Effects of exogenous inosine monophosphate on growth performance, flavor compounds, enzyme activity, and gene expression of muscle tissues in chicken

Effects of exogenous inosine monophosphate on growth performance, flavor compounds, enzyme... Abstract The goal of this experiment was to examine effects of diets supplemented with exogenous inosine monophosphate (IMP) on the growth performance, flavor compounds, enzyme activity and gene expression of chicken. A total of 1,500 healthy, 1-day-old male 3-yellow chickens were used for a 52-d experimental period. Individuals were randomly divided into 5 groups (group I, II, III, IV, V) with 6 replicates per group, and fed a basal diet supplemented with 0.0, 0.05, 0.1, 0.2, and 0.3% IMP, respectively. There was no significant response to the increasing dietary IMP level in average daily feed intake (ADFI), average daily gain (ADG), and feed:gain ratio (F/G) (P ≥ 0.05). IMP content of the breast and thigh muscle showed an exponential and linear response to the increasing dietary IMP level (P < 0.05), the highest IMP content was obtained when the diet with 0.3% and 0.2% exogenous IMP was fed. There were significant effects of IMP level in diet on free amino acids (FAA) (exponential, linear and quadratic effect, P < 0.05) and delicious amino acids (DAA) (quadratic effect, P < 0.01) content in breast muscle. FAA and DAA content in thigh muscle showed an exponential and linear response (P < 0.05), and quadratic response (P < 0.01) to the increasing dietary IMP level, the highest FAA and DAA content was obtained when the diet with 0.2% exogenous IMP was fed. Dietary IMP supplementation had a quadratic effect on 5΄-NT and the alkaline phosphatase (ALP) enzyme activity in the breast muscle (P < 0.05), and the adenosine triphosphate (ATP) enzyme activity in the thigh muscles increased exponentially and linearly with increasing IMP level in diet (exponential effect, P = 0.061; linear effect, P = 0.059). Cyclohydrolase (ATIC) gene expression in thigh muscle had a quadratic response to the increasing dietary IMP level (P < 0.05), 0.2% exogenous IMP group had the highest (AMPD1) gene expression of the breast muscle and ATIC gene expression of the thigh muscle. These results indicate that dietary IMP did not affect the growth performance of chicken, the diet with 0.2 to 0.3% exogenous IMP is optimal to improve the meat flavor quality in chicken. INTRODUCTION Poultry with delicious and uniquely flavored meat is becoming more and more popular (Hofbauer et al., 2010). Meat flavor, one of the most important eating quality parameters, is primarily composed of taste and aroma (Sasaki et al., 2007; Jayasena et al., 2013a). Continued consumption of meat and meat products can be ensured through a tasty, nutritious, and safe meat supply for the consumers (Joo and Kim, 2011). Taste is an important factor that determines meat quality (Kobayashi et al., 2013). The taste active components in chicken meat extract include free glutamic acid, 5΄-inosinic acid, and potassium ion. Among these, inosine monophosphate (IMP)is called an umami taste and is a favorite among consumers (Suzuki et al., 1991; Fujimura et al., 1995; Fujimura et al., 1996). IMP is a flavor enhancer that is 50 times more potent than monosodium glutamate. IMP can improve the meat flavor of livestock and poultry (Masic and Yeomans, 2014; Narukawa et al., 2008) and is used internationally as an important index for measuring meat flavor (Li et al., 2011; Lee et al., 2011). Exogenous nucleic acid additives have a remarkable influence on the IMP content of muscle tissue and may improve the growth performance of livestock and poultry (Zhang et al., 2008a; Wang et al., 2014). Thus, exogenous nucleic acid additives could be an effective way of improving the IMP content in animal tissues. Little information is available on the suitable amount of exogenous IMP to be used for improving chicken flavor. In this experiment, different levels of exogenous IMP were added to chicken diets to study the effects of supplementing IMP on growth performance, flavor compounds as well as molecular events in broilers. Feed additive amounts were based primarily on studies reported in 2008 (Zhang et al., 2008b) , which used corn-soy diets with 0, 0.25, 0.50, and 0.75% doses of IMP. MATERIALS AND METHODS Experimental Design A total of 1,500 healthy, 1-day-old male 3-yellow chickens (a Chinese breed) were used for the 52-d experimental period. Birds were randomly divided into 5 groups (group I, II, III, IV, V) with 6 replicates each and 50 birds per replicate. Groups were fed a basal diet supplemented with 0.0, 0.05, 0.1, 0.2, or 0.3% exogenous IMP, which was obtained from CJ Biological Technology Co. Ltd. (Shanghai, China). There were no significant differences in initial body weight among the groups. The diet components and nutritional levels are shown in Table 1. The purity of the supplemented IMP was 99.0%. Table 1. Ingredients and nutrient composition of basal diets. Ingredients (%)  Phase    d 1 to 36  d 37 to 52  Corn  52.2  56.6  Wheat  10  8  Full-fat rice bran meal  -  5  Oil  1.5  4  Soybean meal (CP, 43%)  20  16.8  Peanut meal  3  -  Cotton seed meal  3  -  Citric acid slag  4  6  Corn protein meal  2.6  -  Limestone  1.4  1.1  CaHPO4  0.86  1.07  DL-Methionine  0.23  0.28  L-Lysine  0.56  0.5  Threonine  0.1  0.1  NaCl  0.3  0.3  Vitamin premix1  0.03  0.03  Trace elements premix2  0.12  0.12  Choline chloride (50%)  0.1  0.1  Total  100  100  Calculated nutrient composition  ME (MJ/kg)  11.41  12.07  CP  20.29  17.48  Lysine  1.17  1.05  Methionine  0.5  0.49  Methionine + Cystine  0.85  0.81  Ca  0.92  0.78  Available P  0.42  0.37  Ingredients (%)  Phase    d 1 to 36  d 37 to 52  Corn  52.2  56.6  Wheat  10  8  Full-fat rice bran meal  -  5  Oil  1.5  4  Soybean meal (CP, 43%)  20  16.8  Peanut meal  3  -  Cotton seed meal  3  -  Citric acid slag  4  6  Corn protein meal  2.6  -  Limestone  1.4  1.1  CaHPO4  0.86  1.07  DL-Methionine  0.23  0.28  L-Lysine  0.56  0.5  Threonine  0.1  0.1  NaCl  0.3  0.3  Vitamin premix1  0.03  0.03  Trace elements premix2  0.12  0.12  Choline chloride (50%)  0.1  0.1  Total  100  100  Calculated nutrient composition  ME (MJ/kg)  11.41  12.07  CP  20.29  17.48  Lysine  1.17  1.05  Methionine  0.5  0.49  Methionine + Cystine  0.85  0.81  Ca  0.92  0.78  Available P  0.42  0.37  1The Vitamin premix provided the following per kg of the diet mix: Vitamin D, 1000 IU; Vitamin A, 4500IU; Vitamin E, 30 IU; Vitamin K3, 1.3 mg; Vitamin B1, 2.2 mg; Vitamin B2, 10 mg; Vitamin B12, 1.013 mg; Vitamin B6, 4 mg; calcium, 7.5 mg; niacin, 20 mg; folic acid, 0.5 mg; biotin, 0.04 mg. 2The Trace elements premix provided the following per kg of the diet mix: Copper, 7.5 mg; Iron, 60 mg; Zinc, 65 mg; Manganese, 110 mg; Iodine, 1.1 mg; Selenium, 0.15 mg. View Large Data and Sample Collection To assess the growth performance of broiler chicks, both their initial and final body weight (BW) were measured and used to determine the amount of weight gained. The feed intake per chicken pen was recorded at the end of the experiment, and the feed conversion ratio was calculated based on both the feed intake and weight gain. Two healthy broilers of average BW from each replicate cage were chosen and weighed individually then slaughtered by bleeding the left jugular vein. Breast (pectoralis major) and thigh (drumstick) meat were skinned and deboned; one was dissected immediately to analyze IMP content, flavor amino acids, and total free amino acids. Two samples from both sides of the breast and thigh meat were packed individually in aluminum foil, frozen immediately in liquid nitrogen, and stored at -80°C for analysis of enzymatic activity and total RNA extraction. The IMP concentrations in breast and thigh meat were determined by high-performance liquid chromotography (HPLC); the IMP content of each meat sample was measured according to the method described by Jung et al. (2013). Briefly, 1.0 g of fresh breast or thigh meat samples were homogenized in 900 μL of ice-cold 0.9 N perchloric acid. After extraction for 30 min in an ice-water bath, the supernatant was obtained by centrifugation at 13,000 × g at 4°C for 10 min. The supernatant was neutralized with 2 M KOH and then centrifuged again to remove KClO4. The neutralized supernatant was then passed through a 0.2-μm filter before being used for the HPLC analyses. Ten-microliter aliquots of the final meat extraction were injected into chromatography columns (Phenomenex C18-MC1, 250 × 4. 