Enhanced Expression of the Key Mitosis Regulator Cyclin B1 Is Mediated by PDZ-Binding Kinase in Islets of Pregnant Mice

Enhanced Expression of the Key Mitosis Regulator Cyclin B1 Is Mediated by PDZ-Binding Kinase in... Abstract The proliferation of pancreatic β cells is enhanced to enable an increase in β-cell mass and to compensate for insulin resistance during pregnancy. To elucidate the mechanisms involved, we previously investigated islets from pregnant and nonpregnant mice by gene expression profiling and found that the expression of postsynaptic density-95/Discs large/zonula occludens-1 (PDZ)–binding kinase (Pbk), a member of the mitogen-activated protein kinase kinase family, is increased in pregnant mouse islets compared with control mouse islets. Among the pregnancy hormones, treatment with estradiol upregulated Pbk expression. Inhibition of Pbk expression using a small interfering RNA for Pbk reduced bromodeoxyuridine incorporation in mouse insulinoma 6 cells, which was accompanied by a decreased expression of Ccnb1, a regulatory gene involved in mitosis. Ccnb1 expression was augmented in mouse islets during pregnancy. The forced expression of Pbk using an adenovirus system in isolated mouse islets increased Ccnb1 expression, and the Pbk inhibitor HI-TOPK-032 suppressed Ccnb1 expression in islets isolated from pregnant mice. Our results suggest that Pbk contributes to the expansion of islets during pregnancy and that Ccnb1 may assist Pbk in its role in β-cell proliferation. Pregnancy results in hormonal changes, which in turn induce insulin resistance to shift nutrients from the mother to the fetus. Previous studies using rodents demonstrated that during pregnancy, β-cell mass is increased to enhance insulin secretion and to compensate for the insulin resistance [1, 2]. β cells express receptors that recognize pregnancy hormones, and this likely contributes to the changes in β-cell function and/or survival during pregnancy. Heterozygous prolactin receptor–deficient mice were unable to augment β-cell mass during pregnancy [3, 4]. Prolactin represses the expression of Menin, which is an endocrine tumor suppressor through the upregulation of cyclin-dependent kinase inhibitors, and enhances the expression of FoxM1, which plays a crucial role in islet expansion [5, 6]. Furthermore, prolactin elicits serotonin production by upregulating the expression of rate-limiting enzymes of serotonin synthesis, namely tryptophan hydroxylase 1 and 2 (Tph1 and Tph2, respectively) in mouse islets [7, 8], and the increased secretion of serotonin plays a key role in β-cell proliferation. Estrogen is also involved in the hormonal changes that alter β-cell function during pregnancy. The activation of estrogen signaling enhances glucose-stimulated insulin secretion through inhibition of the adenosine triphosphate–sensitive potassium channel and protects oxidative stress- and cytokine-induced β-cell apoptosis [9–11]. These studies suggest that pregnancy hormones play key roles in increasing β-cell mass, enhancing insulin secretion, and preserving β cells. Whereas several mechanisms underlying this phenomenon have been studied, the mechanisms underlying the changes that occur during pregnancy remain unclear. Postsynaptic density-95/Discs large/zonula occludens-1 (PDZ)–binding kinase (Pbk) is a member of the serine/threonine kinases and was originally identified as a mitogen-activated protein kinase kinase (MAPKK) by two independent groups [12, 13]. Pbk comprises 322 amino acids, of which 89% are conserved between human and mouse. Pbk is expressed in the placenta, testis, heart muscle, and pancreas and is weakly expressed in skeletal muscle, kidney, liver, and lung. Neural progenitor cells also express Pbk during the preneonatal and postneonatal period [14]. It is noteworthy that Pbk is abundantly expressed in malignant neoplasms, including Burkitt lymphoma and leukemia cells, as well as breast, lung, colon, and prostate cancers [12, 15–20]. Previous studies demonstrated that Pbk plays a role in tumor growth and metastasis. Therefore, an increase in Pbk expression could be a predictor of disease progression and poor prognosis [18, 21–23]. Pbk is phosphorylated by the cyclin-dependent kinase (Cdk) 1/cyclin B complex and induces cell proliferation through the activation of p38 mitogen-activated protein kinase (MAPK), Erk, and phosphoinositide 3-kinase (PI3K), or inactivation of p53 [12, 18, 24–26]. Interestingly, the inhibition of Pbk suppressed the growth of transplanted tumors in a mouse model of colon cancer, suggesting that Pbk plays key roles in the proliferation of many cell types [26–28]. In a previous study, we performed comprehensive gene expression analyses using islets isolated from nonpregnant and pregnant mice at gestational day (G)12.5 and found that the expression of Pbk is augmented in mouse islets during pregnancy [7]. Because Pbk is involved in the proliferation of many cell types, we hypothesized that Pbk plays a role in β-cell proliferation during pregnancy. Hence we aimed to elucidate the role of Pbk in β cells during pregnancy. 1. Material and Methods A. Antibodies and Reagents The polyclonal rabbit antibody against PDZ-binding kinase (PBK) was purchased from BD Biosciences [Research Resource Identifier (RRID): AB_399542; 12, 13]. Monoclonal mouse antibodies against p53 (RRID: AB_331743), p38 MAPK (RRID: AB_331298), phospho-p38 MAPK (RRID: AB_331296), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (RRID: AB_561053) were purchased from Cell Signaling. The polyclonal goat IgG against cyclin B1 (RRID: AB_1964555) was purchased from R&D Systems. The antibody against p21 was purchased from Proteintech (RRID: AB_11042450). The monoclonal mouse antibody against β-actin was purchased from Sigma-Aldrich (RRID: AB_476692). The Pbk inhibitor HI-TOPK-032 was purchased from Merck Millipore. B. Cell Culture MIN6 mouse insulinoma cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 15% [volume-to-volume ratio (v/v)] fetal calf serum, 10 mM HEPES, and 1% (v/v) penicillin and streptomycin (ThermoFisher Scientific) under 5% CO2 at 37°C. MIN6 cells were treated with or without 100 nM estradiol or 5 μM HI-TOPK-032 for the indicated times. C. RNA Interference Stealth small interfering RNAs (siRNAs) against Pbk (si-Pbk or si-Pbk2) or nontargeting sequences (si-scramble) were purchased from Life Technologies and transfected into MIN6 cells using Lipofectamine RNAiMAX Transfection Reagent (ThermoFisher Scientific) according to the manufacturer’s instructions. Seventy-two hours after transfection, cells were obtained for isolation of total RNA or total protein. Sequences of siRNAs used in this study were as follows: si-Pbk: 5′- GCUUUGGAACUAGAUGGCCAAUGUU -3′; si-Pbk2: 5′- CAGAAGAGACUAACUGAUGAAGCUA -3′; and si-scramble: 5′-UAAAUGUACUGCGCGUGGAGAGGAA-3′. D. Quantitative Reverse Transcription Polymerase Chain Reaction MIN6 cells (7 × 105) were seeded in 6-well plates and transfected with si-Pbk, si-Pbk2, or si-scramble. Seventy-two hours after transfection, total RNA was extracted from the cells by using RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions. Complementary DNA was synthesized by using SuperScript III Reverse transcription (ThermoFisher Scientific). Reaction mixtures for PCR were prepared by using FAST SYBR Green Master Mix (Life Technologies) according to the manufacturer’s instructions, and quantitative PCR was performed by using the 7500 Fast Real-Time PCR System (ThermoFisher Scientific). The condition for PCR was 40 cycles of 95°C for 3 seconds and 60°C for 30 seconds. Primer sequences for quantitative reverse transcription (qRT)–PCR are shown in the Supplemental Table. E. Immunoblot Assays MIN6 cells (1 × 106 cells) were seeded onto 10-cm dishes. After 2 days, the cells were washed twice with phosphate-buffered saline and then lysed by adding cell lysis buffer containing 140 mM of NaCl, 20 mM of Tris, 1 mM of EDTA, 50 mM of NaF, 2 mM of MgCl2, 1 mM of phenylmethylsulfonyl fluoride, 25 U/mL of Benzonase (Merck), and 1 × HaltTM Protease Phosphatase Inhibitor Cocktail (ThermoFisher Scientific). Approximately 20 μg of total protein was separated by using 4% to 15% Mini-PROTEAN TGX Precast Gels (Bio-Rad), transferred to polyvinylidene fluoride membranes and incubated with antibodies against PBK (1:1000), p53 (1:1000), cyclin B1 (1:1000), p38 MAPK (1:1000), phospho-p38 MAPK (1:1000), β-actin (1:5000), p21 (1:500), or GAPDH (1:5,000). Bound primary antibodies were detected with peroxidase-coupled secondary mouse, rabbit, or goat antibodies (RRID: AB_2340069, AB_2313567, AB_2340390), and IRDye®-conjugated secondary mouse or rabbit antibodies (LI-COR Biosciences; RRID: AB_621840, AB_621841). Immunoblots were visualized by using the Odyssey (LI-COR Biosciences) or SuperSignal West DURA system (Pierce) with ECL-PlusTM (Amersham Biosciences). F. Bromodeoxyuridine Incorporation Assay Twenty-four hours before transfection, 1 × 104 MIN6 cells were seeded in 96-well plates and then transfected with si-Pbk, si-Pbk2, or si-scramble. Seventy-two hours after transfection or 24 hours after treatment with 5 μM HI-TOPK-032, the proliferation of MIN6 cells was analyzed by using Cell Proliferation ELISA and Bromodeoxyuridine (BrdU; Roche Diagnostics). Briefly, MIN6 cells were incubated with 10 μM BrdU for 2 hours, and the integrated BrdU was detected by using a peroxidase-conjugated anti-BrdU monoclonal antibody. After the addition of tetramethyl-benzidine as a substrate, BrdU incorporation was measured by absorbance at a wavelength of 370 nm by using an xMarkTM microplate spectrophotometer (Bio-Rad). G. Mouse Experiments C57BL/6J mice were mated at 12 weeks old and euthanized at the indicated gestational ages. Mouse islets were isolated from pregnant mice and nonpregnant littermates according to a previous study [29] and were maintained in RPMI1640 supplemented with 10% (v/v) fetal calf serum and 1% (v/v) penicillin and streptomycin. Isolated mouse islets were treated with 100 nM estradiol, 44.2 mM prolactin, 10 IU/mL human chorionic gonadotropin or 10 μM progesterone, and then total RNA was isolated as previously described. Animal experiments were performed with the approval from the Ethics Review Committee for Animal Experimentation of Juntendo University. H. Statistical Analysis All data are presented as the mean ± standard error of the mean. Comparisons involving two groups were analyzed by the Student t test. One-way analysis of variance followed by the Tukey-Kramer test was used for comparisons among three or more groups. A P value < 0.05 was considered to indicate a statistically significant difference between two groups. 