Epigallocatechin-3-gallate protected vanadium-induced eggshell depigmentation via P38MAPK-Nrf2/HO-1 signaling pathway in laying hens

Epigallocatechin-3-gallate protected vanadium-induced eggshell depigmentation via... ABSTRACT It has been demonstrated that tea polyphenol (TP) epigallocatechin-3-gallate (EGCG) can confer protection against vanadium (V) toxicity in laying hens; however, our understanding of the molecular mechanisms beyond this effect are still limited. In this study, 360 hens were randomly assigned to the 3 groups to study whether the potential mechanism P38MAPK-Nrf2/HO-1 signaling pathway is involved in the protective effect of EGCG on eggshell pigmentation in vanadium challenged laying hens. Treatments included a control group, a 10 mg/kg V (V10), and a V10 plus 130 mg/kg of EGCG group (V10+EGCG130). Both eggshell color and protoporphyrin IX were decreased in the V10 group compared with the control diet, while EGCG130 treatment partially improved shell color and protoporphyrin IX (P < 0.05). The V10 exposure induced higher cell apoptosis rate and oxidative stress in birds as evidenced by the histological apoptosis status, decreased uterine glutathione-S transferase (GST) and high abundance of malondialdehyde (MDA) compared with the control group, whereas EGCG130 markedly alleviated oxidative stress via reducing MDA generation (P < 0.05). Dietary vanadium reduced ferrochelatase, NF-E2-related factor 2 (Nrf2), and heme oxygenase (HO-1) mRNA expression, while EGCG up-regulated Nrf2 and HO-1 expression (P < 0.05). Protein levels of Nrf2, HO-1 and phospho-p38 (P-P38) MAPK were reduced in V10 group, while dietary supplementation with 130 mg/kg EGCG markedly increased Nrf2, HO-1 and P-P38 MAPK protein levels in the uterus compared with the V10 group (P < 0.01). In conclusion, EGCG improved eggshell color and antioxidant system in V10-challenged hens, which seems to be associated with P38MAPK-Nrf2/HO-1 signaling pathway. INTRODUCTION Eggshell color, associated with the microstructure of the eggshell, plays an important role in customer preference and is also an important index for the hens’ health status when abnormal depigmentation occurs (Jones et al., 2010; Samiullah et al., 2015). Various factors can affect the eggshell color, including hen age, strains, lack of nutrients (minerals, vitamins), diseases (virus, illness), drugs (antibiotics), and housing system (Samiullah et al., 2015). The main brown and pink eggshell pigment is protoporphyrin IX (C34H34N4O4), although trace of biliverdin (C33H34O6N4) and biliverdin-zinc chelate complex is also present (Miksik et al., 1996; Samiullah and Roberts, 2013). Protoporphyrin IX is a key precursor of heme and it can be synthesized and transformed into heme by ferrochelatase (EFCH) in blood and eggshell gland. Our previous study showed that vanadium, a transition metal, can induce a marked reduction in the eggshell color when included in the diet at 5 and 10 mg/kg (Yuan et al., 2016; Wang et al., 2016a). However, the precise mechanism behind this event is still not known. The pigmentation process takes place in the uterus of layer hen over about four hours before oviposition; protoporphyrin IX is secreted by the epithelial and shell gland of uterus and deposited in the eggshell (Zhao et al., 2006; Wang et al., 2007; Samiullah et al., 2015). Vanadium, exists in oxidative states ranging from −1 to +5 valence, has been reported to directly increase the production and accumulation of radical reactive oxygen species (ROS) directly or through decreasing the cell's ability to eliminate ROS thereby causing oxidative stress in cells (Cortizo et al., 2000; Cano-Gitiėrrez et al., 2010). Transcriptional factor Nrf2 plays a central role in the regulation of genes expression for detoxification and phase II antioxidant enzymes, including heme oxygenase-1 (HO-1), glutathione-S transferase (GST), NAD(P)H/quinone oxidoreductase 1(NQO-1) and glutamate-cysteine ligase (Niture et al., 2009). Under basal conditions, Nrf2 is bound to Keap1 in the cytoplasm due to an interaction between a single Nrf2 protein and a Keap1. Heavy metal and oxidative stress can lead to dissociation of Nrf2 from Keap1 thereby rescuing Nrf2 from proteasomal degradation and allowing for entry into the nucleus to bind with the antioxidant response element (ARE) (Sriram et al., 2009). It has been reported that HO-1 and its byproducts play important roles in the alleviation of oxidative stress (Ryter and Choi, 2006). In addition, HO-1 metabolizes heme into biliverdin, which may also be involved in the synthesis of shell pigment- protoporphyrin IX (Samiullah et al., 2015). Mitogen-activated protein kinases (MAPKs), including P38 MAPK, extracellular signal-regulated protein kinase (ERK), and c-Jun NH(2)-terminal kinase (JNK), are upstream effectors in antioxidant responses, and their activities are manifested in the activation of many transcription factors, including Nrf2 (Nguyen et al., 2003; Shen et al., 2004; Keum et al., 2006). Previous study reported that extracellular P38 MAPK and ERK2 regulate the expression of HO-1 through activation of Nrf2 translocation (Xu et al., 2006). So, we hypothesized that vanadium-caused the depigmentation of eggshell may be associated with MAPK-Nrf2-ARE-mediated oxidative stress and apoptosis in the epithelial cells of uterus, which further influence protoporphyrin IX production and the color of the eggshell. Epigallocatechin-3-gallate (EGCG), a polyphenol consisting more than 30% of the dry matter in the green tea leaf, is an effective scavenger of ROS in vitro and also exhibits an antioxidant activity through mediating transcriptional factors and enzyme activities indirectly (Frei and Higdon, 2003; Na and Surh, 2008; Sriram et al., 2009). Compelling evidence concluded that EGCG can improve cellular antioxidant capacity via up-regulating the Nrf2-mediated phase II detoxification enzymes production (Gupta et al., 2004; Na and Surh, 2008; Sriram et al., 2009). However, the molecular mechanisms underlying EGCG detoxification effect on vanadium-induced eggshell depigmentation in layers is still obscure. Therefore, this research aims to study whether EGCG protected eggshell pigmentation through P38MAPK-Nrf2/HO-1 signaling pathway in vanadium-induced toxicity in laying hens. MATERIAL AND METHODS Birds, Diets and Management This study was undertaken in strict accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals of the State Council of the People's Republic of China. The experimental protocol used in the study was approved by the Animal Care and Use Committee of Sichuan Agricultural University. A total of 360 Lohman laying hens (67-wk-old, obtained from Sundaily Farm, Mianyang, Sichuan, China) were randomly divided into 3 treatments with 6 replicates per treatment of 20 birds each replicate for a 35-day feeding trial. The dietary treatments were as follows: (1) control, fed a basal diet; (2) V10, control + 10 mg/kg V; and (3) V10 + EGCG130, V10 + 130 mg/kg EGCG. Vanadium (added in the form of ammonium metavanadate) and tea polyphenols epigallocatechin-3-gallate (EGCG) with 98% purity, were purchased from Sigma (St. Louis, MO, USA). The basal diet (Table 1) was formulated according to the manual of the Lohman layers recommendations to meet or exceed the requirement of NRC (NRC, 1994). All diets were provided in mash form. Birds were housed individually in stainless steel cages (38.1cm-width × 50 length × 40 height) and room environment was controlled with 22°C by a daily lighting schedule of 16 h light and 8 h dark. Hens were allowed free access to experimental diets and water. Average feed intake was recorded daily and then pooled weekly. Table 1. Composition and nutrient level of basal diet (as fed basis). Item  Amount (%)  Corn  64.80  Soybean oil  0.20  Soybean meal (46% CP)  24.0  Calcium carbonate  8.66  Calcium hydrophosphate  1.16  NaCl  0.35  Choline Chloride  0.16  Vitamin premix1  0.03  Mineral premix2  0.50  Calculated nutrient content     AME3, kcal/kg  2680  Analyzed nutrient levels, %     CP  15.73   Ca  3.65   Total P  11.95   Lysine  0.79   Met  0.36  Item  Amount (%)  Corn  64.80  Soybean oil  0.20  Soybean meal (46% CP)  24.0  Calcium carbonate  8.66  Calcium hydrophosphate  1.16  NaCl  0.35  Choline Chloride  0.16  Vitamin premix1  0.03  Mineral premix2  0.50  Calculated nutrient content     AME3, kcal/kg  2680  Analyzed nutrient levels, %     CP  15.73   Ca  3.65   Total P  11.95   Lysine  0.79   Met  0.36  1 Provided per kilogram of diet: vitamin A, 10,000 IU (retinyl acetate); vitamin D3, 2500 IU; vitamin E, 10 mg; vitamin K3, 2 mg (menadinone dimethpyrimidnol); vitamin B1, 1 mg; vitamin B2, 5 mg; vitamin B6, 1 mg; vitamin B12, 15 μg; folic acid, 1 mg; niacin, 24 mg; Ca-pantothenate acid, 2.2 mg and biotin, 100 μg. 2 Provided per kilogram of diet: 8 mg Mn (as MnO2); 60 mg Zn (as ZnSO4); 5 mg Cu (as CuSO4•5H2O); 40 mg Fe (as FeSO4•7H2O); 0.3 mg Co (as CoSO4•5H2O); 1.5 mg I (as KI), and 0.15 mg Se (as Na2SeO3•5H2O). 3 Calculated by NRC (1994). View Large Table 1. Composition and nutrient level of basal diet (as fed basis). Item  Amount (%)  Corn  64.80  Soybean oil  0.20  Soybean meal (46% CP)  24.0  Calcium carbonate  8.66  Calcium hydrophosphate  1.16  NaCl  0.35  Choline Chloride  0.16  Vitamin premix1  0.03  Mineral premix2  0.50  Calculated nutrient content     AME3, kcal/kg  2680  Analyzed nutrient levels, %     CP  15.73   Ca  3.65   Total P  11.95   Lysine  0.79   Met  0.36  Item  Amount (%)  Corn  64.80  Soybean oil  0.20  Soybean meal (46% CP)  24.0  Calcium carbonate  8.66  Calcium hydrophosphate  1.16  NaCl  0.35  Choline Chloride  0.16  Vitamin premix1  0.03  Mineral premix2  0.50  Calculated nutrient content     AME3, kcal/kg  2680  Analyzed nutrient levels, %     CP  15.73   Ca  3.65   Total P  11.95   Lysine  0.79   Met  0.36  1 Provided per kilogram of diet: vitamin A, 10,000 IU (retinyl acetate); vitamin D3, 2500 IU; vitamin E, 10 mg; vitamin K3, 2 mg (menadinone dimethpyrimidnol); vitamin B1, 1 mg; vitamin B2, 5 mg; vitamin B6, 1 mg; vitamin B12, 15 μg; folic acid, 1 mg; niacin, 24 mg; Ca-pantothenate acid, 2.2 mg and biotin, 100 μg. 2 Provided per kilogram of diet: 8 mg Mn (as MnO2); 60 mg Zn (as ZnSO4); 5 mg Cu (as CuSO4•5H2O); 40 mg Fe (as FeSO4•7H2O); 0.3 mg Co (as CoSO4•5H2O); 1.5 mg I (as KI), and 0.15 mg Se (as Na2SeO3•5H2O). 3 Calculated by NRC (1994). View Large Sample Collection On study d 35, Twenty-four eggs per treatment (4 eggs/replicate) were collected to measure eggshell color and pigmentation content. Then, 72 hens (4 birds/replicate, 24 birds/treatment) were randomly chosen and sacrificed by cervical dislocation. Uterus (middle site) segments were immediately removed for morphology, apoptosis assay, and storage under −80°C for further RT-PCR analysis. Measurement of Eggshell Color and Protoporphyrin IX Content The eggshell color [L*(lightness), a* (redness), and b* (yellowness)] values were measured on the equatorial region two times per egg by a color meter (Minolta CR410 chroma meter, Konica Minolta Sensing Inc., Osaka, Japan). Shell protoporphyrin IX content was measured according to the method described by Gorchein et al. (2009) and Igic et al. (2009) with some modification. The extraction solution was prepared as described previously (Zhao et al., 2006), which was a solution (3:3:2) with 3 N HCl: acetonitrile: water (HPLC grade, Beijing Chemical Reagents Company, Beijing, China). To measure the protoporphyrin IX content, eggshells without attached membranes were rinsed in MQ H2O (Millipore, MA) and ground to powder. The eggshell powder (0.25 g) was solubilized with 8 mL of extraction solution in the dark at room temperature for 2 d. Solubilized samples were centrifuged for 10 min at 17,800 × g at room temperature, and the supernatant (0.3 mL) was transferred into a microtiter plate for analysis with Microplate Reader (Tecan, Port Melbourne, Australia) at the wavelength of 412 nm. Calibration curves of standard protoporphyrin IX (Fisher Scientific, Waltham, MA) were constructed to calculate sample concentrations. Uterus Morphology Uterus segments were cut into pieces within 1–2 cm (in length) in 10% neutral buffered paraformaldehyde, processed and trimmed, embedded in paraffin, sectioned to a 5-μm thickness slice. The morphology were observed using a microscope under 100 × and 200 × magnification (BA400Digital, Mike Audi Industrial Group Co., Ltd., Xiamen, China). Apoptosis Assay of Uterus by TUNEL Method Uterus sites were quickly removed and placed into immediately into methyl aldehyde, then were histochemical stained using TUNEL technique by an in Situ apoptosis detection kit (Roche, Switzerland). Using BA200Digital (Mike Audi Industrial Group Co., Ltd.) to image acquisition. Apoptotic color is light yellow or brown yellow, and negative expression is blue