) transcription factor reveals novel mechanisms for silencing Sp/KLF sites involved in metabolism and endocrinology. J Biol Chem . 2012; 287( 10): 7010– 7025. Google Scholar CrossRef Search ADS PubMed  46. Lomberk G, Urrutia R. The family feud: turning off Sp1 by Sp1-like KLF proteins. Biochem J . 2005; 392( Pt 1): 1– 11. Google Scholar CrossRef Search ADS PubMed  47. Delaney AA, Khan Z, Zheng Y, Correa LF, Zanfagnin V, Shenoy CC, Schoolmeester JK, Saadalla AM, El-Nashar S, Famuyide AO, Subramaniam M, Hawse JR, Khazaie K, Daftary GS. KLF10 mediated epigenetic dysregulation of epithelial CD40/CD154 promotes endometriosis. Biol Reprod . 2016; 95( 3): 62. Google Scholar CrossRef Search ADS PubMed  48. Zheng Y, Khan Z, Zanfagnin V, Correa LF, Delaney AA, Daftary GS. Epigenetic modulation of collagen 1A1: therapeutic implications in fibrosis and endometriosis. Biol Reprod . 2016; 94( 4): 87. Google Scholar CrossRef Search ADS PubMed  49. Buttar NS, DeMars CJ, Lomberk G, Rizvi S, Bonilla-Velez J, Achra S, Rashtak S, Wang KK, Fernandez-Zapico ME, Urrutia R. Distinct role of Kruppel-like factor 11 in the regulation of prostaglandin E2 biosynthesis. J Biol Chem . 2010; 285( 15): 11433– 11444. Google Scholar CrossRef Search ADS PubMed  50. Tabbaa ZM, Zheng Y, Daftary GS. KLF11 epigenetically regulates glycodelin-A, a marker of endometrial biology via histone-modifying chromatin mechanisms. Reprod Sci . 2014; 21( 3): 319– 328. Google Scholar CrossRef Search ADS PubMed  51. Zhang JS, Moncrieffe MC, Kaczynski J, Ellenrieder V, Prendergast FG, Urrutia R. A conserved alpha-helical motif mediates the interaction of Sp1-like transcriptional repressors with the corepressor mSin3A. Mol Cell Biol . 2001; 21( 15): 5041– 5049. Google Scholar CrossRef Search ADS PubMed  52. Kim M, Bae M, Na H, Yang M. Environmental toxicants--induced epigenetic alterations and their reversers [published correction appears in J Environ Sci Health C Environ Carcinog Ecotoxical Rev. 2013;31(3):285]. J Environ Sci Health C Environ Carcinog Ecotoxicol Rev . 2012; 30( 4): 323– 367. Google Scholar CrossRef Search ADS PubMed  53. Birnbaum LS. The mechanism of dioxin toxicity: relationship to risk assessment. Environ Health Perspect . 1994; 102( Suppl 9): 157– 167. Google Scholar CrossRef Search ADS PubMed  54. Denison MS, Nagy SR. Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annu Rev Pharmacol Toxicol . 2003; 43( 1): 309– 334. Google Scholar CrossRef Search ADS PubMed  55. Seo S, Lomberk G, Mathison A, Buttar N, Podratz J, Calvo E, Iovanna J, Brimijoin S, Windebank A, Urrutia R. Krüppel-like factor 11 differentially couples to histone acetyltransferase and histone methyltransferase chromatin remodeling pathways to transcriptionally regulate dopamine D2 receptor in neuronal cells. J Biol Chem . 2012; 287( 16): 12723– 12735. Google Scholar CrossRef Search ADS PubMed  56. Beisel C, Paro R. Silencing chromatin: comparing modes and mechanisms. Nat Rev Genet . 2011; 12( 2): 123– 135. Google Scholar CrossRef Search ADS PubMed  57. Berger SL. The complex language of chromatin regulation during transcription. Nature . 2007; 447( 7143): 407– 412. Google Scholar CrossRef Search ADS PubMed  58. Garcia-Ramirez M, Rocchini C, Ausio J. Modulation of chromatin folding by histone acetylation. J Biol Chem . 1995; 270( 30): 17923– 17928. Google Scholar CrossRef Search ADS PubMed  59. Nishino T, Wang C, Mochizuki-Kashio M, Osawa M, Nakauchi H, Iwama A. Ex vivo expansion of human hematopoietic stem cells by garcinol, a potent inhibitor of histone acetyltransferase. PLoS One . 2011; 6( 9): e24298. Google Scholar CrossRef Search ADS PubMed  60. Wang J, Wang L, Ho CT, Zhang K, Liu Q, Zhao H. Garcinol from Garcinia indica downregulates cancer stem-like cell biomarker ALDH1A1 in nonsmall cell lung cancer A549 cells through DDIT3 activation. J Agric Food Chem . 2017; 65( 18): 3675– 3683. Google Scholar CrossRef Search ADS PubMed  61. Tu SH, Chiou YS, Kalyanam N, Ho CT, Chen LC, Pan MH. Garcinol sensitizes breast cancer cells to Taxol through the suppression of caspase-3/iPLA2 and NF-κB/Twist1 signaling pathways in a mouse 4T1 breast tumor model. Food Funct . 2017; 8( 3): 1067– 1079. Google Scholar CrossRef Search ADS PubMed  62. Johnson NP, Hummelshoj L, Adamson GD, Keckstein J, Taylor HS, Abrao MS, Bush D, Kiesel L, Tamimi R, Sharpe-Timms KL, Rombauts L, Giudice LC; for the World Endometriosis Society Sao Paulo Consortium. World Endometriosis Society consensus on the classification of endometriosis. Hum Reprod . 2017; 32( 2): 315– 324. Google Scholar CrossRef Search ADS PubMed  63. Abbott BD, Perdew GH, Buckalew AR, Birnbaum LS. Interactive regulation of Ah and glucocorticoid receptors in the synergistic induction of cleft palate by 2,3,7,8-tetrachlorodibenzo-p-dioxin and hydrocortisone. Toxicol Appl Pharmacol . 1994; 128( 1): 138– 150. Google Scholar CrossRef Search ADS PubMed  64. Nohara K, Fujimaki H, Tsukumo S, Ushio H, Miyabara Y, Kijima M, Tohyama C, Yonemoto J. The effects of perinatal exposure to low doses of 2,3,7,8-tetrachlorodibenzo-p-dioxin on immune organs in rats. Toxicology . 2000; 154( 1-3): 123– 133. Google Scholar CrossRef Search ADS PubMed  65. Field SL, Cummings M, Orsi NM. Epithelial and stromal-specific immune pathway activation in the murine endometrium post-coitum. Reproduction . 2015; 150( 2): 127– 138. Google Scholar CrossRef Search ADS PubMed  66. Xue J, Zhao Q, Sharma V, Nguyen LP, Lee YN, Pham KL, Edderkaoui M, Pandol SJ, Park W, Habtezion A. Aryl hydrocarbon receptor ligands in cigarette smoke induce production of interleukin-22 to promote pancreatic fibrosis in models of chronic pancreatitis. Gastroenterology . 2016; 151( 6): 1206– 1217. Google Scholar CrossRef Search ADS PubMed  67. Shenoy CC, Khan Z, Zheng Y, Jones TL, Khazaie K, Daftary GS. Progressive fibrosis: a progesterone- and KLF11-mediated sexually dimorphic female response. Endocrinology . 2017; 158( 10): 3605– 3619. Google Scholar CrossRef Search ADS PubMed  Copyright © 2018 Endocrine Society http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Endocrinology Oxford University Press

Epigenetic Therapy: Novel Translational Implications for Arrest of Environmental Dioxin-Induced Disease in Females

Loading next page...
 
/lp/ou_press/epigenetic-therapy-novel-translational-implications-for-arrest-of-cKTjcs2mDV
Publisher
Oxford University Press
Copyright
Copyright © 2018 Endocrine Society
ISSN
0013-7227
eISSN
1945-7170
D.O.I.