2. Results A. Pbk Expression is Augmented in Mouse Islets During Pregnancy We previously performed comprehensive gene expression analysis using isolated islets from nonpregnant and pregnant mice on G12.5 and identified that the rate-limiting enzymes for serotonin synthesis, namely Tph1 and Tph2, are upregulated and contribute to β-cell proliferation [7, 8, 30]. To identify other candidate genes regulating maternal β-cell growth and/or function, we focused on Pbk among the genes upregulated during pregnancy, owing to our above results [7]. To confirm the changes in Pbk expression during pregnancy, we isolated islets from nonpregnant and pregnant mice at G14.5 and quantitated Pbk expression by qRT-PCR. As shown in Fig. 1A, expression of Pbk and E2f1, which is a transcription factor that regulates Pbk expression [31], were increased during pregnancy. In addition, immunoblotting using an anti-Pbk antibody demonstrated an increasing tendency of Pbk protein expression in the islets from pregnant mice compared with those from nonpregnant mice (Fig. 1B). Figure 1. View largeDownload slide Pbk expression is increased in mouse islets during pregnancy. (A) Islets were isolated from nonpregnant and pregnant mice at G14.5 for qRT-PCR analysis. Expression levels of Pbk and E2f1 were normalized to Tbp expression levels. Results are shown as the means ± standard error of the mean; n ≥ 3. *Statistically significant difference (P < 0.05) compared with the islets isolated from nonpregnant mice. (B) Islets were isolated from nonpregnant and pregnant mice at G14.5 and subjected to immunoblot using PBK and β-actin antibodies. Upper panels show a representative immunoblot. Relative protein levels of Pbk were normalized to β-actin (n = 4). Figure 1. View largeDownload slide Pbk expression is increased in mouse islets during pregnancy. (A) Islets were isolated from nonpregnant and pregnant mice at G14.5 for qRT-PCR analysis. Expression levels of Pbk and E2f1 were normalized to Tbp expression levels. Results are shown as the means ± standard error of the mean; n ≥ 3. *Statistically significant difference (P < 0.05) compared with the islets isolated from nonpregnant mice. (B) Islets were isolated from nonpregnant and pregnant mice at G14.5 and subjected to immunoblot using PBK and β-actin antibodies. Upper panels show a representative immunoblot. Relative protein levels of Pbk were normalized to β-actin (n = 4). B. Estradiol Upregulates Pbk Expression in Mouse Islets Because pregnancy hormones contribute to the expansion of islets during pregnancy, it is likely that pregnancy hormones regulate Pbk expression. Thus, we incubated islets with various pregnancy hormones at concentrations equivalent to those present in pregnant mice in the second trimester, and we investigated the expression of various genes that are reported to be involved in the expansion of islets during pregnancy. Whereas we observed a robust increase in the expression of Tph1 by prolactin, as shown previously [7], the expression of Pbk was significantly upregulated by estradiol, but not by the other hormones (Fig. 2A). Although mouse islets treated with estradiol showed a tendency of increased E2f1 expression, there was no significant difference from E2f1 levels in islets treated with vehicle. On the other hand, in MIN 6 cells, the expression levels of Pbk and E2f1 were increased by estradiol (Fig. 2B). Thus, during pregnancy, estradiol may enhance Pbk expression in β cells via both E2f1-dependent and E2f1-independent mechanisms. Figure 2. View largeDownload slide Estradiol upregulates Pbk expression in isolated mouse islets and MIN6 cells. (A) Islets were isolated from 12-week-old female mice; treated with 100 nM estradiol, 10 μM progesterone, 44.2 mM prolactin, or 10 IU/mL human chorionic gonadotropin (Hcg) for 24 hours; and then subjected to qRT-PCR (n ≥ 4). *Statistically significant difference (P < 0.05) compared with islets treated with vehicle. (B) MIN6 cells were treated with or without 100 nM estradiol for 24 hours. Total RNA was isolated for qRT-PCR analysis (n ≥ 4). Expression levels of each gene were normalized to Tbp expression. *Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. Results are shown as the means ± standard error of the mean. Figure 2. View largeDownload slide Estradiol upregulates Pbk expression in isolated mouse islets and MIN6 cells. (A) Islets were isolated from 12-week-old female mice; treated with 100 nM estradiol, 10 μM progesterone, 44.2 mM prolactin, or 10 IU/mL human chorionic gonadotropin (Hcg) for 24 hours; and then subjected to qRT-PCR (n ≥ 4). *Statistically significant difference (P < 0.05) compared with islets treated with vehicle. (B) MIN6 cells were treated with or without 100 nM estradiol for 24 hours. Total RNA was isolated for qRT-PCR analysis (n ≥ 4). Expression levels of each gene were normalized to Tbp expression. *Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. Results are shown as the means ± standard error of the mean. C. Suppression of Pbk Expression Attenuates Cell Proliferation in MIN6 Cells To investigate the role of Pbk in β-cell growth, we suppressed Pbk expression in mouse insulinoma MIN6 cells using the RNA interference method and HI-TOPK-032, a pharmacological inhibitor of Pbk. As shown in Fig. 3A and 3B, treatment of MIN6 cells with an siRNA against Pbk (si-Pbk) that we designed effectively decreased Pbk messenger RNA (mRNA) levels and protein levels. Under this condition of decreased Pbk expression, we analyzed cell proliferation by BrdU incorporation and found that the proliferation rate of MIN6 cells was decreased by 37% (Fig. 3C). This decrease in proliferation was reproducible in MIN6 cells transfected with a different siRNA against Pbk (si-Pbk2) (Fig. 3D and 3E). In addition, treatment with HI-TOPK-032 also attenuated BrdU incorporation in MIN6 cells (Fig. 3F). Figure 3. View largeDownload slide Pbk knockdown reduces cell proliferation in mouse insulinoma MIN6 cells. (A) Seventy-two hours after transfection with si-Pbk or si-scramble, total RNA was isolated from MIN6 cells for analysis of Pbk expression. Expression levels of Pbk were normalized to Tbp expression (n ≥ 3). (B) After knockdown using si-Pbk or si-scramble, total protein was isolated from MIN6 cells and subjected to immunoblot for PBK and GAPDH. Upper panels show a representative immunoblot. Relative protein levels of Pbk were normalized to Gapdh (n ≥ 3). (C) Seventy-two hours after the transfection of MIN6 cells with si-Pbk or si-scramble, the BrdU incorporation assay was performed. (D) Seventy-two hours after transfection with si-Pbk2 or si-scramble, total protein was isolated from MIN6 cells and subjected to immunoblot for PBK and GAPDH. (E) After knockdown using si-Pbk2 or si-scramble, MIN6 cells were subjected to BrdU incorporation analysis. (F) Twenty-four hours after treatment with HI-TOPK-032 (5 μM) or vehicle, BrdU incorporation analysis was performed. Results are shown as the mean ± standard error of the mean. *Statistically significant difference (P < 0.05) compared with MIN6 cells treated with si-scramble. ‡Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. Figure 3. View largeDownload slide Pbk knockdown reduces cell proliferation in mouse insulinoma MIN6 cells. (A) Seventy-two hours after transfection with si-Pbk or si-scramble, total RNA was isolated from MIN6 cells for analysis of Pbk expression. Expression levels of Pbk were normalized to Tbp expression (n ≥ 3). (B) After knockdown using si-Pbk or si-scramble, total protein was isolated from MIN6 cells and subjected to immunoblot for PBK and GAPDH. Upper panels show a representative immunoblot. Relative protein levels of Pbk were normalized to Gapdh (n ≥ 3). (C) Seventy-two hours after the transfection of MIN6 cells with si-Pbk or si-scramble, the BrdU incorporation assay was performed. (D) Seventy-two hours after transfection with si-Pbk2 or si-scramble, total protein was isolated from MIN6 cells and subjected to immunoblot for PBK and GAPDH. (E) After knockdown using si-Pbk2 or si-scramble, MIN6 cells were subjected to BrdU incorporation analysis. (F) Twenty-four hours after treatment with HI-TOPK-032 (5 μM) or vehicle, BrdU incorporation analysis was performed. Results are shown as the mean ± standard error of the mean. *Statistically significant difference (P < 0.05) compared with MIN6 cells treated with si-scramble. ‡Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. D. Inhibition of Pbk Does Not Alter the Expression of p53-Target Genes in MIN6 Cells Pbk is a member of the MAPKK family, which phosphorylates p38 MAPK and contributes to cell growth in breast cancer Michigan Cancer Foundation 7 cells [32]. Although we performed immunoblotting using an antiphospho-p38 MAPK antibody, the phosphorylated form of p38 MAPK could not be detected in MIN6 cells at the steady state, as previously reported (data not shown) [33]. In the HT-1080 fibrosarcoma cell line, Pbk interacts with p53 and the ectopic expression of Pbk induces the destabilization of p53 [34]. In colon cancer cells, pharmacological inhibition of Pbk increased p53 protein levels and inhibited cell proliferation [26]. In contrast, knockdown of Pbk using short hairpin RNA increased p53 activity without affecting p53 protein levels, and upregulated the p53-target gene Cdkn1a, which encodes p21, in colorectal carcinoma HCT-166 cells [27]. To investigate the effect of Pbk on p53 expression, we performed immunoblotting for p53 in MIN6 cells treated with si-Pbk or HI-TOPK-032 and found that the expression of p53 was augmented by both methods of Pbk suppression (Fig. 4A and 4B). p53 contributes to cell cycle arrest and apoptosis through the transactivation of Cdkn1a, Pten, Bax, Fas, and Gadd45a [35–38]. Thus, we analyzed the expression of p53 target genes by qRT-PCR. However, Pbk suppression did not alter the expression of p53 target genes, such as Cdkn1a, Pten, Bax, Fas, and Gadd45a, nor p21 protein levels (Fig. 4C and data not shown). In addition, pregnancy did not change the expression of these genes in mouse islets (Fig. 4D). These results suggest that the role of Pbk on β-cell proliferation may be independent of the p53 target genes mentioned above. Figure 4. View largeDownload slide Expression levels of p53-target genes are not altered by Pbk knockdown in MIN6 cells. (A) Seventy-two hours after transfection of MIN6 cells with si-Pbk or si-scramble, total protein was isolated for immunoblot analysis. Upper panels show representative immunoblots of p53 and GAPDH. Relative protein levels of p53 were normalized to those of Gapdh (n ≥ 4). *Statistically significant difference (P < 0.05) compared with MIN6 cells transfected with si-scramble. (B) Six hours after treatment with HI-TOPK-032 (5 μM) or vehicle, total protein was isolated for immunoblot analysis using anit-p53 and GAPDH antibodies. ‡Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. (C) After knockdown using si-Pbk or si-scramble, total RNA was isolated from MIN6 cells to analyze the expression levels of p53-target genes, including Cdkn1a, Pten, Bax, Fas, and Gadd45a. Expression levels of each gene were normalized to those of Tbp. Results are shown as the means ± standard error of the mean; n ≥ 3. (D) Total RNA was isolated from islets of pregnant or nonpregnant mice to analyze the expression levels of p53-target genes (n ≥ 4). Figure 4. View largeDownload slide Expression levels of p53-target genes are not altered by Pbk knockdown in MIN6 cells. (A) Seventy-two hours after transfection of MIN6 cells with si-Pbk or si-scramble, total protein was isolated for immunoblot analysis. Upper panels show representative immunoblots of p53 and GAPDH. Relative protein levels of p53 were normalized to those of Gapdh (n ≥ 4). *Statistically significant difference (P < 0.05) compared with MIN6 cells transfected with si-scramble. (B) Six hours after treatment with HI-TOPK-032 (5 μM) or vehicle, total protein was isolated for immunoblot analysis using anit-p53 and GAPDH antibodies. ‡Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. (C) After knockdown using si-Pbk or si-scramble, total RNA was isolated from MIN6 cells to analyze the expression levels of p53-target genes, including Cdkn1a, Pten, Bax, Fas, and Gadd45a. Expression levels of each gene were normalized to those of Tbp. Results are shown as the means ± standard error of the mean; n ≥ 3. (D) Total RNA was isolated from islets of pregnant or nonpregnant mice to analyze the expression levels of p53-target genes (n ≥ 4). E. Pbk Regulates Ccnb1 Expression in Islets of Pregnant Mice Because the suppression of Pbk reduced cell proliferation in MIN6 cells and p53-targeted genes showed no change in Pbk suppression in MIN6 cells, we analyzed the expression of genes regulating the cell cycle to identify Pbk-target gene candidates. As shown in Fig. 5A, Pbk knockdown attenuated the expression of Ccna2, Ccnb1, Ccnb2, Ccnd2, Ccnd3, Cdk1, and Cdk4. To confirm these findings, we used HI-TOPK-032 and found that treatment with this inhibitor also attenuated the expression of these genes in MIN6 cells (Fig. 5B). In addition, we isolated mouse islets and enhanced their expression of mouse Pbk using an adenovirus vector system. Interestingly, among these genes, Ccnb1 was the only gene to be upregulated in response to the forced expression of Pbk (Fig. 5C). Similar to the changes in Ccnb1 mRNA, immunoblotting analysis showed that cyclin B1 was reduced in MIN6 cells by Pbk knockdown as well as treatment with HI-TOPK-032 (Fig. 5D and 5E). Previous data showed that p53 interrupts the cell cycle through the suppression of Ccnb1 [39]. To investigate whether a similar system is involved in the regulation