with white background. Totally, 100 images have been taken to measure the cell apoptosis, and apoptosis rate is defined as the percentage of apoptotic cells in 100 cells counted. Antioxidant Enzyme Activity Assay A homogenizer (PowerGen 125, Fisher Scientific, USA) was used for uterus homogenate to determine antioxidant status [superoxide dismutase (SOD), glutathione S-transferase (GST), glutathione peroxidase (GSH-Px), total antioxidant capacity (T-AOC) and malondialdehyde (MDA)] using the reagent kits (SOD, A001-1; GST, A004; GSH-Px, A005; T-AOC, A015; MDA, A003-1, Nanjing Jiancheng Bioengineering Institute of China). Reverse-transcription Polymerase Chain Reaction (RT-PCR) Analysis Total RNA was isolated from uterus using TRIzol (Invitrogen, Carlsbad, CA, USA). Real-time quantitative PCR (RT-qPCR) was performed with SYBR Premix Ex TaqTM HS (TaKaRa Biotechnology, Dalian, China) on the Applied Biosystems 7500 Real-Time PCR System. The PCR amplifications were carried out in a final volume of 25 μL reaction mixture containing 1 μL of 10 × diluted template cDNA, 12.5 μL Taq Master Mix (Tiangen, Beijing, China), 0.5 μL (10 μmol/L) of each primer, 2.5 μL probe, 0.5 μL Rox, 3.5 μL MgCl2, followed by adding sterilized water to reach the final volume. The experiment was repeated for three biological replications. The cycling condition were as follows: 2 min at 95°C followed by 40 cycles of denaturation at 95°C, 15 s; 60°C, 1 min; 72°C, 1 min for Nrf2; 30 cycles of 94°C, 30 s; 55°C 1 min; 72°C, 1 min for HO-1; 30 cycles of 95°C, 30 s; 58°C 1 min; 72°C, 1 min for FECH; 40 cycles of 93°C, 30 s; 58°C 1 min; 72°C, 1 min for P38-MAPK; 40 cycles of 93°C, 30 s; 55°C 1 min; 72°C, 1 min for sMaf; 26 cycles of 95°C, 1 min; 60°C 2 min; 72°C, 2 min of housing keeping gene, β-actin, followed by a final extension at 75°C for 10 min. The primer pairs and the size of expected products are listed in Table 2. All PCR amplification products were analyzed on 1.2% agarose gel electrophoresis, stained with ethidium bromide. All the positive PCR products were cloned and sequenced. Relative quantities of mRNA were calculated using the 2−ΔΔCT method, with the quantity of the control diet scale to 1. One house-keeping gene (β–actin) was assessed for stability of expression using two separate cDNA from each treatment. Table 2. Gene-specific primers for real-time quantitative reverse transcription PCR. Genes  Primers (5΄ to 3΄)  Genes Number2  Product size, bp  FECH  Forward: ACACCACGAATTCAGGAGCA  NM_204,196.1  267    Reverse: AGCAGTTTCACCATGCCTTCT      Nrf2  Forward: TGTGTGTGATTCAACCCGACT  NM_205,117.1  143    Reverse: TTAATGGAAGCCGCACCACT      HO-1  Forward: TTGGCAAGAAGCATCCAGA  NM_205,344.1  129    Reverse: TCCATCTCAAGGGCATTCA      P38MAPK  Forward: TGTGTTCACCCCTGCCAAGT  AJ719744.1  149    Reverse: GCCCCCGAAGAATCTGGTAT      sMaf  Forward: AGTCCCCTGGCCATGGAATA  NM_0,010,44671  247    Reverse: AGCCCGTCATCCAGTAGTAGT      β-actin  Forward: TCAGGGTGTGATGGTTGGTATG  NM_205,518.1  120    Reverse: TGTTCAATGGGGTACTTCAGGG      Genes  Primers (5΄ to 3΄)  Genes Number2  Product size, bp  FECH  Forward: ACACCACGAATTCAGGAGCA  NM_204,196.1  267    Reverse: AGCAGTTTCACCATGCCTTCT      Nrf2  Forward: TGTGTGTGATTCAACCCGACT  NM_205,117.1  143    Reverse: TTAATGGAAGCCGCACCACT      HO-1  Forward: TTGGCAAGAAGCATCCAGA  NM_205,344.1  129    Reverse: TCCATCTCAAGGGCATTCA      P38MAPK  Forward: TGTGTTCACCCCTGCCAAGT  AJ719744.1  149    Reverse: GCCCCCGAAGAATCTGGTAT      sMaf  Forward: AGTCCCCTGGCCATGGAATA  NM_0,010,44671  247    Reverse: AGCCCGTCATCCAGTAGTAGT      β-actin  Forward: TCAGGGTGTGATGGTTGGTATG  NM_205,518.1  120    Reverse: TGTTCAATGGGGTACTTCAGGG      1 Abbreviation indicated that: FECH = ferrochelatase, Nrf2 = nuclear factor erythroid-2 related factor 2, HO-1 = heme oxygenase-1, P38 MAPK = p38 mitogen activated protein kinases. 2 GenBank accession number for sequence from which primers were designed. View Large Table 2. Gene-specific primers for real-time quantitative reverse transcription PCR. Genes  Primers (5΄ to 3΄)  Genes Number2  Product size, bp  FECH  Forward: ACACCACGAATTCAGGAGCA  NM_204,196.1  267    Reverse: AGCAGTTTCACCATGCCTTCT      Nrf2  Forward: TGTGTGTGATTCAACCCGACT  NM_205,117.1  143    Reverse: TTAATGGAAGCCGCACCACT      HO-1  Forward: TTGGCAAGAAGCATCCAGA  NM_205,344.1  129    Reverse: TCCATCTCAAGGGCATTCA      P38MAPK  Forward: TGTGTTCACCCCTGCCAAGT  AJ719744.1  149    Reverse: GCCCCCGAAGAATCTGGTAT      sMaf  Forward: AGTCCCCTGGCCATGGAATA  NM_0,010,44671  247    Reverse: AGCCCGTCATCCAGTAGTAGT      β-actin  Forward: TCAGGGTGTGATGGTTGGTATG  NM_205,518.1  120    Reverse: TGTTCAATGGGGTACTTCAGGG      Genes  Primers (5΄ to 3΄)  Genes Number2  Product size, bp  FECH  Forward: ACACCACGAATTCAGGAGCA  NM_204,196.1  267    Reverse: AGCAGTTTCACCATGCCTTCT      Nrf2  Forward: TGTGTGTGATTCAACCCGACT  NM_205,117.1  143    Reverse: TTAATGGAAGCCGCACCACT      HO-1  Forward: TTGGCAAGAAGCATCCAGA  NM_205,344.1  129    Reverse: TCCATCTCAAGGGCATTCA      P38MAPK  Forward: TGTGTTCACCCCTGCCAAGT  AJ719744.1  149    Reverse: GCCCCCGAAGAATCTGGTAT      sMaf  Forward: AGTCCCCTGGCCATGGAATA  NM_0,010,44671  247    Reverse: AGCCCGTCATCCAGTAGTAGT      β-actin  Forward: TCAGGGTGTGATGGTTGGTATG  NM_205,518.1  120    Reverse: TGTTCAATGGGGTACTTCAGGG      1 Abbreviation indicated that: FECH = ferrochelatase, Nrf2 = nuclear factor erythroid-2 related factor 2, HO-1 = heme oxygenase-1, P38 MAPK = p38 mitogen activated protein kinases. 2 GenBank accession number for sequence from which primers were designed. View Large Immunoblotting Analysis Proteins were extracted from uterine tissues and the protein concentration was determined by using the BCA protein assay kit (Pierce Biotechnology, Inc., Rockford, IL, USA). Fifty micrograms of total protein were separated by SDS-PAGE and then transferred to polyvinylidene fluoride membranes (0.45 μm) at 100 V for 1 h 20 min. were blocked for 1 h in Tris-buffered saline Tween20 (TBST) buffer containing 1% (v/v) ovalbumin, followed by incubation with anti-bovine haptoglobin polyclonal antibodies at 37°C for 1 h. Subsequently, membranes were incubated with horseradish peroxidase-conjugated secondary antibody at 37°C for 1 h. Finally, membranes were detected and visualized by diaminobenzidine solution. The separated proteins were blotted on to a PVDF membrane and probed with a rabbit polyclonal antibody against P38 MAPK (CST, 1:2000), phosphor-P38MAPK (CST, 1:2000), Nrf2 (Santa Cruz, 1:4000), HO-1(Abcam, 1:500) and sMaf (Santa Cruz, 1:1000). The goat anti-rabbit IgG-HRP (1:10,000, Santa Cruz Biotechnol, Inc.) were used as the secondary antibody. The blots were washed again three times with PBST, and immnunoreactive protein complex were detected by the ECL Prime western blotting detection reagent (GE-Healthcare) using a CCD-based imager (Image Quant LAS 4000) according to the manufacture. Statistical Analysis Data were analyzed by one-way ANOVA using GLM procedure of SAS 9.2 (SAS Institute). For all data, when the ANOVA was significant, Tukey's test were conducted. All data are expressed as means value with their standard errors of means (SEM). Significant differences were declared at P < 0.05. RESULTS Eggshell Color and Protoporphyrin IX Content The eggshell color lightness (L*) value was higher and the value of redness (a*) and yellowness (b*) level were lower (P < 0.05) in the V10 group compared to the control diet (Table 3). Supplementation with 130 mg/kg EGCG partially increased (P < 0.05) a* and b* value, but could not achieve values similar to the control. The protoporphyrin IX content in eggshell was also decreased (P < 0.05) in the V10 group compared with the control and V10 + EGCG130 groups. Table 3. Effect of tea polyphenols on eggshell color and protoporphyrin IX content of laying hens in vanadium containing diets (Mean values with their means of standard errors; n = 6 per treatment). Item1  Control  V10  V10+EGCG130  SEM  P-Value  L*  93.64b  96.15a  94.65a,b  0.19  <0.01  a*  6.50a  2.60c  4.85b  0.14  <0.01  b*  18.80a  14.75c  16.21b  0.21  <0.01  Protoporphyrin IX, μg/g eggshell  42.35a  13.02c  28.45b  1.78  <0.01  Item1  Control  V10  V10+EGCG130  SEM  P-Value  L*  93.64b  96.15a  94.65a,b  0.19  <0.01  a*  6.50a  2.60c  4.85b  0.14  <0.01  b*  18.80a  14.75c  16.21b  0.21  <0.01  Protoporphyrin IX, μg/g eggshell  42.35a  13.02c  28.45b  1.78  <0.01  1 V10 = 10 mg/kg V, EGCG130 = 130 mg/kg EGCG. L* = lightness, a* = redness, b* = yellowness. View Large Table 3. Effect of tea polyphenols on eggshell color and protoporphyrin IX content of laying hens in vanadium containing diets (Mean values with their means of standard errors; n = 6 per treatment). Item1  Control  V10  V10+EGCG130  SEM  P-Value  L*  93.64b  96.15a  94.65a,b  0.19  <0.01  a*  6.50a  2.60c  4.85b  0.14  <0.01  b*  18.80a  14.75c  16.21b  0.21  <0.01  Protoporphyrin IX, μg/g eggshell  42.35a  13.02c  28.45b  1.78  <0.01  Item1  Control  V10  V10+EGCG130  SEM  P-Value  L*  93.64b  96.15a  94.65a,b  0.19  <0.01  a*  6.50a  2.60c  4.85b  0.14  <0.01  b*  18.80a  14.75c  16.21b  0.21  <0.01  Protoporphyrin IX, μg/g eggshell  42.35a  13.02c  28.45b  1.78  <0.01  1 V10 = 10 mg/kg V, EGCG130 = 130 mg/kg EGCG. L* = lightness, a* = redness, b* = yellowness. View Large Antioxidant Enzyme Activities, Histopathological Changes and Apoptosis Rate of Uterus Uterine tissues of layers fed 10 mg/kg V showed a reduction in GST activity and increased MDA content compared with the control group, whereas supplementation of 130 mg/kg of EGCG only completely reversed this reduction (P < 0.05; Table 4). No significant changes were observed in the morphology of uterus among dietary treatments (Figure 1). Furthermore, apoptosis rate of uterine epithelial cells was higher (P < 0.01) in V10 than that in the control treatment, while adding 130 mg/kg of EGCG didn’t affect rate incretion (Figure 2). Figure 1. View largeDownload slide Histopathological changes in the uterus of laying hens. Group 1, 2 and 3 obtained from layers fed control, 10 mg/kg V and 10 mg/kg V plus 130 mg/kg EGCG diet (×200). No significant differences were observed in morphology of uterus among dietary treatments. Figure 1. View largeDownload slide Histopathological changes in the uterus of laying hens. Group 1, 2 and 3 obtained from layers fed control, 10 mg/kg V and 10 mg/kg V plus 130 mg/kg EGCG diet (×200). No significant differences were observed in morphology of uterus among dietary treatments. Figure 2. View largeDownload slide Cell apoptosis rate of uterus immunohistochemically stained with TUNEL. ** Means significant difference (P < 0.01). Each means represents 6 replicate cages, with 1 layers/replicate. Abbreviation represents: V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG. Apoptotic color is light yellow or brown yellow with arrow pointed out, and negative expression is blue with white background. Totally, 100 images have been taken to measure the cell apoptosis, and apoptosis rate is defined as the percentage of apoptotic cells in 100 cells counted. Figure 2. View largeDownload slide Cell apoptosis rate of uterus immunohistochemically stained with TUNEL. ** Means significant difference (P < 0.01). Each means represents 6 replicate cages, with 1 layers/replicate. Abbreviation represents: V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG. Apoptotic color is light yellow or brown yellow with arrow pointed out, and negative expression is blue with white background. Totally, 100 images have been taken to measure the cell apoptosis, and apoptosis rate is defined as the percentage of apoptotic cells in 100 cells counted. Table 4. Effect of tea polyphenols on uterus antioxidative status of laying hens in vanadium containing diets (Mean values with means of their standard errors; n = 6 per treatment). Item1  MDA  GSH-Px  GST  SOD  T-AOC    (nmol/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  Control  1.19b  405.58  323.11a  403.4  9.35  V10  3.50a  314.82  201.64b  270.95  9.84  V10+EGCG130  1.08b  279.54  320.53a  306.14  8.56  SEM  0.18  43.04  35.5  46.11  0.65  P-Value  <0.01  0.14  0.04  0.14  0.38  Item1  MDA  GSH-Px  GST  SOD  T-AOC    (nmol/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  Control  1.19b  405.58  323.11a  403.4  9.35  V10  3.50a  314.82  201.64b  270.95  9.84  V10+EGCG130  1.08b  279.54  320.53a  306.14  8.56  SEM  0.18  43.04  35.5  46.11  0.65  P-Value  <0.01  0.14  0.04  0.14  0.38  1 GST = GSH S-transferase, GSH-Px = glutathione peroxidase, MDA = malondialdehyde, SOD = superoxide dismutase, T-AOC = total antioxidant capacity, V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG. View Large Table 4. Effect of tea polyphenols on uterus antioxidative status of laying hens in vanadium containing diets (Mean values with means of their standard errors; n = 6 per treatment). Item1  MDA  GSH-Px  GST  SOD  T-AOC    (nmol/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  Control  1.19b  405.58  323.11a  403.4  9.35  V10  3.50a  314.82  201.64b  270.95  9.84  V10+EGCG130  1.08b  279.54  320.53a  306.14  8.56  SEM  0.18  43.04  35.5  46.11  0.65  P-Value  <0.01  0.14  0.04  0.14  0.38  Item1  MDA  GSH-Px  GST  SOD  T-AOC    (nmol/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  Control  1.19b  405.58  323.11a  403.4  9.35  V10  3.50a  314.82  201.64b  270.95  9.84  V10+EGCG130  1.08b  279.54  320.53a  306.14  8.56  SEM  0.18  43.04  35.5  46.11  0.65  P-Value  <0.01  0.14  0.04  0.14  0.38  1 GST = GSH S-transferase, GSH-Px = glutathione peroxidase, MDA = malondialdehyde, SOD = superoxide dismutase, T-AOC = total antioxidant capacity, V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG. View Large Protein and mRNA Expression Levels of Nrf2, FECH, HO-1, P38-MAPK and P-P38-MAPK Gene expressions of FECH, Nrf2, and HO-1 were down-regulated by V10 treatment, while dietary EGCG markedly up-regulated the Nrf2 and HO-1 gene expression compared to the V10 group (Figure 3). Dietary V supplementation markedly decreased Nrf2, HO-1 and P-P38 MAPK protein levels compared with the control group, while 130 mg/kg EGCG enhanced (P < 0.01) Nrf2, HO-1, and P-P38 MAPK expression and decreased (P < 0.01) sMaf protein level in uterus compared with the V10 group (Figure 4). Figure 3. View largeDownload slide Tea polyphenols can regulate antioxidant related (Nrf2, HO-1, sMaf, P38 MAPK and FECH) mRNA gene expression in uterus of laying hens fed vanadium containing diets. **Means significant difference (P < 0.01). Each means represents 6 replicate cages, with 1 layers/replicate. Abbreviation represents: V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG, Nrf2 = nuclear factor erythroid-2 related factor 2, HO-1 = heme oxygenase-1, FECH = ferrochelatase, P38 MAPK = p38 mitogen activated protein kinases. Figure 3. View largeDownload slide Tea polyphenols can regulate antioxidant related (Nrf2, HO-1, sMaf, P38 MAPK and FECH) mRNA gene expression in uterus of laying hens fed vanadium containing diets. **Means significant difference (P < 0.01). Each means represents 6 replicate cages, with 1 layers/replicate. Abbreviation represents: V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG, Nrf2 = nuclear factor erythroid-2 related factor 2, HO-1 = heme oxygenase-1, FECH = ferrochelatase, P38 MAPK = p38 mitogen activated protein kinases. Figure 4. View largeDownload slide Effect of tea polyphenols on antioxidant related protein levels in uterus of laying hens fed vanadium containing diets at 35d. ** and *Means significant difference with P < 0.01 and P < 0.05, respectively. Each means represents 6 replicate cages, with 1 layers/replicate. Abbreviation represents: V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG, Nrf2 = nuclear factor erythroid-2 related factor 2, P38 MAPK = P38 mitogen activated protein kinases, P-P38 MAPK = phosphate-p38 mitogen activated protein kinases, HO-1 = heme oxygenase-1. Figure 4. View largeDownload slide Effect of tea polyphenols on antioxidant related protein levels in uterus of laying hens fed vanadium containing diets at 35d. ** and *Means significant difference with P < 0.01 and P < 0.05, respectively. Each means represents 6 replicate cages, with 1 layers/replicate. Abbreviation represents: V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG, Nrf2 = nuclear factor erythroid-2 related factor 2, P38 MAPK = P38 mitogen activated protein kinases, P-P38 MAPK = phosphate-p38 mitogen activated protein kinases, HO-1 = heme oxygenase-1. DISCUSSION Eggshell pigmentation has been widely used as a potential indicator for stress and disease conditions in commercial laying hens (Jones et al., 2010; Samiullah et al., 2015). Vanadium has been reported to reduce the egg interior quality evidenced by lower albumen height (Toussant et al., 1995; Bressman et al., 2002; Wang et al., 2016a). In this study, layers exposed to a diet containing 10 mg/kg V led to lower shell color as indicated by higher L* and lower a* and b* values, EGCG treatment resulted in a higher shell color in the V-challenged birds, which is in agreement with previous observation where the decrease in V-induced shell color was reversed by antioxidant supplementation studies (Miles et al., 1997; Yuan et al., 2016; Wang et al., 2016a). Moreover, Odabaşi et al. (2006) found that 30, 50 and 100 mg V supplementation in brown-type laying hens’ diet decreased shell color (higher L* and lower a* and b* value), which was significantly alleviated by dietary supplementation with 100 mg/kg vitamin C (Odabaşi et al., 2006). As the main pigments in eggshell is protoporphyrin IX in pink and brown eggshell layer strains (Miksik et al., 1996; Samiullah and Roberts, 2013), we anticipated that the lighter shell color may be associated with the lower content of protoporphyrin IX in the V fed layers. Protoporphyrin IX, as a precursor of heme, can be synthesized by glycine and then translated into heme by catalyzing of FECH in eggshell. We observed that FECH expression was down-regulated by dietary V, while the addition of EGCG failed to reverse this effect. Thus, it could be argued that the protective effects of EGCG on eggshell color are not mediated by changes in protoporphyrin IX metabolism. V can cause an increase in the generation of ROS in various target cells, which further disrupts redox balance, reduces cell viability, eventually leading to apoptosis (Liu et al., 2011; Imura et al., 2013). The results of this study indicate that V increased apoptosis rate in uterine epithelial cells, which is accordance with the results from our previous study in magnum cells (Wang et al., 2017). Also, it has been reported that exposure to V caused apoptosis in MCF7 cells (Ray et al., 2006). Moreover, accumulating evidence indicated that V-induced ROS production can led to lipid peroxidation (Leonard et al., 2004; Cano-Gitiėrrez et al., 2010). GST, SOD, GSH-Px and HO-1 contribute to the primary enzymatic defense against ROS and each enzyme plays an integral role in redox balance modulation (Fang et al., 2002; Limón-Pacheco and Gonsebatt, 2009). In our study, we found that V increased uterine MDA content and decreased GST activity, which indicated that V induced oxidative stress in the uterus. Similarly, in our previous studies also showed that V exposure induced oxidative stress in layers and rats by decreasing the activity of antioxidant enzymes (i.e., GST, NQO-1, T-AOC, and SOD) and increasing MDA generation in the serum (Yuan et al., 2016; Wang et al., 2016b). It is interesting that the result for GSH-PX and SOD activity is not consistent, which may be because different tissues may respond to vanadium toxicity differently. Heme oxygenase (HO-1), a microsomal enzyme induced during oxidative stress, is responsible for the conversion of heme to biliverdin, carbon monoxide and iron in blood and shell gland (Maines, 1988; Siow et al., 1999). HO-1 also exerts a protective effect against oxidative stress and apoptosis in a variety of cell types (Ferris et al., 1999; Liu et al., 2004). EGCG upregulated expressions of GSH-Px, glutamate cysteine ligase, and HO-1, which might be further involved in elimination or inactivation of ROS (Na and Surh, 2008), therefore boosting the antioxidant network in the uterus. The protective effect of EGCG against V-induced oxidative stress in the hen's uterus appears to be attributable to its restoration of uterine GST and HO-1 level that are prone to be reduced by V challenge. EGCG has been widely demonstrated to protect the cells from chemical or radiation-induced damage (Na and Surh, 2008). However, the potential mechanism of EGCG in antioxidant system in V-treated layer still remains unclear. Nrf2 is a key transcriptional factor that activates the antioxidant-reactive element (ARE), and in turn regulates the expression of antioxidant phase II detoxifying enzymes (Niture et al., 2009). Under normal physiological condition, Nrf2 is bound to Keap1 in the cytoplasm, however when cellular redox balance is disrupt, Nrf2 is released from Keap1 and rapidly translocates to the nucleus to initiate transcription of antioxidant gene (Andreadi et al., 2006; Sriram et al., 2009). In Nrf2 gene knockdown rats, ROS generation and apoptotic cell death are significantly increased by cadmium exposure in kidney cells (Chen and Shaikh, 2009), suggesting that Nrf2 serves as a key regulatory mechanism during redox homeostasis. The results from the present study showed that mRNA and protein abundances of Nrf2, sMaf, and HO-1 were decreased in V-challenged birds, whereas EGCG treatment activated Nrf2 and HO-1 gene and protein expression level in the uterus. EGCG is known as one of the most potent Nrf2 activator amongst green tea polyphenol (Chen et al., 2000). Studies in Nrf2−/- mice also suggest that EGCG can regulate HO-1 expression via the Nrf2 pathway (Shen et al., 2004). Moreover, EGCG can improve cellular antioxidant capacity by up-regulating the production of Nrf2 mediated phase II detoxification enzymes (Gupta et al., 2004; Lee-Hilz et al., 2006; Wu et al., 2006; Na and Surh, 2008; Sriram et al., 2009; Sahin et al., 2010). Since HO-1 can metabolize heme to biliverdin, it may also be involved in the synthesizing of shell pigment- protoporphyrin IX (Samiullah et al., 2015). Therefore, we propose that EGCG maintained eggshell color by enhancing the production of detoxification enzymes and HO-1 expression to replenish precursors of protoporphyrin IX synthesis. The molecular mechanism underlying Nrf2 regulation by V and EGCG has not been elucidated. One of the most plausible mechanisms responsible for activation of Nrf2 seems to be phosphorylation of Nrf2 serine/threonine residues by protein kinases, which facilitates nuclear translocation of Nrf2 and subsequent ARE binding. Indeed, MAPKs such as P38 and ERK have been reported to regulate Nrf2 translocation and Nrf2 targeted genes (Nguyen et al., 2003; Shen et al., 2004; Keum et al., 2006; Eom and Choi, 2009; Limón-Pacheco and Gonsebatt, 2009). In this study, the P38-MAPK gene and protein abundances was not affected by V and EGCG treatments, but P38-MAPK phosphorylation was markedly decreased in the V10 group and activated by EGCG supplementation. Vanadium were reported to reduce phosphor-Nrf2 through MAPK pathway, suppresses its nuclear translocation, thereby reduces phase II detoxification enzymes, causes ROS hard to remove, thereby leads to the accumulation of ROS. However, previous studies reported that V2O5 and its induced H2O2 activated ERK-1/2, P38 MAPK and P-P38 MAPK in human lung fibroblast (Ingram et al., 2003; Wang et al., 2003). The differences may be because that MAPK pathway can mediate many signaling cascades, such as cytokine expression to induce inflammation and cell apoptosis for different cells in vivo and in vitro; therefore, the effect of its activation is depend on the down-stream responsers. Jaspers et al. (2000) reported that V induced oxidative stress in human bronchial epithelial cells by activating P38-MAPK dependent transactivation of NF-κB (Jaspers et al., 2000). Thus, we anticipated that P38-MAPK signaling pathway may be involved in V and EGCG-induced Nrf2 activation and subsequent expression of HO-1 in uterus of layers. Also, it has been reported that EGCG with a higher intrinsic potential to generate ROS and redox cycling are the more potent inducer of ARE-mediated gene expression (Lee-Hilz et al., 2006). The potential mechanism for EGCG on Nrf2 regulation might be associated with Keap1 thiols. Therefore, further study is necessary to test the EGCG induced ROS production and its effect on Nrf2-ARE signaling pathway in vivo. CONCLUSION In conclusion, dietary supplementation with 130 mg/kg EGCG partially reversed the lowered shell color and the disruption in redox balance by dietary V in laying hens; this response might be associated with P38MAPK-Nrf2/HO-1 signaling pathway (Figure 5). These results provided molecular-level insights into the EGCG-mediated V detoxification process in laying hens. Figure 5. View largeDownload slide Proposed mechanism of EGCG-induced activation of Nrf2 and subsequent expression of antioxidant enzymes (HO-1) in uterus and increased eggshell color under vanadium challenge. Vanadium increased the ROS and decreased the sMaf protein and Nrf2 activation. EGCG can activate P38-MAPK, which in turn phosphorylates Nrf2 and stimulating expression of its represented enzymes (including HO-1), to protect uterus against oxidative stress caused by vanadium. Figure 5. View largeDownload slide Proposed mechanism of EGCG-induced activation of Nrf2 and subsequent expression of antioxidant enzymes (HO-1) in uterus and increased eggshell color under vanadium challenge. Vanadium increased the ROS and decreased the sMaf protein and Nrf2 activation. EGCG can activate P38-MAPK, which in turn phosphorylates Nrf2 and stimulating expression of its represented enzymes (including HO-1), to protect uterus against oxidative stress caused by vanadium. ACKNOWLEDGMENTS This study was funded by National Natural Science Foundation of China (Grant No. 31402031), National Key technology Research and Development Program of the Ministry of Science and Technology of China (2014BAD13B04), and Sichuan Provincial Science and Technology Projects (Grant No. 13ZB0290, 2014NZ0043, 2014NZ0002, 2013NZ0054). REFERENCES Andreadi C. K., Howells L. M., Atherfold P. A., Manson M. M.. 2006. Involvement of Nrf2, p38, B-Raf, and nuclear factor-kappaB, but not phosphatidylinositol 3-kinase, in induction of hemeoxygenase-1 by dietary polyphenols. Mol. Pharmacol . 