10.1210/en.2017-00860
Publisher site
See Article on Publisher Site

Abstract

Abstract Increased toxicant exposure and resultant environmentally induced diseases are a tradeoff of industrial productivity. Dioxin [2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD)], a ubiquitous byproduct, is associated with a spectrum of diseases including endometriosis, a common, chronic disease in women. TCDD activates cytochrome (CYP) p450 metabolic enzymes that alter organ function to cause disease. In contrast, the transcription factor, Krüppel-like factor (KLF) 11, represses these enzymes via epigenetic mechanisms. In this study, we characterized these opposing mechanisms in vitro and in vivo as well as determining potential translational implications of epigenetic inhibitor therapy. KLF11 antagonized TCDD-mediated activation of CYP3A4 gene expression and function in endometrial cells. The repression was pharmacologically replicated by selective use of an epigenetic histone acetyltransferase inhibitor (HATI). We further showed phenotypic relevance of this mechanism using an animal model for endometriosis. Fibrotic extent in TCDD-exposed wild-type animals was similar to that previously observed in Klf11−/− animals. When TCDD-exposed animals were treated with a HATI, Cyp3 messenger RNA levels and protein expression decreased along with disease progression. Fibrotic progression is ubiquitous in environmentally induced chronic, untreatable diseases; this report shows that relentless disease progression can be arrested through targeted epigenetic modulation of protective mechanisms. Increased agricultural and industrial production commensurate with human civilizational advance has resulted in increased prevalence of diseases related to environmental exposure. Such diseases occur from biological interaction with an array of diverse environmental physical and chemical exposures in individuals of diverse susceptibility (1). Environmental agents commonly disrupt epigenetic regulatory mechanisms, resulting in altered gene expression, function, and disease (2). In contrast to gene mutations, dysfunctional epigenetic mechanisms are translationally more relevant and can be targeted and reversed by specific pharmacological inhibitors (3, 4). Diseases from environmental exposure commonly result from disruption of stabilizing, homeostatic mechanisms. The resultant cleavage of adaptive capacity enhances disease susceptibility. Dioxin, or 2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD), is a ubiquitous byproduct of herbicide and pesticide manufacturing, smelting, and chlorine bleaching. It is a widely distributed toxic environmental contaminant that belongs to a class of persistent organic pollutants known as polychlorinated biphenyls (5). Humans exposed to atmospheric and/or effluent dioxin, either at low accumulating doses or high concentrations, face various adverse health effects (6–10). Dioxin has been recognized as a carcinogen, teratogen, and endocrine disrupter (11–13). Endometriosis is an endocrine disease with vaguely understood pathophysiology. Exposure to TCDD may be one of the many mechanisms involved in disease pathogenesis (14–22). Endometriosis is a highly prevalent and chronic disease that affects at least 10% of reproductive-age women with pelvic pain, infertility, and sexual dysfunction (23). This recurrent and recalcitrant disease causes tremendous personal and societal morbidity, with annual health expenses exceeding $20 million in the United States alone (24). The association between TCDD and endometriosis was reported and experimentally induced in a primate colony previously exposed to TCDD (25, 26). The role of TCDD in the pathogenesis of endometriosis in humans is a focus of contemporary investigation. Whereas several reports have shown no link between TCDD and endometriosis in humans (27–31), there is also increasing evidence recognizing the relationship between TCDD and endometriosis (14–21). Dioxin-induced endometriosis in animal models therefore offers a robust mechanistic investigation of toxic endocrine disruption resulting in disease (32, 33). Dioxin critically affects homeostasis by activating cytochrome (CYP) enzymes that catalyze more than 75% of phase 1 metabolic reactions in diverse organs and tissues; metabolic dysregulation potentially enhances risk of disease therein (6, 34–36). CYP substrates include endogenous hormones such as estrogens and progesterone as well as exogenous pharmacological substrates, such as acetaminophen, xenobiotics, and toxins (34–36). In humans, CYP enzymes, primarily in the liver but also in the intestine and endometrium, metabolize estrogens into phase 1 metabolites: 2-hydroxy- and 4-hydroxyestrogens (37). Dysregulation of CYP enzyme-mediated metabolic reactions in endometrial tissue can therefore affect embryo implantation, fetal development, and have an impact on endometrial diseases. We have previously shown that altered endometrial metabolism results in endometriosis (38, 39). Krüppel-like factor 11 (KLF11) is a Sp/KLF family zinc finger transcription factor associated with several human endocrine, metabolic, and reproductive diseases (40–43). Although the C-terminal zinc finger DNA-binding domain is characteristically conserved, enabling its inclusion in the larger family, the N-terminal is unique and displays distinct epigenetic cofactor-binding domains (44). KLF11 binds distinct nuclear epigenetic coactivators and/or corepressors and thus recruits them to distinct promoter GC-motif elements located in the 5′ regulatory region of its target genes. The KLF/cofactor complex thus mediates directional target gene expression via modulation of the local chromatin configuration (45, 46). We have previously shown that KLF11 binds the promoters of various CYP isoforms to regulate steroidogenesis as well as metabolism (38). In particular, KLF11 is a repressor of endometrial CYP3A4 expression; this repression is mediated via recruitment of the epigenetic cofactor SIN3A/histone deacetylase (HDAC) (38, 39). Recruitment of SIN3A/HDAC by KLF11 to the CYP3A4 promoter results in localized chromatin compaction, which represses gene expression (38). Diverse environmental exposures to toxins and toxicants have been associated with epigenetic modifications resulting in disease; the ability to target and reverse such mechanisms remains an unmet need. In these studies, we characterize in vitro and in vivo disease progression mediated by TCDD, a common environmental endocrine disruptive chemical, as a result of epigenetic dysregulation of critical metabolic enzyme CYP3A4, a ubiquitous model endometrial metabolic enzyme that is differentially activated by TCDD and KLF11. We also aim to characterize a translationally relevant epigenetic mechanism that targets fibrosis in a well-characterized animal endometriosis model. Given the ubiquity of fibrosis as a pathogenic mechanism in a diversity of tissues, we expect these results to have relevance to a broad spectrum of chronic medical diseases. Materials and Methods Cell line and treatment Ishikawa cells were maintained in Dulbecco’s modified Eagle medium with 10% fetal bovine serum. The cells were transiently transfected with 2.5 µg of pcDNA3/HIS-KLF11, pcDNA3/HIS-KLF11EAPP, or pcDNA3/HIS empty vector (EV; Invitrogen, Carlsbad, CA) for 48 hours using lipofectamine per laboratory protocol (38). The cells were then treated with TCDD (Ultra Scientific, North Kingstown, RI; catalog no. RPE-029S) at various concentrations from 0.05 to 10 nM or 15 μM Garcinol [histone acetyltransferase inhibitor (HATI)] (Enzo Life Sciences, Farmingdale, NY) for 24 hours. RNA isolation and real-time polymerase chain reaction Standard laboratory protocols were used for RNA isolation and polymerase chain reaction (PCR) as previously described (38). Briefly, total RNA from one six-well plate of 80% confluent Ishikawa cells was extracted using an RNeasy kit (Qiagen Inc., Valencia, CA) per the manufacturer’s instructions. RNA yield was quantified using a Nanodrop (Thermo Fisher Scientific, Waltham, MA). Two micrograms of total RNA was used for subsequent complementary DNA synthesis. Oligo-dT primer was for complementary DNA synthesis in the SuperScript III first-strand synthesis system for reverse transcription (RT)-PCR per manufacturer’s protocol (Invitrogen). Quantitative –real-time PCR (qPCR) was performed using commercial primers for CYP3A4 (Qiagen), ΔΔCT was used to normalize expression against a panel of housekeeping controls: beta-2-microglobulin (B2M/B2m), glyceraldehyde 3-phosphate dehydrogenase (GAPDH/Gapdh), and hypoxanthine phosphoribosyltransferase 1 (HPRT1/Hprt1) (Qiagen). qPCR reactions were performed using the IQ-SYBR Green Supermix (Bio-Rad, Hercules, CA) in a PikoReal96 Real-Time PCR System (Thermo Fisher). Each experiment was performed in triplicate three independent times. Chromatin immunoprecipitation Chromatin immunoprecipitation (ChIP) was performed using E-Z ChIP per kit protocol (Millipore, Temecula, CA). Briefly, 2 million Ishikawa cells were treated with either dimethyl sulfoxide (DMSO), TCDD at 1 and 10 nM alone, or 15 µM HATI. Cells were lysed and sonicated to generate 200- to 600-bp fragments. Antiacetyl histone 3K9 antibody (1:250; Abcam, Cambridge, MA; catalog no. ab4441), or a species-specific control immunoglobulin G (IgG; Abcam catalog no. 171870) was used for overnight immunoprecipitation. Overlapping segments of the CYP3A4 regulatory regions spanning −1000 to +1 bp were previously evaluated for KLF11 binding using a series of primers (38). A well-characterized CYP3A4 promoter KLF11 binding element was evaluated here for differences in histone acetylation. Human CYP3A4 promoter region was amplified using primer sequences for ChIP as follows: region A forward/reverse, CTTGGACTCCCCAGTAACATTG/GATTGTTTATATGCTAGAGAAGGAGGC; region B forward/reverse, CTGGGTTTGGAAGGATGTGTAG/GGTTCTGGGTTCTTATCAGAAACTC; and region C forward/reverse, ATGACAGGGAATAAGACTAGACTATGCC/ACAGACAGAGCCTTCTCTTAGAGTCTT. PCR products