of β-cell proliferation, we suppressed Pbk expression and then treated MIN6 cells with the p53 inhibitor Pifithrin-α. However, inhibition of p53 did not reverse the reduction in Ccnb1 expression (data not shown). Figure 5. View largeDownload slide Pbk knockdown attenuates Ccnb1 expression in MIN6 cells. (A) Expression levels of genes regulating the cell cycle were analyzed by qRT-PCR in MIN6 cells transfected with si-Pbk or si-scramble. *Statistically significant difference (P < 0.05) compared with MIN6 cells transfected with si-scramble. (B) Six hours after treatment with HI-TOPK-032 (5 μM) or vehicle, total RNA was isolated from MIN6 cells for qRT-PCR analysis (n ≥ 3). ‡Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. (C) Isolated mouse islets were incubated with adenoviruses expressing Pbk or GFP and then subjected to qRT-PCR analysis (n = 3). Expression levels of each gene were normalized to those of Tbp. Results are shown as the mean ± standard error of the mean. §Statistically significant difference (P < 0.05) compared with islets treated with green fluorescent protein–expressing adenoviruses. (D) MIN6 cells were transfected with si-Pbk or si-scramble, followed by immunoblotting for PBK and GAPDH. Upper panels show representative immunoblots. The lower panel shows relative protein levels of Pbk, which were normalized to those of Gapdh (n ≥ 3). *Statistically significant difference (P < 0.05) compared with MIN6 cells transfected with si-scramble. (E) Six hours after treatment with HI-TOPK-032 or vehicle, total protein was isolated from MIN6 cells for immunoblot analysis. ‡Statistically significant difference (P < 0.05) compared with vehicle-treated cells. Results are shown as the mean ± standard error of the mean; n ≥ 3. Figure 5. View largeDownload slide Pbk knockdown attenuates Ccnb1 expression in MIN6 cells. (A) Expression levels of genes regulating the cell cycle were analyzed by qRT-PCR in MIN6 cells transfected with si-Pbk or si-scramble. *Statistically significant difference (P < 0.05) compared with MIN6 cells transfected with si-scramble. (B) Six hours after treatment with HI-TOPK-032 (5 μM) or vehicle, total RNA was isolated from MIN6 cells for qRT-PCR analysis (n ≥ 3). ‡Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. (C) Isolated mouse islets were incubated with adenoviruses expressing Pbk or GFP and then subjected to qRT-PCR analysis (n = 3). Expression levels of each gene were normalized to those of Tbp. Results are shown as the mean ± standard error of the mean. §Statistically significant difference (P < 0.05) compared with islets treated with green fluorescent protein–expressing adenoviruses. (D) MIN6 cells were transfected with si-Pbk or si-scramble, followed by immunoblotting for PBK and GAPDH. Upper panels show representative immunoblots. The lower panel shows relative protein levels of Pbk, which were normalized to those of Gapdh (n ≥ 3). *Statistically significant difference (P < 0.05) compared with MIN6 cells transfected with si-scramble. (E) Six hours after treatment with HI-TOPK-032 or vehicle, total protein was isolated from MIN6 cells for immunoblot analysis. ‡Statistically significant difference (P < 0.05) compared with vehicle-treated cells. Results are shown as the mean ± standard error of the mean; n ≥ 3. Finally, we investigated the expression of these genes in islets isolated from pregnant mice. As shown in Fig. 6, Ccna2 and Ccnb1 levels were increased in the islets of pregnant mice, and treatment with HI-TOPK-032 attenuated Ccnb1 expression. Figure 6. View largeDownload slide Attenuation of Ccnb1 expression by a Pbk inhibitor in isolated islets of pregnant mice. Isolated mouse islets were incubated with 5 μM HI-TOPK-032 or vehicle for 24 hours and then subjected to qRT-PCR analysis. Expression levels of each gene were normalized to Tbp expression (n ≥ 4). *Statistically significant difference (P < 0.05) compared with islets of nonpregnant mice. §Statistically significant difference (P < 0.05) compared with islets of pregnant mice treated with vehicle. Figure 6. View largeDownload slide Attenuation of Ccnb1 expression by a Pbk inhibitor in isolated islets of pregnant mice. Isolated mouse islets were incubated with 5 μM HI-TOPK-032 or vehicle for 24 hours and then subjected to qRT-PCR analysis. Expression levels of each gene were normalized to Tbp expression (n ≥ 4). *Statistically significant difference (P < 0.05) compared with islets of nonpregnant mice. §Statistically significant difference (P < 0.05) compared with islets of pregnant mice treated with vehicle. 3. Discussion Pbk is expressed in proliferative fetal tissues, and its expression is observed in limited types of adult tissues [15]. Interestingly, we found that the expression of Pbk is augmented in islets during pregnancy. As Pbk contributes to tumor cell growth, we hypothesized that Pbk is involved in the expansion of β-cell mass in pregnancy. In this study, we found that estradiol enhanced the expression of Pbk. In addition, the forced expression of Pbk enhanced the expression of Ccnb1 in islets, and the augmented expression of Ccnb1 in islets from pregnant mice was suppressed by the inhibition of Pbk. Although we could not directly investigate the effect of Pbk on the cell proliferation of pregnant islets, the suppression of Pbk attenuated BrdU incorporation in MIN6 cells, indicating that Pbk is involved in the regulation of β-cell proliferation. Furthermore, Pbk knockdown reduced the mRNA expression levels of several cell-cycle genes, including Ccnb1. To identify the upstream signal of Pbk expression, we treated isolated mouse islets with several pregnancy hormones and identified that estradiol upregulates Pbk expression. The role of the estrogen signal on β cells is controversial. Whereas Le May et al. [40] showed that treatment with estradiol inhibited β-cell apoptosis without affecting β-cell proliferation in a streptozotocin-induced diabetic mouse model, replacement therapy for estradiol was reported to contribute to β-cell proliferation in a mouse model of ovariectomy with subtotal pancreatectomy [41]. In addition, treatment with a selective estrogen receptor β agonist increased the number of BrdU-positive cells in mouse islets [42]. Given that in pregnancy, estrogen induces β-cell proliferation by cooperating with other humoral factors, our results suggest that Pbk is involved in the estrogen signaling pathway. Although the necessity of Ccnb1 for β-cell proliferation has not yet been elucidated, previous studies showed that the expression of cyclin B1 is associated with β-cell proliferation. Ackermann et al. [43] demonstrated that the expression of Ccnb1 was increased during the expansion of mouse islets in a mouse partial pancreatectomy model. In addition, the enhanced expression of cyclin B1 is also observed with the overexpression of the oncoprotein MafB in cultured βTC3 cells [44]. Thus, the enhanced expression of Ccnb1 by Pbk during pregnancy may play a role in the expansion of β-cells mass. Further analyses to investigate the role of Ccnb1 on β-cell proliferation are required in the future. As previously shown, we found that Ccna2 expression is increased in mouse islets during pregnancy [7]. Ccna2 overexpression was reported to enhance β-cell proliferation [45], and thus Ccna2 is a possible candidate downstream target of Pbk that mediates β-cell proliferation [45]. Pbk knockdown attenuated the expression of Ccna2 in MIN6 cells and the pharmacological inhibition of Pbk also demonstrated a decreasing tendency of Ccna2 expression in isolated islets from pregnant mice. However, the forced expression of Pbk was unable to upregulate Ccna2 in mouse islets. This phenomenon can be explained if Pbk is able to enhance Ccna2 expression, by cooperating with other essential factors that are upregulated in pregnancy. Thus, it is possible that Ccna2 is the main mediator of Pbk function in pregnant islets. p53 is a tumor suppressor that plays important roles in cell cycle arrest and apoptosis, and its fundamental functions are well established in cancer research [46, 47]. Pbk directly binds p53 and inhibits the functions of p53. Previous studies demonstrated that the inhibition of p53 increased the expression of Cdkn1a, the gene encoding p21, which inhibits the activity of cyclin/Cdk complexes. p53 also contributes to mitochondrial function and proliferation in β cells [48, 49]. Whereas knockdown of Pbk increased p53 protein levels in MIN6 cells, Cdkn1a expression levels were not altered. The expression of Cdkn1a may be regulated independently of p53 in β cells [50]. We evaluated the expression of other p53-target genes regulating cell proliferation or apoptosis. However, the suppression of Pbk did not alter the expression of those genes. Because p53 plays an important role in tumor growth and controls the transcription of many genes, it is possible that p53 might contribute to the effects of Pbk other than on the cell cycle in β cells. 4. Conclusion Here, we propose a role of Pbk in the expansion of islets in pregnant mice. During pregnancy, an increased estrogen level upregulates the expression of Pbk. This enhanced expression of Pbk increases Ccnb1 and possibly Ccna2. The enhanced expression of Ccnb1 and Ccna2 may induce β-cell proliferation. Although direct evidence that Pbk and Ccnb1 are involved in the expansion of β-cell mass in pregnancy is lacking, here we showed evidence to support such a role. Abbreviations: Abbreviations: BrdU bromodeoxyuridine Cdk cyclin-dependent kinase Cdkn cyclin-dependent kinase inhibitor GAPDH glyceraldehyde 3-phosphate dehydrogenase MAPK mitogen-activated protein kinase MAPKK mitogen-activated protein kinase kinase MIN6 mouse insulinoma 6 mRNA messenger RNA Pbk postsynaptic density-95/Discs large/zona occludens-1–binding kinase PCR polymerase chain reaction PDZ postsynaptic density-95/Discs large/zonula occludens-1 PI3K phosphoinositide 3-kinase qRT-PCR qualitative reverse transcription polymerase chain reaction RRID Research Resource Identifier siRNA small interfering RNA Tph1 tryptophan hydroxylase 1 Tph2 tryptophan hydroxylase 2 v/v volume-to-volume ratio. Acknowledgments We acknowledge Ms. Naoko Daimaru, Ms. Hiroko Hibino, and Ms. Eriko Magoshi for assistance with the experiments. Financial Support: AstraZeneca Schweiz (T.O.), Eli Lilly and Company (T.O.), Mitsubishi Tanabe Pharma (T.O.), and Sanofi-Aventi (T.O.). Author Contributions: T.O. and H.W. designed the research; T.U., A.H., and H.I. conducted the research; T.O., H.W., T.M., Y.F., and S.T. analyzed the data; T.O., T.U., and H.W. wrote the manuscript; H.W. holds primary responsibility for the final content of the manuscript. All authors read and approved the final manuscript. Disclosure Summary: T.O. has received research funding from AstraZeneca, Eli Lilly and Company, Sanofi-Aventis, and Mitsubishi Tanabe Pharma. The remaining authors have nothing to disclose. References and Notes 1. Buchanan TA, Xiang AH. Gestational diabetes mellitus. J Clin Invest . 2005; 115( 3): 485– 491. Google Scholar CrossRef Search ADS PubMed  2. Rieck S, Kaestner KH. Expansion of beta-cell mass in response to pregnancy. Trends Endocrinol Metab . 2010; 21( 3): 151– 158. Google Scholar CrossRef Search ADS PubMed  3. Huang C, Snider F, Cross JC. Prolactin receptor is required for normal glucose homeostasis and modulation of beta-cell mass during pregnancy. Endocrinology . 2009; 150( 4): 1618– 1626. Google Scholar CrossRef Search ADS PubMed  4. Hughes E, Huang C. Participation of Akt, menin, and p21 in pregnancy-induced beta-cell proliferation. Endocrinology . 2011; 152( 3): 847– 855. Google Scholar CrossRef Search ADS PubMed  5. Karnik SK, Chen H, McLean GW, Heit JJ, Gu X, Zhang AY, Fontaine M, Yen MH, Kim SK. Menin controls growth of pancreatic beta-cells in pregnant mice and promotes gestational diabetes mellitus. Science . 2007; 318( 5851): 806– 809. Google Scholar CrossRef Search ADS PubMed  6. Banerjee RR, Cyphert HA, Walker EM, Chakravarthy H, Peiris H, Gu X, Liu Y, Conrad E, Goodrich L, Stein RW, Kim SK. Gestational diabetes mellitus from inactivation of prolactin receptor and MafB in islet β-cells. Diabetes . 