60 mm, 5 μm). Mobile phase A consisted of phosphate buffer (0.04 M potassium dihydrogen orthophosphate and 0.06 M dipotassium hydrogen orthophosphate, pH 7.0), while mobile phase B consisted of acetonitrile. Ultraviolet detection was carried out at a wavelength of 254 nm. The peaks were identified and quantified based on comparisons for the retention time and peak area of known external standards, including IMP (Sigma, St. Louis, MO). After natural thawing, visible fat and fascia were removed from meat samples, and samples were cut into pieces. A total of 2.5 g of muscle tissue was homogenized 3 times with 10 mL of deionized water (22,000 × g/min, for 10 s, interval 10 s) in an ice bath by a T10 disperser (IKA). Next, 10 mL of 10% sulfosalicylic acid was added to the homogenate, mixed by shaking, allowed to stand for 10 min, centrifuged 10 min (15 200 × g) at 4°C, and filtered through a quantitative filter paper. The filtrate was used to determine the free amino acids by automatic amino acid analyzer (Hitachi L-8900, Japan). An additional 0.5 g of muscle tissue sample was cut into pieces, transferred to a 10-mL pre-cooled centrifuge tube with 4.5 mL of pre-cooled media and homogenized into 10% homogenates (10,000 to 15,000 × g/min). The homogenates were centrifuged for 10 min at 2,000 rpm (5 min by 1,000 × g/min for adenosine triphosphate (ATP) enzyme (ATPase) at 4°C. The supernatant was used to test for the activity of ATPase, 5΄-nucleotide enzyme (5΄-NT), acid phosphatase (ACP) and alkaline phosphatase (ALP) in 3-yellow chicken muscle tissue. Test kits were purchased from Jiancheng Bioengineering Institute in Nanjing Province. Breast and thigh muscle samples were taken from 56-day-old birds and immediately frozen in liquid nitrogen and stored at -80°C prior to total RNA extraction. Oligonucleotide primer sets for the 4 genes, adenylosuccinate lyase (ADSL), adenosine monophosphate deaminase 1 (AMPD1), 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were designed using the software programs Primer Premier 5.0 and Oligo 4.0 based on sequences from chicken mRNA published in GenBank (ATIC: NM_205178.1; AMPD1:XM_004935004.1; ADSL: NM_205529.1; and GAPDH: NM_204305). Primer sequences were as follows: GAPDH forward, 5΄-GCCATCACAGCCACACAGA-3΄; GAPDH reverse, 5΄-TTTCCCCACAGCCTTAGCA-3΄; AMPD1 forward, 5΄- AGAAGTCGTATCGTGTGGATGCT-3΄; AMPD1 reverse, 5΄-CCGTTGATGGTGTTTTCTGTCTT-3΄; ADSL forward, 5΄- GCCTACCTTGGGCTTCACTCAC -3΄; ADSL reverse, 5΄- CTGCAGG-TCCATGCACAAGTC-3΄; ATIC forward, 5΄- TCTCCGGGTGTAACTGTACCAGAA-3΄; and ATIC reverse, 5΄- GAGTAGTCTGCAGGATCACACACAA-3΄. Reverse transcription (RT) and quantitative polymerase chain reaction (PCR) were performed using a fluorescence quantitative kit (TaKaRa Bio Inc., Tokyo, Japan), following the manufacturer's instructions. PCR reactions for target and reference genes were performed in different quantitative PCR tubes with 3 replicates per sample. Ct values for every gene were obtained using the Opticon Monitor analysis software. The relative Ct was determined using the following equation with GAPDH as the internal reference gene: ΔCt = Ct (purpose gene) - Ct (internal reference gene). The relative expression levels of ATIC, AMPD1, and ADSL in the various tissues were expressed as 2−ΔCt. Statistical Analysis Data were subjected to analysis of variance (ANOVA) using the GLM procedure of SAS (SAS Institute Inc., Cary, NC). The exponential, linear and quadratic effects of the IMP level were assessed using orthogonal polynomials. The replicate was the experimental unit. Pooled standard error of the mean (SEM) was calculated by averaging the SEMs calculated with the GLM procedure of SAS for the variable of interest. A P-value < 0.05 was considered statistically significant. RESULTS The effects of exogenous IMP on the performance of broilers are presented in Table 2, there was no significant response to the increasing dietary IMP level in average daily feed intake (ADFI), average daily gain (ADG), and feed:gain ratio (F/G) (P ≥ 0.05). IMP content of the breast muscle showed an exponential and linear response to the increasing dietary IMP level (P < 0.05); the highest IMP content was obtained when the diet with 0.3% exogenous IMP was fed. Similarly, there was a significant effect of exogenous IMP level in the broiler diet on IMP content in thigh muscle tissues (exponential effect, P < 0.05), and the highest IMP content was obtained when the diet with 0.2% exogenous IMP was fed (Table 3). Table 2. Effects of inosine monophosphate on the performance of broilers.1 Items2  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  day 1 to 36                    ADG (g)  33.08  32.88  32.95  32.17  33.14  0.24  0.672  0.741  0.735  ADFI (g)  51.27  50.60  51.05  51.41  50.00  0.29  0.408  0.416  0.593  F/G (g:g)  1.55  1.54  1.55  1.60  1.51  0.01  0.830  0.896  0.545  day 37 to 52                    ADG (g)  46.66  48.16  46.75  47.54  45.15  0.77  0.591  0.513  0.566  ADFI (g)  150.35  153.65  142.28  148.03  147.22  1.27  0.204  0.189  0.301  F/G (g:g)  3.29  3.20  3.05  3.12  3.31  0.06  0.952  0.943  0.359  day 1 to 52                    ADG (g)  38.16  38.51  38.10  37.81  37.71  0.24  0.362  0.347  0.601  ADFI (g)  84.65  85.26  81.86  83.99  82.75  0.51  0.170  0.165  0.354  F/G (g:g)  2.22  2.21  2.15  2.22  2.20  0.01  0.663  0.648  0.621  Items2  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  day 1 to 36                    ADG (g)  33.08  32.88  32.95  32.17  33.14  0.24  0.672  0.741  0.735  ADFI (g)  51.27  50.60  51.05  51.41  50.00  0.29  0.408  0.416  0.593  F/G (g:g)  1.55  1.54  1.55  1.60  1.51  0.01  0.830  0.896  0.545  day 37 to 52                    ADG (g)  46.66  48.16  46.75  47.54  45.15  0.77  0.591  0.513  0.566  ADFI (g)  150.35  153.65  142.28  148.03  147.22  1.27  0.204  0.189  0.301  F/G (g:g)  3.29  3.20  3.05  3.12  3.31  0.06  0.952  0.943  0.359  day 1 to 52                    ADG (g)  38.16  38.51  38.10  37.81  37.71  0.24  0.362  0.347  0.601  ADFI (g)  84.65  85.26  81.86  83.99  82.75  0.51  0.170  0.165  0.354  F/G (g:g)  2.22  2.21  2.15  2.22  2.20  0.01  0.663  0.648  0.621  1Values are the means of 6 replicates with 50 birds each. 2ADG, average daily gain; ADFI, average daily feed intake; F/G, the ratio of feed to gain. View Large Tabel 3. Effects of exogenous inosine monophosphate on the content of flavor substances in muscle tissue.1 Items1  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Breast muscle (Pectoralis major)  2.01  2.45  2.75  2.39  3.02  0.09  0.019  0.021  0.073  Thigh muscle (drumstick)  1.95  2.59  2.45  2.74  2.40  0.09  0.039  0.063  0.104  Items1  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Breast muscle (Pectoralis major)  2.01  2.45  2.75  2.39  3.02  0.09  0.019  0.021  0.073  Thigh muscle (drumstick)  1.95  2.59  2.45  2.74  2.40  0.09  0.039  0.063  0.104  1Values are the means of 6 replicates (1 bird from each replicate were analyzed). View Large Dietary IMP supplementation had an exponential and quadratic effect on the Gly, Val, Ile content (P < 0.05), and had a quadratic effect on the Ala (P < 0.01) and Phe (P < 0.05) content in breast muscle. There were significant effects (exponential, linear and quadratic effect, P < 0.05) of IMP level in diet on the free amino acids (FAA) and delicious amino acids (DAA) (quadratic effect, P < 0.01) content in breast muscle; the highest DAA content was obtained when the diet with 0.2% exogenous IMP was fed (Table 4). There were significant effects of IMP level in diet on the Cys (quadratic effect, P < 0.05), Ile (quadratic effect, P < 0.05), His (exponential, linear, and quadratic effect, P < 0.05), and Leu (quadratic effect, P < 0.05) content in thigh muscle. FAA and DAA content in thigh muscle showed an exponential and linear response (P < 0.05), and quadratic response (P < 0.01) to the increasing dietary IMP level (Table 5). The highest FAA and DAA content was obtained when the diet with 0.2% exogenous IMP was fed (Table 4). Table 4. Effects of exogenous inosine monophosphate on the amino acid contents of the breast muscle (Pectoralis major) tissue (mg/100 g).1 Items2  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Asp*  1.65  2.40  2.17  2.63  1.90  0.11  0.359  0.427  0.075  Thr**  2.20  2.95  2.63  2.93  2.35  0.10  0.580  0.695  0.056  Ser*  2.03  2.53  1.90  2.53  1.95  0.09  0.710  0.831  0.074  Glu*  3.95  4.93  4.13  4.97  4.43  0.14  0.587  0.616  0.544  Gly*  0.75  1.13  1.03  1.27  1.10  0.05  0.034  0.054  <0.01  Ala*  2.03  2.98  3.23  3.07  2.40  0.12  0.562  0.668  <0.01  Cys  1.68  1.75  1.78  1.63  2.05  0.06  0.536  0.796  0.912  Val**  2.03  2.55  1.95  2.40  2.08  0.09  0.020  0.391  0.050  Met**  1.48  1.75  1.50  1.63  1.48  0.06  0.103  0.483  0.109  Ile**  1.00  1.28  1.08  1.33  0.98  0.06  0.034  0.541  0.023  Phe**  3.35  4.05  4.15  4.10  4.08  0.13  0.772  0.257  0.039  Lys**  5.17  5.23  4.08  3.67  5.63  0.25  0.984  0.845  0.203  His  1.60  2.90  1.67  1.37  3.25  0.23  0.602  0.143  0.086  Arg*  1.18  1.55  1.83  1.27  1.37  0.07  0.095  0.876  0.123  Tyr  1.38  1.40  1.25  1.17  1.28  0.09  0.359  0.520  0.794  Leu**  4.20  4.60  4.00  4.53  4.40  0.11  0.145  0.993  0.625  Pro  1.80  2.53  2.30  2.87  2.28  0.11  0.094  0.362  0.078  FAA  33.98  48.30  42.33  47.47  45.28  1.55  0.031  0.046  0.023  EAA  17.58  22.40  19.25  20.60  20.98  1.18  0.239  0.278  0.398  DAA  8.80  15.22  13.13  15.73  12.75  0.93  0.070  0.107  <0.01  Items2  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Asp*  1.65  2.40  2.17  2.63  1.90  0.11  0.359  0.427  0.075  Thr**  2.20  2.95  2.63  2.93  2.35  0.10  0.580  0.695  0.056  Ser*  2.03  2.53  1.90  2.53  1.95  0.09  0.710  0.831  0.074  Glu*  3.95  4.93  4.13  4.97  4.43  0.14  0.587  0.616  0.544  Gly*  0.75  1.13  1.03  1.27  1.10  0.05  0.034  0.054  <0.01  Ala*  2.03  2.98  3.23  3.07  2.40  0.12  0.562  0.668  <0.01  Cys  1.68  1.75  1.78  1.63  2.05  0.06  0.536  0.796  0.912  Val**  2.03  2.55  1.95  2.40  2.08  0.09  0.020  0.391  0.050  Met**  1.48  1.75  1.50  1.63  1.48  0.06  0.103  0.483  0.109  Ile**  1.00  1.28  1.08  1.33  0.98  0.06  0.034  0.541  0.023  Phe**  3.35  4.05  4.15  4.10  4.08  0.13  0.772  0.257  0.039  Lys**  5.17  5.23  4.08  3.67  5.63  0.25  0.984  0.845  0.203  His  1.60  2.90  1.67  1.37  3.25  0.23  0.602  0.143  0.086  Arg*  1.18  1.55  1.83  1.27  1.37  0.07  0.095  0.876  0.123  Tyr  1.38  1.40  1.25  1.17  1.28  0.09  0.359  0.520  0.794  Leu**  4.20  4.60  4.00  4.53  4.40  0.11  0.145  0.993  0.625  Pro  1.80  2.53  2.30  2.87  2.28  0.11  0.094  0.362  0.078  FAA  33.98  48.30  42.33  47.47  45.28  1.55  0.031  0.046  0.023  EAA  17.58  22.40  19.25  20.60  20.98  1.18  0.239  0.278  0.398  DAA  8.80  15.22  13.13  15.73  12.75  0.93  0.070  0.107  <0.01  1Values are the means of 6 replicates (1 bird from each replicate were analyzed). 