representing these CYP3A4 promotor regions A, B, and C were examined on a 2% agarose gel. Luciferase reporter assay The pGL3-basic EV was purchased from Promega, Madison, WI. pGL3 basic promoter-reporter constructs each containing serial 200- to 400-bp GC-rich elements in the CYP3A4 promoter were generated as previously described. Ishikawa cells at 80% confluence were cotransfected with either 2.5 μg of pcDNA3/HIS EV (Invitrogen) or pcDNA3/HIS-KLF11 construct and 3 μg of a pGL3-CYP3A4-promoter-reporter construct −600 to +62, corresponding to the region evaluated by ChIP as previously described (38). Forty-eight hours after transfection, cells were lysed and reporter activity was read using the luciferase assay system (Promega) and a 20/20 luminometer (Turner Designs, San Jose, CA) per manufacturer protocol. Data in relative light units were normalized to lysate protein concentrations as characterized previously (41). Experiments were performed in triplicate, three independent times. Experimental animals All experiments were performed in accordance with the Guide for Care and Use of Laboratory Animals from the National Institutes of Health. These guidelines were incorporated into the study protocol which was also approved by the Institutional Animal Care and Use Committee, at the Mayo Clinic, Rochester, Minnesota. C57/BL6 wild-type (wt) mice were housed in specific pathogen-free conditions at the Mayo Clinic animal housing facility; only 8- to 10-week-old females were used throughout the experiment. TCDD at 3 μg/kg body weight or vehicle (DMSO) was administrated by gavage 3 weeks before surgery. Endometriosis was surgically induced for induction of endometriosis, a well-characterized and previously published surgical approach (32, 41). Briefly, one complete uterine horn was resected and two 5-mm everted uterine segments were transplanted by suture on to the parietal peritoneum. Eversion of uterine segments ensured that the endometrial aspect of each resected uterine segment was exposed to the peritoneal cavity as in human disease. Administration of TCDD or vehicle (DMSO) via oral gavage continued every 3 weeks and in addition to that mice were treated postoperatively with Garcinol (HATI: 0.2 mg/kg body weight) or DMSO (v/v) by intraperitoneal injection once a day for 9 weeks (N = 40; 10/treatment group). Doses and treatment regimens were based on previously published studies as well as our own dose-optimization studies to ensure nontoxic, therapeutic efficacy. At the end of 9 weeks, disease lesion size and extent were evaluated in all animals at necropsy. Phenotype was evaluated objectively by at least two independent investigators that were blinded to the treatment condition using a previously published fibrosis scoring system for murine endometriosis (41). Western blotting Whole-cell lysate was obtained from Ishikawa cells treated with DMSO, varying concentrations of TCDD alone, or TCDD + HATI. A total of 10 μg of protein was separated by 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis, transferred to a polyvinylidene fluoride membrane, and probed overnight with anti-CYP3A4 (1:500; Abcam #3572), anti-KLF11 (1:500; Abnova Walnut, CA; catalog no. H00008462-M01), and anti-β-tubulin (1:500; Sigma T2200, Ronkonkoma, NY) primary antibodies. Quantification of Western blots was performed using Image-J software (National Institutes of Health, Bethesda, MD). Immunohistochemistry For immunohistochemistry, standard laboratory protocols were followed as previously published (38, 41, 47). Briefly, deparaffinized and rehydrated sections underwent epitope retrieval by heating with 10 mM citrate buffer (pH 6.0). Peroxidase quenching using hydrogen peroxide/methanol was followed by avidin/biotin blocking (Vector Laboratories, Burlingame, CA) followed by blocking CAS solution (CAS Block; Invitrogen) blocking followed by overnight 4°C incubation with anti-CYP3A4 (1:100 dilution), which also detects murine Cyp3a4 orthologs. After overnight incubation, the tissue microarrays (TMAs) were incubated with secondary biotinylated horse antirabbit antibody (1:500, Vector Laboratories) for 30 minutes at room temperature followed by incubation with streptavidin (Invitrogen) and Nova Red (Vector Laboratories). Examination of the stained sections was conducted using a Nikon Labophot-2 microscope and Image-Pro Plus 5.0.1 acquisition software (Media Cybernetics, Bethesda, MD). For Masson trichrome staining, collagen was stained using the Trichrome Stain Kit (Newcomer Supply, Inc., Middleton, WI) per protocol (38, 41). Briefly, the samples were deparaffinized, hydrated, and fixed in Bouin’s fluid for 1 hour at 60°C. Subsequently, the sections were stained with Weigert iron hematoxylin for 10 minutes, Biebrich Scarlet-Acid Fuchsin for 2 minutes, and Aniline Blue solution for 5 minutes. Image capture was performed as described previously. Statistical analysis Results are expressed as means ± standard error of means. In vitro experiments were performed as three independent biological replicates, with results confirmed each time using three technical replicates. A t test for independence or χ2 tests was used as indicated by data type. The Bonferroni method was used to adjust statistically significant P values where multiple comparisons were used. All statistical tests were two-sided. Statistical analysis was performed using SAS software (SAS Institute, Cary, NC). Comparison between the murine groups was performed using analysis of variance. Experimental animal numbers were based on an expected effect size of at least 30% difference in the lesion measurement as well as clinically important difference in fibrosis scores such that each experimental group consisted of at least seven animals. This would provide 80% power to detect the stated effect size with a type I error level of 0.05 using two-tailed tests. Results Dioxin-activated CYP3A4 in an endometrial epithelial cell line To determine the effect of TCDD on endometrial cell CYP3A4 expression, we treated Ishikawa cells with increasing doses (0.05 to 10 nM) to replicate a range of exposures from typical to excessive. Compared with vehicle (DMSO)-treated controls, CYP3A4 messenger RNA (mRNA) expression was significantly increased by TCDD (Fig. 1A). This is seen at the lowest dose (0.05 nM), with expression levels increasing further at the intermediate dose (1 nM) and more than doubling at 10-nM levels (P < 0.0167 at all dosage points compared with control) (Fig. 1A). Increased mRNA transcription further resulted in elevated CYP3A4 enzyme levels, as is seen by the representative blots (Fig. 1B) and their quantification (P < 0.0167 at all dosage points compared with control; Fig. 1C). KLF11 expression in the cells remained unchanged at all TCDD doses (Supplemental Fig. 1). Figure 1. View largeDownload slide CYP3A4 expression in Ishikawa cells. (A) CYP3A4 mRNA expression levels were determined by qPCR in Ishikawa cells exposed to either vehicle control (DMSO) or increasing doses of TCDD (0.05, 1, and 10 nM). Increase in CYP3A4 expression was directly proportional to TCDD dose (*P < 0.0167 compared with control; based on mean values from three independent biological replicates). CYP3A4 mRNA levels were normalized to a panel of housekeeping genes: B2M, GAPDH, and HPRT1. (B and C) CYP3A4 protein expression was increased in Ishikawa cells treated at all three doses of TCDD (0.05, 1, and 10 nM) compared with DMSO control. β-tubulin was used as loading control. (B) Representative blots. (C) Quantification (*P < 0.0167 compared with control-adjusted P value after Bonferroni correction). Figure 1. View largeDownload slide CYP3A4 expression in Ishikawa cells. (A) CYP3A4 mRNA expression levels were determined by qPCR in Ishikawa cells exposed to either vehicle control (DMSO) or increasing doses of TCDD (0.05, 1, and 10 nM). Increase in CYP3A4 expression was directly proportional to TCDD dose (*P < 0.0167 compared with control; based on mean values from three independent biological replicates). CYP3A4 mRNA levels were normalized to a panel of housekeeping genes: B2M, GAPDH, and HPRT1. (B and C) CYP3A4 protein expression was increased in Ishikawa cells treated at all three doses of TCDD (0.05, 1, and 10 nM) compared with DMSO control. β-tubulin was used as loading control. (B) Representative blots. (C) Quantification (*P < 0.0167 compared with control-adjusted P value after Bonferroni correction). KLF11 antagonized dioxin-induced CYP3A4 expression via epigenetic SIN3A/HDAC-related mechanisms To determine the role of KLF11/SIN3A/HDAC at the CYP3A4 promoter in TCDD-exposed cells, we treated Ishikawa cells transfected with pcDNA3/HIS EV) pcDNA3/HIS-KLF11 (KLF11), or pcDNA3/HIS-KLF11EAPP (KLF11EAPP) with increasing doses of TCDD and evaluated promoter-luciferase activity at a previously characterized KLF11-responsive CYP3A4 regulatory element (Fig. 2A). In contrast to EV, KLF11 significantly repressed CYP3A4 promoter/luciferase activity in vehicle control (DMSO)-treated cells as well as those treated with low-dose (0.05 nM) TCDD (P < 0.0167) (Fig. 2A). At higher doses, there was nonsignificant repression and eventually no repression at 1 and 10 nM dosages, respectively. To confirm the regulatory role of SIN3A/HDAC, additional cells were transfected with KLF11EAPP, a well-characterized KLF11 mutant that does not bind SIN3A (48–51). CYP3A4 promoter/luciferase levels were increased to baseline in cells transfected with KLF11EAPP compared with wt-KLF11 as a result of derepression, irrespective of TCDD dosage (Fig. 2A). Because wt-KLF11–mediated repression was less pronounced at higher TCDD doses, the difference in CYP3A4 promoter/luciferase activity between wt-KLF11 and KLF11EAPP was also correspondingly diminished at higher levels. High-dose TCDD therefore activated the CYP3A4 promoter independently of KLF11/SIN3A/HDAC. CYP3A4 gene expression corresponded with promoter activity; accordingly, KLF11 repressed CYP3A4 mRNA expression at low (0.05 nM) but not higher doses of TCDD (1 