2016; 65( 8): 2331– 2341. Google Scholar CrossRef Search ADS PubMed  7. Kim H, Toyofuku Y, Lynn FC, Chak E, Uchida T, Mizukami H, Fujitani Y, Kawamori R, Miyatsuka T, Kosaka Y, Yang K, Honig G, van der Hart M, Kishimoto N, Wang J, Yagihashi S, Tecott LH, Watada H, German MS. Serotonin regulates pancreatic beta cell mass during pregnancy. Nat Med . 2010; 16( 7): 804– 808. Google Scholar CrossRef Search ADS PubMed  8. Iida H, Ogihara T, Min MK, Hara A, Kim YG, Fujimaki K, Tamaki M, Fujitani Y, Kim H, Watada H. Expression mechanism of tryptophan hydroxylase 1 in mouse islets during pregnancy. J Mol Endocrinol . 2015; 55( 1): 41– 53. Google Scholar PubMed  9. Soriano S, Ropero AB, Alonso-Magdalena P, Ripoll C, Quesada I, Gassner B, Kuhn M, Gustafsson JA, Nadal A. Rapid regulation of K(ATP) channel activity by 17beta-estradiol in pancreatic beta-cells involves the estrogen receptor beta and the atrial natriuretic peptide receptor. Mol Endocrinol . 2009; 23( 12): 1973– 1982. Google Scholar CrossRef Search ADS PubMed  10. Liu S, Le May C, Wong WP, Ward RD, Clegg DJ, Marcelli M, Korach KS, Mauvais-Jarvis F. Importance of extranuclear estrogen receptor-alpha and membrane G protein-coupled estrogen receptor in pancreatic islet survival. Diabetes . 2009; 58( 10): 2292– 2302. Google Scholar CrossRef Search ADS PubMed  11. Kumar R, Balhuizen A, Amisten S, Lundquist I, Salehi A. Insulinotropic and antidiabetic effects of 17β-estradiol and the GPR30 agonist G-1 on human pancreatic islets. Endocrinology . 2011; 152( 7): 2568– 2579. Google Scholar CrossRef Search ADS PubMed  12. Abe Y, Matsumoto S, Kito K, Ueda N. Cloning and expression of a novel MAPKK-like protein kinase, lymphokine-activated killer T-cell-originated protein kinase, specifically expressed in the testis and activated lymphoid cells. J Biol Chem . 2000; 275( 28): 21525– 21531. Google Scholar CrossRef Search ADS PubMed  13. Gaudet S, Branton D, Lue RA. Characterization of PDZ-binding kinase, a mitotic kinase. Proc Natl Acad Sci USA . 2000; 97( 10): 5167– 5172. Google Scholar CrossRef Search ADS PubMed  14. Dougherty JD, Garcia AD, Nakano I, Livingstone M, Norris B, Polakiewicz R, Wexler EM, Sofroniew MV, Kornblum HI, Geschwind DH. PBK/TOPK, a proliferating neural progenitor-specific mitogen-activated protein kinase kinase. J Neurosci . 2005; 25( 46): 10773– 10785. Google Scholar CrossRef Search ADS PubMed  15. Simons-Evelyn M, Bailey-Dell K, Toretsky JA, Ross DD, Fenton R, Kalvakolanu D, Rapoport AP. PBK/TOPK is a novel mitotic kinase which is upregulated in Burkitt’s lymphoma and other highly proliferative malignant cells. Blood Cells Mol Dis . 2001; 27( 5): 825– 829. Google Scholar CrossRef Search ADS PubMed  16. Nandi A, Tidwell M, Karp J, Rapoport AP. Protein expression of PDZ-binding kinase is up-regulated in hematologic malignancies and strongly down-regulated during terminal differentiation of HL-60 leukemic cells. Blood Cells Mol Dis . 2004; 32( 1): 240– 245. Google Scholar CrossRef Search ADS PubMed  17. Park JH, Lin ML, Nishidate T, Nakamura Y, Katagiri T. PDZ-binding kinase/T-LAK cell-originated protein kinase, a putative cancer/testis antigen with an oncogenic activity in breast cancer. Cancer Res . 2006; 66( 18): 9186– 9195. Google Scholar CrossRef Search ADS PubMed  18. Shih MC, Chen JY, Wu YC, Jan YH, Yang BM, Lu PJ, Cheng HC, Huang MS, Yang CJ, Hsiao M, Lai JM. TOPK/PBK promotes cell migration via modulation of the PI3K/PTEN/AKT pathway and is associated with poor prognosis in lung cancer. Oncogene . 2012; 31( 19): 2389– 2400. Google Scholar CrossRef Search ADS PubMed  19. Zhu F, Zykova TA, Kang BS, Wang Z, Ebeling MC, Abe Y, Ma WY, Bode AM, Dong Z. Bidirectional signals transduced by TOPK-ERK interaction increase tumorigenesis of HCT116 colorectal cancer cells. Gastroenterology . 2007; 133( 1): 219– 231. Google Scholar CrossRef Search ADS PubMed  20. Sun H, Zhang L, Shi C, Hu P, Yan W, Wang Z, Duan Q, Lu F, Qin L, Lu T, Xiao J, Wang Y, Zhu F, Shao C. TOPK is highly expressed in circulating tumor cells, enabling metastasis of prostate cancer. Oncotarget . 2015; 6( 14): 12392– 12404. Google Scholar CrossRef Search ADS PubMed  21. Brown-Clay JD, Shenoy DN, Timofeeva O, Kallakury BV, Nandi AK, Banerjee PP. PBK/TOPK enhances aggressive phenotype in prostate cancer via β-catenin-TCF/LEF-mediated matrix metalloproteinases production and invasion. Oncotarget . 2015; 6( 17): 15594– 15609. Google Scholar CrossRef Search ADS PubMed  22. Kwon CH, Park HJ, Choi YR, Kim A, Kim HW, Choi JH, Hwang CS, Lee SJ, Choi CI, Jeon TY, Kim DH, Kim GH, Park Y. PSMB8 and PBK as potential gastric cancer subtype-specific biomarkers associated with prognosis. Oncotarget . 2016; 7( 16): 21454– 21468. Google Scholar CrossRef Search ADS PubMed  23. Wang MY, Lin ZR, Cao Y, Zheng LS, Peng LX, Sun R, Meng DF, Xie P, Yang JP, Cao L, Xu L, Huang BJ, Qian CN. PDZ binding kinase (PBK) is a theranostic target for nasopharyngeal carcinoma: driving tumor growth via ROS signaling and correlating with patient survival. Oncotarget . 2016; 7( 18): 26604– 26616. Google Scholar PubMed  24. Matsumoto S, Abe Y, Fujibuchi T, Takeuchi T, Kito K, Ueda N, Shigemoto K, Gyo K. Characterization of a MAPKK-like protein kinase TOPK. Biochem Biophys Res Commun . 2004; 325( 3): 997– 1004. Google Scholar CrossRef Search ADS PubMed  25. Fujibuchi T, Abe Y, Takeuchi T, Ueda N, Shigemoto K, Yamamoto H, Kito K. Expression and phosphorylation of TOPK during spermatogenesis. Dev Growth Differ . 2005; 47( 9): 637– 644. Google Scholar CrossRef Search ADS PubMed  26. Kim DJ, Li Y, Reddy K, Lee MH, Kim MO, Cho YY, Lee SY, Kim JE, Bode AM, Dong Z. Novel TOPK inhibitor HI-TOPK-032 effectively suppresses colon cancer growth. Cancer Res . 2012; 72( 12): 3060– 3068. Google Scholar CrossRef Search ADS PubMed  27. Hu F, Gartenhaus RB, Eichberg D, Liu Z, Fang HB, Rapoport AP. PBK/TOPK interacts with the DBD domain of tumor suppressor p53 and modulates expression of transcriptional targets including p21. Oncogene . 2010; 29( 40): 5464– 5474. Google Scholar CrossRef Search ADS PubMed  28. Joel M, Mughal AA, Grieg Z, Murrell W, Palmero S, Mikkelsen B, Fjerdingstad HB, Sandberg CJ, Behnan J, Glover JC, Langmoen IA, Stangeland B. Targeting PBK/TOPK decreases growth and survival of glioma initiating cells in vitro and attenuates tumor growth in vivo. Mol Cancer . 2015; 14( 1): 121. Google Scholar CrossRef Search ADS PubMed  29. Iwashita N, Uchida T, Choi JB, Azuma K, Ogihara T, Ferrara N, Gerber H, Kawamori R, Inoue M, Watada H. Impaired insulin secretion in vivo but enhanced insulin secretion from isolated islets in pancreatic beta cell-specific vascular endothelial growth factor-A knock-out mice. Diabetologia . 2007; 50( 2): 380– 389. Google Scholar CrossRef Search ADS PubMed  30. Schraenen A, Lemaire K, de Faudeur G, Hendrickx N, Granvik M, Van Lommel L, Mallet J, Vodjdani G, Gilon P, Binart N, in’t Veld P, Schuit F. Placental lactogens induce serotonin biosynthesis in a subset of mouse beta cells during pregnancy. Diabetologia . 2010; 53( 12): 2589– 2599. Google Scholar CrossRef Search ADS PubMed  31. Hu F, Gartenhaus RB, Zhao XF, Fang HB, Minkove S, Poss DE, Rapoport AP. c-Myc and E2F1 drive PBK/TOPK expression in high-grade malignant lymphomas. Leuk Res . 2013; 37( 4): 447– 454. Google Scholar CrossRef Search ADS PubMed  32. Ayllón V, O’connor R. PBK/TOPK promotes tumour cell proliferation through p38 MAPK activity and regulation of the DNA damage response. Oncogene . 2007; 26( 24): 3451– 3461. Google Scholar CrossRef Search ADS PubMed  33. Lee JS, Kim YR, Song IG, Ha SJ, Kim YE, Baek NI, Hong EK. Cyanidin-3-glucoside isolated from mulberry fruit protects pancreatic β-cells against oxidative stress-induced apoptosis. Int J Mol Med . 2015; 35( 2): 405– 412. Google Scholar CrossRef Search ADS PubMed  34. Nandi AK, Ford T, Fleksher D, Neuman B, Rapoport AP. Attenuation of DNA damage checkpoint by PBK, a novel mitotic kinase, involves protein-protein interaction with tumor suppressor p53. Biochem Biophys Res Commun . 2007; 358( 1): 181– 188. Google Scholar CrossRef Search ADS PubMed  35. Stambolic V, MacPherson D, Sas D, Lin Y, Snow B, Jang Y, Benchimol S, Mak TW. Regulation of PTEN transcription by p53. Mol Cell . 2001; 8( 2): 317– 325. Google Scholar CrossRef Search ADS PubMed  36. Miyashita T, Reed JC. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell . 1995; 80( 2): 293– 299. Google Scholar CrossRef Search ADS PubMed  37. Owen-Schaub LB, Zhang W, Cusack JC, Angelo LS, Santee SM, Fujiwara T, Roth JA, Deisseroth AB, Zhang WW, Kruzel E, et al.  . Wild-type human p53 and a temperature-sensitive mutant induce Fas/APO-1 expression. Mol Cell Biol . 1995; 15( 6): 3032– 3040. Google Scholar CrossRef Search ADS PubMed  38. Kastan MB, Zhan Q, el-Deiry WS, Carrier F, Jacks T, Walsh WV, Plunkett BS, Vogelstein B, Fornace AJ Jr. A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell . 1992; 71( 4): 587– 597. Google Scholar CrossRef Search ADS PubMed  39. Innocente SA, Abrahamson JL, Cogswell JP, Lee JM. p53 regulates a G2 checkpoint through cyclin B1. Proc Natl Acad Sci USA . 1999; 96( 5): 2147– 2152. Google Scholar CrossRef Search ADS PubMed  40. Le May C, Chu K, Hu M, Ortega CS, Simpson ER, Korach KS, Tsai MJ, Mauvais-Jarvis F. Estrogens protect pancreatic beta-cells from apoptosis and prevent insulin-deficient diabetes mellitus in mice. Proc Natl Acad Sci USA . 2006; 103( 24): 9232– 9237. Google Scholar CrossRef Search ADS PubMed  41. Choi SB, Jang JS, Park S. Estrogen and exercise may enhance beta-cell function and mass via insulin receptor substrate 2 induction in ovariectomized diabetic rats. Endocrinology . 2005; 146( 11): 4786– 4794. Google Scholar CrossRef Search ADS PubMed  42. Alonso-Magdalena P, Ropero AB, García-Arévalo M, Soriano S, Quesada I, Muhammed SJ, Salehi A, Gustafsson JA, Nadal A. Antidiabetic actions of an estrogen receptor β selective agonist. Diabetes . 2013; 62( 6): 2015– 2025. Google Scholar CrossRef Search ADS PubMed  43. Ackermann Misfeldt A, Costa RH, Gannon M. Beta-cell proliferation, but not neogenesis, following 60% partial pancreatectomy is impaired in the absence of FoxM1. Diabetes . 2008; 57( 11): 3069– 3077. Google Scholar CrossRef Search ADS PubMed  44. Lu J, Hamze Z, Bonnavion R, Herath N, Pouponnot C, Assade F, Fontanière S, Bertolino P, Cordier-Bussat M, Zhang CX. Reexpression of oncoprotein MafB in proliferative β-cells and Men1 insulinomas in mouse. Oncogene . 2012; 31( 31): 3647– 3654. Google Scholar CrossRef Search ADS PubMed  45. Song WJ, Schreiber WE, Zhong E, Liu FF, Kornfeld BD, Wondisford FE, Hussain MA. Exendin-4 stimulation of cyclin A2 in beta-cell proliferation. Diabetes . 2008; 57( 9): 2371– 2381. Google Scholar CrossRef Search ADS PubMed  46. Vousden KH, Lu X. Live or let die: the cell’s response to p53. Nat Rev Cancer . 2002; 2( 8): 594– 604. Google Scholar CrossRef Search ADS PubMed  47. Vousden KH, Lane DP. p53 in health and disease. Nat Rev Mol Cell Biol . 2007; 8( 4): 275– 283. Google Scholar CrossRef Search ADS PubMed  48. Hoshino A, Ariyoshi M, Okawa Y, Kaimoto S, Uchihashi M, Fukai K, Iwai-Kanai E, Ikeda K, Ueyama T, Ogata T, Matoba S. Inhibition of p53 preserves Parkin-mediated mitophagy and pancreatic β-cell function in diabetes. Proc Natl Acad Sci USA . 2014; 111( 8): 3116– 3121. Google Scholar CrossRef Search ADS PubMed  49. Hobson A, Draney C, Stratford A, Becker TC, Lu D, Arlotto M, Tessem JS. Aurora Kinase A is critical for the Nkx6.1 mediated β-cell proliferation pathway. Islets . 2015; 7( 1): e1027854. Google Scholar CrossRef Search ADS PubMed  50. Abbas T, Dutta A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer . 2009; 9( 6): 400– 414. Google Scholar CrossRef Search ADS PubMed  Copyright © 2018 Endocrine Society This article has been published under the terms of the Creative Commons Attribution Non-Commercial, No-Derivatives License (CC BY-NC-ND; https://creativecommons.org/licenses/by-nc-nd/4.0/). http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of the Endocrine Society Oxford University Press

Enhanced Expression of the Key Mitosis Regulator Cyclin B1 Is Mediated by PDZ-Binding Kinase in Islets of Pregnant Mice

Loading next page...
