Effects of rearing systems on reproductive hormones secretion and their receptors gene expression in Xianju chickens under summer conditions

Effects of rearing systems on reproductive hormones secretion and their receptors gene expression... ABSTRACT Previous study in our lab showed that indigenous Xianju chickens from free-range system (FRS) under summer conditions had lower egg production than those from conventional cage rearing system (CRS). The objective of this study was to preliminarily determine the FRS-dependent mechanism of depressing laying performance according to determining the effect of rearing systems on reproductive hormones secretion and their receptors mRNA expression in Xianju chickens reared under summer conditions. A total of 360 indigenous Xianju chickens were randomly allocated to CRS and FRS groups, each of which included 5 replicates of 36 hens. The experiment lasted between 21 and 29 wk of age. We found that the ovarian weight, numbers of small yellow follicles, and large white follicles in the FRS group were lower than those in the CRS group (P < 0.05). Changing from CRS to FRS increased serum concentrations of prolactin and decreased serum-luteinizing hormone and progesterone levels (P < 0.05). Gene expressions in the preovulatory follicles from FRS hens were upregulated for prolactin receptor and downregulated for luteinizing hormone receptor and progesterone receptor, compared to those from CRS hens (P < 0.05). It can be concluded that changing from CRS to FRS in the current experimental conditions depressed egg production traits in Xianju chickens by inducing a synergistic activity of reproductive hormones and the gene expressions of their receptors. INTRODUCTION Alternative rearing systems such as enriched cage, organic system, and free-range system (FRS) have been shown to have a significant effect on production traits in laying hens (Tauson et al., 1999; Mugnai et al., 2009; Neijat et al., 2011; Ahammed et al., 2014). The general trend in layer strains showed that egg production was higher in conventional cage systems than in alternative rearing systems (Yakubu et al., 2007; Mugnai et al., 2009; Anderson, 2010). However, Küçükyılmaz et al. (2012) found that White Lohmann LSL layers produced more eggs in the cage system than in the organic system, while brown ATAK-S laying hens showed lower laying performance in the cage system than in the organic system, indicating that some genotypes will show better performance under conventional cage systems, whereas some genotypes will respond positively when allowed fresh air and freedom of movement. Furthermore, compared to the conventional cage systems, the egg yield from alternative rearing systems was more affected by seasonal conditions (temperature and photoperiod) as described by Mugnai et al. (2009). Thus, studies on the effect of alternative rearing systems on production traits are continuing, especially in relation to the ability of native pure breeds to adapt to these alternate systems under certain climates. Xianju chicken, originated from humid subtropical areas in Zhejiang provinces, is considered to be one of the most famous indigenous layer breeds in China due to its high egg production (180 to 200/yr) and adaptability (Tang et al., 2009). A recently study in our lab showed that Xianju chickens from FRS under summer conditions had lower egg production than those from conventional cage system (Dong et al., 2017). The debilitating effect on egg production is well recognized, but the mechanism involved is not clearly understood. Egg production is under the control of hormonal status of hen (Pirsaraei et al., 2008). It has been shown that changes of reproductive hormones such as follicle stimulating hormone (FSH), luteinizing hormone (LH), progesterone (P4), and prolactin (PRL) may induce different performance traits in layers (Onagbesan et al., 2006; Li et al., 2011). We hypothesized that the regulatory mechanisms for the reduced egg production in the hens from FRS under summer conditions might be modulated at the level of the reproductive hormone secretion. Hence, the present study was planned to investigate the effects of alternative rearing systems on reproductive hormones response in indigenous Xianju chickens under summer conditions. MATERIAL AND METHODS The experiment was conducted in accordance with the Chinese guidelines for animal welfare and was approved by the animal welfare committee of the Animal Science College, Zhejiang University. Birds, Feeding, and Rearing Systems A total of 360 indigenous Xianju chickens, at the start of laying (21 wk of age), were randomly allocated to 2 treatment groups, each of which included 5 replicates of 36 hens. The conventional cage rearing system (CRS) and FRS were located on the same field in Jinshanjiao layer farm (Taishun within Zhejiang province, China). We conducted a 9-wk trial (with a 1-wk acclimation period) to make sure that the chickens were reared under summer conditions (from June to August) throughout the study period. For CRS, hens were reared with the 4-tiered rearing cages fitted with linear feeders and nipple drinkers (2 nipple drinkers per cage). Each replication consisted of 12 adjacent cages. Hens were kept in cages (47 cm length, 37 cm width, and 50 cm height) with 3 hens per cage providing approximately 579 cm2 floor space per bird, and housed in a windowed layer house with a controlled ventilation regime and a wet curtain cooling system. The FRS had an indoor and paddock area. The indoor area was an open-sided naturally ventilated layer house and its floor was covered with wood shavings. A total 6 hens per m2 was provided in the FRS indoor area. The paddock area was located in front of the open-sided house, covered with alfalfa and trifolium mixture, providing stocking density of 0.25 birds/m2. Inside the paddocks area, there was a small hut with nests (6 hens per nest) and perches (18 cm of area per hen). Replication in FRS was done with the help of fish-net. The paddock area was enclosed by wire fences to keep out predators. The circular feeders and plastic drinkers were used in the indoor and paddock areas. Natural light, supplemented with artificial light to achieve 16L:8D was used in all of the systems. Hens in all rearing systems were fed the same complete diet based on corn and soybean meal with 17% CP and 2750 kcal/kg ME. Feed and drinking water were offered ad libitum to all hens. The mean daily temperature was 31°C (range 26 to 35°C) and ambient RH was 75% (range 60 to 90%) in the FRS throughout the study period. The mean daily temperature and RH inside the barn from CRS was 27°C (range 24 to 30°C) and 80% (range 70 to 90%), respectively. The mean mortalities in CRS and FRS were 0.00 and 2.22%, respectively. Blood sampling and analysis At the end of wk 29, 12 h after feed withdrawal, 2 birds were randomly selected from each replicate and blood samples were collected from the axillary vein. Serum was isolated by centrifugation of blood at 3000× g for 10 min, and was stored in 1.5-mL Eppendorf tubes at −70°C until analyses. Serum FSH, P4, LH, and PRL levels were analyzed using RIA kits (Hengyuan Biological Technology Co., Ltd, Shanghai, China) by radio immunoassay, according to the recommendations of the manufacturer. For measurement of FSH concentration, the assay sensitivity, measuring range, intra- and interassay CVs were 0.4 mIU/mL, 1.5 mIU/mL to 100mIU/mL, <10% and <15%, respectively. For measurement of P4 concentration, the assay sensitivity was 0.2 ng/mL, measuring range was 0.5 to 80 ng/mL, and the intra- and interassay CVs were <10%. For measurement of LH concentration, the assay sensitivity, measuring range, intra- and interassay CVs were 0.02, 0.5 to 20 ng/mL, <10% and <15%, respectively. For measurement of PRL concentration, the assay sensitivity was 0.5 ng/mL, measuring range was 5.0 to 100 ng/mL, and the intra- and interassay CVs were <10%. All the samples were measured in one single assay. Quantification of reproductive hormone receptors mRNA with real-time PCR The hens selected for blood sampling were then slaughtered by cervical dislocation and the ovary were quickly removed and weighed. The numbers of preovulatory follicles (POFs) [F1 (the first largest one of POFs; about 34 mm in diameter), F2 (the second largest one of POFs; 25 to 33 mm in diameter), F3 (the third largest one of POFs; 15 to 24 mm in diameter)], small yellow follicles (SYFs) (4 to 10 mm in diameter), and large white follicles (LWFs) (2 to 4 mm in diameter) of every chicken were counted. Then, the granulosa layers of the POFs, SYFs, and LWFs were separated, minced with a razor blade, frozen as aliquots in liquid nitrogen, and stored at –70°C for gene expression analysis. Total RNA was isolated from the granulosa layers of the POFs, SYFs, and LWFs using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The quality of total RNA was checked by both native RNA electrophoresis on 1.0% agarose gel and the UV absorbance ratio at 260 and 280 nm. The cDNA was synthesized from total RNA by a reverse transcriptase (M-MLV; Takara, Dalian, China) at 42°C for 60 min with oligo dT-adaptor primer using the protocol of the manufacturer. The primer sequences of follicle-stimulating hormone receptor, luteinizing hormone receptor (LHR), progesterone receptor (PR), and prolactin receptor (PRLR) used for quantitative realtime PCR were synthesized by Generay Biotech Co., Ltd (Shanghai, China) and shown in Table 1. The abundance of mRNA was determined on a StepOne Plus Real-Time PCR system (ABI 7500, Applied Biosystems, Foster City, CA) using SYBR Premix PCR kit (Takara, Dalian, China). The PCR program was 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 60 s. Efficiency of the real-time PCR primers for all the examined genes was calculated from standard curves. Each sample was run in triplicate and no template control was included. Specificity of the amplification was verified at the end of PCR run by melting curve analysis. Specificity of the product was also confirmed by running samples on a 1.2% agarose gel, excising for purification using a DNA purification kit (Takara, Dalian, China) and sequencing (Shanghai Sangon Biotech Co. Ltd., Shanghai, China). The difference of Ct (cycle threshold) value for 18S rRNA was less than 0.5 between the CRS and FRS groups, and, therefore, was considered to be an appropriate endogenous control. Average gene expression relative to the endogenous control for each sample was calculated using the 2–ΔΔCt method (Livak and Schmittgen, 2001). The calibrator was the average ΔCt value of each gene in LWF of the CRS group. Table 1. Primers used in real-time PCR. Gene1  Primers sequences (5′-3′)  Reference  FSHR  TCAGCAGCTACATGAAGGT  Long et al., 2017    AAGGCAAGTACATTCAACACTA    LHR  GCTGATCTTAATGCTCAACG      TTGGCAATCTTGGTGTCTTTAT    PRLR  CAGATTCACGAGTTCCGCA      GGCATAAATGAGGATGGGT    PR  ATCATCGTTCTATTCACTGT  Liu et al., 2015    CTCGTTCTCATCTCATCAA    18S rRNA  ATTCCGATAACGAACGAGACT  Deng et al., 2014    GGACATCTAAGGGCATCACA    Gene1  Primers sequences (5′-3′)  Reference  FSHR  TCAGCAGCTACATGAAGGT  Long et al., 2017    AAGGCAAGTACATTCAACACTA    LHR  GCTGATCTTAATGCTCAACG      TTGGCAATCTTGGTGTCTTTAT    PRLR  CAGATTCACGAGTTCCGCA      GGCATAAATGAGGATGGGT    PR  ATCATCGTTCTATTCACTGT  Liu et al., 2015    CTCGTTCTCATCTCATCAA    18S rRNA  ATTCCGATAACGAACGAGACT  Deng et al., 2014    GGACATCTAAGGGCATCACA    1FSHR, follicle-stimulating hormone receptor; LHR, luteinizing hormone receptor; PR, progesterone receptor; PRLR, prolactin receptor; 18S rRNA served as endogenous reference gene. View Large Table 1. Primers used in real-time PCR. Gene1  Primers sequences (5′-3′)  Reference  FSHR  TCAGCAGCTACATGAAGGT  Long et al., 2017    AAGGCAAGTACATTCAACACTA    LHR  GCTGATCTTAATGCTCAACG      TTGGCAATCTTGGTGTCTTTAT    PRLR  CAGATTCACGAGTTCCGCA      GGCATAAATGAGGATGGGT    PR  ATCATCGTTCTATTCACTGT  Liu et al., 2015    CTCGTTCTCATCTCATCAA    18S rRNA  ATTCCGATAACGAACGAGACT  Deng et al., 2014    GGACATCTAAGGGCATCACA    Gene1  Primers sequences (5′-3′)  Reference  FSHR  TCAGCAGCTACATGAAGGT  Long et al., 2017    AAGGCAAGTACATTCAACACTA    LHR  GCTGATCTTAATGCTCAACG      TTGGCAATCTTGGTGTCTTTAT    PRLR  CAGATTCACGAGTTCCGCA      GGCATAAATGAGGATGGGT    PR  ATCATCGTTCTATTCACTGT  Liu et al., 2015    CTCGTTCTCATCTCATCAA    18S rRNA  ATTCCGATAACGAACGAGACT  Deng et al., 2014    GGACATCTAAGGGCATCACA    1FSHR, follicle-stimulating hormone receptor; LHR, luteinizing hormone receptor; PR, progesterone receptor; PRLR, prolactin receptor; 18S rRNA served as endogenous reference gene. View Large Statistical analysis The data were expressed as means ± SE and analyzed statistically by two-tailed Student's t-test, using SPSS 18.0 for Windows (SPSS Inc., Chicago, IL). Statistical significance was considered at P < 0.05. An individual hen served as the experimental unit for all data. RESULTS AND DISCUSSION A previous study in our lab showed that changing from CRS to FRS resulted in a 23.20% decrease of hen-day egg production (74.34 vs. 57.09%) in Xianju chickens under summer conditions (Dong et al., 2017). As the serum hormone level has been considered to be a sensitive indicator of laying performance (Mohammadi and Ansari-Pirsaraei, 2014), we determined the effects of rearing systems on serum hormone profile in the current study by using the same pure native breeds under summer conditions. We found that rearing systems had no significant effect on FSH secretion; however, changing from CRS to FRS increased serum concentrations of PRL and decreased serum LH and P4 levels (P < 0.05; Figure 1). Prolactin, secreted by the pituitary gland, has been considered as a negative regulator of bird reproductive activities by inducing expression of incubating behavior, suppressing secretion of gonadotropins (e.g., FSH and LH), and causing atresia of ovarian follicles (El Halawani and Rozenboim, 1993; Chaiseha and El Halawani, 2005). LH, as a kind of gonadotropins, plays an important role in the course of follicular development and promotes the secretion of P4 in the POFs (Palermo, 2007; Thompson and Kaiser, 2014). Regarding to P4, it is demonstrated that more P4 production could induce ovulation by stimulating the synthesis of protein-decomposing enzymes and collagen hydrolase in the follicular cells (Donoghue, 1989). Accordingly, the diminished egg production in FRS chickens may, in part, be related to increased PRL secretion and decreased LH and P4 secretion. The altered PRL and LH secretion might be partly due to the rearing system but mostly to the environmental factors in FRS, which provide more natural but poorer living conditions as reflected by higher temperature than CRS throughout the current study. Previous studies have been demonstrated that stress, such as heat stress, increased circulating PRL and decreased circulating gonadotropins, respectively, in