and 10 nM; P < 0.0167) (Fig. 2B). As seen at the promoter, KLF11EAPP derepressed wt-KLF11–mediated CYP3A4 mRNA expression; the difference was substantial only in vehicle control and in 0.05 nM TCDD-treated cells, wherein wt-KLF11 was also a repressor (Fig. 2B). Figure 2. View largeDownload slide CYP3A4 expression is antagonized by KLF11 via epigenetic SIN3A/HDAC. (A) Ishikawa cells transfected with EV, KLF11, or a wt KLF11 SIN3A/HDAC nonbinding mutant (KLF11EAPP) were treated with either DMSO vehicle control (veh) or TCDD (0.05, 1, and 10 nM), and evaluated using a CYP3A4-promotor-luciferase reporter assay. KLF11 significantly repressed CYP3A4-luciferase expression compared with EV in control DMSO-treated cells and in cells treated with 0.05 nM of TCDD. In contrast, KLF11 did not repress CYP3A4-luciferase expression in cells treated with higher doses of TCDD (1 and 10 nM). Derepression of CYP3A4-luciferase expression was evident in cells transfected with KLF11EAPP irrespective of DMSO or TCDD treatment; the difference however was significant only in cells treated with vehicle control only (*P < 0.0167 adjusted P value after Bonferroni correction). (B) KLF11 repressed CYP3A4 mRNA expression in vehicle-treated cells as well as at low doses of TCDD (0.05 nM) but not higher doses (1 and 10 nM) (*P < 0.0167 adjusted P value after Bonferroni correction). KLF11EAPP derepressed wt-KLF11–mediated CYP3A4 mRNA expression in vehicle control and 0.05 nM TCDD treated cells (*P < 0.0167 adjusted P value after Bonferroni correction). Figure 2. View largeDownload slide CYP3A4 expression is antagonized by KLF11 via epigenetic SIN3A/HDAC. (A) Ishikawa cells transfected with EV, KLF11, or a wt KLF11 SIN3A/HDAC nonbinding mutant (KLF11EAPP) were treated with either DMSO vehicle control (veh) or TCDD (0.05, 1, and 10 nM), and evaluated using a CYP3A4-promotor-luciferase reporter assay. KLF11 significantly repressed CYP3A4-luciferase expression compared with EV in control DMSO-treated cells and in cells treated with 0.05 nM of TCDD. In contrast, KLF11 did not repress CYP3A4-luciferase expression in cells treated with higher doses of TCDD (1 and 10 nM). Derepression of CYP3A4-luciferase expression was evident in cells transfected with KLF11EAPP irrespective of DMSO or TCDD treatment; the difference however was significant only in cells treated with vehicle control only (*P < 0.0167 adjusted P value after Bonferroni correction). (B) KLF11 repressed CYP3A4 mRNA expression in vehicle-treated cells as well as at low doses of TCDD (0.05 nM) but not higher doses (1 and 10 nM) (*P < 0.0167 adjusted P value after Bonferroni correction). KLF11EAPP derepressed wt-KLF11–mediated CYP3A4 mRNA expression in vehicle control and 0.05 nM TCDD treated cells (*P < 0.0167 adjusted P value after Bonferroni correction). HATI reversed TCDD-induced activation of CYP3A4 activity We performed ChIP using an antiacetyl histone 3K9 on the CYP3A4 promoter KLF11-binding element in Ishikawa cells treated with DMSO (control), TCDD alone, or TCDD with a HATI (Fig. 3A). In contrast to cells treated with either vehicle or TCDD (0.05 or 10 nM) alone, those treated with the combination (0.05 or 10 nM + 15 µM HATI) displayed lower acetyl-histone-H3 levels in the vicinity of the CYP3A4 promoter KLF11-binding element, indicative of relative deacetylation (Fig. 3A). CYP3A4 mRNA levels were also increased in cells treated with increasing doses of TCDD compared with DMSO-treated controls (Fig. 3B). TCDD thus induced CYP3A4 mRNA levels in a dose-dependent manner. HATI treatment overcame this effect of TCDD across the entire tested TCDD dose range. HATI-mediated repression was greatest at higher TCDD doses (Fig. 3B). HATI-mediated gene repression was further seen in correspondingly decreased enzyme levels in cells treated with either vehicle or increasing doses of TCDD and HATI (Fig. 3C and 3D). To determine if HATI-mediated decreased enzyme expression also affected function, Ishikawa cells were treated with either DMSO (control) or TCDD (0.05, 1, or 10 nM) alone or with HATI (15 µM). Forty-eight hours posttreatment, a CYP3A4-specific substrate was added to assess isoform-specific metabolic activity by measurement of proportional metabolic product/luciferase activity. As shown previously with KLF11, HATI treatment repressed TCDD induced activation of CYP3A4 enzymatic activity at low doses (0.05 and 1 nM) doses of the toxin (Fig. 3E). Figure 3. View largeDownload slide HATI reversed TCDD-mediated increased CYP3A4 expression. (A) Promoter acetylation/deacetylation at the CYP3A4 promoter KLF11-binding site was evaluated by ChIP using antiacetyl histone 3K9 in Ishikawa cells treated with either DMSO (vehicle control), TCDD alone, or TCDD and HATI. Compared with DMSO, the CYP3A4 promoter was relatively hyperacetylated in TCDD (0.05 and 10 nM)-treated cells. In contrast, the CYP3A4 promoter was relatively deacetylated at the KLF11-binding site in cells additionally treated with 15 μM HATI. (B) CYP3A4 mRNA levels were diminished in cells treated with 0.05, 1, or 10 nM TCDD and 15 μM HATI compared with those treated with corresponding doses of TCDD alone. CYP3A4 mRNA levels were normalized to a panel of housekeeping genes: B2M, GAPDH, and HPRT1 (*P < 0.05 compared with TCDD alone). (C and D) Ishikawa cells cotreated with HATI and 0.05 and 1 nM TCDD also demonstrated diminished CYP3A4 enzyme expression compared with cells cotreated with HATI and DMSO. This association was statistically significant only at the lowest dose of TCDD (0.05 nM). In contract, HATI could not suppress CYP3A4 enzyme expression in cells exposed to the highest concentration of TCDD (10 nM). β-tubulin was used as loading control. (C) Representative blots; (D) quantification (*P < 0.0167 compared with control). (E) HATI treatment repressed TCDD-induced activation of CYP3A4 enzymatic activity in Ishikawa cells treated at low doses of TCDD (0.05 and 1 nM) (*P < 0.05, compared with TCDD alone). Figure 3. View largeDownload slide HATI reversed TCDD-mediated increased CYP3A4 expression. (A) Promoter acetylation/deacetylation at the CYP3A4 promoter KLF11-binding site was evaluated by ChIP using antiacetyl histone 3K9 in Ishikawa cells treated with either DMSO (vehicle control), TCDD alone, or TCDD and HATI. Compared with DMSO, the CYP3A4 promoter was relatively hyperacetylated in TCDD (0.05 and 10 nM)-treated cells. In contrast, the CYP3A4 promoter was relatively deacetylated at the KLF11-binding site in cells additionally treated with 15 μM HATI. (B) CYP3A4 mRNA levels were diminished in cells treated with 0.05, 1, or 10 nM TCDD and 15 μM HATI compared with those treated with corresponding doses of TCDD alone. CYP3A4 mRNA levels were normalized to a panel of housekeeping genes: B2M, GAPDH, and HPRT1 (*P < 0.05 compared with TCDD alone). (C and D) Ishikawa cells cotreated with HATI and 0.05 and 1 nM TCDD also demonstrated diminished CYP3A4 enzyme expression compared with cells cotreated with HATI and DMSO. This association was statistically significant only at the lowest dose of TCDD (0.05 nM). In contract, HATI could not suppress CYP3A4 enzyme expression in cells exposed to the highest concentration of TCDD (10 nM). β-tubulin was used as loading control. (C) Representative blots; (D) quantification (*P < 0.0167 compared with control). (E) HATI treatment repressed TCDD-induced activation of CYP3A4 enzymatic activity in Ishikawa cells treated at low doses of TCDD (0.05 and 1 nM) (*P < 0.05, compared with TCDD alone). TCDD exposure is associated with increased lesion size and disease progression in vivo To determine the role of TCDD in disease progression, we treated a well-characterized wt animal endometriosis model with either vehicle (oil + DMSO) or TCDD. Because HATI treatment arrested TCDD-induced CYP3A4 induction in vitro (Fig. 3), to determine the effect of such therapy on disease progression in vivo, we treated additional TCDD-exposed animals with vehicle (DMSO) or HATI. Compared with vehicle-treated control (oil + DMSO), TCDD treatment (oil + TCDD) resulted in increased fibrotic disease progression that was objectively quantified by increased fibrosis scores (Fig. 4A and 4B: representative fibrotic disease progression phenotypes; Fig. 4I: fibrotic score; *P < 0.008), as well as lesion size (Fig. 4E and 4F: representative lesions; Fig. 4J: lesion size; *P < 0.008). To determine the effect of HATI treatment on disease progression, TCDD-exposed animals were additionally treated with either HATI or corresponding vehicle (DMSO). Animals treated with TCDD and DMSO demonstrated further phenotypic progression (Fig. 4C, 4G, 4I, and 4J, *P < 0.008). In contrast, HATI treatment resulted in significant diminution of both fibrosis and lesion size compared with animals treated with either TCDD alone or TCDD and DMSO (Fig. 4D, 4H, 4I, and 4J; *P < 0.008). Figure 4. View largeDownload slide TCDD and HATI treatment in a murine endometriosis model. (A–D) Disease progression in wt animals treated with vehicle (oil + DMSO), TCDD (3 μg/kg), TCDD and DMSO, or TCDD and HATI (0.2 μg/kg). Representative images for each treatment condition are shown. (A) Endometriotic lesion (black arrow) without surrounding fibrosis from control vehicle (oil + DMSO)–treated mice. (B) Fibrotic adhesions connecting the endometriotic lesion to the bowel (white arrow) from mice treated with TCDD (oil + TCDD). (C) Extensive fibrotic adhesions connecting the endometriotic lesion and the peritoneum to the bowel (white arrow) from mice treated with TCDD + DMSO (vehicle for HATI). (D) Endometriotic lesion and lack of fibrosis (black arrow) in mice treated with TCDD and HATI. (E–H) Endometriotic lesion (circled) in mice treated with oil + DMSO, oil + TCDD, TCDD + DMSO, and TCDD + HATI, respectively; adhesions dissected completely or partially for clarity. Mice treated with TCDD (oil + TCDD) and TCDD + DMSO had larger lesions compared with mice treated with vehicle (oil + DMSO). In contrast, mice treated with TCDD + HATI had lesion