69: 1033– 1040. Google Scholar PubMed  Bressman R. B., Miles R. D., Comer C. W., Wilson H. R., Butcher G. D.. 2002. Effect of dietary supplementation of vanadium commercial Egg-Type laying Hens1. J. Appl. Poult. Res.  11: 46– 53. Google Scholar CrossRef Search ADS   Cano-Gitiėrrez G., Acevedo-Nava S., Santamaría A.. 2012. Hepatic megalocytosis due to vanadium inhalation: participation of oxidative stress. Toxicol. Ind. Health.  28: 353– 360. Google Scholar CrossRef Search ADS PubMed  Chen C., Yu R., Owuor E. D., Kong A. N.. 2000. Activation of antioxidant-response element (ARE), mitogen-activated protein kinases (MAPKs) and caspases by major green tea polyphenol components during cell survival and death. Arch. Pharm. Res . 23: 605– 612. Google Scholar CrossRef Search ADS PubMed  Jones D. R., Musgrove M. T., Anderson K. E., Thesmer H. S., 2010. Physical quality and composition of retail shell eggs. Poult. Sci.  89: 582– 587. Google Scholar CrossRef Search ADS PubMed  Chen J., Shaikh Z. A.. 2009. Activation of Nrf2 by cadmium and its role in protection against cadmium-induced apoptosis in rat kidney cells. Toxicol. Appl. Pharm . 241: 81– 89. Google Scholar CrossRef Search ADS   Cortizo A. M., Bruzzone L., Molinuevo S., Molinuevo S., Etcheverry S. B.. 2000. A possible role of oxidative stress in the vanadium-induced cytotoxicity in the MC3T3E1 osteoblast and UMR106 osteosarcoma cell lines. Toxicolo . 147: 89– 99. Google Scholar CrossRef Search ADS   Eom H. J., Choi J.. 2009. Oxidative stress of CeO2 nanoparticles via p38-Nrf-2 signaling pathway in human bronchial epithelial cell, Beas-2B. Toxicolo. Lett . 187: 77– 83. Google Scholar CrossRef Search ADS   Fang Y. Z., Yang S., Wu G.. 2002. Free radicals, antioxidants, and nutrition. Nutrition . 18: 872– 879. Google Scholar CrossRef Search ADS PubMed  Ferris C. D., Jaffrey S. R., Sawa A., Takahashi M., Brady S. D., Barrow R. K., Tysoe S. A., Wolosker D. E., Baranano D. E., Dore S., Poss K. D., Snyder S. H.. 1999. Haem oxygenase-1 prevents cell death by regulating cellular iron. Nat. Cell. Biol . 1: 152– 157. Google Scholar CrossRef Search ADS PubMed  Frei B., Higdon J. V.. 2003. Antioxidant activity of tea polyphenols in vivo: evidence from animal studies. J. Nutr.  133: 3275S– 3284S. Google Scholar CrossRef Search ADS PubMed  Gorchein A., Lim C. K., Cassey P.. 2009. Extraction and analysis of colourful eggshell pigments using HPLC and HPLC/electrospray ionization tandem mass spectrometry. Biomed. Chromatogr.  23: 602– 606. Google Scholar CrossRef Search ADS PubMed  Gupta S., Hastak K., Afaq F., Ahmad N., Mukhtar H.. 2004. Essential role of caspases in epigallocatechin-3-gallate-mediated inhibition of nuclear factor kappaB and induction of apoptosis. Oncogene.  23: 2507– 2522. Google Scholar CrossRef Search ADS PubMed  Igic B., Greenwood D. R., Palmer D. J., Cassey P.. 2010. Detecting pigments from colourful eggshells of extinct birds. Chemoecology.  20: 43– 48. Google Scholar CrossRef Search ADS   Imura H., Shimada A., Naota M., Morita T., Togawa M., Hasegawa T., Seko Y.. 2013. Vanadium Toxicity in Mice. Toxicol. Pathol.  41: 842– 856. Google Scholar CrossRef Search ADS PubMed  Ingram J. L., Rice A. B., Santos J., Van Houten J. C.. 2003. Vanadium-induced HB-EGF expression in human lung fibroblasts is oxidant dependent and requires MAP kinases. Am. J. Physiol-Lung C.  284: L774– L782. Google Scholar CrossRef Search ADS   Jaspers I., Samet J. M., Erzurum S., Reed W.. 2000. Vanadium-Induced kB-Dependent transcription depends upon Peroxide-Induced activation of the p38 Mitogen-Activated protein kinase. Am J. Resp. Cell Mol Biol . 23: 95– 102. Google Scholar CrossRef Search ADS   Keum Y. S., Yu S., Chang P. P., Yuan X., Kim J. H., Xu C., Han J., Agarwal A., Kong A. N.. 2006. Mechanism of action of sulforaphane: Inhibition of p38 Mitogen-Activated protein kinase isoforms contributing to the induction of antioxidant response element-mediated heme oxygenase-1 in human hepatoma HepG2 cells. Cancer Res . 66: 8804– 8813. Google Scholar CrossRef Search ADS PubMed  Lagerkvist B. J., Oskarsson A.. 2007. Vanadium. Pages 905– 923. in Nordberg G. F. (ed). Handbook on the toxicology of metals . Springer, Germany. Google Scholar CrossRef Search ADS   Lee-Hilz Y. Y., Boerboom A. M., Westphal A. H., Berkel W. J., Aarts J. M., Rietjens I. M.. 2006. Pro-Oxidant activity of flavonoids induces EpRE-Mediated gene expression. Chem. Res. Toxicol.  19: 1499– 1505. Google Scholar CrossRef Search ADS PubMed  Leonard S. S., Harris G. K., Shi X. L.. 2004. Metal-induced oxidative stress and signal transduction. Free Radic. Biol. Med.  37: 1921– 1942. Google Scholar CrossRef Search ADS PubMed  Limón-Pacheco J., Gonsebatt M. E.. 2009. The role of antioxidants and antioxidant-related enzymes in protective responses to environmentally induced oxidative stress. Mutation Research/Genetic Toxicology and Environmental Mutagenesis  674: 137– 147. Google Scholar CrossRef Search ADS   Liu X., Cui H. M., Peng X., Fang J., Cui W., Wu B.. 2011. The effect of dietary vanadium on cell cycle and apoptosis of liver in broilers. Biol Trace Elem Res  143: 1508– 1515. Google Scholar CrossRef Search ADS PubMed  Liu Z. M., Chen G. G., Ng E. K., Leung W. K., Sung J. J., Chung S. C.. 2004. Upregulation of heme oxygenase-1 and p21 confers resistance to apoptosis in human gastric cancer cells. Oncogene . 23: 503– 513. Google Scholar CrossRef Search ADS PubMed  Maines M. D. 1988. Heme oxygenase: function, multiplicity, regulatory mechanisms, and clinical applications. FASEB J.  2: 2557– 2568. Google Scholar CrossRef Search ADS PubMed  Miles R. D., O’Keefe S. F., Butcher G. D., Comer C. W., Williams D.. 1997. Influence of vitamin E, ascorbic acid and beta-carotene on laying hens fed diets containing 10 ppm supplemental vanadium. Poult. Sci . 76( Suppl. 1): 61. Miksik I., Holan V., Deyl Z.. 1996. Avian eggshell pigments and their variability. Comp. Biochem. Physiol. B Biochem. Mol. Biol.  113: 607– 612. Google Scholar CrossRef Search ADS   Na H. K., Surh Y. J.. 2008. Modulation of Nrf2-mediated antioxidant and detoxifying enzyme induction by the green tea polyphenol EGCG. Food Chem. Toxicol.  46: 1271– 1278. Google Scholar CrossRef Search ADS PubMed  Nguyen T., Sherratt P. J., Huang H. C., Yang C. S., Pickett C. B.. 2003. Increased protein stability as a mechanism that enhances Nrf2-mediated transcriptional activation of the antioxidant response element. J. Biol. Chem.  278: 4536– 4541. Google Scholar CrossRef Search ADS PubMed  Niture S. K., Jain A. K., Jaiswal A. K.. 2009. Antioxidant-induced modification of INrf2 cysteine 151 and PKC-delta-mediated phosphorylation of Nrf2 serine 40 are both required for stabilization and nuclear translocation of Nrf2 and increased drug resistance. J Cell Sci . 122: 4452– 4464. Google Scholar CrossRef Search ADS PubMed  NRC. 1994. Nutrient Requirements of Poultry . 9th, Rev. Ed. National Academy Press, Washington, DC. Odabaşi A. Z., Miles R. D., Balaban M. O., Portier K. M., Sampath V.. 2006. Vitamin C overcomes the detrimental effect of vanadium on brown eggshell pigmentation. J. Appl. Poult. Res.  15: 425– 432. Google Scholar CrossRef Search ADS   Ray R. S., Rana B., Swami B., Venu V.. 2006. Vanadium mediated apoptosis and cell cycle arrest in MCF7 cell line. Chem. Biol. Interact.  163: 239– 247. Google Scholar CrossRef Search ADS PubMed  Ryter S. W., Choi A. M.. 2006. Therapeutic applications of carbon monoxide in lung disease. Curr. Opin. Biotech. 6: 257– 262. Sahin K., Tuzcu M., Gencoglu H., Dogukan A., Timurkan M., Sahin N., Aslan A., Kucuk O.. 2010. Epigallocatechin-3-gallate activates Nrf2/HO-1 signaling pathway in cisplatin-induced nephrotoxicity in rats. Life Sci.  87: 240– 245. Google Scholar CrossRef Search ADS PubMed  Samiullah S., Roberts J. R.. 2013. The location of Protoporphyrin in the eggshell of brown-shelled eggs. Poult. Sci.  92: 2783– 2788. Google Scholar CrossRef Search ADS PubMed  Samiullah S., Roberts J. R., Chousalkar K.. 2015. Eggshell color in brown-egg laying hens - a review. Poult. Sci.  94: 2566– 2575. Google Scholar CrossRef Search ADS PubMed  Shen G., Hebbar V., Nair S., Xu C., Li W., Lin W., Keum Y. S., Han J., Gallo M. A., Kong A. N.. 2004. Regulation of Nrf2 transactivation domain activity. J. Biol. Chem.  279: 23052– 23060. Google Scholar CrossRef Search ADS PubMed  Siow R. C., Sato H., Mann G. E.. 1999. Heme oxygenase–carbon monoxide signalling pathway in atherosclerosis: anti-atherogenic actions of bilirubin and carbon monoxide? Cardiovasc. Res.  41: 385– 394. Google Scholar CrossRef Search ADS PubMed  Sriram N., Kalayarasan S., Sudhandiran G.. 2009. Epigallocatechin-3-gallate augments antioxidant activities and inhibits inflammation during bleomycin-induced experimental pulmonary fibrosis through Nrf2–Keap1 signaling. Pulm. Pharmacol. Ther . 22: 221– 236. Google Scholar CrossRef Search ADS PubMed  Toussant M. J., Swayne D. E., Latshaw J. D.. 1995. Morphologic characteristics of oviducts from hens producing eggs of different Haugh units caused by genetics and by feeding vanadium as determined with computer software-integrated digitizing technology. Poult. Sci.  74: 1671– 1676. Google Scholar CrossRef Search ADS PubMed  Wang J. P., Bai X., Ding X. M., Bai S. P., Zeng Q. F., Mao X. B., Zhang K. Y.. 2017. Quantitative proteomic analysis reveals the role of tea polyphenol EGCG in egg whites in response to vanadium stress. Nutri.  39–40: 20– 29. Google Scholar CrossRef Search ADS   Wang J. P., Cui R. Y., Zhang K. Y., Ding X. M., Luo Y. H., Bai S. P., Zeng Q. F., Xuan Y., Su Z. W.. 2016. High-Fat diet increased renal and hepatic oxidative stress induced by vanadium of wistar rat. Boil. Trace. Elem. Res.  170: 415– 423. Google Scholar CrossRef Search ADS   Wang J. P., Cui R. Y., Zhang K. Y., Ding X. M., Luo Y. H., Bai S. P., Zeng Q. F., Xuan Y., Su Z. W.. 2016. Effect of dietary vanadium and vitamin C on egg quality and antioxidant status in laying hens. J. Anim. Phyaiol. An. N.  100: 440– 447. Google Scholar CrossRef Search ADS   Wang X. T., Deng X. M., Zhao C. J., Li G. Y., Xu G. Y., Lian L. S., Wu C. X.. 2007. Study of the deposition process of eggshell pigments using an improved dissolution method. Poult. Sci.  86: 2236– 2238. Google Scholar CrossRef Search ADS PubMed  Wang Y. Z., Ingram J. L., Walters D. W., Rice A. B., Santos J. H., Houten B. V., Bonner J. C.. 2003. Vanadium-induced STAT-1 activation in lung myofibroblasts requires H2O2 and P38 MAP kinase. Free Radic. Biol. Med.  35: 845– 855. Google Scholar CrossRef Search ADS PubMed  Wu C. C., Hsu M. C., Hsieh C. W., Lin J. B., Lai P. H., Wung B. S.. 2006. Upregulation of heme oxygenase-1 by Epigallocatechin-3-gallate via the phosphatidylinositol 3-kinase/Akt and ERK pathways. Life Sci.  78: 2889– 2897. Google Scholar CrossRef Search ADS PubMed  Xu C., Huang M. T., Shen G., Yuan X., Lin W., Khor T. O., Conney A. H., Kong A. N.. 2006. Inhibition of 7,12-dimethylbenz[a]anthracene-induced skin tumorigenesis in C57BL/6 mice by sulforaphane is mediated by nuclear factor E2-related factor 2. Cancer Res . 66: 8293– 8296. Google Scholar CrossRef Search ADS PubMed  Yuan Z. H., Zhang K. Y., Ding X. M., Luo Y. H., Bai S. P., Zeng Q. F., Wang J. P.. 2016. Effect of tea polyphenols on production performance, egg quality, and hepatic antioxidant status of laying hens in vanadium-containing diets. Poult. Sci.  95: 1709– 1717. Google Scholar CrossRef Search ADS PubMed  Zhao R., Xu G. Y., Liu Z. Z., Li J. Y., Yang N.. 2006. A study on eggshell pigmentation: biliverdin in blue-shelled chickens. Poult. Sci.  85: 546– 549. Google Scholar CrossRef Search ADS PubMed  © Crown copyright 2018. This article contains public sector information licensed under the Open Government Licence v3.0 (http://www.nationalarchives.gov.uk/doc/open-government-licence/version/3/). http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Epigallocatechin-3-gallate protected vanadium-induced eggshell depigmentation via P38MAPK-Nrf2/HO-1 signaling pathway in laying hens

Loading next page...