cows and goats (Johke, 1970), turkey poults (Opel and Proudman, 1982), turkey hens (El Halawani et al., 1985; Rozenboim et al., 2004), and laying hens (Johnson, 1981). The depressed P4 secretion of hens reared under FRS might be associated with the reduction of serum cholesterol concentrations, because steroid hormones including the reproductive hormones P4 are derived from cholesterol (Alodan, 2001; Yoder et al., 2004). Our previous study had confirmed that hens from FRS exhibited lower serum concentration of cholesterol than that in hens reared under CRS (6.44 vs. 10.47 mmol/L; Dong et al., 2017). Figure 1. View largeDownload slide Effects of conventional cage rearing system (CRS) and free-range system (FRS) on serum follicle stimulating hormone (FSH), luteinizing hormone (LH), progesterone (P4), and prolactin (PRL) concentrations in Xianju chickens reared under summer conditions. Data shown as means ± SE (n = 10). Means on each bar with no common letter differ significantly at P < 0.05. Figure 1. View largeDownload slide Effects of conventional cage rearing system (CRS) and free-range system (FRS) on serum follicle stimulating hormone (FSH), luteinizing hormone (LH), progesterone (P4), and prolactin (PRL) concentrations in Xianju chickens reared under summer conditions. Data shown as means ± SE (n = 10). Means on each bar with no common letter differ significantly at P < 0.05. The biological effect of FSH, LH, P4, and PRL on target cells is elicited through their receptors (Kobayashi et al., 2008; Li et al., 2011; Liu et al., 2015; Long et al., 2017). In the current study, FSH, LH, P4, and PRL receptor gene expressions were furtherly investigated. Consistent with previous studies (LaBarbera, 1994; Seekallu et al., 2010; Liu et al., 2015), the mRNA expression of follicle-stimulating hormone receptor was greatest in the granulosa layer of small POFs (F3), while greatest expression of LHR, PRLR, and PR was found in large POFs (F1) (Figure 2). Regarding to the effects of rearing systems on those receptors expression, we found that mRNA expressions in the granulosa layer of POFs from FRS hens were upregulated for PRLR and downregulated for LHR and PR, compared to those from CRS hens (P < 0.05; Figure 2). Our results showed that the significant alteration of circulating reproductive hormone levels of hens reared under different rearing systems was associated with the alteration of their receptors mRNA expressions in the POFs. This synergistic reduction between reproductive hormones and their receptors caused by FRS allows for the decrease of ovarian weight and follicular numbers (P < 0.05; Table 2), as well as follicle growth, development, maturation, and ovulation in the ovary, and thus eventually debilitate egg production of laying hens. Convincing evidence implicating the synergistic change between reproductive hormones and their receptors secretion as a causative factor for managing productivity traits in laying hens has been presented by Long et al. (2017). Figure 2. View largeDownload slide Effects of conventional cage rearing system (CRS) and free-range system (FRS) on the mRNA expression of follicle-stimulating hormone receptor (FSHR), luteinizing hormone receptor (LHR), progesterone receptor (PR), and prolactin receptor (PRLR) in follicles of different size from Xianju chickens reared under summer conditions. F1, F2, F3, preovulatory follicles; SYFs, small yellow follicles; LWFs, large white follicles. Relative gene expression ± SE (n = 10) was calculated using the 2–ΔΔCt method with 18S rRNA as the endogenous control and the average ΔCt value of each gene in LWF of CRS group as the calibrator. Different letters on each bar indicate a significant difference (P < 0.05) at different follicles between CRS and FRS groups. Figure 2. View largeDownload slide Effects of conventional cage rearing system (CRS) and free-range system (FRS) on the mRNA expression of follicle-stimulating hormone receptor (FSHR), luteinizing hormone receptor (LHR), progesterone receptor (PR), and prolactin receptor (PRLR) in follicles of different size from Xianju chickens reared under summer conditions. F1, F2, F3, preovulatory follicles; SYFs, small yellow follicles; LWFs, large white follicles. Relative gene expression ± SE (n = 10) was calculated using the 2–ΔΔCt method with 18S rRNA as the endogenous control and the average ΔCt value of each gene in LWF of CRS group as the calibrator. Different letters on each bar indicate a significant difference (P < 0.05) at different follicles between CRS and FRS groups. Table 2. Effects of rearing systems on ovarian weight and number of different-sized follicles in Xianju chickens.1   Rearing systems3    Item2  CRS  FRS  P-value  Ovarian weight  40.83 ± 1.41a  36.90 ± 1.92b  0.03  Number of POFs  5.33 ± 0.29  5.00 ± 0.24  0.38  Number of SYFs  19.20 ± 0.86a  16.20 ± 0.58b  0.02  Number of LWFs  28.50 ± 1.53a  22.85 ± 1.28b  0.02    Rearing systems3    Item2  CRS  FRS  P-value  Ovarian weight  40.83 ± 1.41a  36.90 ± 1.92b  0.03  Number of POFs  5.33 ± 0.29  5.00 ± 0.24  0.38  Number of SYFs  19.20 ± 0.86a  16.20 ± 0.58b  0.02  Number of LWFs  28.50 ± 1.53a  22.85 ± 1.28b  0.02  1n = 10 hens per group. 2POFs, preovulatory follicles; SYFs, small yellow follicles; LWFs, large white follicles. 3Rearing systems: CRS, conventional cage rearing system; FRS, free-range system. a,bMeans within a row with different superscripts differ significantly (P < 0.05). View Large Table 2. Effects of rearing systems on ovarian weight and number of different-sized follicles in Xianju chickens.1   Rearing systems3    Item2  CRS  FRS  P-value  Ovarian weight  40.83 ± 1.41a  36.90 ± 1.92b  0.03  Number of POFs  5.33 ± 0.29  5.00 ± 0.24  0.38  Number of SYFs  19.20 ± 0.86a  16.20 ± 0.58b  0.02  Number of LWFs  28.50 ± 1.53a  22.85 ± 1.28b  0.02    Rearing systems3    Item2  CRS  FRS  P-value  Ovarian weight  40.83 ± 1.41a  36.90 ± 1.92b  0.03  Number of POFs  5.33 ± 0.29  5.00 ± 0.24  0.38  Number of SYFs  19.20 ± 0.86a  16.20 ± 0.58b  0.02  Number of LWFs  28.50 ± 1.53a  22.85 ± 1.28b  0.02  1n = 10 hens per group. 2POFs, preovulatory follicles; SYFs, small yellow follicles; LWFs, large white follicles. 3Rearing systems: CRS, conventional cage rearing system; FRS, free-range system. a,bMeans within a row with different superscripts differ significantly (P < 0.05). View Large In general, we presented the first data referring to the effect of rearing systems on circulating reproductive hormones and mRNA expression of their receptors in follicles of different size by using indigenous Xianju chickens reared under summer conditions. It can be concluded that changing from CRS to FRS in the current experimental conditions depressed egg production traits in Xianju chickens by inducing a synergistic activity of reproductive hormones and the gene expressions of their receptors. Notes This research is appropriate for Management and Production. The research was supported by the Science & Technology Project (NO. [2013]215-29) and the Key Agriculture Science and Technology Project (NO. 2016C02054-15) in Zhejiang province of China. REFERENCES Ahammed A., Chae B. J., Lohakare J., Keohavong B., Lee M. H., Lee S. J., Kim D. M., Lee J. Y., Ohh S. J.. 2014. Comparison of aviary, barn and conventional cage raising of chickens on laying performance and egg quality. Asian Australas. J. Anim. Sci . 