2FAA, free amino acids, EAA, essential amino acids, DAA, delicious amino acids. **Essential amino acids, including Thr, Val, Met, Ile, Phe, Lys, Leu. *Delicious amino acids, including Asp, Ser, Glu, Gly, Ala, Arg. View Large Table 5. Effects of exogenous inosine monophosphate on the amino acid contents of the thigh muscle (drumstick) tissue (mg/100 g).1 Items2  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Asp*  2.63  4.03  3.68  5.10  2.68  0.27  0.659  0.888  0.061  Thr**  4.78  4.18  5.30  4.28  3.58  0.36  0.316  0.403  0.543  Ser*  3.83  3.00  2.83  3.50  2.95  0.14  0.750  0.733  0.826  Glu*  3.75  5.53  5.55  7.25  5.23  0.29  0.311  0.320  0.143  Gly*  2.53  1.88  1.78  2.08  2.00  0.12  0.568  0.665  0.369  Ala*  4.33  3.83  3.68  4.28  3.03  0.21  0.255  0.302  0.474  Cys  1.93  2.10  2.30  1.88  1.75  0.06  0.086  0.099  0.030  Val**  1.50  2.08  2.20  2.25  1.85  0.07  0.750  0.749  0.216  Met**  1.63  1.65  1.63  1.58  1.43  0.05  0.381  0.346  0.411  Ile**  1.23  1.25  1.40  1.38  0.93  0.08  0.417  0.497  0.035  Tyr  1.30  1.13  1.25  1.28  1.13  0.04  0.859  0.806  0.191  Phe**  4.18  4.20  4.15  4.30  3.63  0.13  0.704  0.708  0.239  Lys**  1.68  1.55  1.90  1.73  3.30  0.31  0.631  0.699  0.237  His  0.75  0.80  0.78  0.98  1.15  0.05  0.011  <0.01  0.037  Leu**  3.10  4.48  4.88  5.18  3.88  0.17  0.994  0.990  0.028  Arg*  0.80  1.85  1.70  1.95  2.53  0.15  0.346  0.267  0.427  Pro  1.80  2.58  2.28  2.45  2.85  0.09  0.642  0.589  0.170  FAA  39.47  48.68  50.13  59.43  48.07  1.76  0.026  0.032  <0.01  EAA  17.60  19.38  21.45  20.68  18.58  0.84  0.389  0.373  0.274  DAA  11.25  20.10  19.20  24.15  18.40  1.18  0.030  0.022  <0.01  Items2  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Asp*  2.63  4.03  3.68  5.10  2.68  0.27  0.659  0.888  0.061  Thr**  4.78  4.18  5.30  4.28  3.58  0.36  0.316  0.403  0.543  Ser*  3.83  3.00  2.83  3.50  2.95  0.14  0.750  0.733  0.826  Glu*  3.75  5.53  5.55  7.25  5.23  0.29  0.311  0.320  0.143  Gly*  2.53  1.88  1.78  2.08  2.00  0.12  0.568  0.665  0.369  Ala*  4.33  3.83  3.68  4.28  3.03  0.21  0.255  0.302  0.474  Cys  1.93  2.10  2.30  1.88  1.75  0.06  0.086  0.099  0.030  Val**  1.50  2.08  2.20  2.25  1.85  0.07  0.750  0.749  0.216  Met**  1.63  1.65  1.63  1.58  1.43  0.05  0.381  0.346  0.411  Ile**  1.23  1.25  1.40  1.38  0.93  0.08  0.417  0.497  0.035  Tyr  1.30  1.13  1.25  1.28  1.13  0.04  0.859  0.806  0.191  Phe**  4.18  4.20  4.15  4.30  3.63  0.13  0.704  0.708  0.239  Lys**  1.68  1.55  1.90  1.73  3.30  0.31  0.631  0.699  0.237  His  0.75  0.80  0.78  0.98  1.15  0.05  0.011  <0.01  0.037  Leu**  3.10  4.48  4.88  5.18  3.88  0.17  0.994  0.990  0.028  Arg*  0.80  1.85  1.70  1.95  2.53  0.15  0.346  0.267  0.427  Pro  1.80  2.58  2.28  2.45  2.85  0.09  0.642  0.589  0.170  FAA  39.47  48.68  50.13  59.43  48.07  1.76  0.026  0.032  <0.01  EAA  17.60  19.38  21.45  20.68  18.58  0.84  0.389  0.373  0.274  DAA  11.25  20.10  19.20  24.15  18.40  1.18  0.030  0.022  <0.01  1Values are the means of 6 replicates (1 bird from each replicate were analyzed). 2FAA, free amino acids, EAA, essential amino acids, DAA, delicious amino acids. **Essential amino acids, including Thr, Val, Met, Ile, Phe, Lys, Leu. *Delicious amino acids, including Asp, Ser, Glu, Gly, Ala, Arg. View Large Dietary IMP supplementation had a quadratic effect on 5΄-NT and ALP enzyme activity in breast muscle (P < 0.05); no difference of ATPase and ACP activity in breast muscle were observed. ATPase enzyme activity in the thigh muscles increased exponentially and linearly with the IMP level in diet (exponential effect, P = 0.061; linear effect, P = 0.059). The 0.2% exogenous IMP group had the lowest 5΄-NT enzyme activity in breast muscle, while the 0.3% exogenous IMP group had the highest ATPase enzyme activity in thigh muscle (Table 6). Table 6. Effects of exogenous inosine monophosphate on relative enzyme activity in muscle tissues (U/g prot).1 Items  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Breast muscle (Pectoralis major)  ATPase  3.95  4.11  4.30  3.97  3.89  0.14  0.359  0.390  0.418  ACP  5.34  4.04  4.81  4.20  5.26  0.17  0.742  0.743  0.186  5-NT  6.88  5.31  5.06  4.79  5.73  0.22  0.339  0.271  0.025  ALP  5.38  4.17  4.40  4.63  5.09  0.20  0.291  0.216  0.024  Thigh muscle (drumstick)  ATPase  3.76  4.19  4.66  4.18  4.82  0.14  0.061  0.059  0.179  ACP  5.20  4.32  4.99  4.87  4.75  0.14  0.874  0.830  0.553  5-NT  5.44  5.08  5.73  4.78  4.99  0.13  0.143  0.141  0.348  ALP  4.84  3.91  4.59  4.61  4.15  0.53  0.411  0.390  0.318  Items  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Breast muscle (Pectoralis major)  ATPase  3.95  4.11  4.30  3.97  3.89  0.14  0.359  0.390  0.418  ACP  5.34  4.04  4.81  4.20  5.26  0.17  0.742  0.743  0.186  5-NT  6.88  5.31  5.06  4.79  5.73  0.22  0.339  0.271  0.025  ALP  5.38  4.17  4.40  4.63  5.09  0.20  0.291  0.216  0.024  Thigh muscle (drumstick)  ATPase  3.76  4.19  4.66  4.18  4.82  0.14  0.061  0.059  0.179  ACP  5.20  4.32  4.99  4.87  4.75  0.14  0.874  0.830  0.553  5-NT  5.44  5.08  5.73  4.78  4.99  0.13  0.143  0.141  0.348  ALP  4.84  3.91  4.59  4.61  4.15  0.53  0.411  0.390  0.318  1Values are the means of 6 replicates (2 birds from each replicate were analyzed). View Large AMPD1 gene expression of the breast muscle showed a quadratic response to the increasing dietary IMP level (P = 0.061), while there was no difference in ADSL and ATIC gene expression of the breast muscle (P ≥ 0.05). ATIC gene expression in thigh muscle had a quadratic response to the increasing dietary IMP level (P < 0.05), ADSL and AMPD1 gene expression had no significant response to the increasing dietary IMP level (P ≥ 0.05). The 0.2% exogenous IMP group had the highest (AMPD1) gene expression of the breast muscle and ATIC gene expression of the thigh muscle (Table 7). Table 7. Effects of exogenous inosine monophosphate on gene expression in muscle tissue.1 Items  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Breast muscle (Pectoralis major)  ADSL  0.0211  0.0361  0.0538  0.0233  0.0260  0.004  0.780  0.934  0.271  AMPD1  0.01392  0.0452  0.0425  0.0525  0.0208  0.005  0.685  0.801  0.061  ATIC  0.0005  0.0010  0.0009  0.0006  0.0008  0.00007  0.809  0.656  0.910  Thigh muscle (drumstick)  ADSL  0.0504  0.0868  0.0548  0.0532  0.0529  0.007  0.992  0.901  0.909  AMPD1  0.1871  0.2668  0.0364  0.1109  0.1264  0.031  0.123  0.293  0.434  ATIC  0.0009  0.0014  0.0014  0.0015  0.0011  0.0009  0.219  0.320  0.043  Items  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Breast muscle (Pectoralis major)  ADSL  0.0211  0.0361  0.0538  0.0233  0.0260  0.004  0.780  0.934  0.271  AMPD1  0.01392  0.0452  0.0425  0.0525  0.0208  0.005  0.685  0.801  0.061  ATIC  0.0005  0.0010  0.0009  0.0006  0.0008  0.00007  0.809  0.656  0.910  Thigh muscle (drumstick)  ADSL  0.0504  0.0868  0.0548  0.0532  0.0529  0.007  0.992  0.901  0.909  AMPD1  0.1871  0.2668  0.0364  0.1109  0.1264  0.031  0.123  0.293  0.434  ATIC  0.0009  0.0014  0.0014  0.0015  0.0011  0.0009  0.219  0.320  0.043  1Values are the means of 6 replicates (2 birds from each replicate were analyzed). View Large DISCUSSION Inosine monophosphate, a nucleotide dietary supplement, is closely associated with animal growth and immune and intestinal healthy and is particularly important in the early stages of animal growth. IMP is the main product in the de novo synthesis process of nucleotides (Mateo, 2005). Although nucleotides can be synthesized by de novo synthesis, it may be useful to supplement with exogenous nucleotides during rapid growth periods or under stressful conditions (Frankič et al., 2006). Inosine monophosphate, as the intermediate metabolite of nucleotide de novo synthesis (Mateo, 2005), could synthesize other functional nucleotides (Stein and Kil, 2006). Exogenous IMP could remit the stress of nucleotide de novo synthesis and increase feed intake by stimulating taste receptors (Kubitza et al., 1997). Song et al. (2012) also reported that the growth of flounder could be improved by supplementation of 0.1% to 0.2% IMP in the diet. However, few studies have examined the effects of adding exogenous nucleotides to broiler chicken diets. Here, broiler diets were supplemented with varying doses of exogenous IMP, during the early growth stage of broilers, the feed gain ratio of 0.3% IMP group reduced by 2.58% compared with the control group. These results are in accord with those of Weaver and Kim (2014) in pigs. Some studies have also shown that pure nucleotide complexes could increase the feed intake of weaned piglets (Sauer et al., 2012). In this experiment, the feed intake of the 0.2% IMP group was the highest in the later growth stage of broilers. Inosine monophosphate is thought to be an important umami substance that stimulates taste and promotes animal feeding after it enters the digestive tract. However, because chickens have a low taste intensity, the presence of IMP may not be sufficient to increase appetite. Alternatively, increased feed intake might be due to the growth promoting properties of IMP. Throughout the growth period, there were no significant differences in the growth performance of broilers among all groups; a similar result was found by Lee et al. (2007). Inosine monophosphate is one of the important components in producing the umami flavor and important for meat flavor evaluation (Calkins and Hodgen, 2007). Adding exogenous nucleotides is an effective way to increase the amount of IMP in muscle tissues. Exogenous IMP could be digested and absorbed directly for nucleotide synthesis, which reduces energy consumption in the process of nucleotide de novo synthesis and increases the amount of ATP and IMP. Zhang et al. (2008b) reported that exogenous IMP could significantly increase the amount of IMP in boiler chest muscle, with 0.25% supplementation providing the optimum level. In this experiment, supplementing with 