sizes comparable to mice treated with vehicle (oil + DMSO). (I) Fibrosis score using a murine adhesion scoring system (41). The fibrosis score was higher in mice treated with TCDD [mean ± standard deviation (SD), 26.42 ± 9.5) compared with the vehicle (mean ±SD, 12.46 ± 0.9). An additive effect was seen in mice treated with TCDD + DMSO, as they had the highest overall fibrosis score (mean ± SD, 51 ± 38.1). Mice treated with TCDD + HATI had a significantly lower fibrosis score (mean ± SD, 15.5 ± 4.2) (*P < 0.008 adjusted P value after Bonferroni correction). (J) Lesion sizes increased in mice treated with TCDD alone (mean ± SD, 40.36 ± 3.2) and TCDD + DMSO (mean ± SD, 41.6 ± 7.8) as compared with vehicle control (oil + DMSO) (mean ± SD, 14.38 ± 3.1) and TCDD + HATI (mean ± SD, 6.85 ± 3.9). There was a significant decrease in lesion size (mean and SD) in mice treated with TCDD and HATI compared with mice treated with TCDD + DMSO and TCDD alone (*P < 0.008 adjusted P value after Bonferroni correction). Figure 4. View largeDownload slide TCDD and HATI treatment in a murine endometriosis model. (A–D) Disease progression in wt animals treated with vehicle (oil + DMSO), TCDD (3 μg/kg), TCDD and DMSO, or TCDD and HATI (0.2 μg/kg). Representative images for each treatment condition are shown. (A) Endometriotic lesion (black arrow) without surrounding fibrosis from control vehicle (oil + DMSO)–treated mice. (B) Fibrotic adhesions connecting the endometriotic lesion to the bowel (white arrow) from mice treated with TCDD (oil + TCDD). (C) Extensive fibrotic adhesions connecting the endometriotic lesion and the peritoneum to the bowel (white arrow) from mice treated with TCDD + DMSO (vehicle for HATI). (D) Endometriotic lesion and lack of fibrosis (black arrow) in mice treated with TCDD and HATI. (E–H) Endometriotic lesion (circled) in mice treated with oil + DMSO, oil + TCDD, TCDD + DMSO, and TCDD + HATI, respectively; adhesions dissected completely or partially for clarity. Mice treated with TCDD (oil + TCDD) and TCDD + DMSO had larger lesions compared with mice treated with vehicle (oil + DMSO). In contrast, mice treated with TCDD + HATI had lesion sizes comparable to mice treated with vehicle (oil + DMSO). (I) Fibrosis score using a murine adhesion scoring system (41). The fibrosis score was higher in mice treated with TCDD [mean ± standard deviation (SD), 26.42 ± 9.5) compared with the vehicle (mean ±SD, 12.46 ± 0.9). An additive effect was seen in mice treated with TCDD + DMSO, as they had the highest overall fibrosis score (mean ± SD, 51 ± 38.1). Mice treated with TCDD + HATI had a significantly lower fibrosis score (mean ± SD, 15.5 ± 4.2) (*P < 0.008 adjusted P value after Bonferroni correction). (J) Lesion sizes increased in mice treated with TCDD alone (mean ± SD, 40.36 ± 3.2) and TCDD + DMSO (mean ± SD, 41.6 ± 7.8) as compared with vehicle control (oil + DMSO) (mean ± SD, 14.38 ± 3.1) and TCDD + HATI (mean ± SD, 6.85 ± 3.9). There was a significant decrease in lesion size (mean and SD) in mice treated with TCDD and HATI compared with mice treated with TCDD + DMSO and TCDD alone (*P < 0.008 adjusted P value after Bonferroni correction). Endometriotic progression is associated with differential Cyp3a levels in lesions To determine if differential Cyp3a expression was associated with TCDD and HATI therapy, we evaluated mRNA expression levels from the lesions in TCDD- and HATI-treated animals (Fig. 5A). Compared with oil- and DMSO-treated controls, animals treated with oil and TCDD had elevated Cyp3a mRNA expression levels in the lesions (Fig. 5A). The levels were further increased in animals treated with TCDD and DMSO. In contrast, in HATI-treated animals, Cyp3a levels in the lesions were significantly diminished compared with those in TCDD- and TCDD + DMSO–treated animals (Fig. 5A). Disease progression and lesion size thus directly corresponded to Cyp3a mRNA expression levels in the lesions. We also determined expression of scar tissue Collagen1a1 (Col1a1) levels in the lesions, which we have previously shown to have translational relevance in endometriotic progression associated with loss of Klf11/epigenetic regulation (48). Col1a1 levels were increased in lesions from TCDD- and TCDD + DMSO–treated animals compared with oil- and DMSO-treated controls (Fig. 5B). In contrast, HATI therapy abrogated TCDD-associated increased Col1a1 expression (Fig. 5B) and fibrotic progression (Fig. 4). We further determined the expression of Cyp3a enzyme and Col1 in lesions from these animals (Fig. 5C–5J). Whereas CYP3A4/Cyp3a is expressed in endometrial epithelial cells in eutopic and ectopic endometrium (38), Col1 is deposited in extracellular stromal and subepithelial locations (48). Accordingly, we observed differential expression of Cyp3a in lesions from control, TCDD-, and TCDD + HATI–treated animals. Cyp3a was expressed in epithelial cells, as previously seen in human disease lesions; expression was minimal in controls (Fig. 5C), increased in TCDD-treated animals (Fig. 5D), and was maximal in animals treated with TCDD and DMSO (Fig. 5E). HATI treatment was associated with diminished expression of Cyp3a expression (Fig. 5F); overall, therefore, epithelial enzyme expression corresponded with mRNA expression levels (Fig. 5C–5F). Col1 expression also mirrored Cyp3a expression with maximal expression in TCDD- and DMSO-treated animals, and diminished expression with HATI therapy (Fig. 5G–5J). Col1 expression also corresponded phenotypically with fibrotic extent (Fig. 4A–4D). Figure 5. View largeDownload slide HATI therapy abrogated TCDD-induced Cyp3a and Col1 expression in murine endometrial implants. (A) Cyp3a mRNA expression levels were determined by qPCR in endometrial implants from wt mice exposed to vehicle control (oil + DMSO), TCDD (3 μg/kg), TCDD + DMSO, or TCDD + HATI (0.2 μg/kg). Cyp3a mRNA levels were normalized to a panel of housekeeping genes: B2M, GAPDH, and HPRT1. Cyp3a expression in endometrial implants increased twofold in mice exposed to TCDD and fivefold in mice treated with TCDD + DMSO compared with control. Endometrial implants from mice treated with TCDD + HATI had significantly decreased (0.6-fold) Cyp3a mRNA levels (*P < 0.008 adjusted P value after Bonferroni correction). (B) Col1a1 mRNA expression was increased in endometrial implants from mice treated with TCDD (fourfold) or TCDD + DMSO (sixfold). In contrast, Col1a1 expression was not increased in mice treated with TCDD and HATI. (C–F) Cyp3a enzyme expression in murine endometrial implants treated with oil +DMSO (control), TCDD, TCDD + DMSO, and TCDD + HATI is shown at magnification 200× (brown stain). (C) No enzyme expression was detected in tissue obtained from vehicle-treated control animals. (D and E) Epithelial Cyp3a expression was increased in lesions (D, black arrow) from mice treated with TCDD and (E, white and black arrows) even more so in mice treated with TCDD + DMSO. (F) Epithelial Cyp3a enzyme expression was diminished in lesions obtained from mice treated with TCDD + HATI (black arrow). (G–J) Endometriotic lesions in treated wt mice were also assessed for Col1 expression using Masson Trichome staining (blue stain), magnification 200×. (G) Vehicle-treated controls showed minimal Col1 protein expression. (H and I) Increased lesional Col1 staining was observed in mice treated with TCDD (H) and even more so for those treated with TCDD + DMSO (I). (J) Col1 expression was diminished in lesions of mice treated with TCDD + HATI. Figure 5. View largeDownload slide HATI therapy abrogated TCDD-induced Cyp3a and Col1 expression in murine endometrial implants. (A) Cyp3a mRNA expression levels were determined by qPCR in endometrial implants from wt mice exposed to vehicle control (oil + DMSO), TCDD (3 μg/kg), TCDD + DMSO, or TCDD + HATI (0.2 μg/kg). Cyp3a mRNA levels were normalized to a panel of housekeeping genes: B2M, GAPDH, and HPRT1. Cyp3a expression in endometrial implants increased twofold in mice exposed to TCDD and fivefold in mice treated with TCDD + DMSO compared with control. Endometrial implants from mice treated with TCDD + HATI had significantly decreased (0.6-fold) Cyp3a mRNA levels (*P < 0.008 adjusted P value after Bonferroni correction). (B) Col1a1 mRNA expression was increased in endometrial implants from mice treated with TCDD (fourfold) or TCDD + DMSO (sixfold). In contrast, Col1a1 expression was not increased in mice treated with TCDD and HATI. (C–F) Cyp3a enzyme expression in murine endometrial implants treated with oil +DMSO (control), TCDD, TCDD + DMSO, and TCDD + HATI is shown at magnification 200× (brown stain). (C) No enzyme expression was detected in tissue obtained from vehicle-treated control animals. (D and E) Epithelial Cyp3a expression was increased in lesions (D, black arrow) from mice treated with TCDD and (E, white and black arrows) even more so in mice treated with TCDD + DMSO. (F) Epithelial Cyp3a enzyme expression was diminished in lesions obtained from mice treated with TCDD + HATI (black arrow). (G–J) Endometriotic lesions in treated wt mice were also assessed for Col1 expression using Masson Trichome staining (blue stain), magnification 200×. (G) Vehicle-treated controls showed minimal Col1 protein expression. (H and I) Increased lesional Col1 staining was observed in mice treated with TCDD (H) and even more so for those treated with TCDD + DMSO (I). (J) Col1 expression was diminished in lesions of mice treated with TCDD + HATI. Discussion Humans are exposed to a diversity of toxins and toxicants, both chemical and biological, as a consequence of large-scale agricultural and industrial production. Such exposures are increasingly being recognized and implicated in the de novo appearance and/or increased incidence of environmentally implicated human diseases (52). Specifically, the common industrial effluent TCDD is associated with a spectrum of human diseases, including endometriosis, in several studies from diverse populations (6–9, 14–21). Although the association is recognized, it