27: 1196– 1203. Google Scholar CrossRef Search ADS PubMed  Alodan M. A. 2001. Cytokine il-1b Modulation of Reproductive Function in Heat Stressed Hens . PhD thesis, University of Nebraska, Lincoln, Nebraska. Anderson K. A. 2010. Range egg production, is it better than in cages? MPF Convention  March 16–18, 2010. Chaiseha Y., El Halawani M. E.. 2005. Neuroendocrinology of the female turkey reproductive cycle. J. Poult. Sci.  42: 87– 100. Google Scholar CrossRef Search ADS   Deng H., Zheng A., Liu G., Chang W., Zhang S., Cai H.. 2014. Activation of mammalian target of rapamycin signaling in skeletal muscle of neonatal chicks: effects of dietary leucine and age. Poult. Sci.  93: 114– 121. Google Scholar CrossRef Search ADS PubMed  Dong X. Y., Yin Z. Z., Ma Y. Z., Cao H. Y., Dong D. J.. 2017. Effects of rearing systems on laying performance, egg quality, and serum biochemistry of Xianju chickens in summer. Poult. Sci . 96: 3896– 3900. Google Scholar CrossRef Search ADS PubMed  Donoghue D. 1989. Thermal stress reduces serum luteinizing hormone and bioassayable hypothalamic content of luteinizing hormone-releasing hormone in hens. Biol. Reprod.  41: 419– 424. Google Scholar CrossRef Search ADS PubMed  El Halawani M. E., Rozenboim I.. 1993. The ontogeny and control of incubation behavior in turkeys. Poult. Sci.  72: 906– 911. Google Scholar CrossRef Search ADS   Halawani El, M. E., Silsby J. L., Fehrer S. C., Behnke E. J.. 1985. The influence of acute or repeated immobilization on plasma prolactin levels in the turkey (Meleagris gallopavo). Gen. Comp. Endocrinol.  59: 410– 415. Google Scholar CrossRef Search ADS PubMed  Johke T. 1970. Factors affecting the plasma prolactin level in the cow and the goat as determined by radioimmunoassay. Endocrinol. Jpn.  17: 393– 401. Google Scholar CrossRef Search ADS PubMed  Johnson A. L. 1981. Comparison of three serial blood sampling techniques on plasma hormone concentrations in the laying hen. Poult. Sci.  60: 2322– 2327. Google Scholar CrossRef Search ADS PubMed  Kobayashi T., Pakarinen P., Torgersen J., Huhtaniemi I., Andersen O.. 2008. The gonadotropin receptors FSH-R and LH-R of Atlantic halibut (Hippoglossus hippoglossus)—2. Differential follicle expression and asynchronous oogenesis. Gen. Comp. Endocrinol . 156: 595– 602. Google Scholar CrossRef Search ADS PubMed  Küçükyılmaz K., Bozkurt M., Herken E. N., Cınar M., Catlı A. U., Bintaş E., Cöven F.. 2012. Effects of rearing systems on performance, egg characteristics and immune response in two layer hen genotype. Asian Australas. J. Anim. Sci . 25: 559– 568. Google Scholar CrossRef Search ADS PubMed  LaBarbera A. R. 1994. Follicle-stimulating hormone (FSH) receptors and FSH-responsive adenosine 3′,5′-cyclic monophosphate production in porcine granulosa cells decline with follicular growth. Endocr. Res.  20: 65– 77. Google Scholar CrossRef Search ADS PubMed  Li W. L., Liu Y., Yu Y. C., Huang Y. M., Liang S. D., Shi Z. D.. 2011. Prolactin plays a stimulatory role in ovarian follicular development and egg laying in chicken hens. Dom. Anim. Endocrinol.  41: 57– 66. Google Scholar CrossRef Search ADS   Liu L., Li D., Gilbert E. R., Xiao Q., Zhao X., Wang Y., Yin H., Zhu Q.. 2015. Effect of monochromatic light on expression of estrogen receptor (er) and progesterone receptor (pr) in ovarian follicles of chicken. PLoS One.  10: e0144102. Google Scholar CrossRef Search ADS PubMed  Livak K. J., Schmittgen T. D.. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2–ΔΔCT method. Methods . 25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Long L., Wu S. G., Yuan F., Zhang H. J., Wang J., Qi G. H.. 2017. Effects of dietary octacosanol supplementation on laying performance, egg quality, serum hormone levels, and expression of genes related to the reproductive axis in laying hens. Poult. Sci . 96: 894– 890. Google Scholar CrossRef Search ADS PubMed  Mohammadi H., Ansari-Pirsaraei Z.. 2014. Changes in some blood parameters and production performance of old laying hens due to growth hormone and testosterone injection. J. Anim. Physiol. Anim. Nutr . 98: 483– 490. Google Scholar CrossRef Search ADS   Mugnai C., Bosco A. D., Castellini C.. 2009. Effect of rearing system and season on the performance and egg characteristics of ancona laying hens. Italian J. Anim. Sci.  8: 175– 188. Google Scholar CrossRef Search ADS   Neijat M., House J. D., Guenter W., Kebreab E.. 2011. Production performance and nitrogen flow of Shaver White layers housed in enriched or conventional cage systems. Poult. Sci.  90: 543– 554. Google Scholar CrossRef Search ADS PubMed  Onagbesan O. M., Metayer S., Tona K., Williams J., Decuypere E., Bruggeman V.. 2006. Effects of genotype and feed allowance on plasma luteinizing hormones, follicle-stimulating hormones, progesterone, estradiol levels, follicle differentiation, and egg production rates of broiler breeder hens. Poult. Sci. . 85: 1245– 1258. Google Scholar CrossRef Search ADS PubMed  Opel H., Proudman J. A.. 1982. Effects of repeated handling and blood sampling on plasma prolactin levels in young turkeys. Poult. Sci.  61: 1390– 1398. Palermo R. 2007. Differential actions of FSH and LH during folliculogenesis. Reprod. BioMed. Online . 15: 326– 337. Google Scholar CrossRef Search ADS PubMed  Pirsaraei Z. A., Shahneh A. Z., Zaghari M., Zamiri M. J., Mianji G. R.. 2008. Effect of testosterone and growth hormone injection before puberty on follicles size, rate of egg production and egg characteristics of the mazandaran native breeder hens. Afr. J. Biotechnol . 7: 3149– 3154. Rozenboim I., Mobarky N., Heiblum R., Chaiseha Y., Kang S. W., Biran I., Rosenstrauch A., Sklan D., El Halawani M. E.. 2004. The role of prolactin in reproductive failure associated with heat stress in the domestic turkey. Biol. Reprod.  71: 1208– 1213. Google Scholar CrossRef Search ADS PubMed  Seekallu S. V., Toosi B. M., Zeigler A., Rawlings N. C.. 2010. Effects of estradiol and progesterone on circulating LH and FSH secretion, and ovarian antral follicle growth in anestrous ewes. Small Rum. Res . 91: 178– 185. Google Scholar CrossRef Search ADS   Tang H., Gong Y. Z., Wu C. X., Jiang J., Wang Y., Li K.. 2009. Variation of meat quality traits among five genotypes of chicken. Poult. Sci. . 88: 2212– 2218. Google Scholar CrossRef Search ADS PubMed  Tauson R., Wahlström A., Abrahamsson P.. 1999. Effect of two floor housing systems and cages on health, production, and fear response in layers. J. Appl. Poult. Res . 8: 152– 159. Google Scholar CrossRef Search ADS   Thompson I. R., Kaiser U. B.. 2014. GnRH pulse frequency-dependent differential regulation of LH and FSH gene expression. Mol. Cell. Endocrinol.  385: 28– 35. Google Scholar CrossRef Search ADS PubMed  Yakubu A., Saleko A. E., Ige A. O.. 2007. Effects of genotype and housing system on the laying performance of chickens in different seasons in the semi-humid tropics. Int. J. Poult. Sci.  6: 434– 439. Google Scholar CrossRef Search ADS   Yoder C. A., Andelt W. F., Miller L. A., Johnston J. J., Goodall M. J.. 2004. Effectiveness of twenty, twenty-five diazacholesterol, avian gonadotropin-releasing hormone, and chicken riboflavin carrier protein for inhibiting reproduction in Coturnix quail. Poult. Sci . 83: 234– 244. Google Scholar CrossRef Search ADS PubMed  © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Effects of rearing systems on reproductive hormones secretion and their receptors gene expression in Xianju chickens under summer conditions

Loading next page...