0.2% and 0.3% exogenous IMP significantly increased the amount of IMP in muscle tissue; this result is similar to that of Wang et al. (2014). The added dietary IMP may have been absorbed and transformed into ATP, thereby increasing the ATP content, which increased the content of IMP in the tissues. The addition of nucleotides may also have affected enzyme activity related to IMP metabolism. The nutritional value and flavor of muscle tissues are determined by the species and content of free amino acids in the tissues. Five amino acids (aspartate, glutamate, glycine, alanine and arginine) are the precursor substances comprising meat flavor and directly affect how delicious meat is considered (Mohamed et al., 2014). Oike et al. (2006) reported that so-called delicious amino acids could directly activate the ion channel in the taste pathway in type II recipient cells, which determine flavor and sweetness, thus improving the flavor of chicken and keeping the muscles delicious, tender, and smooth. Higher contents of delicious amino acids in muscle tissues correspond with higher meat quality. In this experiment, 0.2% exogenous IMP significantly increased the contents of delicious amino acids and total free amino acids in breast and thigh muscles. The most important substances in delicious amino acids are glutamate and glycine, which can decrease bitterness and remove unpleasant tastes from food. Glutamate and glycine also provide a sweet fragrance. In contrast, arginine works through inositol and glycerol phosphocholine, enhancing the synthesis and deposition of body proteins and the degradation of fat, and improving carcass composition (He et al., 2009). The main factor affecting the content of IMP in animals is the presence of enzymes involved in the process of IMP anabolism. ATP is the primary enzyme in the IMP generation process, and 5΄-nucleotidase and phosphatase are the enzymes related to IMP degradation. The enzyme a+-K+∼ATP, a protein embedded in the lipid bilayer of the cytoplasmic membrane, is the main factor that determines the speed of ATP decomposition (Gorini et al., 2002). After animal death, the sarcoplasmic reticulum disintegrates and loses function, including the calcium pump. Calcium is released, activating the myosin ATP enzyme, which causes a large amount of ATP decomposition. Inosine monophosphate is produced by ATP degradation after animal death. Therefore, ATP degrading enzyme is involved in the synthesis of IMP. The results of this experiment showed that 0.3% exogenous IMP group had the highest ATPase enzyme activity in thigh muscle, which is similar to the results of Wang et al. (2014). However, Zhang et al. (2008a) demonstrated that there were no significant effects of exogenous IMP on ATP enzyme activity in muscle tissues. IMP degrading enzymes primarily include 5΄-nucleotidase and phosphatase. These enzymes can catalyze the partial 5΄-end carbon phosphate of ribose or deoxyribose in some nucleic acid molecules and thus affect the nucleic acid content in the cell (Gallier et al., 2011). Therefore, 5΄-nucleotidase is one of the compounds that effects the stability of IMP. Phosphatase primarily catalyzes nucleic acid molecules by removing the 5΄ phosphate group and reducing the content of IMP. To increase the content of IMP in the muscle tissues of livestock and poultry, IMP decomposition needs to be prevented. In our studies, dietary IMP supplementation had a quadratic effect on ALP enzyme activity in breast muscle, and 0.2% exogenous IMP group had the lowest 5΄-NT enzyme activity in breast muscle. The trend simultaneously indicated that more is not always better. Without considering the influence of strain, sex, and size, enzymes associated with ATP metabolism could be the important factor that affected the amount of IMP in broilers’ muscle. The enzymes involved include ATPase, 5΄-nucleotidase, and phosphatase. Inosine 5΄-monophosphate is the intermediate product in ATP metabolism, so there should be a positive correlation between the concentration of IMP in muscle and ATP hydrolase activity as well as a negative correlation between the concentration of IMP in muscle and IMP degrading enzyme activity. Dietary nucleic acids and nucleotides should be enzymatically hydrolyzed before absorption and they were absorbed mainly in the form of nucleosides and small molecular nucleotides (Bronk and Hastewell, 1987). Nucleotides with highly negatively charged phosphate groups hinder absorption. Thus, nucleotides enter enterocytes mainly in the form of nucleosides and the effective process is carried out mainly by facilitated diffusion and by special sodium ion-dependent carrier mediated mechanisms (Bronk and Hastewell, 1987). Nucleosides, endogenous nucleotides, and partial dietary metabolic products are transported into muscle tissue through the circulation system. While one portion of the products were decomposed into uric acid or β-alanine and excreted, the others were resynthesized for nucleotides and participated in metabolism again (Carver and Walker, 1995; Thorell et al.,1996). Therefore, as a type of small molecular nucleotide, partial dietary IMP is likely to be absorbed directly. However, little IMP exists in muscle of live animals, and the deposition of IMP in muscle basically occurs during the progression of rigor mortis. Further studies may help to clarify the mechanism. There are 10 steps for the de novo synthesis of the nucleotide IMP. ADSL, AMPD1, and ATIC are essential enzymes involved in this de novo purine biosynthesis, which catalyzes 2 steps in the synthesis (Aimi et al., 1990). Considering the important role of these 3 genes in IMP synthesis, ADSL, AMPD1, and ATIC genes were chosen as a candidate gene for IMP content of chicken muscle in this study. The ADSL gene has typical housekeeping gene features. It plays an important role in the biological pathways of purine nucleotide de novo synthesis and maintains the proportion of ATP/ AMP in muscle tissues. ADSL is vitally important to the content of IMP and maintaining normal cell division and metabolism (Xu et al., 2011). ADSL gene mutations can decrease IMP synthetic ability in vivo and may result in a series of neurological disorders (Lundy et al., 2010). High ADSL gene expression can cause the mass synthesis of purine nucleotides. Purine nucleotides are the material of ATP synthesis, and muscle movement requires a large amount of ATP to provide energy. Therefore, ADSL expression is the highest in muscle tissues (Yuan et al., 2011). Single nucleotide polymorphisms in the ADSL gene have been shown to affect the content of IMP in muscle tissues (Shu et al., 2009; Ye et al., 2010), whereas the effects of exogenous IMP on gene expression in muscle tissues have not been reported. Our results haven’t showed strong correlation between the content of IMP in muscle and ADSL expression, which is probably because the purine-biosynthetic pathway is ultimately responsible for the generation of inosine 5΄-monophosphate from α-D-ribose-5-phosphate (Zhang et al., 2008a) and provides the essential purine nucleotides required for DNA replication and cell division. The pathway consists of 10 enzyme-catalyzed steps in vertebrates (Hartman and Buchanan, 1959) and 11 in Escherichia coli (Mueller et al., 1994); if one of the enzymes changed, the IMP content would be different, furthermore, we have showed the difference in mRNA expressional level of the ADSL gene, and have not studied the difference in protein level, future research would helpful for clearing the correlation of IMP content with ADSL gene expression. ATIC is the only bifunctional enzyme with 2 enzymes catalytic activity in the biosynthetic pathway of purine nucleotide synthesis. The research of Greasley et al. (2001) on the crystal structure of the chicken ATIC gene showed that the N-extremity of ATIC activates inosine 5΄-monophosphate dehydrogenase (IMPCH), while the C-extremity activates aminoimidazole carboxamide ribonucleotide transformylase (AICARTfase). The distance between the activity centers of the IMPCH and AICARTfase enzymes is approximately 50A. There is no intermediate connecting channel between these 2 activity centers, which plays an important regulatory role in the synthesis of IMP. ATIC gene expression in the thigh muscle of the 0.2% IMP group was significantly increased. The AMPD1 gene is primarily expressed in muscle tissues and involved in the metabolism of IMP. Therefore, the AMPD1 gene can be considered to be a candidate gene that affects the IMP content. Hu et al. (2015) reported that polymorphisms of AMPD1 (single nucleotide polymorphisms [SNPs]) in broiler chickens were related to the IMP content and could be a possible candidate marker for the IMP content. Here, 0.2% exogenous IMP group had the highest (AMPD1) gene expression of the breast muscle. The effects of exogenous IMP on related gene expression in muscle tissues of livestock and poultry has not been reported previously. The results of this experiment implied that diet supplementation with exogenous IMP probably play an important role in increasing related gene expression. CONCLUSION In summary, dietary supplementation with IMP did not affect growth performance of the broilers. Supplementation with 0.2 to 0.3% exogenous IMP promoted the deposition of IMP in the muscle tissues, increased FAA and DAA content in muscle, increased enzymes involved in the process of IMP generation, and decreased the enzymes related to IMP degradation. These results indicate that dietary IMP didn’t affect the growth performance of chicken, the diet with 0.2 to 0.3% exogenous IMP is optimal to improve the meat flavor quality in chicken. Acknowledgements This work was supported by the National Science Foundation of China (no.31302006) and Jiangsu Province Agricultural Science and Technology Autonomous Innovation Fund Project (CX(14)5034). REFERENCES Aimi J, Qiu H., Williams J., Zalkin H., Dixon J. E.. 1990. De novopurine nucleotide biosynthesis: cloning of human and avian cDNAs encoding the trifunctional glycinamide ribonucleotide synthetase-aminoimidazole ribonculeotide synthetase-glycinamide ribonucleotide transformylase by functional complementation in E. coli. Nucleic Acids Res . 