 
/lp/ou_press/epigallocatechin-3-gallate-protected-vanadium-induced-eggshell-0P0vH6zjIA
Publisher
Oxford University Press
Copyright
© Crown copyright 2018.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pey165
Publisher site
See Article on Publisher Site

Abstract

ABSTRACT It has been demonstrated that tea polyphenol (TP) epigallocatechin-3-gallate (EGCG) can confer protection against vanadium (V) toxicity in laying hens; however, our understanding of the molecular mechanisms beyond this effect are still limited. In this study, 360 hens were randomly assigned to the 3 groups to study whether the potential mechanism P38MAPK-Nrf2/HO-1 signaling pathway is involved in the protective effect of EGCG on eggshell pigmentation in vanadium challenged laying hens. Treatments included a control group, a 10 mg/kg V (V10), and a V10 plus 130 mg/kg of EGCG group (V10+EGCG130). Both eggshell color and protoporphyrin IX were decreased in the V10 group compared with the control diet, while EGCG130 treatment partially improved shell color and protoporphyrin IX (P < 0.05). The V10 exposure induced higher cell apoptosis rate and oxidative stress in birds as evidenced by the histological apoptosis status, decreased uterine glutathione-S transferase (GST) and high abundance of malondialdehyde (MDA) compared with the control group, whereas EGCG130 markedly alleviated oxidative stress via reducing MDA generation (P < 0.05). Dietary vanadium reduced ferrochelatase, NF-E2-related factor 2 (Nrf2), and heme oxygenase (HO-1) mRNA expression, while EGCG up-regulated Nrf2 and HO-1 expression (P < 0.05). Protein levels of Nrf2, HO-1 and phospho-p38 (P-P38) MAPK were reduced in V10 group, while dietary supplementation with 130 mg/kg EGCG markedly increased Nrf2, HO-1 and P-P38 MAPK protein levels in the uterus compared with the V10 group (P < 0.01). In conclusion, EGCG improved eggshell color and antioxidant system in V10-challenged hens, which seems to be associated with P38MAPK-Nrf2/HO-1 signaling pathway. INTRODUCTION Eggshell color, associated with the microstructure of the eggshell, plays an important role in customer preference and is also an important index for the hens’ health status when abnormal depigmentation occurs (Jones et al., 2010; Samiullah et al., 2015). Various factors can affect the eggshell color, including hen age, strains, lack of nutrients (minerals, vitamins), diseases (virus, illness), drugs (antibiotics), and housing system (Samiullah et al., 2015). The main brown and pink eggshell pigment is protoporphyrin IX (C34H34N4O4), although trace of biliverdin (C33H34O6N4) and biliverdin-zinc chelate complex is also present (Miksik et al., 1996; Samiullah and Roberts, 2013). Protoporphyrin IX is a key precursor of heme and it can be synthesized and transformed into heme by ferrochelatase (EFCH) in blood and eggshell gland. Our previous study showed that vanadium, a transition metal, can induce a marked reduction in the eggshell color when included in the diet at 5 and 10 mg/kg (Yuan et al., 2016; Wang et al., 2016a). However, the precise mechanism behind this event is still not known. The pigmentation process takes place in the uterus of layer hen over about four hours before oviposition; protoporphyrin IX is secreted by the epithelial and shell gland of uterus and deposited in the eggshell (Zhao et al., 2006; Wang et al., 2007; Samiullah et al., 2015). Vanadium, exists in oxidative states ranging from −1 to +5 valence, has been reported to directly increase the production and accumulation of radical reactive oxygen species (ROS) directly or through decreasing the cell's ability to eliminate ROS thereby causing oxidative stress in cells (Cortizo et al., 2000; Cano-Gitiėrrez et al., 2010). Transcriptional factor Nrf2 plays a central role in the regulation of genes expression for detoxification and phase II antioxidant enzymes, including heme oxygenase-1 (HO-1), glutathione-S transferase (GST), NAD(P)H/quinone oxidoreductase 1(NQO-1) and glutamate-cysteine ligase (Niture et al., 2009). Under basal conditions, Nrf2 is bound to Keap1 in the cytoplasm due to an interaction between a single Nrf2 protein and a Keap1. Heavy metal and oxidative stress can lead to dissociation of Nrf2 from Keap1 thereby rescuing Nrf2 from proteasomal degradation and allowing for entry into the nucleus to bind with the antioxidant response element (ARE) (Sriram et al., 2009). It has been reported that HO-1 and its byproducts play important roles in the alleviation of oxidative stress (Ryter and Choi, 2006). In addition, HO-1 metabolizes heme into biliverdin, which may also be involved in the synthesis of shell pigment- protoporphyrin IX (Samiullah et al., 2015). Mitogen-activated protein kinases (MAPKs), including P38 MAPK, extracellular signal-regulated protein kinase (ERK), and c-Jun NH(2)-terminal kinase (JNK), are upstream effectors in antioxidant responses, and their activities are manifested in the activation of many transcription factors, including Nrf2 (Nguyen et al., 2003; Shen et al., 2004; Keum et al., 2006). Previous study reported that extracellular P38 MAPK and ERK2 regulate the expression of HO-1 through activation of Nrf2 translocation (Xu et al., 2006). So, we hypothesized that vanadium-caused the depigmentation of eggshell may be associated with MAPK-Nrf2-ARE-mediated oxidative stress and apoptosis in the epithelial cells of uterus, which further influence protoporphyrin IX production and the color of the eggshell. Epigallocatechin-3-gallate (EGCG), a polyphenol consisting more than 30% of the dry matter in the green tea leaf, is an effective scavenger of ROS in vitro and also exhibits an antioxidant activity through mediating transcriptional factors and enzyme activities indirectly (Frei and Higdon, 2003; Na and Surh, 2008; Sriram et al., 2009). Compelling evidence concluded that EGCG can improve cellular antioxidant capacity via up-regulating the Nrf2-mediated phase II detoxification enzymes production (Gupta et al., 2004; Na and Surh, 2008; Sriram et al., 2009). However, the molecular mechanisms underlying EGCG detoxification effect on vanadium-induced eggshell depigmentation in layers is still obscure. Therefore, this research aims to study whether EGCG protected eggshell pigmentation through P38MAPK-Nrf2/HO-1 signaling pathway in vanadium-induced toxicity in laying hens. MATERIAL AND METHODS Birds, Diets and Management This study was undertaken in strict accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals of the State Council of the People's Republic of China. The experimental protocol used in the study was approved by the Animal Care and Use Committee of Sichuan Agricultural University. A total of 360 Lohman laying hens (67-wk-old, obtained from Sundaily Farm, Mianyang, Sichuan, China) were randomly divided into 3 treatments with 6 replicates per treatment of 20 birds each replicate for a 35-day feeding trial. The dietary treatments were as follows: (1) control, fed a basal diet; (2) V10, control + 10 mg/kg V; and (3) V10 + EGCG130, V10 + 130 mg/kg EGCG. Vanadium (added in the form of ammonium metavanadate) and tea polyphenols epigallocatechin-3-gallate (EGCG) with 98% purity, were purchased from Sigma (St. Louis, MO, USA). The basal diet (Table 1) was formulated according to the manual of the Lohman layers recommendations to meet or exceed the requirement of NRC (NRC, 1994). All diets were provided in mash form. Birds were housed individually in stainless steel cages (38.1cm-width × 50 length × 40 height) and room environment was controlled with 22°C by a daily lighting schedule of 16 h light and 8 h dark. Hens were allowed free access to experimental diets and water. Average feed intake was recorded daily and then pooled weekly. Table 1. Composition and nutrient level of basal diet (as fed basis). Item  Amount (%)  Corn  64.80  Soybean oil  0.20  Soybean meal (46% CP)  24.0  Calcium carbonate  8.66  Calcium hydrophosphate  1.16  NaCl  0.35  Choline Chloride  0.16  Vitamin premix1  0.03  Mineral premix2  0.50  Calculated nutrient content     AME3, kcal/kg  2680  Analyzed nutrient levels, %     CP  15.73   Ca  3.65   Total P  11.95   Lysine  0.79   Met  0.36  Item  Amount (%)  Corn  64.80  Soybean oil  0.20  Soybean meal (46% CP)  24.0  Calcium carbonate  8.66  Calcium hydrophosphate  1.16  NaCl  0.35  Choline Chloride  0.16  Vitamin premix1  0.03  Mineral premix2  0.50  Calculated nutrient content     AME3, kcal/kg  2680  Analyzed nutrient levels, %     CP  15.73   Ca  3.65   Total P  11.95   Lysine  0.79   Met  0.36  1 Provided per kilogram of diet: vitamin A, 10,000 IU (retinyl acetate); vitamin D3, 2500 IU; vitamin E, 10 mg; vitamin K3, 2 mg (menadinone dimethpyrimidnol); vitamin B1, 1 mg; vitamin B2, 5 mg; vitamin B6, 1 mg; vitamin B12, 15 μg; folic acid, 1 mg; niacin, 24 mg; Ca-pantothenate acid, 2.2 mg and biotin, 100 μg. 2 Provided per kilogram of diet: 8 mg Mn (as MnO2); 60 mg Zn (as ZnSO4); 5 mg Cu (as CuSO4•5H2O); 40 mg Fe (as FeSO4•7H2O); 0.3 mg Co (as CoSO4•5H2O); 1.5 mg I (as KI), and 0.15 mg Se (as Na2SeO3•5H2O). 3 Calculated by NRC (1994). View Large Table 1. Composition and nutrient level of basal diet (as fed basis). Item  Amount (%)  Corn  64.80  Soybean oil  0.20  Soybean meal (46% CP)  24.0  Calcium carbonate  8.66  Calcium hydrophosphate  1.16  NaCl  0.35  Choline Chloride  0.16  Vitamin premix1  0.03  Mineral premix2  0.50  Calculated nutrient content     AME3, kcal/kg  2680  Analyzed nutrient levels, %     CP  15.73   Ca  3.65   Total P  11.95   Lysine  0.79   Met  0.36  Item  Amount (%)  Corn  64.80  Soybean oil  0.20  Soybean meal (46% CP)  24.0  Calcium carbonate  8.66  Calcium hydrophosphate  1.16  NaCl  0.35  Choline Chloride  0.16  Vitamin premix1  0.03  Mineral premix2  0.50  Calculated nutrient content     AME3, kcal/kg  2680  Analyzed nutrient levels, %     CP  15.73   Ca  3.65   Total P  11.95   Lysine  0.79   Met  0.36  1 Provided per kilogram of diet: vitamin A, 10,000 IU (retinyl acetate); vitamin D3, 2500 IU; vitamin E, 10 mg; vitamin K3, 2 mg (menadinone dimethpyrimidnol); vitamin B1, 1 mg; vitamin B2, 5 mg; vitamin B6, 1 mg; vitamin B12, 15 μg; folic acid, 1 mg; niacin, 24 mg; Ca-pantothenate acid, 2.2 mg and biotin, 100 μg. 2 Provided per kilogram of diet: 8 mg Mn (as MnO2); 60 mg Zn (as ZnSO4); 5 mg Cu (as CuSO4•5H2O); 40 mg Fe (as FeSO4•7H2O); 0.3 mg Co (as CoSO4•5H2O); 1.5 mg I (as KI), and 0.15 mg Se (as Na2SeO3•5H2O). 3 Calculated by NRC (1994). View Large Sample Collection On study d 35, Twenty-four eggs per treatment (4 eggs/replicate) were collected to measure eggshell color and pigmentation content. Then, 72 hens (4 birds/replicate, 24 birds/treatment) were randomly chosen and sacrificed by cervical dislocation. Uterus (middle site) segments were immediately removed for morphology, apoptosis assay, and storage under −80°C for further RT-PCR analysis. Measurement of Eggshell Color and Protoporphyrin IX Content The eggshell color [L*(lightness), a* (redness), and b* (yellowness)] values were measured on the equatorial region two times per egg by a color meter (Minolta CR410 chroma meter, Konica Minolta Sensing Inc., Osaka, Japan). Shell protoporphyrin IX content was measured according to the method described by Gorchein et al. (2009) and Igic et al. (2009) with some modification. The extraction solution was prepared as described previously (Zhao et al., 2006), which was a solution (3:3:2) with 3 N HCl: acetonitrile: water (HPLC grade, Beijing Chemical Reagents Company, Beijing, China). To measure the protoporphyrin IX content, eggshells without attached membranes were rinsed in MQ H2O (Millipore, MA) and ground to powder. The eggshell powder (0.25 g) was solubilized with 8 mL of extraction solution in the dark at room temperature for 2 d. Solubilized samples were centrifuged for 10 min at 17,800 × g at room temperature, and the supernatant (0.3 mL) was transferred into a microtiter plate for analysis with Microplate Reader (Tecan, Port Melbourne, Australia) at the wavelength of 412 nm. Calibration curves of standard protoporphyrin IX (Fisher Scientific, Waltham, MA) were constructed to calculate sample concentrations. Uterus Morphology Uterus segments were cut into pieces within 1–2 cm (in length) in 10% neutral buffered paraformaldehyde, processed and trimmed, embedded in paraffin, sectioned to a 5-μm thickness slice. The morphology were observed using a microscope under 100 × and 200 × magnification (BA400Digital, Mike Audi Industrial Group Co., Ltd., Xiamen, China). Apoptosis Assay of Uterus by TUNEL Method Uterus sites were quickly removed and placed into immediately into methyl aldehyde, then were histochemical stained using TUNEL technique by an in Situ apoptosis detection kit (Roche, Switzerland). Using BA200Digital (Mike Audi Industrial Group Co., Ltd.) to image acquisition. Apoptotic color is