 
/lp/ou_press/enhanced-expression-of-the-key-mitosis-regulator-cyclin-b1-is-mediated-HgpsBjqxez
Publisher
Endocrine Society
Copyright
Copyright © 2018 Endocrine Society
eISSN
2472-1972
D.O.I.
10.1210/js.2017-00338
Publisher site
See Article on Publisher Site

Abstract

Abstract The proliferation of pancreatic β cells is enhanced to enable an increase in β-cell mass and to compensate for insulin resistance during pregnancy. To elucidate the mechanisms involved, we previously investigated islets from pregnant and nonpregnant mice by gene expression profiling and found that the expression of postsynaptic density-95/Discs large/zonula occludens-1 (PDZ)–binding kinase (Pbk), a member of the mitogen-activated protein kinase kinase family, is increased in pregnant mouse islets compared with control mouse islets. Among the pregnancy hormones, treatment with estradiol upregulated Pbk expression. Inhibition of Pbk expression using a small interfering RNA for Pbk reduced bromodeoxyuridine incorporation in mouse insulinoma 6 cells, which was accompanied by a decreased expression of Ccnb1, a regulatory gene involved in mitosis. Ccnb1 expression was augmented in mouse islets during pregnancy. The forced expression of Pbk using an adenovirus system in isolated mouse islets increased Ccnb1 expression, and the Pbk inhibitor HI-TOPK-032 suppressed Ccnb1 expression in islets isolated from pregnant mice. Our results suggest that Pbk contributes to the expansion of islets during pregnancy and that Ccnb1 may assist Pbk in its role in β-cell proliferation. Pregnancy results in hormonal changes, which in turn induce insulin resistance to shift nutrients from the mother to the fetus. Previous studies using rodents demonstrated that during pregnancy, β-cell mass is increased to enhance insulin secretion and to compensate for the insulin resistance [1, 2]. β cells express receptors that recognize pregnancy hormones, and this likely contributes to the changes in β-cell function and/or survival during pregnancy. Heterozygous prolactin receptor–deficient mice were unable to augment β-cell mass during pregnancy [3, 4]. Prolactin represses the expression of Menin, which is an endocrine tumor suppressor through the upregulation of cyclin-dependent kinase inhibitors, and enhances the expression of FoxM1, which plays a crucial role in islet expansion [5, 6]. Furthermore, prolactin elicits serotonin production by upregulating the expression of rate-limiting enzymes of serotonin synthesis, namely tryptophan hydroxylase 1 and 2 (Tph1 and Tph2, respectively) in mouse islets [7, 8], and the increased secretion of serotonin plays a key role in β-cell proliferation. Estrogen is also involved in the hormonal changes that alter β-cell function during pregnancy. The activation of estrogen signaling enhances glucose-stimulated insulin secretion through inhibition of the adenosine triphosphate–sensitive potassium channel and protects oxidative stress- and cytokine-induced β-cell apoptosis [9–11]. These studies suggest that pregnancy hormones play key roles in increasing β-cell mass, enhancing insulin secretion, and preserving β cells. Whereas several mechanisms underlying this phenomenon have been studied, the mechanisms underlying the changes that occur during pregnancy remain unclear. Postsynaptic density-95/Discs large/zonula occludens-1 (PDZ)–binding kinase (Pbk) is a member of the serine/threonine kinases and was originally identified as a mitogen-activated protein kinase kinase (MAPKK) by two independent groups [12, 13]. Pbk comprises 322 amino acids, of which 89% are conserved between human and mouse. Pbk is expressed in the placenta, testis, heart muscle, and pancreas and is weakly expressed in skeletal muscle, kidney, liver, and lung. Neural progenitor cells also express Pbk during the preneonatal and postneonatal period [14]. It is noteworthy that Pbk is abundantly expressed in malignant neoplasms, including Burkitt lymphoma and leukemia cells, as well as breast, lung, colon, and prostate cancers [12, 15–20]. Previous studies demonstrated that Pbk plays a role in tumor growth and metastasis. Therefore, an increase in Pbk expression could be a predictor of disease progression and poor prognosis [18, 21–23]. Pbk is phosphorylated by the cyclin-dependent kinase (Cdk) 1/cyclin B complex and induces cell proliferation through the activation of p38 mitogen-activated protein kinase (MAPK), Erk, and phosphoinositide 3-kinase (PI3K), or inactivation of p53 [12, 18, 24–26]. Interestingly, the inhibition of Pbk suppressed the growth of transplanted tumors in a mouse model of colon cancer, suggesting that Pbk plays key roles in the proliferation of many cell types [26–28]. In a previous study, we performed comprehensive gene expression analyses using islets isolated from nonpregnant and pregnant mice at gestational day (G)12.5 and found that the expression of Pbk is augmented in mouse islets during pregnancy [7]. Because Pbk is involved in the proliferation of many cell types, we hypothesized that Pbk plays a role in β-cell proliferation during pregnancy. Hence we aimed to elucidate the role of Pbk in β cells during pregnancy. 1. Material and Methods A. Antibodies and Reagents The polyclonal rabbit antibody against PDZ-binding kinase (PBK) was purchased from BD Biosciences [Research Resource Identifier (RRID): AB_399542; 12, 13]. Monoclonal mouse antibodies against p53 (RRID: AB_331743), p38 MAPK (RRID: AB_331298), phospho-p38 MAPK (RRID: AB_331296), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (RRID: AB_561053) were purchased from Cell Signaling. The polyclonal goat IgG against cyclin B1 (RRID: AB_1964555) was purchased from R&D Systems. The antibody against p21 was purchased from Proteintech (RRID: AB_11042450). The monoclonal mouse antibody against β-actin was purchased from Sigma-Aldrich (RRID: AB_476692). The Pbk inhibitor HI-TOPK-032 was purchased from Merck Millipore. B. Cell Culture MIN6 mouse insulinoma cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 15% [volume-to-volume ratio (v/v)] fetal calf serum, 10 mM HEPES, and 1% (v/v) penicillin and streptomycin (ThermoFisher Scientific) under 5% CO2 at 37°C. MIN6 cells were treated with or without 100 nM estradiol or 5 μM HI-TOPK-032 for the indicated times. C. RNA Interference Stealth small interfering RNAs (siRNAs) against Pbk (si-Pbk or si-Pbk2) or nontargeting sequences (si-scramble) were purchased from Life Technologies and transfected into MIN6 cells using Lipofectamine RNAiMAX Transfection Reagent (ThermoFisher Scientific) according to the manufacturer’s instructions. Seventy-two hours after transfection, cells were obtained for isolation of total RNA or total protein. Sequences of siRNAs used in this study were as follows: si-Pbk: 5′- GCUUUGGAACUAGAUGGCCAAUGUU -3′; si-Pbk2: 5′- CAGAAGAGACUAACUGAUGAAGCUA -3′; and si-scramble: 5′-UAAAUGUACUGCGCGUGGAGAGGAA-3′. D. Quantitative Reverse Transcription Polymerase Chain Reaction MIN6 cells (7 × 105) were seeded in 6-well plates and transfected with si-Pbk, si-Pbk2, or si-scramble. Seventy-two hours after transfection, total RNA was extracted from the cells by using RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions. Complementary DNA was synthesized by using SuperScript III Reverse transcription (ThermoFisher Scientific). Reaction mixtures for PCR were prepared by using FAST SYBR Green Master Mix (Life Technologies) according to the manufacturer’s instructions, and quantitative PCR was performed by using the 7500 Fast Real-Time PCR System (ThermoFisher Scientific). The condition for PCR was 40 cycles of 95°C for 3 seconds and 60°C for 30 seconds. Primer sequences for quantitative reverse transcription (qRT)–PCR are shown in the Supplemental Table. E. Immunoblot Assays MIN6 cells (1 × 106 cells) were seeded onto 10-cm dishes. After 2 days, the cells were washed twice with phosphate-buffered saline and then lysed by adding cell lysis buffer containing 140 mM of NaCl, 20 mM of Tris, 1 mM of EDTA, 50 mM of NaF, 2 mM of MgCl2, 1 mM of phenylmethylsulfonyl fluoride, 25 U/mL of Benzonase (Merck), and 1 × HaltTM Protease Phosphatase Inhibitor Cocktail (ThermoFisher Scientific). Approximately 20 μg of total protein was separated by using 4% to 15% Mini-PROTEAN TGX Precast Gels (Bio-Rad), transferred to polyvinylidene fluoride membranes and incubated with antibodies against PBK (1:1000), p53 (1:1000), cyclin B1 (1:1000), p38 MAPK (1:1000), phospho-p38 MAPK (1:1000), β-actin (1:5000), p21 (1:500), or GAPDH (1:5,000). Bound primary antibodies were detected with peroxidase-coupled secondary mouse, rabbit, or goat antibodies (RRID: AB_2340069, AB_2313567, AB_2340390), and IRDye®-conjugated secondary mouse or rabbit antibodies (LI-COR Biosciences; RRID: AB_621840, AB_621841). Immunoblots were visualized by using the Odyssey (LI-COR Biosciences) or SuperSignal West DURA system (Pierce) with ECL-PlusTM (Amersham Biosciences). F. Bromodeoxyuridine Incorporation Assay Twenty-four hours before transfection, 1 × 104 MIN6 cells were seeded in 96-well plates and then transfected with si-Pbk, si-Pbk2, or si-scramble. Seventy-two hours after transfection or 24 hours after treatment with 5 μM HI-TOPK-032, the proliferation of MIN6 cells was analyzed by using Cell Proliferation ELISA and Bromodeoxyuridine (BrdU; Roche Diagnostics). Briefly, MIN6 cells were incubated with 10 μM BrdU for 2 hours, and the integrated BrdU was detected by using a peroxidase-conjugated anti-BrdU monoclonal antibody. After the addition of tetramethyl-benzidine as a substrate, BrdU incorporation was measured by absorbance at a wavelength of 370 nm by using an xMarkTM microplate spectrophotometer (Bio-Rad). G. Mouse Experiments C57BL/6J mice were mated at 12 weeks old and euthanized at the indicated gestational ages. Mouse islets were isolated from pregnant mice and nonpregnant littermates according to a previous study [29] and were maintained in RPMI1640 supplemented with 10% (v/v) fetal calf serum and 1% (v/v) penicillin and streptomycin. Isolated mouse islets were treated with 100 nM estradiol, 44.2 mM prolactin, 10 IU/mL human chorionic gonadotropin or 10 μM progesterone, and then total RNA was isolated as previously described. Animal experiments were performed with the approval from the Ethics Review Committee for Animal Experimentation of Juntendo University. H. Statistical Analysis All data are presented as the mean ± standard error of the mean. Comparisons involving two groups were analyzed by the Student t test. One-way analysis of variance followed by the Tukey-Kramer test was used for comparisons among three or more groups. A P value < 0.05 was considered to indicate a statistically significant difference between two groups. 