 
/lp/ou_press/effects-of-rearing-systems-on-reproductive-hormones-secretion-and-7r36N1a8tx
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pey194
Publisher site
See Article on Publisher Site

Abstract

ABSTRACT Previous study in our lab showed that indigenous Xianju chickens from free-range system (FRS) under summer conditions had lower egg production than those from conventional cage rearing system (CRS). The objective of this study was to preliminarily determine the FRS-dependent mechanism of depressing laying performance according to determining the effect of rearing systems on reproductive hormones secretion and their receptors mRNA expression in Xianju chickens reared under summer conditions. A total of 360 indigenous Xianju chickens were randomly allocated to CRS and FRS groups, each of which included 5 replicates of 36 hens. The experiment lasted between 21 and 29 wk of age. We found that the ovarian weight, numbers of small yellow follicles, and large white follicles in the FRS group were lower than those in the CRS group (P < 0.05). Changing from CRS to FRS increased serum concentrations of prolactin and decreased serum-luteinizing hormone and progesterone levels (P < 0.05). Gene expressions in the preovulatory follicles from FRS hens were upregulated for prolactin receptor and downregulated for luteinizing hormone receptor and progesterone receptor, compared to those from CRS hens (P < 0.05). It can be concluded that changing from CRS to FRS in the current experimental conditions depressed egg production traits in Xianju chickens by inducing a synergistic activity of reproductive hormones and the gene expressions of their receptors. INTRODUCTION Alternative rearing systems such as enriched cage, organic system, and free-range system (FRS) have been shown to have a significant effect on production traits in laying hens (Tauson et al., 1999; Mugnai et al., 2009; Neijat et al., 2011; Ahammed et al., 2014). The general trend in layer strains showed that egg production was higher in conventional cage systems than in alternative rearing systems (Yakubu et al., 2007; Mugnai et al., 2009; Anderson, 2010). However, Küçükyılmaz et al. (2012) found that White Lohmann LSL layers produced more eggs in the cage system than in the organic system, while brown ATAK-S laying hens showed lower laying performance in the cage system than in the organic system, indicating that some genotypes will show better performance under conventional cage systems, whereas some genotypes will respond positively when allowed fresh air and freedom of movement. Furthermore, compared to the conventional cage systems, the egg yield from alternative rearing systems was more affected by seasonal conditions (temperature and photoperiod) as described by Mugnai et al. (2009). Thus, studies on the effect of alternative rearing systems on production traits are continuing, especially in relation to the ability of native pure breeds to adapt to these alternate systems under certain climates. Xianju chicken, originated from humid subtropical areas in Zhejiang provinces, is considered to be one of the most famous indigenous layer breeds in China due to its high egg production (180 to 200/yr) and adaptability (Tang et al., 2009). A recently study in our lab showed that Xianju chickens from FRS under summer conditions had lower egg production than those from conventional cage system (Dong et al., 2017). The debilitating effect on egg production is well recognized, but the mechanism involved is not clearly understood. Egg production is under the control of hormonal status of hen (Pirsaraei et al., 2008). It has been shown that changes of reproductive hormones such as follicle stimulating hormone (FSH), luteinizing hormone (LH), progesterone (P4), and prolactin (PRL) may induce different performance traits in layers (Onagbesan et al., 2006; Li et al., 2011). We hypothesized that the regulatory mechanisms for the reduced egg production in the hens from FRS under summer conditions might be modulated at the level of the reproductive hormone secretion. Hence, the present study was planned to investigate the effects of alternative rearing systems on reproductive hormones response in indigenous Xianju chickens under summer conditions. MATERIAL AND METHODS The experiment was conducted in accordance with the Chinese guidelines for animal welfare and was approved by the animal welfare committee of the Animal Science College, Zhejiang University. Birds, Feeding, and Rearing Systems A total of 360 indigenous Xianju chickens, at the start of laying (21 wk of age), were randomly allocated to 2 treatment groups, each of which included 5 replicates of 36 hens. The conventional cage rearing system (CRS) and FRS were located on the same field in Jinshanjiao layer farm (Taishun within Zhejiang province, China). We conducted a 9-wk trial (with a 1-wk acclimation period) to make sure that the chickens were reared under summer conditions (from June to August) throughout the study period. For CRS, hens were reared with the 4-tiered rearing cages fitted with linear feeders and nipple drinkers (2 nipple drinkers per cage). Each replication consisted of 12 adjacent cages. Hens were kept in cages (47 cm length, 37 cm width, and 50 cm height) with 3 hens per cage providing approximately 579 cm2 floor space per bird, and housed in a windowed layer house with a controlled ventilation regime and a wet curtain cooling system. The FRS had an indoor and paddock area. The indoor area was an open-sided naturally ventilated layer house and its floor was covered with wood shavings. A total 6 hens per m2 was provided in the FRS indoor area. The paddock area was located in front of the open-sided house, covered with alfalfa and trifolium mixture, providing stocking density of 0.25 birds/m2. Inside the paddocks area, there was a small hut with nests (6 hens per nest) and perches (18 cm of area per hen). Replication in FRS was done with the help of fish-net. The paddock area was enclosed by wire fences to keep out predators. The circular feeders and plastic drinkers were used in the indoor and paddock areas. Natural light, supplemented with artificial light to achieve 16L:8D was used in all of the systems. Hens in all rearing systems were fed the same complete diet based on corn and soybean meal with 17% CP and 2750 kcal/kg ME. Feed and drinking water were offered ad libitum to all hens. The mean daily temperature was 31°C (range 26 to 35°C) and ambient RH was 75% (range 60 to 90%) in the FRS throughout the study period. The mean daily temperature and RH inside the barn from CRS was 27°C (range 24 to 30°C) and 80% (range 70 to 90%), respectively. The mean mortalities in CRS and FRS were 0.00 and 2.22%, respectively. Blood sampling and analysis At the end of wk 29, 12 h after feed withdrawal, 2 birds were randomly selected from each replicate and blood samples were collected from the axillary vein. Serum was isolated by centrifugation of blood at 3000× g for 10 min, and was stored in 1.5-mL Eppendorf tubes at −70°C until analyses. Serum FSH, P4, LH, and PRL levels were analyzed using RIA kits (Hengyuan Biological Technology Co., Ltd, Shanghai, China) by radio immunoassay, according to the recommendations of the manufacturer. For measurement of FSH concentration, the assay sensitivity, measuring range, intra- and interassay CVs were 0.4 mIU/mL, 1.5 mIU/mL to 100mIU/mL, <10% and <15%, respectively. For