has yet to gain wide acceptance, and the mechanism of pathogenicity is unclear. The proposed intracellular mechanism of action of TCDD is via aryl hydrocarbon signaling (53). In this pathway, TCDD binds the cytosolic aryl hydrocarbon receptor (AhR), which translocates to the nucleus and binds the aryl hydrocarbon nuclear translocator (ARNT) (54). The AhR/ARNT dimer then binds to xenobiotic response elements located in the target gene promoters. Xenobiotic response elements are commonly encountered in the regulatory regions of genes that encode cytochrome p450 enzymes with resultant metabolic dysregulation in a diversity of tissues and organs, which therefore results in wide spectrum of disease (34). In this paper, we propose an alternate cell-intrinsic mechanism mediated by the Sp/KLF transcription factor KLF11 and its epigenetic binding partners SIN3A/HDAC that mitigate TCDD action. Together, KLF11/SIN3A/HDAC antagonize TCDD-mediated up-regulation of metabolic CYP enzymes (38). We show here in vitro that TCDD and KLF11 oppositely regulated the abundantly expressed endometrial metabolic enzyme CYP3A4. Moreover, KLF11-mediated CYP3A4 repression overcame TCDD-mediated activation in a dose-responsive manner; repression was robust at low but not high doses of toxin exposure (Fig. 2). KLF11 recruits and binds several specific epigenetic nuclear cofactors via well-defined domains. These include SIN3A/HDAC and histone methyl transferase (heterochromatin protein 1/histone methyl transferase) corepressors, as well as the CBP/p300/pCAF-histone acetyl transferase coactivators (40, 49, 55). Each epigenetic cofactor is an enzyme that catalyzes specific posttranslational reactions on distinct histone tail amino acid residues through addition or removal of reactive chemical groups (56, 57). Flux of reactive chemical groups induces alterations in local chromatin configuration, resulting in corresponding gene activation or silencing. As with mutations, epigenetic mechanisms can also profoundly affect gene expression; however, in contrast to the former, the latter is the outcome of chemical reactions that can be potentially reversed by targeted therapy. In these studies, we observed that treatment of cells with KLF11EAPP abrogated wt-KLF11–mediated CYP3A4 promoter repression (Fig. 2). KLF11EAPP is a well-characterized mutant of wt-KLF11 that does not bind SIN3A/HDAC; as a result, the CYP3A4 promoter in the vicinity of the KLF11 binding site was not deacetylated, resulting in unrepressed gene expression (38, 39). Histone tail amino acid residues are reversibly acetylated and deacetylated by histone acetyl transferases and HDACs, respectively (58). We used HATI to pharmacologically mimic histone deacetylation. HATI prevents histone acetylation; lack of de novo acetylation with unmitigated endogenous HDAC activity enables net deacetylation over time (48). We treated Ishikawa cells with different doses of TCDD and observed histone hyperacetylation in the vicinity of the CYP3A4 promoter KLF11 binding site. This site was deacetylated when the cells were additionally treated with HATI (Fig. 3A). Moreover, promoter site deacetylation resulted in corresponding repression of CYP3A4 RNA and protein expression (Fig. 3B–3D). In contrast to active histone deacetylation mediated by HDAC, this pharmacological approach using HATI to actively repress the opposite chemical reaction is passive. However, it is currently the most feasible therapeutic option. Moreover, Garcinol, the HATI used in these experiments, has been successfully used in diverse human cell lines, which indicates translational potential and viability of harnessing this agent for future therapeutic endeavors (59–61). To determine potential therapeutic efficacy of HATI in TCDD-induced disease, we investigated disease progression in a well-characterized TCDD-induced mouse model of endometriosis (Fig. 4). After surgical implantation of endometriosis lesions, the animals were treated with TCDD or TCDD and HATI. Compared with vehicle (DMSO)-exposed controls, animals exposed to TCDD demonstrated disease progression (Fig. 4). Women with progressive scarring that obliterates intra-abdominal and pelvic anatomy resulting in a “frozen pelvis” have a higher score and more advanced stage of endometriosis, according to the revised American Society for Reproductive Medicine scoring system for women with endometriosis (62). Disease progression in our animal models thus was a phenocopy of human disease with advanced lesion sizes and quantified fibrotic scarring (Fig. 4). Scarring was worsened by the additive effect of TCDD with DMSO; the exact mechanism is not known and remains a focus of further investigation. In contrast, when TCDD-treated animals were additionally administered the HATI, there was substantial amelioration in both lesion size and fibrotic progression (Fig. 4). Our findings therefore suggest that HATI therapy is effective at phenotypically arresting disease progression despite its purported passive mechanism of deacetylation. These findings are congruent with our in vitro findings in Ishikawa cells and are also associated with specific phenotypic changes in the animal model (Fig. 4). Although aryl hydrocarbon/xenobiotic signaling is the commonly implicated mechanism for TCDD-induced pathogenicity, we show here that parallel mechanisms may also be operative in exposed tissues. We used a well-characterized human endometrial cell line and an animal endometriosis model to comprehensively evaluate TCDD-induced pathogenicity and disease in vitro and in vivo. Similar mechanisms may be operative in other organs, tissues, and their cognate diseases as well, however (63, 64). TCDD commonly induces metabolic CYP450 enzymes; dysregulation of endometrial metabolism is likely an early event in establishment of endometriosis because cells displaced into an ectopic environment as the peritoneal cavity have to adapt to survive. Epithelial-stromal interactions are critical in endometrial physiology; they maintain precise, temporally coordinated differentiation, which results in coordinated peak epithelial secretion and stromal decidualization, necessary for the achievement of endometrial receptivity (65). Discordant interaction as a result of altered epithelial physiology and metabolism likely promotes aberrant stromal responses such as fibrosis in ectopic endometrial tissues. The animal model loss of Klf11 or TCDD exposure was associated with similar phenotypic progression of endometriosis (41). Disease progression in Klf11−/− mice was associated with increased Cyp3a expression in the lesions, from epigenetic dysregulation arising out of a failure to recruit and bind Sin3a/Hdac; further, disease progression was arrested by HATI therapy (48). In human endometriosis lesions, selective loss of KLF11 is also associated with increased CYP3A4 expression, which results in augmented proliferation (38). KLF11 represses multiple CYP enzymes; loss of KLF11/Klf11 is thus associated with increased CYP expression and endometriotic progression. In contrast to KLF11, TCDD is a known inducer of CYP450 enzymes, which we show here as being relevant in disease progression. We also show here that disease induction via TCDD exposure was mitigated by epigenetic therapy. It is likely that at high doses, TCDD operates predominantly via the AhR/ARNT pathway, which may not be responsive to epigenetic targeting. We found that HATI treatment repressed CYP3A4 mRNA but not protein suppression at higher doses of TCDD. This may be due to particular in vitro experimental conditions, modification of other acetylated histones besides H3K9, or via activation of other pathways that affect posttranscriptional signaling. In contrast, however, there was robust phenotypic repression in vivo. Our findings suggest that, at low exposure doses, it may be possible to reverse pathogenicity by recruiting alternative inhibitory pathways. This is important because environmental exposure is usually low dose, resulting in chronic disease. Many environmentally induced diseases result in scarring and fibrosis, as in our model, which impairs organ function (5, 66). We have previously shown that epigenetic therapy has the potential to ameliorate progressive fibrosis; the potential for therapeutic applicability is thus ample (48). KLF11 and TCDD are specifically associated with fibrotic progression and scarring. Scarring is a ubiquitous pathological mechanism in diseases affecting multiple organ systems, such as collagen vascular diseases. We have recently shown that KLF11-associated scarring and fibrosis can be replicated in a nonendometriosis animal model (67), which suggests that the findings generated here may have greater implications for diseases associated with fibrosis other than endometriosis. Elucidation of these mechanisms continues to be a focus of future investigations by our laboratory. Additionally, we plan to further mechanistically evaluate the relationship of TCDD and KLF11/epigenetic mechanisms and to collaboratively evaluate the role and translational relevance of this pathway in diseases of other dioxin-associated systemic disease. This is a report of successfully arresting chronic, toxin exposure–related progressive fibrosis in a relevant disease model using pharmacological agents that are being actively developed for use in human studies in a widening spectrum of disease. Appendix. Antibody Table Peptide/Protein Target  Antigen Sequence (if Known)  Name of Antibody  Manufacturer, Catalog No.  Species Raised in; Monoclonal or Polyclonal  Dilution Used  RRID  Anti-acetyl histone 3, lysine 9  ARTKQTAR(Ac)KSTG-C  Antiacetyl histone3K9 antibody  Abcam, 4441  Rabbit; polyclonal  1:250  AB_2118292  IgG  NA  Rabbit IgG, polyclonal - isotype control (ChIP grade)  Abcam, 171870  Rabbit; polyclonal  1:250  AB_2687657  Anti-CYP3A4  NA  Anti-cytochrome P450 3A4 antibody  Abcam, 3572  Rabbit; polyclonal  1:500 and 1:100  AB_303918  Anti-beta-tubulin III  NA  Anti-ß-tubulin-III antibody  Sigma, T2200  Rabbit; polyclonal  1:500  AB_262133  Anti-KLF11  NA  Anti-TIEG2 antibody  Abnova, H00008462-M01  Mouse; monoclonal  1:500  AB_894164  Peptide/Protein Target  Antigen Sequence (if Known)  Name of Antibody  Manufacturer, Catalog No.  