light yellow or brown yellow, and negative expression is blue with white background. Totally, 100 images have been taken to measure the cell apoptosis, and apoptosis rate is defined as the percentage of apoptotic cells in 100 cells counted. Antioxidant Enzyme Activity Assay A homogenizer (PowerGen 125, Fisher Scientific, USA) was used for uterus homogenate to determine antioxidant status [superoxide dismutase (SOD), glutathione S-transferase (GST), glutathione peroxidase (GSH-Px), total antioxidant capacity (T-AOC) and malondialdehyde (MDA)] using the reagent kits (SOD, A001-1; GST, A004; GSH-Px, A005; T-AOC, A015; MDA, A003-1, Nanjing Jiancheng Bioengineering Institute of China). Reverse-transcription Polymerase Chain Reaction (RT-PCR) Analysis Total RNA was isolated from uterus using TRIzol (Invitrogen, Carlsbad, CA, USA). Real-time quantitative PCR (RT-qPCR) was performed with SYBR Premix Ex TaqTM HS (TaKaRa Biotechnology, Dalian, China) on the Applied Biosystems 7500 Real-Time PCR System. The PCR amplifications were carried out in a final volume of 25 μL reaction mixture containing 1 μL of 10 × diluted template cDNA, 12.5 μL Taq Master Mix (Tiangen, Beijing, China), 0.5 μL (10 μmol/L) of each primer, 2.5 μL probe, 0.5 μL Rox, 3.5 μL MgCl2, followed by adding sterilized water to reach the final volume. The experiment was repeated for three biological replications. The cycling condition were as follows: 2 min at 95°C followed by 40 cycles of denaturation at 95°C, 15 s; 60°C, 1 min; 72°C, 1 min for Nrf2; 30 cycles of 94°C, 30 s; 55°C 1 min; 72°C, 1 min for HO-1; 30 cycles of 95°C, 30 s; 58°C 1 min; 72°C, 1 min for FECH; 40 cycles of 93°C, 30 s; 58°C 1 min; 72°C, 1 min for P38-MAPK; 40 cycles of 93°C, 30 s; 55°C 1 min; 72°C, 1 min for sMaf; 26 cycles of 95°C, 1 min; 60°C 2 min; 72°C, 2 min of housing keeping gene, β-actin, followed by a final extension at 75°C for 10 min. The primer pairs and the size of expected products are listed in Table 2. All PCR amplification products were analyzed on 1.2% agarose gel electrophoresis, stained with ethidium bromide. All the positive PCR products were cloned and sequenced. Relative quantities of mRNA were calculated using the 2−ΔΔCT method, with the quantity of the control diet scale to 1. One house-keeping gene (β–actin) was assessed for stability of expression using two separate cDNA from each treatment. Table 2. Gene-specific primers for real-time quantitative reverse transcription PCR. Genes  Primers (5΄ to 3΄)  Genes Number2  Product size, bp  FECH  Forward: ACACCACGAATTCAGGAGCA  NM_204,196.1  267    Reverse: AGCAGTTTCACCATGCCTTCT      Nrf2  Forward: TGTGTGTGATTCAACCCGACT  NM_205,117.1  143    Reverse: TTAATGGAAGCCGCACCACT      HO-1  Forward: TTGGCAAGAAGCATCCAGA  NM_205,344.1  129    Reverse: TCCATCTCAAGGGCATTCA      P38MAPK  Forward: TGTGTTCACCCCTGCCAAGT  AJ719744.1  149    Reverse: GCCCCCGAAGAATCTGGTAT      sMaf  Forward: AGTCCCCTGGCCATGGAATA  NM_0,010,44671  247    Reverse: AGCCCGTCATCCAGTAGTAGT      β-actin  Forward: TCAGGGTGTGATGGTTGGTATG  NM_205,518.1  120    Reverse: TGTTCAATGGGGTACTTCAGGG      Genes  Primers (5΄ to 3΄)  Genes Number2  Product size, bp  FECH  Forward: ACACCACGAATTCAGGAGCA  NM_204,196.1  267    Reverse: AGCAGTTTCACCATGCCTTCT      Nrf2  Forward: TGTGTGTGATTCAACCCGACT  NM_205,117.1  143    Reverse: TTAATGGAAGCCGCACCACT      HO-1  Forward: TTGGCAAGAAGCATCCAGA  NM_205,344.1  129    Reverse: TCCATCTCAAGGGCATTCA      P38MAPK  Forward: TGTGTTCACCCCTGCCAAGT  AJ719744.1  149    Reverse: GCCCCCGAAGAATCTGGTAT      sMaf  Forward: AGTCCCCTGGCCATGGAATA  NM_0,010,44671  247    Reverse: AGCCCGTCATCCAGTAGTAGT      β-actin  Forward: TCAGGGTGTGATGGTTGGTATG  NM_205,518.1  120    Reverse: TGTTCAATGGGGTACTTCAGGG      1 Abbreviation indicated that: FECH = ferrochelatase, Nrf2 = nuclear factor erythroid-2 related factor 2, HO-1 = heme oxygenase-1, P38 MAPK = p38 mitogen activated protein kinases. 2 GenBank accession number for sequence from which primers were designed. View Large Table 2. Gene-specific primers for real-time quantitative reverse transcription PCR. Genes  Primers (5΄ to 3΄)  Genes Number2  Product size, bp  FECH  Forward: ACACCACGAATTCAGGAGCA  NM_204,196.1  267    Reverse: AGCAGTTTCACCATGCCTTCT      Nrf2  Forward: TGTGTGTGATTCAACCCGACT  NM_205,117.1  143    Reverse: TTAATGGAAGCCGCACCACT      HO-1  Forward: TTGGCAAGAAGCATCCAGA  NM_205,344.1  129    Reverse: TCCATCTCAAGGGCATTCA      P38MAPK  Forward: TGTGTTCACCCCTGCCAAGT  AJ719744.1  149    Reverse: GCCCCCGAAGAATCTGGTAT      sMaf  Forward: AGTCCCCTGGCCATGGAATA  NM_0,010,44671  247    Reverse: AGCCCGTCATCCAGTAGTAGT      β-actin  Forward: TCAGGGTGTGATGGTTGGTATG  NM_205,518.1  120    Reverse: TGTTCAATGGGGTACTTCAGGG      Genes  Primers (5΄ to 3΄)  Genes Number2  Product size, bp  FECH  Forward: ACACCACGAATTCAGGAGCA  NM_204,196.1  267    Reverse: AGCAGTTTCACCATGCCTTCT      Nrf2  Forward: TGTGTGTGATTCAACCCGACT  NM_205,117.1  143    Reverse: TTAATGGAAGCCGCACCACT      HO-1  Forward: TTGGCAAGAAGCATCCAGA  NM_205,344.1  129    Reverse: TCCATCTCAAGGGCATTCA      P38MAPK  Forward: TGTGTTCACCCCTGCCAAGT  AJ719744.1  149    Reverse: GCCCCCGAAGAATCTGGTAT      sMaf  Forward: AGTCCCCTGGCCATGGAATA  NM_0,010,44671  247    Reverse: AGCCCGTCATCCAGTAGTAGT      β-actin  Forward: TCAGGGTGTGATGGTTGGTATG  NM_205,518.1  120    Reverse: TGTTCAATGGGGTACTTCAGGG      1 Abbreviation indicated that: FECH = ferrochelatase, Nrf2 = nuclear factor erythroid-2 related factor 2, HO-1 = heme oxygenase-1, P38 MAPK = p38 mitogen activated protein kinases. 2 GenBank accession number for sequence from which primers were designed. View Large Immunoblotting Analysis Proteins were extracted from uterine tissues and the protein concentration was determined by using the BCA protein assay kit (Pierce Biotechnology, Inc., Rockford, IL, USA). Fifty micrograms of total protein were separated by SDS-PAGE and then transferred to polyvinylidene fluoride membranes (0.45 μm) at 100 V for 1 h 20 min. were blocked for 1 h in Tris-buffered saline Tween20 (TBST) buffer containing 1% (v/v) ovalbumin, followed by incubation with anti-bovine haptoglobin polyclonal antibodies at 37°C for 1 h. Subsequently, membranes were incubated with horseradish peroxidase-conjugated secondary antibody at 37°C for 1 h. Finally, membranes were detected and visualized by diaminobenzidine solution. The separated proteins were blotted on to a PVDF membrane and probed with a rabbit polyclonal antibody against P38 MAPK (CST, 1:2000), phosphor-P38MAPK (CST, 1:2000), Nrf2 (Santa Cruz, 1:4000), HO-1(Abcam, 1:500) and sMaf (Santa Cruz, 1:1000). The goat anti-rabbit IgG-HRP (1:10,000, Santa Cruz Biotechnol, Inc.) were used as the secondary antibody. The blots were washed again three times with PBST, and immnunoreactive protein complex were detected by the ECL Prime western blotting detection reagent (GE-Healthcare) using a CCD-based imager (Image Quant LAS 4000) according to the manufacture. Statistical Analysis Data were analyzed by one-way ANOVA using GLM procedure of SAS 9.2 (SAS Institute). For all data, when the ANOVA was significant, Tukey's test were conducted. All data are expressed as means value with their standard errors of means (SEM). Significant differences were declared at P < 0.05. RESULTS Eggshell Color and Protoporphyrin IX Content The eggshell color lightness (L*) value was higher and the value of redness (a*) and yellowness (b*) level were lower (P < 0.05) in the V10 group compared to the control diet (Table 3). Supplementation with 130 mg/kg EGCG partially increased (P < 0.05) a* and b* value, but could not achieve values similar to the control. The protoporphyrin IX content in eggshell was also decreased (P < 0.05) in the V10 group compared with the control and V10 + EGCG130 groups. Table 3. Effect of tea polyphenols on eggshell color and protoporphyrin IX content of laying hens in vanadium containing diets (Mean values with their means of standard errors; n = 6 per treatment). Item1  Control  V10  V10+EGCG130  SEM  P-Value  L*  93.64b  96.15a  94.65a,b  0.19  <0.01  a*  6.50a  2.60c  4.85b  0.14  <0.01  b*  18.80a  14.75c  16.21b  0.21  <0.01  Protoporphyrin IX, μg/g eggshell  42.35a  13.02c  28.45b  1.78  <0.01  Item1  Control  V10  V10+EGCG130  SEM  P-Value  L*  93.64b  96.15a  94.65a,b  0.19  <0.01  a*  6.50a  2.60c  4.85b  0.14  <0.01  b*  18.80a  14.75c  16.21b  0.21  <0.01  Protoporphyrin IX, μg/g eggshell  42.35a  13.02c  28.45b  1.78  <0.01  1 V10 = 10 mg/kg V, EGCG130 = 130 mg/kg EGCG. L* = lightness, a* = redness, b* = yellowness. View Large Table 3. Effect of tea polyphenols on eggshell color and protoporphyrin IX content of laying hens in vanadium containing diets (Mean values with their means of standard errors; n = 6 per treatment). Item1  Control  V10  V10+EGCG130  SEM  P-Value  L*  93.64b  96.15a  94.65a,b  0.19  <0.01  a*  6.50a  2.60c  4.85b  0.14  <0.01  b*  18.80a  14.75c  16.21b  0.21  <0.01  Protoporphyrin IX, μg/g eggshell  42.35a  13.02c  28.45b  1.78  <0.01  Item1  Control  V10  V10+EGCG130  SEM  P-Value  L*  93.64b  96.15a  94.65a,b  0.19  <0.01  a*  6.50a  2.60c  4.85b  0.14  <0.01  b*  18.80a  14.75c  16.21b  0.21  <0.01  Protoporphyrin IX, μg/g eggshell  42.35a  13.02c  28.45b  1.78  <0.01  1 V10 = 10 mg/kg V, EGCG130 = 130 mg/kg EGCG. L* = lightness, a* = redness, b* = yellowness. View Large Antioxidant Enzyme Activities, Histopathological Changes and Apoptosis Rate of Uterus Uterine tissues of layers fed 10 mg/kg V showed a reduction in GST activity and increased MDA content compared with the control group, whereas supplementation of 130 mg/kg of EGCG only completely reversed this reduction (P < 0.05; Table 4). No significant changes were observed in the morphology of uterus among dietary treatments (Figure 1). Furthermore, apoptosis rate of uterine epithelial cells was higher (P < 0.01) in V10 than that in the control treatment, while adding 130 mg/kg of EGCG didn’t affect rate incretion (Figure 2). Figure 1. View largeDownload slide Histopathological changes in the uterus of laying hens. Group 1, 2 and 3 obtained from layers fed control, 10 mg/kg V and 10 mg/kg V plus 130 mg/kg EGCG diet (×200). No significant differences were observed in morphology of uterus among dietary treatments. Figure 1. View largeDownload slide Histopathological changes in the uterus of laying hens. Group 1, 2 and 3 obtained from layers fed control, 10 mg/kg V and 10 mg/kg V plus 130 mg/kg EGCG diet (×200). No significant differences were observed in morphology of uterus among dietary treatments. Figure 2. View largeDownload slide Cell apoptosis rate of uterus immunohistochemically stained with TUNEL. ** Means significant difference (P < 0.01). Each means represents 6 replicate cages, with 1 layers/replicate. Abbreviation represents: V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG. Apoptotic color is light yellow or brown yellow with arrow pointed out, and negative expression is blue with white background. Totally, 100 images have been taken to measure the cell apoptosis, and apoptosis rate is defined as the percentage of apoptotic cells in 100 cells counted. Figure 2. View largeDownload slide Cell apoptosis rate of uterus immunohistochemically stained with TUNEL. ** Means significant difference (P < 0.01). Each means represents 6 replicate cages, with 1 layers/replicate. Abbreviation represents: V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG. Apoptotic color is light yellow or brown yellow with arrow pointed out, and negative expression is blue with white background. Totally, 100 images have been taken to measure the cell apoptosis, and apoptosis rate is defined as the percentage of apoptotic cells in 100 cells counted. Table 4. Effect of tea polyphenols on uterus antioxidative status of laying hens in vanadium containing diets (Mean values with means of their standard errors; n = 6 per treatment). Item1  MDA  GSH-Px  GST  SOD  T-AOC    (nmol/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  Control  1.19b  405.58  323.11a  403.4  9.35  V10  3.50a  314.82  201.64b  270.95  9.84  V10+EGCG130  1.08b  279.54  320.53a  306.14  8.56  SEM  0.18  43.04  35.5  46.11  0.65  P-Value  <0.01  0.14  0.04  0.14  0.38  Item1  MDA  GSH-Px  GST  SOD  T-AOC    (nmol/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  Control  1.19b  405.58  323.11a  403.4  9.35  V10  3.50a  314.82  201.64b  270.95  9.84  V10+EGCG130  1.08b  279.54  320.53a  306.14  8.56  SEM  0.18  43.04  35.5  46.11  0.65  P-Value  <0.01  0.14  0.04  0.14  0.38  1 GST = GSH S-transferase, GSH-Px = glutathione peroxidase, MDA = malondialdehyde, SOD = superoxide dismutase, T-AOC = total antioxidant capacity, V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG. View Large Table 4. Effect of tea polyphenols on uterus antioxidative status of laying hens in vanadium containing diets (Mean values with means of their standard errors; n = 6 per treatment). Item1  MDA  GSH-Px  GST  SOD  T-AOC    (nmol/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  Control  1.19b  405.58  323.11a  403.4  9.35  V10  3.50a  314.82  201.64b  270.95  9.84  V10+EGCG130  1.08b  279.54  320.53a  306.14  8.56  SEM  0.18  43.04  35.5  46.11  0.65  P-Value  <0.01  0.14  0.04  0.14  0.38  Item1  MDA  GSH-Px  GST  SOD  T-AOC    (nmol/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  (U/mgprot)  Control  1.19b  405.58  323.11a  403.4  9.35  V10  3.50a  314.82  201.64b  270.95  9.84  V10+EGCG130  1.08b  279.54  320.53a  306.14  8.56  SEM  0.18  43.04  35.5  46.11  0.65  P-Value  <0.01  0.14  0.04  0.14  0.38  1 GST = GSH S-transferase, GSH-Px = glutathione peroxidase, MDA = malondialdehyde, SOD = superoxide dismutase, T-AOC = total antioxidant capacity, V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG. View Large Protein and mRNA Expression Levels of Nrf2, FECH, HO-1, P38-MAPK and P-P38-MAPK Gene expressions of FECH, Nrf2, and HO-1 were down-regulated by V10 treatment, while dietary EGCG markedly up-regulated the Nrf2 and HO-1 gene expression compared to the V10 group (Figure 3). Dietary V supplementation markedly decreased Nrf2, HO-1 and P-P38 MAPK protein levels compared with the control group, while 130 mg/kg EGCG enhanced (P < 0.01) Nrf2, HO-1, and P-P38 MAPK expression and decreased (P < 0.01) sMaf protein level in uterus compared with the V10 group (Figure 4). Figure 3. View largeDownload slide Tea polyphenols can regulate antioxidant related (Nrf2, HO-1, sMaf, P38 MAPK and FECH) mRNA gene expression in uterus of laying hens fed vanadium containing diets. **Means significant difference (P < 0.01). Each means represents 6 replicate cages, with 1 layers/replicate. Abbreviation represents: V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG, Nrf2 = nuclear factor erythroid-2 related factor 2, HO-1 = heme oxygenase-1, FECH = ferrochelatase, P38 MAPK = p38 mitogen activated protein kinases. Figure 3. View largeDownload slide Tea polyphenols can regulate antioxidant related (Nrf2, HO-1, sMaf, P38 MAPK and FECH) mRNA gene expression in uterus of laying hens fed vanadium containing diets. **Means significant difference (P < 0.01). Each means represents 6 replicate cages, with 1 layers/replicate. Abbreviation represents: V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG, Nrf2 = nuclear factor erythroid-2 related factor 2, HO-1 = heme oxygenase-1, FECH = ferrochelatase, P38 MAPK = p38 mitogen activated protein kinases. Figure 4. View largeDownload slide Effect of tea polyphenols on antioxidant related protein levels in uterus of laying hens fed vanadium containing diets at 35d. ** and *Means significant difference with P < 0.01 and P < 0.05, respectively. Each means represents 6 replicate cages, with 1 layers/replicate. Abbreviation represents: V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG, Nrf2 = nuclear factor erythroid-2 related factor 2, P38 MAPK = P38 mitogen activated protein kinases, P-P38 MAPK = phosphate-p38 mitogen activated protein kinases, HO-1 = heme oxygenase-1. Figure 4. View largeDownload slide Effect of tea polyphenols on antioxidant related protein levels in uterus of laying hens fed vanadium containing diets at 35d. ** and *Means significant difference with P < 0.01 and P < 0.05, respectively. Each means represents 6 replicate cages, with 1 layers/replicate. Abbreviation represents: V10 = 10 mg/kg vanadium, EGCG130 = 130 mg/kg EGCG, Nrf2 = nuclear factor erythroid-2 related factor 2, P38 MAPK = P38 mitogen activated protein kinases, P-P38 MAPK = phosphate-p38 mitogen activated protein kinases, HO-1 = heme oxygenase-1. DISCUSSION Eggshell pigmentation has been widely used as a potential indicator for stress and disease conditions in commercial laying hens (Jones et al., 2010; Samiullah et al., 2015). Vanadium has been reported to reduce the egg interior quality evidenced by lower albumen height (Toussant et al., 1995; Bressman et al., 2002; Wang et al., 2016a). In this study, layers exposed to a diet containing 10 mg/kg V led to lower shell color as indicated by higher L* and lower a* and b* values, EGCG treatment resulted in a higher shell color in the V-challenged birds, which is in agreement with previous observation where the decrease in V-induced shell color was reversed by antioxidant supplementation studies (Miles et al., 1997; Yuan et al., 2016; Wang et al., 2016a). Moreover, Odabaşi et al. (2006) found that 30, 50 and 100 mg V supplementation in brown-type laying hens’ diet decreased shell color (higher L* and lower a* and b* value), which was significantly alleviated by dietary supplementation with 100 mg/kg vitamin C (Odabaşi et al., 2006). As the main pigments in eggshell is protoporphyrin IX in pink and brown eggshell layer strains (Miksik et al., 1996; Samiullah and Roberts, 2013), we anticipated that the lighter shell color may be associated with the lower content of protoporphyrin IX in the V fed layers. Protoporphyrin IX, as a precursor of heme, can be synthesized by glycine and then translated into heme by catalyzing of FECH in eggshell. We observed that FECH expression was down-regulated by dietary V, while the addition of EGCG failed to reverse this effect. Thus, it could be argued that the protective effects of EGCG on eggshell color are not mediated by changes in protoporphyrin IX metabolism. V can cause an increase in the generation of ROS in various target cells, which further disrupts redox balance, reduces cell viability, eventually leading to apoptosis (Liu et al., 2011; Imura et al., 2013). The results of this study indicate that V increased apoptosis rate in uterine epithelial cells, which is accordance with the results from our previous study in magnum cells (Wang et al., 2017). Also, it has been reported that exposure to V caused apoptosis in MCF7 cells (Ray et al., 2006). Moreover, accumulating evidence indicated that V-induced ROS production can led to lipid peroxidation (Leonard et al., 2004; Cano-Gitiėrrez et al., 2010). GST, SOD, GSH-Px and HO-1 contribute to the primary enzymatic defense against ROS and each enzyme plays an integral role in redox balance modulation (Fang et al., 2002; Limón-Pacheco and Gonsebatt, 2009). In our study, we found that V increased uterine MDA content and decreased GST activity, which indicated that V induced oxidative stress in the uterus. Similarly, in our previous studies also showed that V exposure induced oxidative stress in layers and rats by decreasing the activity of antioxidant enzymes (i.e., GST, NQO-1, T-AOC, and SOD) and increasing MDA generation in the serum (Yuan et al., 2016; Wang et al., 2016b). It is interesting that the result for GSH-PX and SOD activity is not consistent, which may be because different tissues may respond to vanadium toxicity differently. Heme oxygenase (HO-1), a microsomal enzyme induced during oxidative stress, is responsible for the conversion of heme to biliverdin, carbon monoxide and iron in blood and shell gland (Maines, 1988; Siow et al., 1999). HO-1 also exerts a protective effect against oxidative stress and apoptosis in a variety of cell types (Ferris et al., 1999; Liu et al., 2004). EGCG upregulated expressions of GSH-Px, glutamate cysteine ligase, and HO-1, which might be further involved in elimination or inactivation of ROS (Na and Surh, 2008), therefore boosting the antioxidant network in the uterus. The protective effect of EGCG against V-induced oxidative stress in the hen's uterus appears to be attributable to its restoration of uterine GST and HO-1 level that are prone to be reduced by V challenge. EGCG has been widely demonstrated to protect the cells from chemical or radiation-induced damage (Na and Surh, 2008). However, the potential mechanism of EGCG in antioxidant system in V-treated layer still remains unclear. Nrf2 is a key transcriptional factor that activates the antioxidant-reactive element (ARE), and in turn regulates the expression of antioxidant phase II detoxifying enzymes (Niture et al., 2009). Under normal physiological condition, Nrf2 is bound to Keap1 in the cytoplasm, however when cellular redox balance is disrupt, Nrf2 is released from Keap1 and rapidly translocates to the nucleus to initiate transcription of antioxidant gene (Andreadi et al., 2006; Sriram et al., 2009). In Nrf2 gene knockdown rats, ROS generation and apoptotic cell death are significantly increased by cadmium exposure in kidney cells (Chen and Shaikh, 2009), suggesting that Nrf2 serves as a key regulatory mechanism during redox homeostasis. The results from the present study showed that mRNA and protein abundances of Nrf2, sMaf, and HO-1 were decreased in V-challenged birds, whereas EGCG treatment activated Nrf2 and HO-1 gene and protein expression level in the uterus. EGCG is known as one of the most potent Nrf2 activator amongst green tea polyphenol (Chen et al., 2000). Studies in Nrf2−/- mice also suggest that EGCG can regulate HO-1 expression via the Nrf2 pathway (Shen et al., 2004). Moreover, EGCG can improve cellular antioxidant capacity by up-regulating the production of Nrf2 mediated phase II detoxification enzymes (Gupta et al., 2004; Lee-Hilz et al., 2006; Wu et al., 2006; Na and Surh, 2008; Sriram et al., 2009; Sahin et al., 2010). Since HO-1 can metabolize heme to biliverdin, it may also be involved in the synthesizing of shell pigment- protoporphyrin IX (Samiullah et al., 2015). Therefore, we propose that EGCG maintained eggshell color by enhancing the production of detoxification enzymes and HO-1 expression to replenish precursors of protoporphyrin IX synthesis. The molecular mechanism underlying Nrf2 regulation by V and EGCG has not been elucidated. One of the most plausible mechanisms responsible for activation of Nrf2 seems to be phosphorylation of Nrf2 serine/threonine residues by protein kinases, which facilitates nuclear translocation of Nrf2 and subsequent ARE binding. Indeed, MAPKs such as P38 and ERK have been reported to regulate Nrf2 translocation and Nrf2 targeted genes (Nguyen et al., 2003; Shen et al., 2004; Keum et al., 2006; Eom and Choi, 2009; Limón-Pacheco and Gonsebatt, 2009). In this study, the P38-MAPK gene and protein abundances was not affected by V and EGCG treatments, but P38-MAPK phosphorylation was markedly decreased in the V10 group and activated by EGCG supplementation. Vanadium were reported to reduce phosphor-Nrf2 through MAPK pathway, suppresses its nuclear translocation, thereby reduces phase II detoxification enzymes, causes ROS hard to remove, thereby leads to the accumulation of ROS. However, previous studies reported that V2O5 and its induced H2O2 activated ERK-1/2, P38 MAPK and P-P38 MAPK in human lung fibroblast (Ingram et al., 2003; Wang et al., 2003). The differences may be because that MAPK pathway can mediate many signaling cascades, such as cytokine expression to induce inflammation and cell apoptosis for different cells in vivo and in vitro; therefore, the effect of its activation is depend on the down-stream responsers. Jaspers et al. (2000) reported that V induced oxidative stress in human bronchial epithelial cells by activating P38-MAPK dependent transactivation of NF-κB (Jaspers et al., 2000). Thus, we anticipated that P38-MAPK signaling pathway may be involved in V and EGCG-induced Nrf2 activation and subsequent expression of HO-1 in uterus of layers. Also, it has been reported that EGCG with a higher intrinsic potential to generate ROS and redox cycling are the more potent inducer of ARE-mediated gene expression (Lee-Hilz et al., 2006). The potential mechanism for EGCG on Nrf2 regulation might be associated with Keap1 thiols. Therefore, further study is necessary to test the EGCG induced ROS production and its effect on Nrf2-ARE signaling pathway in vivo. CONCLUSION In conclusion, dietary supplementation with 130 mg/kg EGCG partially reversed the lowered shell color and the disruption in redox balance by dietary V in laying hens; this response might be associated with P38MAPK-Nrf2/HO-1 signaling pathway (Figure 5). These results provided molecular-level insights into the EGCG-mediated V detoxification process in laying hens. Figure 5. View largeDownload slide Proposed mechanism of EGCG-induced activation of Nrf2 and subsequent expression of antioxidant enzymes (HO-1) in uterus and increased eggshell color under vanadium challenge. Vanadium increased the ROS and decreased the sMaf protein and Nrf2 activation. EGCG can activate P38-MAPK, which in turn phosphorylates Nrf2 and stimulating expression of its represented enzymes (including HO-1), to protect uterus against oxidative stress caused by vanadium. Figure 5. View largeDownload slide Proposed mechanism of EGCG-induced activation of Nrf2 and subsequent expression of antioxidant enzymes (HO-1) in uterus and increased eggshell color under vanadium challenge. Vanadium increased the ROS and decreased the sMaf protein and Nrf2 activation. EGCG can activate P38-MAPK, which in turn phosphorylates Nrf2 and stimulating expression of its represented enzymes (including HO-1), to protect uterus against oxidative stress caused by vanadium. ACKNOWLEDGMENTS This study was funded by National Natural Science Foundation of China (Grant No. 31402031), National Key technology Research and Development Program of the Ministry of Science and Technology of China (2014BAD13B04), and Sichuan Provincial Science and Technology Projects (Grant No. 13ZB0290, 2014NZ0043, 2014NZ0002, 2013NZ0054). REFERENCES Andreadi C. K., Howells L. M., Atherfold P. A., Manson M. M.. 2006. Involvement of Nrf2, p38, B-Raf, and nuclear factor-kappaB, but not phosphatidylinositol 3-kinase, in induction of hemeoxygenase-1 by dietary polyphenols. Mol. Pharmacol . 