2. Results A. Pbk Expression is Augmented in Mouse Islets During Pregnancy We previously performed comprehensive gene expression analysis using isolated islets from nonpregnant and pregnant mice on G12.5 and identified that the rate-limiting enzymes for serotonin synthesis, namely Tph1 and Tph2, are upregulated and contribute to β-cell proliferation [7, 8, 30]. To identify other candidate genes regulating maternal β-cell growth and/or function, we focused on Pbk among the genes upregulated during pregnancy, owing to our above results [7]. To confirm the changes in Pbk expression during pregnancy, we isolated islets from nonpregnant and pregnant mice at G14.5 and quantitated Pbk expression by qRT-PCR. As shown in Fig. 1A, expression of Pbk and E2f1, which is a transcription factor that regulates Pbk expression [31], were increased during pregnancy. In addition, immunoblotting using an anti-Pbk antibody demonstrated an increasing tendency of Pbk protein expression in the islets from pregnant mice compared with those from nonpregnant mice (Fig. 1B). Figure 1. View largeDownload slide Pbk expression is increased in mouse islets during pregnancy. (A) Islets were isolated from nonpregnant and pregnant mice at G14.5 for qRT-PCR analysis. Expression levels of Pbk and E2f1 were normalized to Tbp expression levels. Results are shown as the means ± standard error of the mean; n ≥ 3. *Statistically significant difference (P < 0.05) compared with the islets isolated from nonpregnant mice. (B) Islets were isolated from nonpregnant and pregnant mice at G14.5 and subjected to immunoblot using PBK and β-actin antibodies. Upper panels show a representative immunoblot. Relative protein levels of Pbk were normalized to β-actin (n = 4). Figure 1. View largeDownload slide Pbk expression is increased in mouse islets during pregnancy. (A) Islets were isolated from nonpregnant and pregnant mice at G14.5 for qRT-PCR analysis. Expression levels of Pbk and E2f1 were normalized to Tbp expression levels. Results are shown as the means ± standard error of the mean; n ≥ 3. *Statistically significant difference (P < 0.05) compared with the islets isolated from nonpregnant mice. (B) Islets were isolated from nonpregnant and pregnant mice at G14.5 and subjected to immunoblot using PBK and β-actin antibodies. Upper panels show a representative immunoblot. Relative protein levels of Pbk were normalized to β-actin (n = 4). B. Estradiol Upregulates Pbk Expression in Mouse Islets Because pregnancy hormones contribute to the expansion of islets during pregnancy, it is likely that pregnancy hormones regulate Pbk expression. Thus, we incubated islets with various pregnancy hormones at concentrations equivalent to those present in pregnant mice in the second trimester, and we investigated the expression of various genes that are reported to be involved in the expansion of islets during pregnancy. Whereas we observed a robust increase in the expression of Tph1 by prolactin, as shown previously [7], the expression of Pbk was significantly upregulated by estradiol, but not by the other hormones (Fig. 2A). Although mouse islets treated with estradiol showed a tendency of increased E2f1 expression, there was no significant difference from E2f1 levels in islets treated with vehicle. On the other hand, in MIN 6 cells, the expression levels of Pbk and E2f1 were increased by estradiol (Fig. 2B). Thus, during pregnancy, estradiol may enhance Pbk expression in β cells via both E2f1-dependent and E2f1-independent mechanisms. Figure 2. View largeDownload slide Estradiol upregulates Pbk expression in isolated mouse islets and MIN6 cells. (A) Islets were isolated from 12-week-old female mice; treated with 100 nM estradiol, 10 μM progesterone, 44.2 mM prolactin, or 10 IU/mL human chorionic gonadotropin (Hcg) for 24 hours; and then subjected to qRT-PCR (n ≥ 4). *Statistically significant difference (P < 0.05) compared with islets treated with vehicle. (B) MIN6 cells were treated with or without 100 nM estradiol for 24 hours. Total RNA was isolated for qRT-PCR analysis (n ≥ 4). Expression levels of each gene were normalized to Tbp expression. *Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. Results are shown as the means ± standard error of the mean. Figure 2. View largeDownload slide Estradiol upregulates Pbk expression in isolated mouse islets and MIN6 cells. (A) Islets were isolated from 12-week-old female mice; treated with 100 nM estradiol, 10 μM progesterone, 44.2 mM prolactin, or 10 IU/mL human chorionic gonadotropin (Hcg) for 24 hours; and then subjected to qRT-PCR (n ≥ 4). *Statistically significant difference (P < 0.05) compared with islets treated with vehicle. (B) MIN6 cells were treated with or without 100 nM estradiol for 24 hours. Total RNA was isolated for qRT-PCR analysis (n ≥ 4). Expression levels of each gene were normalized to Tbp expression. *Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. Results are shown as the means ± standard error of the mean. C. Suppression of Pbk Expression Attenuates Cell Proliferation in MIN6 Cells To investigate the role of Pbk in β-cell growth, we suppressed Pbk expression in mouse insulinoma MIN6 cells using the RNA interference method and HI-TOPK-032, a pharmacological inhibitor of Pbk. As shown in Fig. 3A and 3B, treatment of MIN6 cells with an siRNA against Pbk (si-Pbk) that we designed effectively decreased Pbk messenger RNA (mRNA) levels and protein levels. Under this condition of decreased Pbk expression, we analyzed cell proliferation by BrdU incorporation and found that the proliferation rate of MIN6 cells was decreased by 37% (Fig. 3C). This decrease in proliferation was reproducible in MIN6 cells transfected with a different siRNA against Pbk (si-Pbk2) (Fig. 3D and 3E). In addition, treatment with HI-TOPK-032 also attenuated BrdU incorporation in MIN6 cells (Fig. 3F). Figure 3. View largeDownload slide Pbk knockdown reduces cell proliferation in mouse insulinoma MIN6 cells. (A) Seventy-two hours after transfection with si-Pbk or si-scramble, total RNA was isolated from MIN6 cells for analysis of Pbk expression. Expression levels of Pbk were normalized to Tbp expression (n ≥ 3). (B) After knockdown using si-Pbk or si-scramble, total protein was isolated from MIN6 cells and subjected to immunoblot for PBK and GAPDH. Upper panels show a representative immunoblot. Relative protein levels of Pbk were normalized to Gapdh (n ≥ 3). (C) Seventy-two hours after the transfection of MIN6 cells with si-Pbk or si-scramble, the BrdU incorporation assay was performed. (D) Seventy-two hours after transfection with si-Pbk2 or si-scramble, total protein was isolated from MIN6 cells and subjected to immunoblot for PBK and GAPDH. (E) After knockdown using si-Pbk2 or si-scramble, MIN6 cells were subjected to BrdU incorporation analysis. (F) Twenty-four hours after treatment with HI-TOPK-032 (5 μM) or vehicle, BrdU incorporation analysis was performed. Results are shown as the mean ± standard error of the mean. *Statistically significant difference (P < 0.05) compared with MIN6 cells treated with si-scramble. ‡Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. Figure 3. View largeDownload slide Pbk knockdown reduces cell proliferation in mouse insulinoma MIN6 cells. (A) Seventy-two hours after transfection with si-Pbk or si-scramble, total RNA was isolated from MIN6 cells for analysis of Pbk expression. Expression levels of Pbk were normalized to Tbp expression (n ≥ 3). (B) After knockdown using si-Pbk or si-scramble, total protein was isolated from MIN6 cells and subjected to immunoblot for PBK and GAPDH. Upper panels show a representative immunoblot. Relative protein levels of Pbk were normalized to Gapdh (n ≥ 3). (C) Seventy-two hours after the transfection of MIN6 cells with si-Pbk or si-scramble, the BrdU incorporation assay was performed. (D) Seventy-two hours after transfection with si-Pbk2 or si-scramble, total protein was isolated from MIN6 cells and subjected to immunoblot for PBK and GAPDH. (E) After knockdown using si-Pbk2 or si-scramble, MIN6 cells were subjected to BrdU incorporation analysis. (F) Twenty-four hours after treatment with HI-TOPK-032 (5 μM) or vehicle, BrdU incorporation analysis was performed. Results are shown as the mean ± standard error of the mean. *Statistically significant difference (P < 0.05) compared with MIN6 cells treated with si-scramble. ‡Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. D. Inhibition of Pbk Does Not Alter the Expression of p53-Target Genes in MIN6 Cells Pbk is a member of the MAPKK family, which phosphorylates p38 MAPK and contributes to cell growth in breast cancer Michigan Cancer Foundation 7 cells [32]. Although we performed immunoblotting using an antiphospho-p38 MAPK antibody, the phosphorylated form of p38 MAPK could not be detected in MIN6 cells at the steady state, as previously reported (data not shown) [33]. In the HT-1080 fibrosarcoma cell line, Pbk interacts with p53 and the ectopic expression of Pbk induces the destabilization of p53 [34]. In colon cancer cells, pharmacological inhibition of Pbk increased p53 protein levels and inhibited cell proliferation [26]. In contrast, knockdown of Pbk using short hairpin RNA increased p53 activity without affecting p53 protein levels, and upregulated the p53-target gene Cdkn1a, which encodes p21, in colorectal carcinoma HCT-166 cells [27]. To investigate the effect of Pbk on p53 expression, we performed immunoblotting for p53 in MIN6 cells treated with si-Pbk or HI-TOPK-032 and found that the expression of p53 was augmented by both methods of Pbk suppression (Fig. 4A and 4B). p53 contributes to cell cycle arrest and apoptosis through the transactivation of Cdkn1a, Pten, Bax, Fas, and Gadd45a [35–38]. Thus, we analyzed the expression of p53 target genes by qRT-PCR. However, Pbk suppression did not alter the expression of p53 target genes, such as Cdkn1a, Pten, Bax, Fas, and Gadd45a, nor p21 protein levels (Fig. 4C and data not shown). In addition, pregnancy did not change the expression of these genes in mouse islets (Fig. 4D). These results suggest that the role of Pbk on β-cell proliferation may be independent of the p53 target genes mentioned above. Figure 4. View largeDownload slide Expression levels of p53-target genes are not altered by Pbk knockdown in MIN6 cells. (A) Seventy-two hours after transfection of MIN6 cells with si-Pbk or si-scramble, total protein was isolated for immunoblot analysis. Upper panels show representative immunoblots of p53 and GAPDH. Relative protein levels of p53 were normalized to those of Gapdh (n ≥ 4). *Statistically significant difference (P < 0.05) compared with MIN6 cells transfected with si-scramble. (B) Six hours after treatment with HI-TOPK-032 (5 μM) or vehicle, total protein was isolated for immunoblot analysis using anit-p53 and GAPDH antibodies. ‡Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. (C) After knockdown using si-Pbk or si-scramble, total RNA was isolated from MIN6 cells to analyze the expression levels of p53-target genes, including Cdkn1a, Pten, Bax, Fas, and Gadd45a. Expression levels of each gene were normalized to those of Tbp. Results are shown as the means ± standard error of the mean; n ≥ 3. (D) Total RNA was isolated from islets of pregnant or nonpregnant mice to analyze the expression levels of p53-target genes (n ≥ 4). Figure 4. View largeDownload slide Expression levels of p53-target genes are not altered by Pbk knockdown in MIN6 cells. (A) Seventy-two hours after transfection of MIN6 cells with si-Pbk or si-scramble, total protein was isolated for immunoblot analysis. Upper panels show representative immunoblots of p53 and GAPDH. Relative protein levels of p53 were normalized to those of Gapdh (n ≥ 4). *Statistically significant difference (P < 0.05) compared with MIN6 cells transfected with si-scramble. (B) Six hours after treatment with HI-TOPK-032 (5 μM) or vehicle, total protein was isolated for immunoblot analysis using anit-p53 and GAPDH antibodies. ‡Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. (C) After knockdown using si-Pbk or si-scramble, total RNA was isolated from MIN6 cells to analyze the expression levels of p53-target genes, including Cdkn1a, Pten, Bax, Fas, and Gadd45a. Expression levels of each gene were normalized to those of Tbp. Results are shown as the means ± standard error of the mean; n ≥ 3. (D) Total RNA was isolated from islets of pregnant or nonpregnant mice to analyze the expression levels of p53-target genes (n ≥ 4). E. Pbk Regulates Ccnb1 Expression in Islets of Pregnant Mice Because the suppression of Pbk reduced cell proliferation in MIN6 cells and p53-targeted genes showed no change in Pbk suppression in MIN6 cells, we analyzed the expression of genes regulating the cell cycle to identify Pbk-target gene candidates. As shown in Fig. 5A, Pbk knockdown attenuated the expression of Ccna2, Ccnb1, Ccnb2, Ccnd2, Ccnd3, Cdk1, and Cdk4. To confirm these findings, we used HI-TOPK-032 and found that treatment with this inhibitor also attenuated the expression of these genes in MIN6 cells (Fig. 5B). In addition, we isolated mouse islets and enhanced their expression of mouse Pbk using an adenovirus vector system. Interestingly, among these genes, Ccnb1 was the only gene to be upregulated in response to the forced expression of Pbk (Fig. 5C). Similar to the changes in Ccnb1 mRNA, immunoblotting analysis showed that cyclin B1 was reduced in MIN6 cells by Pbk knockdown as well as treatment with HI-TOPK-032 (Fig. 5D and 5E). Previous data showed that p53 interrupts the cell cycle through the suppression