18: 6665– 6672. Google Scholar CrossRef Search ADS PubMed  Bronk J. R., Hastewell J. G.. 1987. The transport of pyrimidines into tissue rings cut from rat small intestine. J. Physiol.  382: 475– 488. Google Scholar CrossRef Search ADS PubMed  Calkins C. R., Hodgen J. M.. 2007. A fresh look at meat flavor. Meat Sci . 77: 63– 80. Google Scholar CrossRef Search ADS PubMed  Carver J. D., Walker W. A.. 1995. The role of nucleotides in human nutrition. Nutr. Biochem.  6: 58– 72. Google Scholar CrossRef Search ADS   Frankič T., Pajk T., Rezar V., Levart A., Salobir J.. 2006. The role of dietary nucleotides in reduction of DNA damage induced by T-2 toxin and deoxynivalenol in chicken leukocytes. Food Chem. Toxicol.  44: 1838– 1844. Google Scholar CrossRef Search ADS PubMed  Fujimura S., Koga H., Takeda H., Tone N., Kadowaki M., Ishibashi T.. 1996. Role of taste-active components, glutamic acid, 5΄-inosinic acid and potassium ion in taste of chicken meat extract. Anim. Sci. Technol . 423– 429. Fujimura S., Kawano S., Koga H., Takeda H., Kadowaki M., Ishibashi T.. 1995. Identification of taste-active components in the chicken meat extract by omission test-involvement of glutamic acid, IMP and potassium ion. Anim. Sci. Technol . 43– 51. Gallier F., Lallemand P., Meurillon M.. 2011. Structural insights into the inhibition of cytosolic 5΄-nucleotidase II (cN-II) by ribonucleoside 5΄-monophosphate analogues. PLoS Comput. Biol . 7: e1002295. Google Scholar CrossRef Search ADS PubMed  Gorini A., Canosi U., Devecchi E.. 2002. ATPases enzyme activities during ageing in different types of somatic and synaptic plasma membranes from rat frontal cerebral cortex. Prog. Neuro-Psychopharmacol. Biol. Psychiatry  26: 81– 90. Google Scholar CrossRef Search ADS   Greasley S. E., PIorton P. A., Ramcharan J.. 2001. Crystal structure of a bifunctional transformylase and cyclohydrolase enzyme in purine biosynthesis. Nat. Struct. Biol.  8: 402– 406. Google Scholar CrossRef Search ADS PubMed  Hartman S. C., Buchanan J. M.. 1959. Nucleic acids, purines, pyrimidines (nucleotide synthesis). Annu. Rev. Biochem . 28: 365– 410. Google Scholar CrossRef Search ADS PubMed  He Q., Kong X., Wu G.. 2009. Metabolomic analysis of the response of growing pigs to dietary L- arginine supplementation. Amino Acids . 37: 199– 208. Google Scholar CrossRef Search ADS PubMed  Hofbauer P., Smulders F. J. M., Vodnansky M.. 2010. A note on meat quality traits of pheasants (Phasianus colchicus). Eur. J. Wildl. Res . 56: 809– 813. Google Scholar CrossRef Search ADS   Hu J., Yu P., Ding X. L.. 2015. Genetic polymorphisms of the AMPD1 gene and their correlations with IMP contents in Fast Partridge and Lingshan chickens. J. Gene.  574: 204– 209. Google Scholar CrossRef Search ADS   Jayasena D. D., Ahn D. U., Nam K. C., Jo C.. 2013. Flavour chemistry of chicken meat: A review. Asian-Australas. J. Anim. Sci.  26: 732– 742. Google Scholar CrossRef Search ADS PubMed  Jung S., Bae Y. S., Kim H. J., Jayasena D. D., Lee J. H., Park H. B., Heo K. N., Jo C.. 2013. Carnosine, anserine, creatine, and inosine 5΄-monophosphate contents in breast and thigh meats from five lines of Korean native chicken. Poult. Sci.  92: 3275– 3282. Google Scholar CrossRef Search ADS PubMed  Joo S. T., Kim G. D.. 2011. Meat quality traits and control technologies. In: Control of Meat Quality  (Ed. Joo S. T). Research Signpost, Kerala: pp. 1– 20. Kobayashi H., Nakashima K., Ishida A., Ashihara A., Katsumata M.. 2013. Effects of low protein diet and low protein diet supplemented with synthetic essential amino acids on meat quality of broiler chickens. Anim Sci J . 84: 489– 495. Google Scholar CrossRef Search ADS PubMed  Kubitza F., Lovshin L. L., Lovell R. T.. 1997. Identification of feed enhancers for juvenile largemouth bass Micropterus salmoides. Aquaculture . 148: 191– 200. Google Scholar CrossRef Search ADS   Lee D. N., Liu S. R., Chen Y. T., Wang R. C., Lin S. Y., Weng C. F.. 2007. Effects of diets supplemented with organic acids and nucleotides on growth, immune responses and digestive tract development in weaned pigs. J. Anim. Physiol. Anim. Nutr.  91: 508– 518. Google Scholar CrossRef Search ADS   Lee H. Y., Kim J. M., Byun M. J.. 2011. Structure and polymorphisms of the 5΄ regulatory region of porcine adenylate kinase 3-like 1 gene and effect on trait of meat quality. Genes Genom . 33: 147– 153. Google Scholar CrossRef Search ADS   Li W. G., Jiao F. L., Wu Z. J., Yan Y., Shen C., Sui C.. 2011. Improvement of flavor and pork quality. J. Food Eng.  4: 7– 10. Lundy C. T., Jungbluth H., Pohl K. R.. 2010. Adenylosuccinate lyase deficiency in the United Kingdom pediatric population: first 3 cases. Pediatr. Neurol.  43: 351– 354. Google Scholar CrossRef Search ADS PubMed  Masic U., Yeomans M. R.. 2014. Umami flavor enhances appetite but also increases satiety. Am. J. Clin. Nutr.  100: 532– 538. Google Scholar CrossRef Search ADS PubMed  Mateo C. D. 2005. Aspects of Nucleotide Nutrition in Pigs . PhD Diss. South Dakota State Univ., Brookings, SD. Mohamed A. R., Cidalia P., Xavier Malcata F.. 2014. Evolution of amino acids and biogenic amines throughout storage in sausages made of horse, beef and turkey meats. Meat Sci . 96: 82– 87. Google Scholar CrossRef Search ADS PubMed  Mueller E. J., Meyer E., Rudolph J., Davisson V. J., Stubbe J. 1994. N5-carboxyaminoimidazole ribonucleotide: evidence for a new intermediate and two new enzymatic activities in the de novo purine biosynthetic pathway of Escherichia coli. Biochemistry . 33: 2269– 2278. Google Scholar CrossRef Search ADS PubMed  Narukawa M., Morita K., Hayashi Y.. 2008. L-theanine elicits an umami taste with inosine 5΄-monophosphate. Biosci. Biotechnol. Biochem . 72: 3015– 3017. Google Scholar CrossRef Search ADS PubMed  Oike H., Wakamori M., Mori Y.. 2006. Arachidonic acid can function as a signaling modulator by activating the TRPM5 cation channel in taste receptor cells. Biochim. Biophys. Acta.  1761: 1078– 1084. Google Scholar CrossRef Search ADS PubMed  Sasaki K., Motoyama M., Mitsumoto M.. 2007. Changes in the amounts of water-soluble umami-related substances in porcine longissimus and biceps femoris muscles during moist heat cooking. Meat Sci . 77: 167– 172. Google Scholar CrossRef Search ADS PubMed  Sauer N., Eklund M., Bauer E., Gänzle M. G., Field C. J., Zijlstra R. T., Mosenthin R.. 2012. The effects of pure nucleotides on performance, humoral immunity, gut structure and numbers of intestinal bacteria of newly weaned pigs. J. Anim. Sci.  90: 3126– 3134. Google Scholar CrossRef Search ADS PubMed  Shu J. T., Bao W. B., Zhang H. X., Chen K. W.. 2009. Combined effect of mutations in ADSL and GARS-AIRS-GART genes on IMP content in chickens. Br. Poult. Sci.  50: 680– 686. Google Scholar CrossRef Search ADS PubMed  Song J. W., Limb S. J., Lee K. J.. 2012. Effects of dietary supplementation of inosine monophosphate on growth performance, innate immunity and disease resistance of olive flounder (Paralichthys olivaceus). Fish Shellfish Immunol . 33: 1050– 1054. Google Scholar CrossRef Search ADS PubMed  Stein H. H., Kil D. Y.. 2006. Reduced use of antibiotic growth promoters in diets fed to weanling pigs: Dietary tools, part 2. Anim. Biotechnol . 17: 217– 231. Google Scholar CrossRef Search ADS PubMed  Suzuki A., Kojima N., Ikeuchi Y., Ikarashi S., Moriyama N., Ishizuka T., Tokushige H.. 1991. Carcass composition and meat quality of Chinese purebred and European × Chinese crossbred pigs. Meat Sci . 29: 31– 41. Google Scholar CrossRef Search ADS PubMed  Thorell L., Sjoberg L. B., Hernell O.. 1996. Nucleotides in human milk: Sources and metabolism by the newborn infant. Pediatr. Res.  40: 845– 852. Google Scholar CrossRef Search ADS PubMed  Wang X. F., Liu G. H., Cai H. Y.. 2014. Attempts to increase inosinic acid in broiler meat by using feed additives. Poult. Sci.  93: 1– 7. Google Scholar CrossRef Search ADS PubMed  Weaver A. C., Kim S. W.. 2014. Supplemental nucleotides high in inosine 5΄-monophosphate to improve the growth and health of nursery pigs. J. Anim. Sci.  92: 645– 651. Google Scholar CrossRef Search ADS PubMed  Xu S. J., Yu D. B., Du W. X.. 2011. Current research advances in IMP and related enzymes. Biotechnol. Bull.  3: 44– 53. Ye M. H., Chen J. L., Zhao G. P.. 2010. Correlation between polymorphisms in ADSL and GARS-AIRS-GART genes with inosine 5΄-monophosphate (IMP) contents in Beijing-you chickens. Br. Poult. Sci.  51: 609– 613. Google Scholar CrossRef Search ADS PubMed  Yuan T., Gu J. R., Gu W. B.. 2011. Molecular cloning, characterization and expression analysis of adenylosuccinate lyase gene in grass carp (Ctenopharyngodon idella). Mol. Biol. Rep.  38: 2059– 2065. Google Scholar CrossRef Search ADS PubMed  Zhang Y., Morar M., Ealick. S. E. 2008a. Structural biology of the purine biosynthetic pathway. Cel. Mol. Life. Sci.  65: 3699– 3724. Google Scholar CrossRef Search ADS   Zhang G. Q., Ma Q. G., Ji C.. 2008b. Effects of dietary inosinic acid on carcass characteristics, meat quality, and deposition of inosinic acid in broilers. Poult. Sci.  87: 1364– 1369. Google Scholar CrossRef Search ADS   © 2018 Poultry Science Association Inc. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Effects of exogenous inosine monophosphate on growth performance, flavor compounds, enzyme activity, and gene expression of muscle tissues in chicken

Loading next page...