69: 1033– 1040. Google Scholar PubMed  Bressman R. B., Miles R. D., Comer C. W., Wilson H. R., Butcher G. D.. 2002. Effect of dietary supplementation of vanadium commercial Egg-Type laying Hens1. J. Appl. Poult. Res.  11: 46– 53. Google Scholar CrossRef Search ADS   Cano-Gitiėrrez G., Acevedo-Nava S., Santamaría A.. 2012. Hepatic megalocytosis due to vanadium inhalation: participation of oxidative stress. Toxicol. Ind. Health.  28: 353– 360. Google Scholar CrossRef Search ADS PubMed  Chen C., Yu R., Owuor E. D., Kong A. N.. 2000. Activation of antioxidant-response element (ARE), mitogen-activated protein kinases (MAPKs) and caspases by major green tea polyphenol components during cell survival and death. Arch. Pharm. Res . 23: 605– 612. Google Scholar CrossRef Search ADS PubMed  Jones D. R., Musgrove M. T., Anderson K. E., Thesmer H. S., 2010. Physical quality and composition of retail shell eggs. Poult. Sci.  89: 582– 587. Google Scholar CrossRef Search ADS PubMed  Chen J., Shaikh Z. A.. 2009. Activation of Nrf2 by cadmium and its role in protection against cadmium-induced apoptosis in rat kidney cells. Toxicol. Appl. Pharm . 241: 81– 89. Google Scholar CrossRef Search ADS   Cortizo A. M., Bruzzone L., Molinuevo S., Molinuevo S., Etcheverry S. B.. 2000. A possible role of oxidative stress in the vanadium-induced cytotoxicity in the MC3T3E1 osteoblast and UMR106 osteosarcoma cell lines. Toxicolo . 147: 89– 99. Google Scholar CrossRef Search ADS   Eom H. J., Choi J.. 2009. Oxidative stress of CeO2 nanoparticles via p38-Nrf-2 signaling pathway in human bronchial epithelial cell, Beas-2B. Toxicolo. Lett . 187: 77– 83. Google Scholar CrossRef Search ADS   Fang Y. Z., Yang S., Wu G.. 2002. Free radicals, antioxidants, and nutrition. Nutrition . 18: 872– 879. Google Scholar CrossRef Search ADS PubMed  Ferris C. D., Jaffrey S. R., Sawa A., Takahashi M., Brady S. D., Barrow R. K., Tysoe S. A., Wolosker D. E., Baranano D. E., Dore S., Poss K. D., Snyder S. H.. 1999. Haem oxygenase-1 prevents cell death by regulating cellular iron. Nat. Cell. Biol . 1: 152– 157. Google Scholar CrossRef Search ADS PubMed  Frei B., Higdon J. V.. 2003. Antioxidant activity of tea polyphenols in vivo: evidence from animal studies. J. Nutr.  133: 3275S– 3284S. Google Scholar CrossRef Search ADS PubMed  Gorchein A., Lim C. K., Cassey P.. 2009. Extraction and analysis of colourful eggshell pigments using HPLC and HPLC/electrospray ionization tandem mass spectrometry. Biomed. Chromatogr.  23: 602– 606. Google Scholar CrossRef Search ADS PubMed  Gupta S., Hastak K., Afaq F., Ahmad N., Mukhtar H.. 2004. Essential role of caspases in epigallocatechin-3-gallate-mediated inhibition of nuclear factor kappaB and induction of apoptosis. Oncogene.  23: 2507– 2522. Google Scholar CrossRef Search ADS PubMed  Igic B., Greenwood D. R., Palmer D. J., Cassey P.. 2010. Detecting pigments from colourful eggshells of extinct birds. Chemoecology.  20: 43– 48. Google Scholar CrossRef Search ADS   Imura H., Shimada A., Naota M., Morita T., Togawa M., Hasegawa T., Seko Y.. 2013. Vanadium Toxicity in Mice. Toxicol. Pathol.  41: 842– 856. Google Scholar CrossRef Search ADS PubMed  Ingram J. L., Rice A. B., Santos J., Van Houten J. C.. 2003. Vanadium-induced HB-EGF expression in human lung fibroblasts is oxidant dependent and requires MAP kinases. Am. J. Physiol-Lung C.  284: L774– L782. Google Scholar CrossRef Search ADS   Jaspers I., Samet J. M., Erzurum S., Reed W.. 2000. Vanadium-Induced kB-Dependent transcription depends upon Peroxide-Induced activation of the p38 Mitogen-Activated protein kinase. Am J. Resp. Cell Mol Biol . 23: 95– 102. Google Scholar CrossRef Search ADS   Keum Y. S., Yu S., Chang P. P., Yuan X., Kim J. H., Xu C., Han J., Agarwal A., Kong A. N.. 2006. Mechanism of action of sulforaphane: Inhibition of p38 Mitogen-Activated protein kinase isoforms contributing to the induction of antioxidant response element-mediated heme oxygenase-1 in human hepatoma HepG2 cells. Cancer Res . 66: 8804– 8813. Google Scholar CrossRef Search ADS PubMed  Lagerkvist B. J., Oskarsson A.. 2007. Vanadium. Pages 905– 923. in Nordberg G. F. (ed). Handbook on the toxicology of metals . Springer, Germany. Google Scholar CrossRef Search ADS   Lee-Hilz Y. Y., Boerboom A. M., Westphal A. H., Berkel W. J., Aarts J. M., Rietjens I. M.. 2006. Pro-Oxidant activity of flavonoids induces EpRE-Mediated gene expression. Chem. Res. Toxicol.  19: 1499– 1505. Google Scholar CrossRef Search ADS PubMed  Leonard S. S., Harris G. K., Shi X. L.. 2004. Metal-induced oxidative stress and signal transduction. Free Radic. Biol. Med.  37: 1921– 1942. Google Scholar CrossRef Search ADS PubMed  Limón-Pacheco J., Gonsebatt M. E.. 2009. The role of antioxidants and antioxidant-related enzymes in protective responses to environmentally induced oxidative stress. Mutation Research/Genetic Toxicology and Environmental Mutagenesis  674: 137– 147. Google Scholar CrossRef Search ADS   Liu X., Cui H. M., Peng X., Fang J., Cui W., Wu B.. 2011. The effect of dietary vanadium on cell cycle and apoptosis of liver in broilers. Biol Trace Elem Res  143: 1508– 1515. Google Scholar CrossRef Search ADS PubMed  Liu Z. M., Chen G. G., Ng E. K., Leung W. K., Sung J. J., Chung S. C.. 2004. Upregulation of heme oxygenase-1 and p21 confers resistance to apoptosis in human gastric cancer cells. Oncogene . 23: 503– 513. Google Scholar CrossRef Search ADS PubMed  Maines M. D. 1988. Heme oxygenase: function, multiplicity, regulatory mechanisms, and clinical applications. FASEB J.  2: 2557– 2568. Google Scholar CrossRef Search ADS PubMed  Miles R. D., O’Keefe S. F., Butcher G. D., Comer C. W., Williams D.. 1997. Influence of vitamin E, ascorbic acid and beta-carotene on laying hens fed diets containing 10 ppm supplemental vanadium. Poult. Sci . 76( Suppl. 1): 61. Miksik I., Holan V., Deyl Z.. 1996. Avian eggshell pigments and their variability. Comp. Biochem. Physiol. B Biochem. Mol. Biol.  113: 607– 612. Google Scholar CrossRef Search ADS   Na H. K., Surh Y. J.. 2008. Modulation of Nrf2-mediated antioxidant and detoxifying enzyme induction by the green tea polyphenol EGCG. Food Chem. Toxicol.  46: 1271– 1278. Google Scholar CrossRef Search ADS PubMed  Nguyen T., Sherratt P. J., Huang H. C., Yang C. S., Pickett C. B.. 2003. Increased protein stability as a mechanism that enhances Nrf2-mediated transcriptional activation of the antioxidant response element. J. Biol. Chem.  278: 4536– 4541. Google Scholar CrossRef Search ADS PubMed  Niture S. K., Jain A. K., Jaiswal A. K.. 2009. Antioxidant-induced modification of INrf2 cysteine 151 and PKC-delta-mediated phosphorylation of Nrf2 serine 40 are both required for stabilization and nuclear translocation of Nrf2 and increased drug resistance. J Cell Sci . 122: 4452– 4464. Google Scholar CrossRef Search ADS PubMed  NRC. 1994. Nutrient Requirements of Poultry . 9th, Rev. Ed. National Academy Press, Washington, DC. Odabaşi A. Z., Miles R. D., Balaban M. O., Portier K. M., Sampath V.. 2006. Vitamin C overcomes the detrimental effect of vanadium on brown eggshell pigmentation. J. Appl. Poult. Res.  15: 425– 432. Google Scholar CrossRef Search ADS   Ray R. S., Rana B., Swami B., Venu V.. 2006. Vanadium mediated apoptosis and cell cycle arrest in MCF7 cell line. Chem. Biol. Interact.  163: 239– 247. Google Scholar CrossRef Search ADS PubMed  Ryter S. W., Choi A. M.. 2006. Therapeutic applications of carbon monoxide in lung disease. Curr. Opin. Biotech. 6: 257– 262. Sahin K., Tuzcu M., Gencoglu H., Dogukan A., Timurkan M., Sahin N., Aslan A., Kucuk O.. 2010. Epigallocatechin-3-gallate activates Nrf2/HO-1 signaling pathway in cisplatin-induced nephrotoxicity in rats. Life Sci.  87: 240– 245. Google Scholar CrossRef Search ADS PubMed  Samiullah S., Roberts J. R.. 2013. The location of Protoporphyrin in the eggshell of brown-shelled eggs. Poult. Sci.  92: 2783– 2788. Google Scholar CrossRef Search ADS PubMed  Samiullah S., Roberts J. R., Chousalkar K.. 2015. Eggshell color in brown-egg laying hens - a review. Poult. Sci.  94: 2566– 2575. Google Scholar CrossRef Search ADS PubMed  Shen G., Hebbar V., Nair S., Xu C., Li W., Lin W., Keum Y. S., Han J., Gallo M. A., Kong A. N.. 2004. Regulation of Nrf2 transactivation domain activity. J. Biol. Chem.  279: 23052– 23060. Google Scholar CrossRef Search ADS PubMed  Siow R. C., Sato H., Mann G. E.. 1999. Heme oxygenase–carbon monoxide signalling pathway in atherosclerosis: anti-atherogenic actions of bilirubin and carbon monoxide? Cardiovasc. Res.  41: 385– 394. Google Scholar CrossRef Search ADS PubMed  Sriram N., Kalayarasan S., Sudhandiran G.. 2009. Epigallocatechin-3-gallate augments antioxidant activities and inhibits inflammation during bleomycin-induced experimental pulmonary fibrosis through Nrf2–Keap1 signaling. Pulm. Pharmacol. Ther . 22: 221– 236. Google Scholar CrossRef Search ADS PubMed  Toussant M. J., Swayne D. E., Latshaw J. D.. 1995. Morphologic characteristics of oviducts from hens producing eggs of different Haugh units caused by genetics and by feeding vanadium as determined with computer software-integrated digitizing technology. Poult. Sci.  74: 1671– 1676. Google Scholar CrossRef Search ADS PubMed  Wang J. P., Bai X., Ding X. M., Bai S. P., Zeng Q. F., Mao X. B., Zhang K. Y.. 2017. Quantitative proteomic analysis reveals the role of tea polyphenol EGCG in egg whites in response to vanadium stress. Nutri.  39–40: 20– 29. Google Scholar CrossRef Search ADS   Wang J. P., Cui R. Y., Zhang K. Y., Ding X. M., Luo Y. H., Bai S. P., Zeng Q. F., Xuan Y., Su Z. W.. 2016. High-Fat diet increased renal and hepatic oxidative stress induced by vanadium of wistar rat. Boil. Trace. Elem. Res.  170: 415– 423. Google Scholar CrossRef Search ADS   Wang J. P., Cui R. Y., Zhang K. Y., Ding X. M., Luo Y. H., Bai S. P., Zeng Q. F., Xuan Y., Su Z. W.. 2016. Effect of dietary vanadium and vitamin C on egg quality and antioxidant status in laying hens. J. Anim. Phyaiol. An. N.  100: 440– 447. Google Scholar CrossRef Search ADS   Wang X. T., Deng X. M., Zhao C. J., Li G. Y., Xu G. Y., Lian L. S., Wu C. X.. 2007. Study of the deposition process of eggshell pigments using an improved dissolution method. Poult. Sci.  86: 2236– 2238. Google Scholar CrossRef Search ADS PubMed  Wang Y. Z., Ingram J. L., Walters D. W., Rice A. B., Santos J. H., Houten B. V., Bonner J. C.. 2003. Vanadium-induced STAT-1 activation in lung myofibroblasts requires H2O2 and P38 MAP kinase. Free Radic. Biol. Med.  35: 845– 855. Google Scholar CrossRef Search ADS PubMed  Wu C. C., Hsu M. C., Hsieh C. W., Lin J. B., Lai P. H., Wung B. S.. 2006. Upregulation of heme oxygenase-1 by Epigallocatechin-3-gallate via the phosphatidylinositol 3-kinase/Akt and ERK pathways. Life Sci.  78: 2889– 2897. Google Scholar CrossRef Search ADS PubMed  Xu C., Huang M. T., Shen G., Yuan X., Lin W., Khor T. O., Conney A. H., Kong A. N.. 2006. Inhibition of 7,12-dimethylbenz[a]anthracene-induced skin tumorigenesis in C57BL/6 mice by sulforaphane is mediated by nuclear factor E2-related factor 2. Cancer Res . 66: 8293– 8296. Google Scholar CrossRef Search ADS PubMed  Yuan Z. H., Zhang K. Y., Ding X. M., Luo Y. H., Bai S. P., Zeng Q. F., Wang J. P.. 2016. Effect of tea polyphenols on production performance, egg quality, and hepatic antioxidant status of laying hens in vanadium-containing diets. Poult. Sci.  95: 1709– 1717. Google Scholar CrossRef Search ADS PubMed  Zhao R., Xu G. Y., Liu Z. Z., Li J. Y., Yang N.. 2006. A study on eggshell pigmentation: biliverdin in blue-shelled chickens. Poult. Sci.  85: 546– 549. Google Scholar CrossRef Search ADS PubMed  © Crown copyright 2018. This article contains public sector information licensed under the Open Government Licence v3.0 (http://www.nationalarchives.gov.uk/doc/open-government-licence/version/3/).

Journal

Poultry ScienceOxford University Press

Published: May 19, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off