of Ccnb1 [39]. To investigate whether a similar system is involved in the regulation of β-cell proliferation, we suppressed Pbk expression and then treated MIN6 cells with the p53 inhibitor Pifithrin-α. However, inhibition of p53 did not reverse the reduction in Ccnb1 expression (data not shown). Figure 5. View largeDownload slide Pbk knockdown attenuates Ccnb1 expression in MIN6 cells. (A) Expression levels of genes regulating the cell cycle were analyzed by qRT-PCR in MIN6 cells transfected with si-Pbk or si-scramble. *Statistically significant difference (P < 0.05) compared with MIN6 cells transfected with si-scramble. (B) Six hours after treatment with HI-TOPK-032 (5 μM) or vehicle, total RNA was isolated from MIN6 cells for qRT-PCR analysis (n ≥ 3). ‡Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. (C) Isolated mouse islets were incubated with adenoviruses expressing Pbk or GFP and then subjected to qRT-PCR analysis (n = 3). Expression levels of each gene were normalized to those of Tbp. Results are shown as the mean ± standard error of the mean. §Statistically significant difference (P < 0.05) compared with islets treated with green fluorescent protein–expressing adenoviruses. (D) MIN6 cells were transfected with si-Pbk or si-scramble, followed by immunoblotting for PBK and GAPDH. Upper panels show representative immunoblots. The lower panel shows relative protein levels of Pbk, which were normalized to those of Gapdh (n ≥ 3). *Statistically significant difference (P < 0.05) compared with MIN6 cells transfected with si-scramble. (E) Six hours after treatment with HI-TOPK-032 or vehicle, total protein was isolated from MIN6 cells for immunoblot analysis. ‡Statistically significant difference (P < 0.05) compared with vehicle-treated cells. Results are shown as the mean ± standard error of the mean; n ≥ 3. Figure 5. View largeDownload slide Pbk knockdown attenuates Ccnb1 expression in MIN6 cells. (A) Expression levels of genes regulating the cell cycle were analyzed by qRT-PCR in MIN6 cells transfected with si-Pbk or si-scramble. *Statistically significant difference (P < 0.05) compared with MIN6 cells transfected with si-scramble. (B) Six hours after treatment with HI-TOPK-032 (5 μM) or vehicle, total RNA was isolated from MIN6 cells for qRT-PCR analysis (n ≥ 3). ‡Statistically significant difference (P < 0.05) compared with MIN6 cells treated with vehicle. (C) Isolated mouse islets were incubated with adenoviruses expressing Pbk or GFP and then subjected to qRT-PCR analysis (n = 3). Expression levels of each gene were normalized to those of Tbp. Results are shown as the mean ± standard error of the mean. §Statistically significant difference (P < 0.05) compared with islets treated with green fluorescent protein–expressing adenoviruses. (D) MIN6 cells were transfected with si-Pbk or si-scramble, followed by immunoblotting for PBK and GAPDH. Upper panels show representative immunoblots. The lower panel shows relative protein levels of Pbk, which were normalized to those of Gapdh (n ≥ 3). *Statistically significant difference (P < 0.05) compared with MIN6 cells transfected with si-scramble. (E) Six hours after treatment with HI-TOPK-032 or vehicle, total protein was isolated from MIN6 cells for immunoblot analysis. ‡Statistically significant difference (P < 0.05) compared with vehicle-treated cells. Results are shown as the mean ± standard error of the mean; n ≥ 3. Finally, we investigated the expression of these genes in islets isolated from pregnant mice. As shown in Fig. 6, Ccna2 and Ccnb1 levels were increased in the islets of pregnant mice, and treatment with HI-TOPK-032 attenuated Ccnb1 expression. Figure 6. View largeDownload slide Attenuation of Ccnb1 expression by a Pbk inhibitor in isolated islets of pregnant mice. Isolated mouse islets were incubated with 5 μM HI-TOPK-032 or vehicle for 24 hours and then subjected to qRT-PCR analysis. Expression levels of each gene were normalized to Tbp expression (n ≥ 4). *Statistically significant difference (P < 0.05) compared with islets of nonpregnant mice. §Statistically significant difference (P < 0.05) compared with islets of pregnant mice treated with vehicle. Figure 6. View largeDownload slide Attenuation of Ccnb1 expression by a Pbk inhibitor in isolated islets of pregnant mice. Isolated mouse islets were incubated with 5 μM HI-TOPK-032 or vehicle for 24 hours and then subjected to qRT-PCR analysis. Expression levels of each gene were normalized to Tbp expression (n ≥ 4). *Statistically significant difference (P < 0.05) compared with islets of nonpregnant mice. §Statistically significant difference (P < 0.05) compared with islets of pregnant mice treated with vehicle. 3. Discussion Pbk is expressed in proliferative fetal tissues, and its expression is observed in limited types of adult tissues [15]. Interestingly, we found that the expression of Pbk is augmented in islets during pregnancy. As Pbk contributes to tumor cell growth, we hypothesized that Pbk is involved in the expansion of β-cell mass in pregnancy. In this study, we found that estradiol enhanced the expression of Pbk. In addition, the forced expression of Pbk enhanced the expression of Ccnb1 in islets, and the augmented expression of Ccnb1 in islets from pregnant mice was suppressed by the inhibition of Pbk. Although we could not directly investigate the effect of Pbk on the cell proliferation of pregnant islets, the suppression of Pbk attenuated BrdU incorporation in MIN6 cells, indicating that Pbk is involved in the regulation of β-cell proliferation. Furthermore, Pbk knockdown reduced the mRNA expression levels of several cell-cycle genes, including Ccnb1. To identify the upstream signal of Pbk expression, we treated isolated mouse islets with several pregnancy hormones and identified that estradiol upregulates Pbk expression. The role of the estrogen signal on β cells is controversial. Whereas Le May et al. [40] showed that treatment with estradiol inhibited β-cell apoptosis without affecting β-cell proliferation in a streptozotocin-induced diabetic mouse model, replacement therapy for estradiol was reported to contribute to β-cell proliferation in a mouse model of ovariectomy with subtotal pancreatectomy [41]. In addition, treatment with a selective estrogen receptor β agonist increased the number of BrdU-positive cells in mouse islets [42]. Given that in pregnancy, estrogen induces β-cell proliferation by cooperating with other humoral factors, our results suggest that Pbk is involved in the estrogen signaling pathway. Although the necessity of Ccnb1 for β-cell proliferation has not yet been elucidated, previous studies showed that the expression of cyclin B1 is associated with β-cell proliferation. Ackermann et al. [43] demonstrated that the expression of Ccnb1 was increased during the expansion of mouse islets in a mouse partial pancreatectomy model. In addition, the enhanced expression of cyclin B1 is also observed with the overexpression of the oncoprotein MafB in cultured βTC3 cells [44]. Thus, the enhanced expression of Ccnb1 by Pbk during pregnancy may play a role in the expansion of β-cells mass. Further analyses to investigate the role of Ccnb1 on β-cell proliferation are required in the future. As previously shown, we found that Ccna2 expression is increased in mouse islets during pregnancy [7]. Ccna2 overexpression was reported to enhance β-cell proliferation [45], and thus Ccna2 is a possible candidate downstream target of Pbk that mediates β-cell proliferation [45]. Pbk knockdown attenuated the expression of Ccna2 in MIN6 cells and the pharmacological inhibition of Pbk also demonstrated a decreasing tendency of Ccna2 expression in isolated islets from pregnant mice. However, the forced expression of Pbk was unable to upregulate Ccna2 in mouse islets. This phenomenon can be explained if Pbk is able to enhance Ccna2 expression, by cooperating with other essential factors that are upregulated in pregnancy. Thus, it is possible that Ccna2 is the main mediator of Pbk function in pregnant islets. p53 is a tumor suppressor that plays important roles in cell cycle arrest and apoptosis, and its fundamental functions are well established in cancer research [46, 47]. Pbk directly binds p53 and inhibits the functions of p53. Previous studies demonstrated that the inhibition of p53 increased the expression of Cdkn1a, the gene encoding p21, which inhibits the activity of cyclin/Cdk complexes. p53 also contributes to mitochondrial function and proliferation in β cells [48, 49]. Whereas knockdown of Pbk increased p53 protein levels in MIN6 cells, Cdkn1a expression levels were not altered. The expression of Cdkn1a may be regulated independently of p53 in β cells [50]. We evaluated the expression of other p53-target genes regulating cell proliferation or apoptosis. However, the suppression of Pbk did not alter the expression of those genes. Because p53 plays an important role in tumor growth and controls the transcription of many genes, it is possible that p53 might contribute to the effects of Pbk other than on the cell cycle in β cells. 4. Conclusion Here, we propose a role of Pbk in the expansion of islets in pregnant mice. During pregnancy, an increased estrogen level upregulates the expression of Pbk. This enhanced expression of Pbk increases Ccnb1 and possibly Ccna2. The enhanced expression of Ccnb1 and Ccna2 may induce β-cell proliferation. Although direct evidence that Pbk and Ccnb1 are involved in the expansion of β-cell mass in pregnancy is lacking, here we showed evidence to support such a role. Abbreviations: Abbreviations: BrdU bromodeoxyuridine Cdk cyclin-dependent kinase Cdkn cyclin-dependent kinase inhibitor GAPDH glyceraldehyde 3-phosphate dehydrogenase MAPK mitogen-activated protein kinase MAPKK mitogen-activated protein kinase kinase MIN6 mouse insulinoma 6 mRNA messenger RNA Pbk postsynaptic density-95/Discs large/zona occludens-1–binding kinase PCR polymerase chain reaction PDZ postsynaptic density-95/Discs large/zonula occludens-1 PI3K phosphoinositide 3-kinase qRT-PCR qualitative reverse transcription polymerase chain reaction RRID Research Resource Identifier siRNA small interfering RNA Tph1 tryptophan hydroxylase 1 Tph2 tryptophan hydroxylase 2 v/v volume-to-volume ratio. Acknowledgments We acknowledge Ms. Naoko Daimaru, Ms. Hiroko Hibino, and Ms. Eriko Magoshi for assistance with the experiments. Financial Support: AstraZeneca Schweiz (T.O.), Eli Lilly and Company (T.O.), Mitsubishi Tanabe Pharma (T.O.), and Sanofi-Aventi (T.O.). Author Contributions: T.O. and H.W. designed the research; T.U., A.H., and H.I. conducted the research; T.O., H.W., T.M., Y.F., and S.T. analyzed the data; T.O., T.U., and H.W. wrote the manuscript; H.W. holds primary responsibility for the final content of the manuscript. All authors read and approved the final manuscript. Disclosure Summary: T.O. has received research funding from AstraZeneca, Eli Lilly and Company, Sanofi-Aventis, and Mitsubishi Tanabe Pharma. The remaining authors have nothing to disclose. References and Notes 1. Buchanan TA, Xiang AH. Gestational diabetes mellitus. J Clin Invest . 2005; 115( 3): 485– 491. Google Scholar CrossRef Search ADS PubMed  2. Rieck S, Kaestner KH. Expansion of beta-cell mass in response to pregnancy. Trends Endocrinol Metab . 2010; 21( 3): 151– 158. Google Scholar CrossRef Search ADS PubMed  3. Huang C, Snider F, Cross JC. Prolactin receptor is required for normal glucose homeostasis and modulation of beta-cell mass during pregnancy. Endocrinology . 2009; 150( 4): 1618– 1626. Google Scholar CrossRef Search ADS PubMed  4. Hughes E, Huang C. Participation of Akt, menin, and p21 in pregnancy-induced beta-cell proliferation. Endocrinology . 2011; 152( 3): 847– 855. Google Scholar CrossRef Search ADS PubMed  5. Karnik SK, Chen H, McLean GW, Heit JJ, Gu X, Zhang AY, Fontaine M, Yen MH, Kim SK. Menin controls growth of pancreatic beta-cells in pregnant mice and promotes gestational diabetes mellitus. Science . 2007; 318( 5851): 806– 809. Google Scholar CrossRef Search ADS PubMed  6. Banerjee RR, Cyphert HA, Walker EM, Chakravarthy H, Peiris H, Gu X, Liu Y, Conrad E, Goodrich L, Stein RW, Kim SK. Gestational diabetes mellitus from inactivation of prolactin receptor and MafB in islet β-cells. Diabetes . 