Species Raised in; Monoclonal or Polyclonal  Dilution Used  RRID  Anti-acetyl histone 3, lysine 9  ARTKQTAR(Ac)KSTG-C  Antiacetyl histone3K9 antibody  Abcam, 4441  Rabbit; polyclonal  1:250  AB_2118292  IgG  NA  Rabbit IgG, polyclonal - isotype control (ChIP grade)  Abcam, 171870  Rabbit; polyclonal  1:250  AB_2687657  Anti-CYP3A4  NA  Anti-cytochrome P450 3A4 antibody  Abcam, 3572  Rabbit; polyclonal  1:500 and 1:100  AB_303918  Anti-beta-tubulin III  NA  Anti-ß-tubulin-III antibody  Sigma, T2200  Rabbit; polyclonal  1:500  AB_262133  Anti-KLF11  NA  Anti-TIEG2 antibody  Abnova, H00008462-M01  Mouse; monoclonal  1:500  AB_894164  Abbreviations: NA, not available; RRID, Research Resource Identifier. View Large Abbreviations: AhR aryl hydrocarbon receptor ARNT aryl hydrocarbon nuclear translocator ChIP chromatin immunoprecipitation CYP cytochrome DMSO dimethyl sulfoxide EV empty vector KLF Krüppel-like factor HATI histone acetyltransferase inhibitor HDAC histone deacetylase Ig immunoglobulin mRNA messenger RNA PCR polymerase chain reaction qPCR quantitative real-time polymerase chain reaction RT reverse transcription TCDD 2,3,7,8 tetrachlorodibenzo-p-dioxin wt wild-type. Acknowledgments Financial Support: This research was funded by Mayo Foundation’s Kathleen and Roger Penske Career Development Award (to G.S.D.). Disclosure Summary: The authors have nothing to disclose. References 1. Baccarelli A, Bollati V. Epigenetics and environmental chemicals. Curr Opin Pediatr . 2009; 21( 2): 243– 251. Google Scholar CrossRef Search ADS PubMed  2. Jirtle RL, Skinner MK. Environmental epigenomics and disease susceptibility. Nat Rev Genet . 2007; 8( 4): 253– 262. Google Scholar CrossRef Search ADS PubMed  3. Pera B, Tang T, Marullo R, Yang SN, Ahn H, Patel J, Elstrom R, Ruan J, Furman R, Leonard J, Cerchietti L, Martin P. Combinatorial epigenetic therapy in diffuse large B cell lymphoma pre-clinical models and patients. Clin Epigenetics . 2016; 8( 1): 79. Google Scholar CrossRef Search ADS PubMed  4. Yeo W, Chung HC, Chan SL, Wang LZ, Lim R, Picus J, Boyer M, Mo FK, Koh J, Rha SY, Hui EP, Jeung HC, Roh JK, Yu SC, To KF, Tao Q, Ma BB, Chan AW, Tong JH, Erlichman C, Chan AT, Goh BC. Epigenetic therapy using belinostat for patients with unresectable hepatocellular carcinoma: a multicenter phase I/II study with biomarker and pharmacokinetic analysis of tumors from patients in the Mayo Phase II Consortium and the Cancer Therapeutics Research Group. J Clin Oncol . 2012; 30( 27): 3361– 3367. Google Scholar CrossRef Search ADS PubMed  5. Han M, Liu X, Liu S, Su G, Fan X, Chen J, Yuan Q, Xu G. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) induces hepatic stellate cell (HSC) activation and liver fibrosis in C57BL6 mouse via activating Akt and NF-κB signaling pathways. Toxicol Lett . 2017; 273: 10– 19. Google Scholar CrossRef Search ADS PubMed  6. DeVito MJ, Birnbaum LS, Farland WH, Gasiewicz TA. Comparisons of estimated human body burdens of dioxinlike chemicals and TCDD body burdens in experimentally exposed animals. Environ Health Perspect . 1995; 103( 9): 820– 831. Google Scholar CrossRef Search ADS PubMed  7. Aoki Y. Polychlorinated biphenyls, polychlorinated dibenzo-p-dioxins, and polychlorinated dibenzofurans as endocrine disrupters--what we have learned from Yusho disease. Environ Res . 2001; 86( 1): 2– 11. Google Scholar CrossRef Search ADS PubMed  8. Patterson AT, Kaffenberger BH, Keller RA, Elston DM. Skin diseases associated with Agent Orange and other organochlorine exposures. J Am Acad Dermatol . 2016; 74( 1): 143– 170. Google Scholar CrossRef Search ADS PubMed  9. Huang CY, Wu CL, Wu JS, Chang JW, Cheng YY, Kuo YC, Yang YC, Lee CC, Guo HR. Association between blood dioxin level and chronic kidney disease in an endemic area of exposure. PLoS One . 2016; 11( 3): e0150248. Google Scholar CrossRef Search ADS PubMed  10. Fukushi J, Tokunaga S, Nakashima Y, Motomura G, Mitoma C, Uchi H, Furue M, Iwamoto Y. Effects of dioxin-related compounds on bone mineral density in patients affected by the Yusho incident. Chemosphere . 2016; 145: 25– 33. Google Scholar CrossRef Search ADS PubMed  11. Schlezinger JJ, Liu D, Farago M, Seldin DC, Belguise K, Sonenshein GE, Sherr DH. A role for the aryl hydrocarbon receptor in mammary gland tumorigenesis. Biol Chem . 2006; 387( 9): 1175– 1187. Google Scholar CrossRef Search ADS PubMed  12. Koliopanos A, Kleeff J, Xiao Y, Safe S, Zimmermann A, Büchler MW, Friess H. Increased arylhydrocarbon receptor expression offers a potential therapeutic target for pancreatic cancer. Oncogene . 2002; 21( 39): 6059– 6070. Google Scholar CrossRef Search ADS PubMed  13. Smarr MM, Kannan K, Buck Louis GM. Endocrine disrupting chemicals and endometriosis. Fertil Steril . 2016; 106( 4): 959– 966. Google Scholar CrossRef Search ADS PubMed  14. Reddy BS, Rozati R, Reddy S, Kodampur S, Reddy P, Reddy R. High plasma concentrations of polychlorinated biphenyls and phthalate esters in women with endometriosis: a prospective case control study. Fertil Steril . 2006; 85( 3): 775– 779. Google Scholar CrossRef Search ADS PubMed  15. Heilier JF, Nackers F, Verougstraete V, Tonglet R, Lison D, Donnez J. Increased dioxin-like compounds in the serum of women with peritoneal endometriosis and deep endometriotic (adenomyotic) nodules. Fertil Steril . 2005; 84( 2): 305– 312. Google Scholar CrossRef Search ADS PubMed  16. Hoffman CS, Small CM, Blanck HM, Tolbert P, Rubin C, Marcus M. Endometriosis among women exposed to polybrominated biphenyls. Ann Epidemiol . 2007; 17( 7): 503– 510. Google Scholar CrossRef Search ADS PubMed  17. Louis GM, Weiner JM, Whitcomb BW, Sperrazza R, Schisterman EF, Lobdell DT, Crickard K, Greizerstein H, Kostyniak PJ. Environmental PCB exposure and risk of endometriosis. Hum Reprod . 2005; 20( 1): 279– 285. Google Scholar CrossRef Search ADS PubMed  18. Martínez-Zamora MA, Mattioli L, Parera J, Abad E, Coloma JL, van Babel B, Galceran MT, Balasch J, Carmona F. Increased levels of dioxin-like substances in adipose tissue in patients with deep infiltrating endometriosis. Hum Reprod . 2015; 30( 5): 1059– 1068. Google Scholar CrossRef Search ADS PubMed  19. Porpora MG, Medda E, Abballe A, Bolli S, De Angelis I, di Domenico A, Ferro A, Ingelido AM, Maggi A, Panici PB, De Felip E. Endometriosis and organochlorinated environmental pollutants: a case-control study on Italian women of reproductive age. Environ Health Perspect . 2009; 117( 7): 1070– 1075. Google Scholar CrossRef Search ADS PubMed  20. Simsa P, Mihalyi A, Schoeters G, Koppen G, Kyama CM, Den Hond EM, Fülöp V, D’Hooghe TM. Increased exposure to dioxin-like compounds is associated with endometriosis in a case-control study in women. Reprod Biomed Online . 2010; 20( 5): 681– 688. Google Scholar CrossRef Search ADS PubMed  21. Cai LY, Izumi S, Suzuki T, Goya K, Nakamura E, Sugiyama T, Kobayashi H. Dioxins in ascites and serum of women with endometriosis: a pilot study. Hum Reprod . 2011; 26( 1): 117– 126. Google Scholar CrossRef Search ADS PubMed  22. Sofo V, Götte M, Laganà AS, Salmeri FM, Triolo O, Sturlese E, Retto G, Alfa M, Granese R, Abrão MS. Correlation between dioxin and endometriosis: an epigenetic route to unravel the pathogenesis of the disease. Arch Gynecol Obstet . 2015; 292( 5): 973– 986. Google Scholar CrossRef Search ADS PubMed  23. Giudice LC, Kao LC. Endometriosis. Lancet . 2004; 364( 9447): 1789– 1799. Google Scholar CrossRef Search ADS PubMed  24. Simoens S, Hummelshoj L, D’Hooghe T. Endometriosis: cost estimates and methodological perspective. Hum Reprod Update . 2007; 13( 4): 395– 404. Google Scholar CrossRef Search ADS PubMed  25. Rier SE, Martin DC, Bowman RE, Dmowski WP, Becker JL. Endometriosis in rhesus monkeys (Macaca mulatta) following chronic exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Fundam Appl Toxicol . 1993; 21( 4): 433– 441. Google Scholar CrossRef Search ADS PubMed  26. Rier SE, Turner WE, Martin DC, Morris R, Lucier GW, Clark GC. Serum levels of TCDD and dioxin-like chemicals in Rhesus monkeys chronically exposed to dioxin: correlation of increased serum PCB levels with endometriosis. Toxicol Sci . 2001; 59( 1): 147– 159. Google Scholar CrossRef Search ADS PubMed  27. Tsukino H, Hanaoka T, Sasaki H, Motoyama H, Hiroshima M, Tanaka T, Kabuto M, Niskar AS, Rubin C, Patterson DG, Jr, Turner W, Needham L, Tsugane S. Associations between serum levels of selected organochlorine compounds and endometriosis in infertile Japanese women. Environ Res . 2005; 99( 1): 118– 125. Google Scholar CrossRef Search ADS PubMed  28. Pauwels A, Schepens PJ, D’Hooghe T, Delbeke L, Dhont M, Brouwer A, Weyler J. The risk of endometriosis and exposure to dioxins and polychlorinated biphenyls: a case-control study of infertile women. Hum Reprod . 2001; 16( 10): 2050– 2055. Google Scholar CrossRef Search ADS PubMed  29. De Felip E, Porpora MG, di Domenico A, Ingelido AM, Cardelli M, Cosmi EV, Donnez J. Dioxin-like compounds and endometriosis: a study on Italian and Belgian women of reproductive age. Toxicol Lett . 2004; 150( 2): 203– 209. Google Scholar CrossRef Search ADS PubMed  30. Lebel G, Dodin S, Ayotte P, Marcoux S, Ferron LA, Dewailly E. Organochlorine exposure and the risk of endometriosis. Fertil Steril . 1998; 69( 2): 221– 228. Google Scholar CrossRef Search ADS PubMed  31. Niskar AS, Needham LL, Rubin C, Turner WE, Martin CA, Patterson DG, Jr, Hasty L, Wong LY, Marcus M. Serum dioxins, polychlorinated biphenyls, and endometriosis: a case-control study in Atlanta. Chemosphere . 2009; 74( 7): 944– 949. Google Scholar CrossRef Search ADS PubMed  32. Cummings AM, Metcalf JL. Induction of endometriosis in mice: a new model sensitive to estrogen. Reprod Toxicol . 