measurement of P4 concentration, the assay sensitivity was 0.2 ng/mL, measuring range was 0.5 to 80 ng/mL, and the intra- and interassay CVs were <10%. For measurement of LH concentration, the assay sensitivity, measuring range, intra- and interassay CVs were 0.02, 0.5 to 20 ng/mL, <10% and <15%, respectively. For measurement of PRL concentration, the assay sensitivity was 0.5 ng/mL, measuring range was 5.0 to 100 ng/mL, and the intra- and interassay CVs were <10%. All the samples were measured in one single assay. Quantification of reproductive hormone receptors mRNA with real-time PCR The hens selected for blood sampling were then slaughtered by cervical dislocation and the ovary were quickly removed and weighed. The numbers of preovulatory follicles (POFs) [F1 (the first largest one of POFs; about 34 mm in diameter), F2 (the second largest one of POFs; 25 to 33 mm in diameter), F3 (the third largest one of POFs; 15 to 24 mm in diameter)], small yellow follicles (SYFs) (4 to 10 mm in diameter), and large white follicles (LWFs) (2 to 4 mm in diameter) of every chicken were counted. Then, the granulosa layers of the POFs, SYFs, and LWFs were separated, minced with a razor blade, frozen as aliquots in liquid nitrogen, and stored at –70°C for gene expression analysis. Total RNA was isolated from the granulosa layers of the POFs, SYFs, and LWFs using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The quality of total RNA was checked by both native RNA electrophoresis on 1.0% agarose gel and the UV absorbance ratio at 260 and 280 nm. The cDNA was synthesized from total RNA by a reverse transcriptase (M-MLV; Takara, Dalian, China) at 42°C for 60 min with oligo dT-adaptor primer using the protocol of the manufacturer. The primer sequences of follicle-stimulating hormone receptor, luteinizing hormone receptor (LHR), progesterone receptor (PR), and prolactin receptor (PRLR) used for quantitative realtime PCR were synthesized by Generay Biotech Co., Ltd (Shanghai, China) and shown in Table 1. The abundance of mRNA was determined on a StepOne Plus Real-Time PCR system (ABI 7500, Applied Biosystems, Foster City, CA) using SYBR Premix PCR kit (Takara, Dalian, China). The PCR program was 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 60 s. Efficiency of the real-time PCR primers for all the examined genes was calculated from standard curves. Each sample was run in triplicate and no template control was included. Specificity of the amplification was verified at the end of PCR run by melting curve analysis. Specificity of the product was also confirmed by running samples on a 1.2% agarose gel, excising for purification using a DNA purification kit (Takara, Dalian, China) and sequencing (Shanghai Sangon Biotech Co. Ltd., Shanghai, China). The difference of Ct (cycle threshold) value for 18S rRNA was less than 0.5 between the CRS and FRS groups, and, therefore, was considered to be an appropriate endogenous control. Average gene expression relative to the endogenous control for each sample was calculated using the 2–ΔΔCt method (Livak and Schmittgen, 2001). The calibrator was the average ΔCt value of each gene in LWF of the CRS group. Table 1. Primers used in real-time PCR. Gene1  Primers sequences (5′-3′)  Reference  FSHR  TCAGCAGCTACATGAAGGT  Long et al., 2017    AAGGCAAGTACATTCAACACTA    LHR  GCTGATCTTAATGCTCAACG      TTGGCAATCTTGGTGTCTTTAT    PRLR  CAGATTCACGAGTTCCGCA      GGCATAAATGAGGATGGGT    PR  ATCATCGTTCTATTCACTGT  Liu et al., 2015    CTCGTTCTCATCTCATCAA    18S rRNA  ATTCCGATAACGAACGAGACT  Deng et al., 2014    GGACATCTAAGGGCATCACA    Gene1  Primers sequences (5′-3′)  Reference  FSHR  TCAGCAGCTACATGAAGGT  Long et al., 2017    AAGGCAAGTACATTCAACACTA    LHR  GCTGATCTTAATGCTCAACG      TTGGCAATCTTGGTGTCTTTAT    PRLR  CAGATTCACGAGTTCCGCA      GGCATAAATGAGGATGGGT    PR  ATCATCGTTCTATTCACTGT  Liu et al., 2015    CTCGTTCTCATCTCATCAA    18S rRNA  ATTCCGATAACGAACGAGACT  Deng et al., 2014    GGACATCTAAGGGCATCACA    1FSHR, follicle-stimulating hormone receptor; LHR, luteinizing hormone receptor; PR, progesterone receptor; PRLR, prolactin receptor; 18S rRNA served as endogenous reference gene. View Large Table 1. Primers used in real-time PCR. Gene1  Primers sequences (5′-3′)  Reference  FSHR  TCAGCAGCTACATGAAGGT  Long et al., 2017    AAGGCAAGTACATTCAACACTA    LHR  GCTGATCTTAATGCTCAACG      TTGGCAATCTTGGTGTCTTTAT    PRLR  CAGATTCACGAGTTCCGCA      GGCATAAATGAGGATGGGT    PR  ATCATCGTTCTATTCACTGT  Liu et al., 2015    CTCGTTCTCATCTCATCAA    18S rRNA  ATTCCGATAACGAACGAGACT  Deng et al., 2014    GGACATCTAAGGGCATCACA    Gene1  Primers sequences (5′-3′)  Reference  FSHR  TCAGCAGCTACATGAAGGT  Long et al., 2017    AAGGCAAGTACATTCAACACTA    LHR  GCTGATCTTAATGCTCAACG      TTGGCAATCTTGGTGTCTTTAT    PRLR  CAGATTCACGAGTTCCGCA      GGCATAAATGAGGATGGGT    PR  ATCATCGTTCTATTCACTGT  Liu et al., 2015    CTCGTTCTCATCTCATCAA    18S rRNA  ATTCCGATAACGAACGAGACT  Deng et al., 2014    GGACATCTAAGGGCATCACA    1FSHR, follicle-stimulating hormone receptor; LHR, luteinizing hormone receptor; PR, progesterone receptor; PRLR, prolactin receptor; 18S rRNA served as endogenous reference gene. View Large Statistical analysis The data were expressed as means ± SE and analyzed statistically by two-tailed Student's t-test, using SPSS 18.0 for Windows (SPSS Inc., Chicago, IL). Statistical significance was considered at P < 0.05. An individual hen served as the experimental unit for all data. RESULTS AND DISCUSSION A previous study in our lab showed that changing from CRS to FRS resulted in a 23.20% decrease of hen-day egg production (74.34 vs. 57.09%) in Xianju chickens under summer conditions (Dong et al., 2017). As the serum hormone level has been considered to be a sensitive indicator of laying performance (Mohammadi and Ansari-Pirsaraei, 2014), we determined the effects of rearing systems on serum hormone profile in the current study by using the same pure native breeds under summer conditions. We found that rearing systems had no significant effect on FSH secretion; however, changing from CRS to FRS increased serum concentrations of PRL and decreased serum LH and P4 levels (P < 0.05; Figure 1). Prolactin, secreted by the pituitary gland, has been considered as a negative regulator of bird reproductive activities by inducing expression of incubating behavior, suppressing secretion of gonadotropins (e.g., FSH and LH), and causing atresia of ovarian follicles (El Halawani and Rozenboim, 1993; Chaiseha and El Halawani, 2005). LH, as a kind of gonadotropins, plays an important role in the course of follicular development and promotes the secretion of P4 in the POFs (Palermo, 2007; Thompson and Kaiser, 2014). Regarding to P4, it is demonstrated that more P4 production could induce ovulation by stimulating the synthesis of protein-decomposing enzymes and collagen hydrolase in the follicular cells (Donoghue, 1989). Accordingly, the diminished egg production in FRS chickens may, in part, be related to increased PRL secretion and decreased LH and P4 secretion. The altered PRL and LH secretion might be partly due to the rearing system but mostly to the environmental factors in FRS, which provide more natural but poorer living conditions as reflected by higher temperature than CRS throughout the current study. Previous studies have been demonstrated that stress, such as heat stress, increased circulating PRL and decreased circulating gonadotropins, respectively, in