 
/lp/ou_press/effects-of-exogenous-inosine-monophosphate-on-growth-performance-wTszK7NO8y
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pex415
Publisher site
See Article on Publisher Site

Abstract

Abstract The goal of this experiment was to examine effects of diets supplemented with exogenous inosine monophosphate (IMP) on the growth performance, flavor compounds, enzyme activity and gene expression of chicken. A total of 1,500 healthy, 1-day-old male 3-yellow chickens were used for a 52-d experimental period. Individuals were randomly divided into 5 groups (group I, II, III, IV, V) with 6 replicates per group, and fed a basal diet supplemented with 0.0, 0.05, 0.1, 0.2, and 0.3% IMP, respectively. There was no significant response to the increasing dietary IMP level in average daily feed intake (ADFI), average daily gain (ADG), and feed:gain ratio (F/G) (P ≥ 0.05). IMP content of the breast and thigh muscle showed an exponential and linear response to the increasing dietary IMP level (P < 0.05), the highest IMP content was obtained when the diet with 0.3% and 0.2% exogenous IMP was fed. There were significant effects of IMP level in diet on free amino acids (FAA) (exponential, linear and quadratic effect, P < 0.05) and delicious amino acids (DAA) (quadratic effect, P < 0.01) content in breast muscle. FAA and DAA content in thigh muscle showed an exponential and linear response (P < 0.05), and quadratic response (P < 0.01) to the increasing dietary IMP level, the highest FAA and DAA content was obtained when the diet with 0.2% exogenous IMP was fed. Dietary IMP supplementation had a quadratic effect on 5΄-NT and the alkaline phosphatase (ALP) enzyme activity in the breast muscle (P < 0.05), and the adenosine triphosphate (ATP) enzyme activity in the thigh muscles increased exponentially and linearly with increasing IMP level in diet (exponential effect, P = 0.061; linear effect, P = 0.059). Cyclohydrolase (ATIC) gene expression in thigh muscle had a quadratic response to the increasing dietary IMP level (P < 0.05), 0.2% exogenous IMP group had the highest (AMPD1) gene expression of the breast muscle and ATIC gene expression of the thigh muscle. These results indicate that dietary IMP did not affect the growth performance of chicken, the diet with 0.2 to 0.3% exogenous IMP is optimal to improve the meat flavor quality in chicken. INTRODUCTION Poultry with delicious and uniquely flavored meat is becoming more and more popular (Hofbauer et al., 2010). Meat flavor, one of the most important eating quality parameters, is primarily composed of taste and aroma (Sasaki et al., 2007; Jayasena et al., 2013a). Continued consumption of meat and meat products can be ensured through a tasty, nutritious, and safe meat supply for the consumers (Joo and Kim, 2011). Taste is an important factor that determines meat quality (Kobayashi et al., 2013). The taste active components in chicken meat extract include free glutamic acid, 5΄-inosinic acid, and potassium ion. Among these, inosine monophosphate (IMP)is called an umami taste and is a favorite among consumers (Suzuki et al., 1991; Fujimura et al., 1995; Fujimura et al., 1996). IMP is a flavor enhancer that is 50 times more potent than monosodium glutamate. IMP can improve the meat flavor of livestock and poultry (Masic and Yeomans, 2014; Narukawa et al., 2008) and is used internationally as an important index for measuring meat flavor (Li et al., 2011; Lee et al., 2011). Exogenous nucleic acid additives have a remarkable influence on the IMP content of muscle tissue and may improve the growth performance of livestock and poultry (Zhang et al., 2008a; Wang et al., 2014). Thus, exogenous nucleic acid additives could be an effective way of improving the IMP content in animal tissues. Little information is available on the suitable amount of exogenous IMP to be used for improving chicken flavor. In this experiment, different levels of exogenous IMP were added to chicken diets to study the effects of supplementing IMP on growth performance, flavor compounds as well as molecular events in broilers. Feed additive amounts were based primarily on studies reported in 2008 (Zhang et al., 2008b) , which used corn-soy diets with 0, 0.25, 0.50, and 0.75% doses of IMP. MATERIALS AND METHODS Experimental Design A total of 1,500 healthy, 1-day-old male 3-yellow chickens (a Chinese breed) were used for the 52-d experimental period. Birds were randomly divided into 5 groups (group I, II, III, IV, V) with 6 replicates each and 50 birds per replicate. Groups were fed a basal diet supplemented with 0.0, 0.05, 0.1, 0.2, or 0.3% exogenous IMP, which was obtained from CJ Biological Technology Co. Ltd. (Shanghai, China). There were no significant differences in initial body weight among the groups. The diet components and nutritional levels are shown in Table 1. The purity of the supplemented IMP was 99.0%. Table 1. Ingredients and nutrient composition of basal diets. Ingredients (%)  Phase    d 1 to 36  d 37 to 52  Corn  52.2  56.6  Wheat  10  8  Full-fat rice bran meal  -  5  Oil  1.5  4  Soybean meal (CP, 43%)  20  16.8  Peanut meal  3  -  Cotton seed meal  3  -  Citric acid slag  4  6  Corn protein meal  2.6  -  Limestone  1.4  1.1  CaHPO4  0.86  1.07  DL-Methionine  0.23  0.28  L-Lysine  0.56  0.5  Threonine  0.1  0.1  NaCl  0.3  0.3  Vitamin premix1  0.03  0.03  Trace elements premix2  0.12  0.12  Choline chloride (50%)  0.1  0.1  Total  100  100  Calculated nutrient composition  ME (MJ/kg)  11.41  12.07  CP  20.29  17.48  Lysine  1.17  1.05  Methionine  0.5  0.49  Methionine + Cystine  0.85  0.81  Ca  0.92  0.78  Available P  0.42  0.37  Ingredients (%)  Phase    d 1 to 36  d 37 to 52  Corn  52.2  56.6  Wheat  10  8  Full-fat rice bran meal  -  5  Oil  1.5  4  Soybean meal (CP, 43%)  20  16.8  Peanut meal  3  -  Cotton seed meal  3  -  Citric acid slag  4  6  Corn protein meal  2.6  -  Limestone  1.4  1.1  CaHPO4  0.86  1.07  DL-Methionine  0.23  0.28  L-Lysine  0.56  0.5  Threonine  0.1  0.1  NaCl  0.3  0.3  Vitamin premix1  0.03  0.03  Trace elements premix2  0.12  0.12  Choline chloride (50%)  0.1  0.1  Total  100  100  Calculated nutrient composition  ME (MJ/kg)  11.41  12.07  CP  20.29  17.48  Lysine  1.17  1.05  Methionine  0.5  0.49  Methionine + Cystine  0.85  0.81  Ca  0.92  0.78  Available P  0.42  0.37  1The Vitamin premix provided the following per kg of the diet mix: Vitamin D, 1000 IU; Vitamin A, 4500IU; Vitamin E, 30 IU; Vitamin K3, 1.3 mg; Vitamin B1, 2.2 mg; Vitamin B2, 10 mg; Vitamin B12, 1.013 mg; Vitamin B6, 4 mg; calcium, 7.5 mg; niacin, 20 mg; folic acid, 0.5 mg; biotin, 0.04 mg. 2The Trace elements premix provided the following per kg of the diet mix: Copper, 7.5 mg; Iron, 60 mg; Zinc, 65 mg; Manganese, 110 mg; Iodine, 1.1 mg; Selenium, 0.15 mg. View Large Data and Sample Collection To assess the growth performance of broiler chicks, both their initial and final body weight (BW) were measured and used to determine the amount of weight gained. The feed intake per chicken pen was recorded at the end of the experiment, and the feed conversion ratio was calculated based on both the feed intake and weight gain. Two healthy broilers of average BW from each replicate cage were chosen and weighed individually then slaughtered by bleeding the left jugular vein. Breast (pectoralis major) and thigh (drumstick) meat were skinned and deboned; one was dissected immediately to analyze IMP content, flavor amino acids, and total free amino acids. Two samples from both sides of the breast and thigh meat were packed individually in aluminum foil, frozen immediately in liquid nitrogen, and stored at -80°C for analysis of enzymatic activity and total RNA extraction. The IMP concentrations in breast and thigh meat were determined by high-performance liquid chromotography (HPLC); the IMP content of each meat sample was measured according to the method described by Jung et al. (2013). Briefly, 1.0 g of fresh breast or thigh meat samples were homogenized in 900 μL of ice-cold 0.9 N perchloric acid. After extraction for 30 min in an ice-water bath, the supernatant was obtained by centrifugation at 13,000 × g at 4°C for 10 min. The supernatant was neutralized with 2 M KOH and then centrifuged again to remove KClO4. The neutralized supernatant was then passed through a 0.2-μm filter before being used for the HPLC analyses. Ten-microliter aliquots of the final meat extraction were injected into chromatography columns (Phenomenex C18-MC1, 250 × 4. 