1995; 9( 3): 233– 238. Google Scholar CrossRef Search ADS PubMed  33. Nayyar T, Bruner-Tran KL, Piestrzeniewicz-Ulanska D, Osteen KG. Developmental exposure of mice to TCDD elicits a similar uterine phenotype in adult animals as observed in women with endometriosis. Reprod Toxicol . 2007; 23( 3): 326– 336. Google Scholar CrossRef Search ADS PubMed  34. De Jongh J, DeVito M, Nieboer R, Birnbaum L, Van den Berg M. Induction of cytochrome P450 isoenzymes after toxicokinetic interactions between 2,3,7,8-tetrachlorodibenzo-p-dioxin and 2,2′,4,4′,5,5′-hexachlorobiphenyl in the liver of the mouse. Fundam Appl Toxicol . 1995; 25( 2): 264– 270. Google Scholar CrossRef Search ADS PubMed  35. DeVito MJ, Ma X, Babish JG, Menache M, Birnbaum LS. Dose-response relationships in mice following subchronic exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin: CYP1A1, CYP1A2, estrogen receptor, and protein tyrosine phosphorylation. Toxicol Appl Pharmacol . 1994; 124( 1): 82– 90. Google Scholar CrossRef Search ADS PubMed  36. Diliberto JJ, Akubue PI, Luebke RW, Birnbaum LS. Dose-response relationships of tissue distribution and induction of CYP1A1 and CYP1A2 enzymatic activities following acute exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in mice. Toxicol Appl Pharmacol . 1995; 130( 2): 197– 208. Google Scholar CrossRef Search ADS PubMed  37. Guengerich FP. Metabolism of 17 alpha-ethynylestradiol in humans. Life Sci . 1990; 47( 22): 1981– 1988. Google Scholar CrossRef Search ADS PubMed  38. Zheng Y, Tabbaa ZM, Khan Z, Schoolmeester JK, El-Nashar S, Famuyide A, Keeney GL, Daftary GS. Epigenetic regulation of uterine biology by transcription factor KLF11 via posttranslational histone deacetylation of cytochrome p450 metabolic enzymes. Endocrinology . 2014; 155( 11): 4507– 4520. Google Scholar CrossRef Search ADS PubMed  39. Correa LF, Zheng Y, Delaney AA, Khan Z, Shenoy CC, Daftary GS. TGF-β induces endometriotic progression via a noncanonical, KLF11-mediated mechanism. Endocrinology . 2016; 157( 9): 3332– 3343. Google Scholar CrossRef Search ADS PubMed  40. Bonnefond A, Lomberk G, Buttar N, Busiah K, Vaillant E, Lobbens S, Yengo L, Dechaume A, Mignot B, Simon A, Scharfmann R, Neve B, Tanyolaç S, Hodoglugil U, Pattou F, Cavé H, Iovanna J, Stein R, Polak M, Vaxillaire M, Froguel P, Urrutia R. Disruption of a novel Kruppel-like transcription factor p300-regulated pathway for insulin biosynthesis revealed by studies of the c.-331 INS mutation found in neonatal diabetes mellitus. J Biol Chem . 2011; 286( 32): 28414– 28424. Google Scholar CrossRef Search ADS PubMed  41. Daftary GS, Zheng Y, Tabbaa ZM, Schoolmeester JK, Gada RP, Grzenda AL, Mathison AJ, Keeney GL, Lomberk GA, Urrutia R. A novel role of the Sp/KLF transcription factor KLF11 in arresting progression of endometriosis. PLoS One . 2013; 8( 3): e60165. Google Scholar CrossRef Search ADS PubMed  42. Potapova A, Hasemeier B, Römermann D, Metzig K, Göhring G, Schlegelberger B, Länger F, Kreipe H, Lehmann U. Epigenetic inactivation of tumour suppressor gene KLF11 in myelodysplastic syndromes*. Eur J Haematol . 2010; 84( 4): 298– 303. Google Scholar CrossRef Search ADS PubMed  43. Yin P, Lin Z, Reierstad S, Wu J, Ishikawa H, Marsh EE, Innes J, Cheng Y, Pearson K, Coon JS V, Kim JJ, Chakravarti D, Bulun SE. Transcription factor KLF11 integrates progesterone receptor signaling and proliferation in uterine leiomyoma cells. Cancer Res . 2010; 70( 4): 1722– 1730. Google Scholar CrossRef Search ADS PubMed  44. Cook T, Gebelein B, Belal M, Mesa K, Urrutia R. Three conserved transcriptional repressor domains are a defining feature of the TIEG subfamily of Sp1-like zinc finger proteins. J Biol Chem . 1999; 274( 41): 29500– 29504. Google Scholar CrossRef Search ADS PubMed  45. Daftary GS, Lomberk GA, Buttar NS, Allen TW, Grzenda A, Zhang J, Zheng Y, Mathison AJ, Gada RP, Calvo E, Iovanna JL, Billadeau DD, Prendergast FG, Urrutia R. Detailed structural-functional analysis of the Krüppel-like factor 16 (KLF16) transcription factor reveals novel mechanisms for silencing Sp/KLF sites involved in metabolism and endocrinology. J Biol Chem . 2012; 287( 10): 7010– 7025. Google Scholar CrossRef Search ADS PubMed  46. Lomberk G, Urrutia R. The family feud: turning off Sp1 by Sp1-like KLF proteins. Biochem J . 2005; 392( Pt 1): 1– 11. Google Scholar CrossRef Search ADS PubMed  47. Delaney AA, Khan Z, Zheng Y, Correa LF, Zanfagnin V, Shenoy CC, Schoolmeester JK, Saadalla AM, El-Nashar S, Famuyide AO, Subramaniam M, Hawse JR, Khazaie K, Daftary GS. KLF10 mediated epigenetic dysregulation of epithelial CD40/CD154 promotes endometriosis. Biol Reprod . 2016; 95( 3): 62. Google Scholar CrossRef Search ADS PubMed  48. Zheng Y, Khan Z, Zanfagnin V, Correa LF, Delaney AA, Daftary GS. Epigenetic modulation of collagen 1A1: therapeutic implications in fibrosis and endometriosis. Biol Reprod . 2016; 94( 4): 87. Google Scholar CrossRef Search ADS PubMed  49. Buttar NS, DeMars CJ, Lomberk G, Rizvi S, Bonilla-Velez J, Achra S, Rashtak S, Wang KK, Fernandez-Zapico ME, Urrutia R. Distinct role of Kruppel-like factor 11 in the regulation of prostaglandin E2 biosynthesis. J Biol Chem . 2010; 285( 15): 11433– 11444. Google Scholar CrossRef Search ADS PubMed  50. Tabbaa ZM, Zheng Y, Daftary GS. KLF11 epigenetically regulates glycodelin-A, a marker of endometrial biology via histone-modifying chromatin mechanisms. Reprod Sci . 2014; 21( 3): 319– 328. Google Scholar CrossRef Search ADS PubMed  51. Zhang JS, Moncrieffe MC, Kaczynski J, Ellenrieder V, Prendergast FG, Urrutia R. A conserved alpha-helical motif mediates the interaction of Sp1-like transcriptional repressors with the corepressor mSin3A. Mol Cell Biol . 2001; 21( 15): 5041– 5049. Google Scholar CrossRef Search ADS PubMed  52. Kim M, Bae M, Na H, Yang M. Environmental toxicants--induced epigenetic alterations and their reversers [published correction appears in J Environ Sci Health C Environ Carcinog Ecotoxical Rev. 2013;31(3):285]. J Environ Sci Health C Environ Carcinog Ecotoxicol Rev . 2012; 30( 4): 323– 367. Google Scholar CrossRef Search ADS PubMed  53. Birnbaum LS. The mechanism of dioxin toxicity: relationship to risk assessment. Environ Health Perspect . 1994; 102( Suppl 9): 157– 167. Google Scholar CrossRef Search ADS PubMed  54. Denison MS, Nagy SR. Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annu Rev Pharmacol Toxicol . 2003; 43( 1): 309– 334. Google Scholar CrossRef Search ADS PubMed  55. Seo S, Lomberk G, Mathison A, Buttar N, Podratz J, Calvo E, Iovanna J, Brimijoin S, Windebank A, Urrutia R. Krüppel-like factor 11 differentially couples to histone acetyltransferase and histone methyltransferase chromatin remodeling pathways to transcriptionally regulate dopamine D2 receptor in neuronal cells. J Biol Chem . 2012; 287( 16): 12723– 12735. Google Scholar CrossRef Search ADS PubMed  56. Beisel C, Paro R. Silencing chromatin: comparing modes and mechanisms. Nat Rev Genet . 2011; 12( 2): 123– 135. Google Scholar CrossRef Search ADS PubMed  57. Berger SL. The complex language of chromatin regulation during transcription. Nature . 2007; 447( 7143): 407– 412. Google Scholar CrossRef Search ADS PubMed  58. Garcia-Ramirez M, Rocchini C, Ausio J. Modulation of chromatin folding by histone acetylation. J Biol Chem . 1995; 270( 30): 17923– 17928. Google Scholar CrossRef Search ADS PubMed  59. Nishino T, Wang C, Mochizuki-Kashio M, Osawa M, Nakauchi H, Iwama A. Ex vivo expansion of human hematopoietic stem cells by garcinol, a potent inhibitor of histone acetyltransferase. PLoS One . 2011; 6( 9): e24298. Google Scholar CrossRef Search ADS PubMed  60. Wang J, Wang L, Ho CT, Zhang K, Liu Q, Zhao H. Garcinol from Garcinia indica downregulates cancer stem-like cell biomarker ALDH1A1 in nonsmall cell lung cancer A549 cells through DDIT3 activation. J Agric Food Chem . 2017; 65( 18): 3675– 3683. Google Scholar CrossRef Search ADS PubMed  61. Tu SH, Chiou YS, Kalyanam N, Ho CT, Chen LC, Pan MH. Garcinol sensitizes breast cancer cells to Taxol through the suppression of caspase-3/iPLA2 and NF-κB/Twist1 signaling pathways in a mouse 4T1 breast tumor model. Food Funct . 2017; 8( 3): 1067– 1079. Google Scholar CrossRef Search ADS PubMed  62. Johnson NP, Hummelshoj L, Adamson GD, Keckstein J, Taylor HS, Abrao MS, Bush D, Kiesel L, Tamimi R, Sharpe-Timms KL, Rombauts L, Giudice LC; for the World Endometriosis Society Sao Paulo Consortium. World Endometriosis Society consensus on the classification of endometriosis. Hum Reprod . 2017; 32( 2): 315– 324. Google Scholar CrossRef Search ADS PubMed  63. Abbott BD, Perdew GH, Buckalew AR, Birnbaum LS. Interactive regulation of Ah and glucocorticoid receptors in the synergistic induction of cleft palate by 2,3,7,8-tetrachlorodibenzo-p-dioxin and hydrocortisone. Toxicol Appl Pharmacol . 1994; 128( 1): 138– 150. Google Scholar CrossRef Search ADS PubMed  64. Nohara K, Fujimaki H, Tsukumo S, Ushio H, Miyabara Y, Kijima M, Tohyama C, Yonemoto J. The effects of perinatal exposure to low doses of 2,3,7,8-tetrachlorodibenzo-p-dioxin on immune organs in rats. Toxicology . 2000; 154( 1-3): 123– 133. Google Scholar CrossRef Search ADS PubMed  65. Field SL, Cummings M, Orsi NM. Epithelial and stromal-specific immune pathway activation in the murine endometrium post-coitum. Reproduction . 2015; 150( 2): 127– 138. Google Scholar CrossRef Search ADS PubMed  66. Xue J, Zhao Q, Sharma V, Nguyen LP, Lee YN, Pham KL, Edderkaoui M, Pandol SJ, Park W, Habtezion A. Aryl hydrocarbon receptor ligands in cigarette smoke induce production of interleukin-22 to promote pancreatic fibrosis in models of chronic pancreatitis. Gastroenterology . 2016; 151( 6): 1206– 1217. Google Scholar CrossRef Search ADS PubMed  67. Shenoy CC, Khan Z, Zheng Y, Jones TL, Khazaie K, Daftary GS. Progressive fibrosis: a progesterone- and KLF11-mediated sexually dimorphic female response. Endocrinology . 2017; 158( 10): 3605– 3619. Google Scholar CrossRef Search ADS PubMed  Copyright © 2018 Endocrine Society

Journal

EndocrinologyOxford University Press

Published: Jan 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off