cows and goats (Johke, 1970), turkey poults (Opel and Proudman, 1982), turkey hens (El Halawani et al., 1985; Rozenboim et al., 2004), and laying hens (Johnson, 1981). The depressed P4 secretion of hens reared under FRS might be associated with the reduction of serum cholesterol concentrations, because steroid hormones including the reproductive hormones P4 are derived from cholesterol (Alodan, 2001; Yoder et al., 2004). Our previous study had confirmed that hens from FRS exhibited lower serum concentration of cholesterol than that in hens reared under CRS (6.44 vs. 10.47 mmol/L; Dong et al., 2017). Figure 1. View largeDownload slide Effects of conventional cage rearing system (CRS) and free-range system (FRS) on serum follicle stimulating hormone (FSH), luteinizing hormone (LH), progesterone (P4), and prolactin (PRL) concentrations in Xianju chickens reared under summer conditions. Data shown as means ± SE (n = 10). Means on each bar with no common letter differ significantly at P < 0.05. Figure 1. View largeDownload slide Effects of conventional cage rearing system (CRS) and free-range system (FRS) on serum follicle stimulating hormone (FSH), luteinizing hormone (LH), progesterone (P4), and prolactin (PRL) concentrations in Xianju chickens reared under summer conditions. Data shown as means ± SE (n = 10). Means on each bar with no common letter differ significantly at P < 0.05. The biological effect of FSH, LH, P4, and PRL on target cells is elicited through their receptors (Kobayashi et al., 2008; Li et al., 2011; Liu et al., 2015; Long et al., 2017). In the current study, FSH, LH, P4, and PRL receptor gene expressions were furtherly investigated. Consistent with previous studies (LaBarbera, 1994; Seekallu et al., 2010; Liu et al., 2015), the mRNA expression of follicle-stimulating hormone receptor was greatest in the granulosa layer of small POFs (F3), while greatest expression of LHR, PRLR, and PR was found in large POFs (F1) (Figure 2). Regarding to the effects of rearing systems on those receptors expression, we found that mRNA expressions in the granulosa layer of POFs from FRS hens were upregulated for PRLR and downregulated for LHR and PR, compared to those from CRS hens (P < 0.05; Figure 2). Our results showed that the significant alteration of circulating reproductive hormone levels of hens reared under different rearing systems was associated with the alteration of their receptors mRNA expressions in the POFs. This synergistic reduction between reproductive hormones and their receptors caused by FRS allows for the decrease of ovarian weight and follicular numbers (P < 0.05; Table 2), as well as follicle growth, development, maturation, and ovulation in the ovary, and thus eventually debilitate egg production of laying hens. Convincing evidence implicating the synergistic change between reproductive hormones and their receptors secretion as a causative factor for managing productivity traits in laying hens has been presented by Long et al. (2017). Figure 2. View largeDownload slide Effects of conventional cage rearing system (CRS) and free-range system (FRS) on the mRNA expression of follicle-stimulating hormone receptor (FSHR), luteinizing hormone receptor (LHR), progesterone receptor (PR), and prolactin receptor (PRLR) in follicles of different size from Xianju chickens reared under summer conditions. F1, F2, F3, preovulatory follicles; SYFs, small yellow follicles; LWFs, large white follicles. Relative gene expression ± SE (n = 10) was calculated using the 2–ΔΔCt method with 18S rRNA as the endogenous control and the average ΔCt value of each gene in LWF of CRS group as the calibrator. Different letters on each bar indicate a significant difference (P < 0.05) at different follicles between CRS and FRS groups. Figure 2. View largeDownload slide Effects of conventional cage rearing system (CRS) and free-range system (FRS) on the mRNA expression of follicle-stimulating hormone receptor (FSHR), luteinizing hormone receptor (LHR), progesterone receptor (PR), and prolactin receptor (PRLR) in follicles of different size from Xianju chickens reared under summer conditions. F1, F2, F3, preovulatory follicles; SYFs, small yellow follicles; LWFs, large white follicles. Relative gene expression ± SE (n = 10) was calculated using the 2–ΔΔCt method with 18S rRNA as the endogenous control and the average ΔCt value of each gene in LWF of CRS group as the calibrator. Different letters on each bar indicate a significant difference (P < 0.05) at different follicles between CRS and FRS groups. Table 2. Effects of rearing systems on ovarian weight and number of different-sized follicles in Xianju chickens.1   Rearing systems3    Item2  CRS  FRS  P-value  Ovarian weight  40.83 ± 1.41a  36.90 ± 1.92b  0.03  Number of POFs  5.33 ± 0.29  5.00 ± 0.24  0.38  Number of SYFs  19.20 ± 0.86a  16.20 ± 0.58b  0.02  Number of LWFs  28.50 ± 1.53a  22.85 ± 1.28b  0.02    Rearing systems3    Item2  CRS  FRS  P-value  Ovarian weight  40.83 ± 1.41a  36.90 ± 1.92b  0.03  Number of POFs  5.33 ± 0.29  5.00 ± 0.24  0.38  Number of SYFs  19.20 ± 0.86a  16.20 ± 0.58b  0.02  Number of LWFs  28.50 ± 1.53a  22.85 ± 1.28b  0.02  1n = 10 hens per group. 2POFs, preovulatory follicles; SYFs, small yellow follicles; LWFs, large white follicles. 3Rearing systems: CRS, conventional cage rearing system; FRS, free-range system. a,bMeans within a row with different superscripts differ significantly (P < 0.05). View Large Table 2. Effects of rearing systems on ovarian weight and number of different-sized follicles in Xianju chickens.1   Rearing systems3    Item2  CRS  FRS  P-value  Ovarian weight  40.83 ± 1.41a  36.90 ± 1.92b  0.03  Number of POFs  5.33 ± 0.29  5.00 ± 0.24  0.38  Number of SYFs  19.20 ± 0.86a  16.20 ± 0.58b  0.02  Number of LWFs  28.50 ± 1.53a  22.85 ± 1.28b  0.02    Rearing systems3    Item2  CRS  FRS  P-value  Ovarian weight  40.83 ± 1.41a  36.90 ± 1.92b  0.03  Number of POFs  5.33 ± 0.29  5.00 ± 0.24  0.38  Number of SYFs  19.20 ± 0.86a  16.20 ± 0.58b  0.02  Number of LWFs  28.50 ± 1.53a  22.85 ± 1.28b  0.02  1n = 10 hens per group. 2POFs, preovulatory follicles; SYFs, small yellow follicles; LWFs, large white follicles. 3Rearing systems: CRS, conventional cage rearing system; FRS, free-range system. a,bMeans within a row with different superscripts differ significantly (P < 0.05). View Large In general, we presented the first data referring to the effect of rearing systems on circulating reproductive hormones and mRNA expression of their receptors in follicles of different size by using indigenous Xianju chickens reared under summer conditions. It can be concluded that changing from CRS to FRS in the current experimental conditions depressed egg production traits in Xianju chickens by inducing a synergistic activity of reproductive hormones and the gene expressions of their receptors. Notes This research is appropriate for Management and Production. The research was supported by the Science & Technology Project (NO. [2013]215-29) and the Key Agriculture Science and Technology Project (NO. 2016C02054-15) in Zhejiang province of China. REFERENCES Ahammed A., Chae B. J., Lohakare J., Keohavong B., Lee M. H., Lee S. J., Kim D. M., Lee J. Y., Ohh S. J.. 2014. Comparison of aviary, barn and conventional cage raising of chickens on laying performance and egg quality. Asian Australas. J. Anim. Sci . 