60 mm, 5 μm). Mobile phase A consisted of phosphate buffer (0.04 M potassium dihydrogen orthophosphate and 0.06 M dipotassium hydrogen orthophosphate, pH 7.0), while mobile phase B consisted of acetonitrile. Ultraviolet detection was carried out at a wavelength of 254 nm. The peaks were identified and quantified based on comparisons for the retention time and peak area of known external standards, including IMP (Sigma, St. Louis, MO). After natural thawing, visible fat and fascia were removed from meat samples, and samples were cut into pieces. A total of 2.5 g of muscle tissue was homogenized 3 times with 10 mL of deionized water (22,000 × g/min, for 10 s, interval 10 s) in an ice bath by a T10 disperser (IKA). Next, 10 mL of 10% sulfosalicylic acid was added to the homogenate, mixed by shaking, allowed to stand for 10 min, centrifuged 10 min (15 200 × g) at 4°C, and filtered through a quantitative filter paper. The filtrate was used to determine the free amino acids by automatic amino acid analyzer (Hitachi L-8900, Japan). An additional 0.5 g of muscle tissue sample was cut into pieces, transferred to a 10-mL pre-cooled centrifuge tube with 4.5 mL of pre-cooled media and homogenized into 10% homogenates (10,000 to 15,000 × g/min). The homogenates were centrifuged for 10 min at 2,000 rpm (5 min by 1,000 × g/min for adenosine triphosphate (ATP) enzyme (ATPase) at 4°C. The supernatant was used to test for the activity of ATPase, 5΄-nucleotide enzyme (5΄-NT), acid phosphatase (ACP) and alkaline phosphatase (ALP) in 3-yellow chicken muscle tissue. Test kits were purchased from Jiancheng Bioengineering Institute in Nanjing Province. Breast and thigh muscle samples were taken from 56-day-old birds and immediately frozen in liquid nitrogen and stored at -80°C prior to total RNA extraction. Oligonucleotide primer sets for the 4 genes, adenylosuccinate lyase (ADSL), adenosine monophosphate deaminase 1 (AMPD1), 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were designed using the software programs Primer Premier 5.0 and Oligo 4.0 based on sequences from chicken mRNA published in GenBank (ATIC: NM_205178.1; AMPD1:XM_004935004.1; ADSL: NM_205529.1; and GAPDH: NM_204305). Primer sequences were as follows: GAPDH forward, 5΄-GCCATCACAGCCACACAGA-3΄; GAPDH reverse, 5΄-TTTCCCCACAGCCTTAGCA-3΄; AMPD1 forward, 5΄- AGAAGTCGTATCGTGTGGATGCT-3΄; AMPD1 reverse, 5΄-CCGTTGATGGTGTTTTCTGTCTT-3΄; ADSL forward, 5΄- GCCTACCTTGGGCTTCACTCAC -3΄; ADSL reverse, 5΄- CTGCAGG-TCCATGCACAAGTC-3΄; ATIC forward, 5΄- TCTCCGGGTGTAACTGTACCAGAA-3΄; and ATIC reverse, 5΄- GAGTAGTCTGCAGGATCACACACAA-3΄. Reverse transcription (RT) and quantitative polymerase chain reaction (PCR) were performed using a fluorescence quantitative kit (TaKaRa Bio Inc., Tokyo, Japan), following the manufacturer's instructions. PCR reactions for target and reference genes were performed in different quantitative PCR tubes with 3 replicates per sample. Ct values for every gene were obtained using the Opticon Monitor analysis software. The relative Ct was determined using the following equation with GAPDH as the internal reference gene: ΔCt = Ct (purpose gene) - Ct (internal reference gene). The relative expression levels of ATIC, AMPD1, and ADSL in the various tissues were expressed as 2−ΔCt. Statistical Analysis Data were subjected to analysis of variance (ANOVA) using the GLM procedure of SAS (SAS Institute Inc., Cary, NC). The exponential, linear and quadratic effects of the IMP level were assessed using orthogonal polynomials. The replicate was the experimental unit. Pooled standard error of the mean (SEM) was calculated by averaging the SEMs calculated with the GLM procedure of SAS for the variable of interest. A P-value < 0.05 was considered statistically significant. RESULTS The effects of exogenous IMP on the performance of broilers are presented in Table 2, there was no significant response to the increasing dietary IMP level in average daily feed intake (ADFI), average daily gain (ADG), and feed:gain ratio (F/G) (P ≥ 0.05). IMP content of the breast muscle showed an exponential and linear response to the increasing dietary IMP level (P < 0.05); the highest IMP content was obtained when the diet with 0.3% exogenous IMP was fed. Similarly, there was a significant effect of exogenous IMP level in the broiler diet on IMP content in thigh muscle tissues (exponential effect, P < 0.05), and the highest IMP content was obtained when the diet with 0.2% exogenous IMP was fed (Table 3). Table 2. Effects of inosine monophosphate on the performance of broilers.1 Items2  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  day 1 to 36                    ADG (g)  33.08  32.88  32.95  32.17  33.14  0.24  0.672  0.741  0.735  ADFI (g)  51.27  50.60  51.05  51.41  50.00  0.29  0.408  0.416  0.593  F/G (g:g)  1.55  1.54  1.55  1.60  1.51  0.01  0.830  0.896  0.545  day 37 to 52                    ADG (g)  46.66  48.16  46.75  47.54  45.15  0.77  0.591  0.513  0.566  ADFI (g)  150.35  153.65  142.28  148.03  147.22  1.27  0.204  0.189  0.301  F/G (g:g)  3.29  3.20  3.05  3.12  3.31  0.06  0.952  0.943  0.359  day 1 to 52                    ADG (g)  38.16  38.51  38.10  37.81  37.71  0.24  0.362  0.347  0.601  ADFI (g)  84.65  85.26  81.86  83.99  82.75  0.51  0.170  0.165  0.354  F/G (g:g)  2.22  2.21  2.15  2.22  2.20  0.01  0.663  0.648  0.621  Items2  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  day 1 to 36                    ADG (g)  33.08  32.88  32.95  32.17  33.14  0.24  0.672  0.741  0.735  ADFI (g)  51.27  50.60  51.05  51.41  50.00  0.29  0.408  0.416  0.593  F/G (g:g)  1.55  1.54  1.55  1.60  1.51  0.01  0.830  0.896  0.545  day 37 to 52                    ADG (g)  46.66  48.16  46.75  47.54  45.15  0.77  0.591  0.513  0.566  ADFI (g)  150.35  153.65  142.28  148.03  147.22  1.27  0.204  0.189  0.301  F/G (g:g)  3.29  3.20  3.05  3.12  3.31  0.06  0.952  0.943  0.359  day 1 to 52                    ADG (g)  38.16  38.51  38.10  37.81  37.71  0.24  0.362  0.347  0.601  ADFI (g)  84.65  85.26  81.86  83.99  82.75  0.51  0.170  0.165  0.354  F/G (g:g)  2.22  2.21  2.15  2.22  2.20  0.01  0.663  0.648  0.621  1Values are the means of 6 replicates with 50 birds each. 2ADG, average daily gain; ADFI, average daily feed intake; F/G, the ratio of feed to gain. View Large Tabel 3. Effects of exogenous inosine monophosphate on the content of flavor substances in muscle tissue.1 Items1  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Breast muscle (Pectoralis major)  2.01  2.45  2.75  2.39  3.02  0.09  0.019  0.021  0.073  Thigh muscle (drumstick)  1.95  2.59  2.45  2.74  2.40  0.09  0.039  0.063  0.104  Items1  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Breast muscle (Pectoralis major)  2.01  2.45  2.75  2.39  3.02  0.09  0.019  0.021  0.073  Thigh muscle (drumstick)  1.95  2.59  2.45  2.74  2.40  0.09  0.039  0.063  0.104  1Values are the means of 6 replicates (1 bird from each replicate were analyzed). View Large Dietary IMP supplementation had an exponential and quadratic effect on the Gly, Val, Ile content (P < 0.05), and had a quadratic effect on the Ala (P < 0.01) and Phe (P < 0.05) content in breast muscle. There were significant effects (exponential, linear and quadratic effect, P < 0.05) of IMP level in diet on the free amino acids (FAA) and delicious amino acids (DAA) (quadratic effect, P < 0.01) content in breast muscle; the highest DAA content was obtained when the diet with 0.2% exogenous IMP was fed (Table 4). There were significant effects of IMP level in diet on the Cys (quadratic effect, P < 0.05), Ile (quadratic effect, P < 0.05), His (exponential, linear, and quadratic effect, P < 0.05), and Leu (quadratic effect, P < 0.05) content in thigh muscle. FAA and DAA content in thigh muscle showed an exponential and linear response (P < 0.05), and quadratic response (P < 0.01) to the increasing dietary IMP level (Table 5). The highest FAA and DAA content was obtained when the diet with 0.2% exogenous IMP was fed (Table 4). Table 4. Effects of exogenous inosine monophosphate on the amino acid contents of the breast muscle (Pectoralis major) tissue (mg/100 g).1 Items2  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Asp*  1.65  2.40  2.17  2.63  1.90  0.11  0.359  0.427  0.075  Thr**  2.20  2.95  2.63  2.93  2.35  0.10  0.580  0.695  0.056  Ser*  2.03  2.53  1.90  2.53  1.95  0.09  0.710  0.831  0.074  Glu*  3.95  4.93  4.13  4.97  4.43  0.14  0.587  0.616  0.544  Gly*  0.75  1.13  1.03  1.27  1.10  0.05  0.034  0.054  <0.01  Ala*  2.03  2.98  3.23  3.07  2.40  0.12  0.562  0.668  <0.01  Cys  1.68  1.75  1.78  1.63  2.05  0.06  0.536  0.796  0.912  Val**  2.03  2.55  1.95  2.40  2.08  0.09  0.020  0.391  0.050  Met**  1.48  1.75  1.50  1.63  1.48  0.06  0.103  0.483  0.109  Ile**  1.00  1.28  1.08  1.33  0.98  0.06  0.034  0.541  0.023  Phe**  3.35  4.05  4.15  4.10  4.08  0.13  0.772  0.257  0.039  Lys**  5.17  5.23  4.08  3.67  5.63  0.25  0.984  0.845  0.203  His  1.60  2.90  1.67  1.37  3.25  0.23  0.602  0.143  0.086  Arg*  1.18  1.55  1.83  1.27  1.37  0.07  0.095  0.876  0.123  Tyr  1.38  1.40  1.25  1.17  1.28  0.09  0.359  0.520  0.794  Leu**  4.20  4.60  4.00  4.53  4.40  0.11  0.145  0.993  0.625  Pro  1.80  2.53  2.30  2.87  2.28  0.11  0.094  0.362  0.078  FAA  33.98  48.30  42.33  47.47  45.28  1.55  0.031  0.046  0.023  EAA  17.58  22.40  19.25  20.60  20.98  1.18  0.239  0.278  0.398  DAA  8.80  15.22  13.13  15.73  12.75  0.93  0.070  0.107  <0.01  Items2  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Asp*  1.65  2.40  2.17  2.63  1.90  0.11  0.359  0.427  0.075  Thr**  2.20  2.95  2.63  2.93  2.35  0.10  0.580  0.695  0.056  Ser*  2.03  2.53  1.90  2.53  1.95  0.09  0.710  0.831  0.074  Glu*  3.95  4.93  4.13  4.97  4.43  0.14  0.587  0.616  0.544  Gly*  0.75  1.13  1.03  1.27  1.10  0.05  0.034  0.054  <0.01  Ala*  2.03  2.98  3.23  3.07  2.40  0.12  0.562  0.668  <0.01  Cys  1.68  1.75  1.78  1.63  2.05  0.06  0.536  0.796  0.912  Val**  2.03  2.55  1.95  2.40  2.08  0.09  0.020  0.391  0.050  Met**  1.48  1.75  1.50  1.63  1.48  0.06  0.103  0.483  0.109  Ile**  1.00  1.28  1.08  1.33  0.98  0.06  0.034  0.541  0.023  Phe**  3.35  4.05  4.15  4.10  4.08  0.13  0.772  0.257  0.039  Lys**  5.17  5.23  4.08  3.67  5.63  0.25  0.984  0.845  0.203  His  1.60  2.90  1.67  1.37  3.25  0.23  0.602  0.143  0.086  Arg*  1.18  1.55  1.83  1.27  1.37  0.07  0.095  0.876  0.123  Tyr  1.38  1.40  1.25  1.17  1.28  0.09  0.359  0.520  0.794  Leu**  4.20  4.60  4.00  4.53  4.40  0.11  0.145  0.993  0.625  Pro  1.80  2.53  2.30  2.87  2.28  0.11  0.094  0.362  0.078  FAA  33.98  48.30  42.33  47.47  45.28  1.55  0.031  0.046  0.023  EAA  17.58  22.40  19.25  20.60  20.98  1.18  0.239  0.278  0.398  DAA  8.80  15.22  13.13  15.73  12.75  0.93  0.070  0.107  <0.01  1Values are the means of 6 replicates (1 bird from each replicate were analyzed). 