2016; 65( 8): 2331– 2341. Google Scholar CrossRef Search ADS PubMed  7. Kim H, Toyofuku Y, Lynn FC, Chak E, Uchida T, Mizukami H, Fujitani Y, Kawamori R, Miyatsuka T, Kosaka Y, Yang K, Honig G, van der Hart M, Kishimoto N, Wang J, Yagihashi S, Tecott LH, Watada H, German MS. Serotonin regulates pancreatic beta cell mass during pregnancy. Nat Med . 2010; 16( 7): 804– 808. Google Scholar CrossRef Search ADS PubMed  8. Iida H, Ogihara T, Min MK, Hara A, Kim YG, Fujimaki K, Tamaki M, Fujitani Y, Kim H, Watada H. Expression mechanism of tryptophan hydroxylase 1 in mouse islets during pregnancy. J Mol Endocrinol . 2015; 55( 1): 41– 53. Google Scholar PubMed  9. Soriano S, Ropero AB, Alonso-Magdalena P, Ripoll C, Quesada I, Gassner B, Kuhn M, Gustafsson JA, Nadal A. Rapid regulation of K(ATP) channel activity by 17beta-estradiol in pancreatic beta-cells involves the estrogen receptor beta and the atrial natriuretic peptide receptor. Mol Endocrinol . 2009; 23( 12): 1973– 1982. Google Scholar CrossRef Search ADS PubMed  10. Liu S, Le May C, Wong WP, Ward RD, Clegg DJ, Marcelli M, Korach KS, Mauvais-Jarvis F. Importance of extranuclear estrogen receptor-alpha and membrane G protein-coupled estrogen receptor in pancreatic islet survival. Diabetes . 2009; 58( 10): 2292– 2302. Google Scholar CrossRef Search ADS PubMed  11. Kumar R, Balhuizen A, Amisten S, Lundquist I, Salehi A. Insulinotropic and antidiabetic effects of 17β-estradiol and the GPR30 agonist G-1 on human pancreatic islets. Endocrinology . 2011; 152( 7): 2568– 2579. Google Scholar CrossRef Search ADS PubMed  12. Abe Y, Matsumoto S, Kito K, Ueda N. Cloning and expression of a novel MAPKK-like protein kinase, lymphokine-activated killer T-cell-originated protein kinase, specifically expressed in the testis and activated lymphoid cells. J Biol Chem . 2000; 275( 28): 21525– 21531. Google Scholar CrossRef Search ADS PubMed  13. Gaudet S, Branton D, Lue RA. Characterization of PDZ-binding kinase, a mitotic kinase. Proc Natl Acad Sci USA . 2000; 97( 10): 5167– 5172. Google Scholar CrossRef Search ADS PubMed  14. Dougherty JD, Garcia AD, Nakano I, Livingstone M, Norris B, Polakiewicz R, Wexler EM, Sofroniew MV, Kornblum HI, Geschwind DH. PBK/TOPK, a proliferating neural progenitor-specific mitogen-activated protein kinase kinase. J Neurosci . 2005; 25( 46): 10773– 10785. Google Scholar CrossRef Search ADS PubMed  15. Simons-Evelyn M, Bailey-Dell K, Toretsky JA, Ross DD, Fenton R, Kalvakolanu D, Rapoport AP. PBK/TOPK is a novel mitotic kinase which is upregulated in Burkitt’s lymphoma and other highly proliferative malignant cells. Blood Cells Mol Dis . 2001; 27( 5): 825– 829. Google Scholar CrossRef Search ADS PubMed  16. Nandi A, Tidwell M, Karp J, Rapoport AP. Protein expression of PDZ-binding kinase is up-regulated in hematologic malignancies and strongly down-regulated during terminal differentiation of HL-60 leukemic cells. Blood Cells Mol Dis . 2004; 32( 1): 240– 245. Google Scholar CrossRef Search ADS PubMed  17. Park JH, Lin ML, Nishidate T, Nakamura Y, Katagiri T. PDZ-binding kinase/T-LAK cell-originated protein kinase, a putative cancer/testis antigen with an oncogenic activity in breast cancer. Cancer Res . 2006; 66( 18): 9186– 9195. Google Scholar CrossRef Search ADS PubMed  18. Shih MC, Chen JY, Wu YC, Jan YH, Yang BM, Lu PJ, Cheng HC, Huang MS, Yang CJ, Hsiao M, Lai JM. TOPK/PBK promotes cell migration via modulation of the PI3K/PTEN/AKT pathway and is associated with poor prognosis in lung cancer. Oncogene . 2012; 31( 19): 2389– 2400. Google Scholar CrossRef Search ADS PubMed  19. Zhu F, Zykova TA, Kang BS, Wang Z, Ebeling MC, Abe Y, Ma WY, Bode AM, Dong Z. Bidirectional signals transduced by TOPK-ERK interaction increase tumorigenesis of HCT116 colorectal cancer cells. Gastroenterology . 2007; 133( 1): 219– 231. Google Scholar CrossRef Search ADS PubMed  20. Sun H, Zhang L, Shi C, Hu P, Yan W, Wang Z, Duan Q, Lu F, Qin L, Lu T, Xiao J, Wang Y, Zhu F, Shao C. TOPK is highly expressed in circulating tumor cells, enabling metastasis of prostate cancer. Oncotarget . 2015; 6( 14): 12392– 12404. Google Scholar CrossRef Search ADS PubMed  21. Brown-Clay JD, Shenoy DN, Timofeeva O, Kallakury BV, Nandi AK, Banerjee PP. PBK/TOPK enhances aggressive phenotype in prostate cancer via β-catenin-TCF/LEF-mediated matrix metalloproteinases production and invasion. Oncotarget . 2015; 6( 17): 15594– 15609. Google Scholar CrossRef Search ADS PubMed  22. Kwon CH, Park HJ, Choi YR, Kim A, Kim HW, Choi JH, Hwang CS, Lee SJ, Choi CI, Jeon TY, Kim DH, Kim GH, Park Y. PSMB8 and PBK as potential gastric cancer subtype-specific biomarkers associated with prognosis. Oncotarget . 2016; 7( 16): 21454– 21468. Google Scholar CrossRef Search ADS PubMed  23. Wang MY, Lin ZR, Cao Y, Zheng LS, Peng LX, Sun R, Meng DF, Xie P, Yang JP, Cao L, Xu L, Huang BJ, Qian CN. PDZ binding kinase (PBK) is a theranostic target for nasopharyngeal carcinoma: driving tumor growth via ROS signaling and correlating with patient survival. Oncotarget . 2016; 7( 18): 26604– 26616. Google Scholar PubMed  24. Matsumoto S, Abe Y, Fujibuchi T, Takeuchi T, Kito K, Ueda N, Shigemoto K, Gyo K. Characterization of a MAPKK-like protein kinase TOPK. Biochem Biophys Res Commun . 2004; 325( 3): 997– 1004. Google Scholar CrossRef Search ADS PubMed  25. Fujibuchi T, Abe Y, Takeuchi T, Ueda N, Shigemoto K, Yamamoto H, Kito K. Expression and phosphorylation of TOPK during spermatogenesis. Dev Growth Differ . 2005; 47( 9): 637– 644. Google Scholar CrossRef Search ADS PubMed  26. Kim DJ, Li Y, Reddy K, Lee MH, Kim MO, Cho YY, Lee SY, Kim JE, Bode AM, Dong Z. Novel TOPK inhibitor HI-TOPK-032 effectively suppresses colon cancer growth. Cancer Res . 2012; 72( 12): 3060– 3068. Google Scholar CrossRef Search ADS PubMed  27. Hu F, Gartenhaus RB, Eichberg D, Liu Z, Fang HB, Rapoport AP. PBK/TOPK interacts with the DBD domain of tumor suppressor p53 and modulates expression of transcriptional targets including p21. Oncogene . 2010; 29( 40): 5464– 5474. Google Scholar CrossRef Search ADS PubMed  28. Joel M, Mughal AA, Grieg Z, Murrell W, Palmero S, Mikkelsen B, Fjerdingstad HB, Sandberg CJ, Behnan J, Glover JC, Langmoen IA, Stangeland B. Targeting PBK/TOPK decreases growth and survival of glioma initiating cells in vitro and attenuates tumor growth in vivo. Mol Cancer . 2015; 14( 1): 121. Google Scholar CrossRef Search ADS PubMed  29. Iwashita N, Uchida T, Choi JB, Azuma K, Ogihara T, Ferrara N, Gerber H, Kawamori R, Inoue M, Watada H. Impaired insulin secretion in vivo but enhanced insulin secretion from isolated islets in pancreatic beta cell-specific vascular endothelial growth factor-A knock-out mice. Diabetologia . 2007; 50( 2): 380– 389. Google Scholar CrossRef Search ADS PubMed  30. Schraenen A, Lemaire K, de Faudeur G, Hendrickx N, Granvik M, Van Lommel L, Mallet J, Vodjdani G, Gilon P, Binart N, in’t Veld P, Schuit F. Placental lactogens induce serotonin biosynthesis in a subset of mouse beta cells during pregnancy. Diabetologia . 2010; 53( 12): 2589– 2599. Google Scholar CrossRef Search ADS PubMed  31. Hu F, Gartenhaus RB, Zhao XF, Fang HB, Minkove S, Poss DE, Rapoport AP. c-Myc and E2F1 drive PBK/TOPK expression in high-grade malignant lymphomas. Leuk Res . 2013; 37( 4): 447– 454. Google Scholar CrossRef Search ADS PubMed  32. Ayllón V, O’connor R. PBK/TOPK promotes tumour cell proliferation through p38 MAPK activity and regulation of the DNA damage response. Oncogene . 2007; 26( 24): 3451– 3461. Google Scholar CrossRef Search ADS PubMed  33. Lee JS, Kim YR, Song IG, Ha SJ, Kim YE, Baek NI, Hong EK. Cyanidin-3-glucoside isolated from mulberry fruit protects pancreatic β-cells against oxidative stress-induced apoptosis. Int J Mol Med . 2015; 35( 2): 405– 412. Google Scholar CrossRef Search ADS PubMed  34. Nandi AK, Ford T, Fleksher D, Neuman B, Rapoport AP. Attenuation of DNA damage checkpoint by PBK, a novel mitotic kinase, involves protein-protein interaction with tumor suppressor p53. Biochem Biophys Res Commun . 2007; 358( 1): 181– 188. Google Scholar CrossRef Search ADS PubMed  35. Stambolic V, MacPherson D, Sas D, Lin Y, Snow B, Jang Y, Benchimol S, Mak TW. Regulation of PTEN transcription by p53. Mol Cell . 2001; 8( 2): 317– 325. Google Scholar CrossRef Search ADS PubMed  36. Miyashita T, Reed JC. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell . 1995; 80( 2): 293– 299. Google Scholar CrossRef Search ADS PubMed  37. Owen-Schaub LB, Zhang W, Cusack JC, Angelo LS, Santee SM, Fujiwara T, Roth JA, Deisseroth AB, Zhang WW, Kruzel E, et al.  . Wild-type human p53 and a temperature-sensitive mutant induce Fas/APO-1 expression. Mol Cell Biol . 1995; 15( 6): 3032– 3040. Google Scholar CrossRef Search ADS PubMed  38. Kastan MB, Zhan Q, el-Deiry WS, Carrier F, Jacks T, Walsh WV, Plunkett BS, Vogelstein B, Fornace AJ Jr. A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell . 1992; 71( 4): 587– 597. Google Scholar CrossRef Search ADS PubMed  39. Innocente SA, Abrahamson JL, Cogswell JP, Lee JM. p53 regulates a G2 checkpoint through cyclin B1. Proc Natl Acad Sci USA . 1999; 96( 5): 2147– 2152. Google Scholar CrossRef Search ADS PubMed  40. Le May C, Chu K, Hu M, Ortega CS, Simpson ER, Korach KS, Tsai MJ, Mauvais-Jarvis F. Estrogens protect pancreatic beta-cells from apoptosis and prevent insulin-deficient diabetes mellitus in mice. Proc Natl Acad Sci USA . 2006; 103( 24): 9232– 9237. Google Scholar CrossRef Search ADS PubMed  41. Choi SB, Jang JS, Park S. Estrogen and exercise may enhance beta-cell function and mass via insulin receptor substrate 2 induction in ovariectomized diabetic rats. Endocrinology . 2005; 146( 11): 4786– 4794. Google Scholar CrossRef Search ADS PubMed  42. Alonso-Magdalena P, Ropero AB, García-Arévalo M, Soriano S, Quesada I, Muhammed SJ, Salehi A, Gustafsson JA, Nadal A. Antidiabetic actions of an estrogen receptor β selective agonist. Diabetes . 2013; 62( 6): 2015– 2025. Google Scholar CrossRef Search ADS PubMed  43. Ackermann Misfeldt A, Costa RH, Gannon M. Beta-cell proliferation, but not neogenesis, following 60% partial pancreatectomy is impaired in the absence of FoxM1. Diabetes . 2008; 57( 11): 3069– 3077. Google Scholar CrossRef Search ADS PubMed  44. Lu J, Hamze Z, Bonnavion R, Herath N, Pouponnot C, Assade F, Fontanière S, Bertolino P, Cordier-Bussat M, Zhang CX. Reexpression of oncoprotein MafB in proliferative β-cells and Men1 insulinomas in mouse. Oncogene . 2012; 31( 31): 3647– 3654. Google Scholar CrossRef Search ADS PubMed  45. Song WJ, Schreiber WE, Zhong E, Liu FF, Kornfeld BD, Wondisford FE, Hussain MA. Exendin-4 stimulation of cyclin A2 in beta-cell proliferation. Diabetes . 2008; 57( 9): 2371– 2381. Google Scholar CrossRef Search ADS PubMed  46. Vousden KH, Lu X. Live or let die: the cell’s response to p53. Nat Rev Cancer . 2002; 2( 8): 594– 604. Google Scholar CrossRef Search ADS PubMed  47. Vousden KH, Lane DP. p53 in health and disease. Nat Rev Mol Cell Biol . 2007; 8( 4): 275– 283. Google Scholar CrossRef Search ADS PubMed  48. Hoshino A, Ariyoshi M, Okawa Y, Kaimoto S, Uchihashi M, Fukai K, Iwai-Kanai E, Ikeda K, Ueyama T, Ogata T, Matoba S. Inhibition of p53 preserves Parkin-mediated mitophagy and pancreatic β-cell function in diabetes. Proc Natl Acad Sci USA . 2014; 111( 8): 3116– 3121. Google Scholar CrossRef Search ADS PubMed  49. Hobson A, Draney C, Stratford A, Becker TC, Lu D, Arlotto M, Tessem JS. Aurora Kinase A is critical for the Nkx6.1 mediated β-cell proliferation pathway. Islets . 2015; 7( 1): e1027854. Google Scholar CrossRef Search ADS PubMed  50. Abbas T, Dutta A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer . 2009; 9( 6): 400– 414. Google Scholar CrossRef Search ADS PubMed  Copyright © 2018 Endocrine Society This article has been published under the terms of the Creative Commons Attribution Non-Commercial, No-Derivatives License (CC BY-NC-ND; https://creativecommons.org/licenses/by-nc-nd/4.0/).

Journal

Journal of the Endocrine SocietyOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off