27: 1196– 1203. Google Scholar CrossRef Search ADS PubMed  Alodan M. A. 2001. Cytokine il-1b Modulation of Reproductive Function in Heat Stressed Hens . PhD thesis, University of Nebraska, Lincoln, Nebraska. Anderson K. A. 2010. Range egg production, is it better than in cages? MPF Convention  March 16–18, 2010. Chaiseha Y., El Halawani M. E.. 2005. Neuroendocrinology of the female turkey reproductive cycle. J. Poult. Sci.  42: 87– 100. Google Scholar CrossRef Search ADS   Deng H., Zheng A., Liu G., Chang W., Zhang S., Cai H.. 2014. Activation of mammalian target of rapamycin signaling in skeletal muscle of neonatal chicks: effects of dietary leucine and age. Poult. Sci.  93: 114– 121. Google Scholar CrossRef Search ADS PubMed  Dong X. Y., Yin Z. Z., Ma Y. Z., Cao H. Y., Dong D. J.. 2017. Effects of rearing systems on laying performance, egg quality, and serum biochemistry of Xianju chickens in summer. Poult. Sci . 96: 3896– 3900. Google Scholar CrossRef Search ADS PubMed  Donoghue D. 1989. Thermal stress reduces serum luteinizing hormone and bioassayable hypothalamic content of luteinizing hormone-releasing hormone in hens. Biol. Reprod.  41: 419– 424. Google Scholar CrossRef Search ADS PubMed  El Halawani M. E., Rozenboim I.. 1993. The ontogeny and control of incubation behavior in turkeys. Poult. Sci.  72: 906– 911. Google Scholar CrossRef Search ADS   Halawani El, M. E., Silsby J. L., Fehrer S. C., Behnke E. J.. 1985. The influence of acute or repeated immobilization on plasma prolactin levels in the turkey (Meleagris gallopavo). Gen. Comp. Endocrinol.  59: 410– 415. Google Scholar CrossRef Search ADS PubMed  Johke T. 1970. Factors affecting the plasma prolactin level in the cow and the goat as determined by radioimmunoassay. Endocrinol. Jpn.  17: 393– 401. Google Scholar CrossRef Search ADS PubMed  Johnson A. L. 1981. Comparison of three serial blood sampling techniques on plasma hormone concentrations in the laying hen. Poult. Sci.  60: 2322– 2327. Google Scholar CrossRef Search ADS PubMed  Kobayashi T., Pakarinen P., Torgersen J., Huhtaniemi I., Andersen O.. 2008. The gonadotropin receptors FSH-R and LH-R of Atlantic halibut (Hippoglossus hippoglossus)—2. Differential follicle expression and asynchronous oogenesis. Gen. Comp. Endocrinol . 156: 595– 602. Google Scholar CrossRef Search ADS PubMed  Küçükyılmaz K., Bozkurt M., Herken E. N., Cınar M., Catlı A. U., Bintaş E., Cöven F.. 2012. Effects of rearing systems on performance, egg characteristics and immune response in two layer hen genotype. Asian Australas. J. Anim. Sci . 25: 559– 568. Google Scholar CrossRef Search ADS PubMed  LaBarbera A. R. 1994. Follicle-stimulating hormone (FSH) receptors and FSH-responsive adenosine 3′,5′-cyclic monophosphate production in porcine granulosa cells decline with follicular growth. Endocr. Res.  20: 65– 77. Google Scholar CrossRef Search ADS PubMed  Li W. L., Liu Y., Yu Y. C., Huang Y. M., Liang S. D., Shi Z. D.. 2011. Prolactin plays a stimulatory role in ovarian follicular development and egg laying in chicken hens. Dom. Anim. Endocrinol.  41: 57– 66. Google Scholar CrossRef Search ADS   Liu L., Li D., Gilbert E. R., Xiao Q., Zhao X., Wang Y., Yin H., Zhu Q.. 2015. Effect of monochromatic light on expression of estrogen receptor (er) and progesterone receptor (pr) in ovarian follicles of chicken. PLoS One.  10: e0144102. Google Scholar CrossRef Search ADS PubMed  Livak K. J., Schmittgen T. D.. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2–ΔΔCT method. Methods . 25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Long L., Wu S. G., Yuan F., Zhang H. J., Wang J., Qi G. H.. 2017. Effects of dietary octacosanol supplementation on laying performance, egg quality, serum hormone levels, and expression of genes related to the reproductive axis in laying hens. Poult. Sci . 96: 894– 890. Google Scholar CrossRef Search ADS PubMed  Mohammadi H., Ansari-Pirsaraei Z.. 2014. Changes in some blood parameters and production performance of old laying hens due to growth hormone and testosterone injection. J. Anim. Physiol. Anim. Nutr . 98: 483– 490. Google Scholar CrossRef Search ADS   Mugnai C., Bosco A. D., Castellini C.. 2009. Effect of rearing system and season on the performance and egg characteristics of ancona laying hens. Italian J. Anim. Sci.  8: 175– 188. Google Scholar CrossRef Search ADS   Neijat M., House J. D., Guenter W., Kebreab E.. 2011. Production performance and nitrogen flow of Shaver White layers housed in enriched or conventional cage systems. Poult. Sci.  90: 543– 554. Google Scholar CrossRef Search ADS PubMed  Onagbesan O. M., Metayer S., Tona K., Williams J., Decuypere E., Bruggeman V.. 2006. Effects of genotype and feed allowance on plasma luteinizing hormones, follicle-stimulating hormones, progesterone, estradiol levels, follicle differentiation, and egg production rates of broiler breeder hens. Poult. Sci. . 85: 1245– 1258. Google Scholar CrossRef Search ADS PubMed  Opel H., Proudman J. A.. 1982. Effects of repeated handling and blood sampling on plasma prolactin levels in young turkeys. Poult. Sci.  61: 1390– 1398. Palermo R. 2007. Differential actions of FSH and LH during folliculogenesis. Reprod. BioMed. Online . 15: 326– 337. Google Scholar CrossRef Search ADS PubMed  Pirsaraei Z. A., Shahneh A. Z., Zaghari M., Zamiri M. J., Mianji G. R.. 2008. Effect of testosterone and growth hormone injection before puberty on follicles size, rate of egg production and egg characteristics of the mazandaran native breeder hens. Afr. J. Biotechnol . 7: 3149– 3154. Rozenboim I., Mobarky N., Heiblum R., Chaiseha Y., Kang S. W., Biran I., Rosenstrauch A., Sklan D., El Halawani M. E.. 2004. The role of prolactin in reproductive failure associated with heat stress in the domestic turkey. Biol. Reprod.  71: 1208– 1213. Google Scholar CrossRef Search ADS PubMed  Seekallu S. V., Toosi B. M., Zeigler A., Rawlings N. C.. 2010. Effects of estradiol and progesterone on circulating LH and FSH secretion, and ovarian antral follicle growth in anestrous ewes. Small Rum. Res . 91: 178– 185. Google Scholar CrossRef Search ADS   Tang H., Gong Y. Z., Wu C. X., Jiang J., Wang Y., Li K.. 2009. Variation of meat quality traits among five genotypes of chicken. Poult. Sci. . 88: 2212– 2218. Google Scholar CrossRef Search ADS PubMed  Tauson R., Wahlström A., Abrahamsson P.. 1999. Effect of two floor housing systems and cages on health, production, and fear response in layers. J. Appl. Poult. Res . 8: 152– 159. Google Scholar CrossRef Search ADS   Thompson I. R., Kaiser U. B.. 2014. GnRH pulse frequency-dependent differential regulation of LH and FSH gene expression. Mol. Cell. Endocrinol.  385: 28– 35. Google Scholar CrossRef Search ADS PubMed  Yakubu A., Saleko A. E., Ige A. O.. 2007. Effects of genotype and housing system on the laying performance of chickens in different seasons in the semi-humid tropics. Int. J. Poult. Sci.  6: 434– 439. Google Scholar CrossRef Search ADS   Yoder C. A., Andelt W. F., Miller L. A., Johnston J. J., Goodall M. J.. 2004. Effectiveness of twenty, twenty-five diazacholesterol, avian gonadotropin-releasing hormone, and chicken riboflavin carrier protein for inhibiting reproduction in Coturnix quail. Poult. Sci . 83: 234– 244. Google Scholar CrossRef Search ADS PubMed  © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Poultry ScienceOxford University Press

Published: May 18, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off