2FAA, free amino acids, EAA, essential amino acids, DAA, delicious amino acids. **Essential amino acids, including Thr, Val, Met, Ile, Phe, Lys, Leu. *Delicious amino acids, including Asp, Ser, Glu, Gly, Ala, Arg. View Large Table 5. Effects of exogenous inosine monophosphate on the amino acid contents of the thigh muscle (drumstick) tissue (mg/100 g).1 Items2  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Asp*  2.63  4.03  3.68  5.10  2.68  0.27  0.659  0.888  0.061  Thr**  4.78  4.18  5.30  4.28  3.58  0.36  0.316  0.403  0.543  Ser*  3.83  3.00  2.83  3.50  2.95  0.14  0.750  0.733  0.826  Glu*  3.75  5.53  5.55  7.25  5.23  0.29  0.311  0.320  0.143  Gly*  2.53  1.88  1.78  2.08  2.00  0.12  0.568  0.665  0.369  Ala*  4.33  3.83  3.68  4.28  3.03  0.21  0.255  0.302  0.474  Cys  1.93  2.10  2.30  1.88  1.75  0.06  0.086  0.099  0.030  Val**  1.50  2.08  2.20  2.25  1.85  0.07  0.750  0.749  0.216  Met**  1.63  1.65  1.63  1.58  1.43  0.05  0.381  0.346  0.411  Ile**  1.23  1.25  1.40  1.38  0.93  0.08  0.417  0.497  0.035  Tyr  1.30  1.13  1.25  1.28  1.13  0.04  0.859  0.806  0.191  Phe**  4.18  4.20  4.15  4.30  3.63  0.13  0.704  0.708  0.239  Lys**  1.68  1.55  1.90  1.73  3.30  0.31  0.631  0.699  0.237  His  0.75  0.80  0.78  0.98  1.15  0.05  0.011  <0.01  0.037  Leu**  3.10  4.48  4.88  5.18  3.88  0.17  0.994  0.990  0.028  Arg*  0.80  1.85  1.70  1.95  2.53  0.15  0.346  0.267  0.427  Pro  1.80  2.58  2.28  2.45  2.85  0.09  0.642  0.589  0.170  FAA  39.47  48.68  50.13  59.43  48.07  1.76  0.026  0.032  <0.01  EAA  17.60  19.38  21.45  20.68  18.58  0.84  0.389  0.373  0.274  DAA  11.25  20.10  19.20  24.15  18.40  1.18  0.030  0.022  <0.01  Items2  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Asp*  2.63  4.03  3.68  5.10  2.68  0.27  0.659  0.888  0.061  Thr**  4.78  4.18  5.30  4.28  3.58  0.36  0.316  0.403  0.543  Ser*  3.83  3.00  2.83  3.50  2.95  0.14  0.750  0.733  0.826  Glu*  3.75  5.53  5.55  7.25  5.23  0.29  0.311  0.320  0.143  Gly*  2.53  1.88  1.78  2.08  2.00  0.12  0.568  0.665  0.369  Ala*  4.33  3.83  3.68  4.28  3.03  0.21  0.255  0.302  0.474  Cys  1.93  2.10  2.30  1.88  1.75  0.06  0.086  0.099  0.030  Val**  1.50  2.08  2.20  2.25  1.85  0.07  0.750  0.749  0.216  Met**  1.63  1.65  1.63  1.58  1.43  0.05  0.381  0.346  0.411  Ile**  1.23  1.25  1.40  1.38  0.93  0.08  0.417  0.497  0.035  Tyr  1.30  1.13  1.25  1.28  1.13  0.04  0.859  0.806  0.191  Phe**  4.18  4.20  4.15  4.30  3.63  0.13  0.704  0.708  0.239  Lys**  1.68  1.55  1.90  1.73  3.30  0.31  0.631  0.699  0.237  His  0.75  0.80  0.78  0.98  1.15  0.05  0.011  <0.01  0.037  Leu**  3.10  4.48  4.88  5.18  3.88  0.17  0.994  0.990  0.028  Arg*  0.80  1.85  1.70  1.95  2.53  0.15  0.346  0.267  0.427  Pro  1.80  2.58  2.28  2.45  2.85  0.09  0.642  0.589  0.170  FAA  39.47  48.68  50.13  59.43  48.07  1.76  0.026  0.032  <0.01  EAA  17.60  19.38  21.45  20.68  18.58  0.84  0.389  0.373  0.274  DAA  11.25  20.10  19.20  24.15  18.40  1.18  0.030  0.022  <0.01  1Values are the means of 6 replicates (1 bird from each replicate were analyzed). 2FAA, free amino acids, EAA, essential amino acids, DAA, delicious amino acids. **Essential amino acids, including Thr, Val, Met, Ile, Phe, Lys, Leu. *Delicious amino acids, including Asp, Ser, Glu, Gly, Ala, Arg. View Large Dietary IMP supplementation had a quadratic effect on 5΄-NT and ALP enzyme activity in breast muscle (P < 0.05); no difference of ATPase and ACP activity in breast muscle were observed. ATPase enzyme activity in the thigh muscles increased exponentially and linearly with the IMP level in diet (exponential effect, P = 0.061; linear effect, P = 0.059). The 0.2% exogenous IMP group had the lowest 5΄-NT enzyme activity in breast muscle, while the 0.3% exogenous IMP group had the highest ATPase enzyme activity in thigh muscle (Table 6). Table 6. Effects of exogenous inosine monophosphate on relative enzyme activity in muscle tissues (U/g prot).1 Items  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Breast muscle (Pectoralis major)  ATPase  3.95  4.11  4.30  3.97  3.89  0.14  0.359  0.390  0.418  ACP  5.34  4.04  4.81  4.20  5.26  0.17  0.742  0.743  0.186  5-NT  6.88  5.31  5.06  4.79  5.73  0.22  0.339  0.271  0.025  ALP  5.38  4.17  4.40  4.63  5.09  0.20  0.291  0.216  0.024  Thigh muscle (drumstick)  ATPase  3.76  4.19  4.66  4.18  4.82  0.14  0.061  0.059  0.179  ACP  5.20  4.32  4.99  4.87  4.75  0.14  0.874  0.830  0.553  5-NT  5.44  5.08  5.73  4.78  4.99  0.13  0.143  0.141  0.348  ALP  4.84  3.91  4.59  4.61  4.15  0.53  0.411  0.390  0.318  Items  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Breast muscle (Pectoralis major)  ATPase  3.95  4.11  4.30  3.97  3.89  0.14  0.359  0.390  0.418  ACP  5.34  4.04  4.81  4.20  5.26  0.17  0.742  0.743  0.186  5-NT  6.88  5.31  5.06  4.79  5.73  0.22  0.339  0.271  0.025  ALP  5.38  4.17  4.40  4.63  5.09  0.20  0.291  0.216  0.024  Thigh muscle (drumstick)  ATPase  3.76  4.19  4.66  4.18  4.82  0.14  0.061  0.059  0.179  ACP  5.20  4.32  4.99  4.87  4.75  0.14  0.874  0.830  0.553  5-NT  5.44  5.08  5.73  4.78  4.99  0.13  0.143  0.141  0.348  ALP  4.84  3.91  4.59  4.61  4.15  0.53  0.411  0.390  0.318  1Values are the means of 6 replicates (2 birds from each replicate were analyzed). View Large AMPD1 gene expression of the breast muscle showed a quadratic response to the increasing dietary IMP level (P = 0.061), while there was no difference in ADSL and ATIC gene expression of the breast muscle (P ≥ 0.05). ATIC gene expression in thigh muscle had a quadratic response to the increasing dietary IMP level (P < 0.05), ADSL and AMPD1 gene expression had no significant response to the increasing dietary IMP level (P ≥ 0.05). The 0.2% exogenous IMP group had the highest (AMPD1) gene expression of the breast muscle and ATIC gene expression of the thigh muscle (Table 7). Table 7. Effects of exogenous inosine monophosphate on gene expression in muscle tissue.1 Items  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Breast muscle (Pectoralis major)  ADSL  0.0211  0.0361  0.0538  0.0233  0.0260  0.004  0.780  0.934  0.271  AMPD1  0.01392  0.0452  0.0425  0.0525  0.0208  0.005  0.685  0.801  0.061  ATIC  0.0005  0.0010  0.0009  0.0006  0.0008  0.00007  0.809  0.656  0.910  Thigh muscle (drumstick)  ADSL  0.0504  0.0868  0.0548  0.0532  0.0529  0.007  0.992  0.901  0.909  AMPD1  0.1871  0.2668  0.0364  0.1109  0.1264  0.031  0.123  0.293  0.434  ATIC  0.0009  0.0014  0.0014  0.0015  0.0011  0.0009  0.219  0.320  0.043  Items  IMP(%)  SEM  P-value    0  0.05  0.1  0.2  0.3    Exponential  Linear  Quadratic  Breast muscle (Pectoralis major)  ADSL  0.0211  0.0361  0.0538  0.0233  0.0260  0.004  0.780  0.934  0.271  AMPD1  0.01392  0.0452  0.0425  0.0525  0.0208  0.005  0.685  0.801  0.061  ATIC  0.0005  0.0010  0.0009  0.0006  0.0008  0.00007  0.809  0.656  0.910  Thigh muscle (drumstick)  ADSL  0.0504  0.0868  0.0548  0.0532  0.0529  0.007  0.992  0.901  0.909  AMPD1  0.1871  0.2668  0.0364  0.1109  0.1264  0.031  0.123  0.293  0.434  ATIC  0.0009  0.0014  0.0014  0.0015  0.0011  0.0009  0.219  0.320  0.043  1Values are the means of 6 replicates (2 birds from each replicate were analyzed). View Large DISCUSSION Inosine monophosphate, a nucleotide dietary supplement, is closely associated with animal growth and immune and intestinal healthy and is particularly important in the early stages of animal growth. IMP is the main product in the de novo synthesis process of nucleotides (Mateo, 2005). Although nucleotides can be synthesized by de novo synthesis, it may be useful to supplement with exogenous nucleotides during rapid growth periods or under stressful conditions (Frankič et al., 2006). Inosine monophosphate, as the intermediate metabolite of nucleotide de novo synthesis (Mateo, 2005), could synthesize other functional nucleotides (Stein and Kil, 2006). Exogenous IMP could remit the stress of nucleotide de novo synthesis and increase feed intake by stimulating taste receptors (Kubitza et al., 1997). Song et al. (2012) also reported that the growth of flounder could be improved by supplementation of 0.1% to 0.2% IMP in the diet. However, few studies have examined the effects of adding exogenous nucleotides to broiler chicken diets. Here, broiler diets were supplemented with varying doses of exogenous IMP, during the early growth stage of broilers, the feed gain ratio of 0.3% IMP group reduced by 2.58% compared with the control group. These results are in accord with those of Weaver and Kim (2014) in pigs. Some studies have also shown that pure nucleotide complexes could increase the feed intake of weaned piglets (Sauer et al., 2012). In this experiment, the feed intake of the 0.2% IMP group was the highest in the later growth stage of broilers. Inosine monophosphate is thought to be an important umami substance that stimulates taste and promotes animal feeding after it enters the digestive tract. However, because chickens have a low taste intensity, the presence of IMP may not be sufficient to increase appetite. Alternatively, increased feed intake might be due to the growth promoting properties of IMP. Throughout the growth period, there were no significant differences in the growth performance of broilers among all groups; a similar result was found by Lee et al. (2007). Inosine monophosphate is one of the important components in producing the umami flavor and important for meat flavor evaluation (Calkins and Hodgen, 2007). Adding exogenous nucleotides is an effective way to increase the amount of IMP in muscle tissues. Exogenous IMP could be digested and absorbed directly for nucleotide synthesis, which reduces energy consumption in the process of nucleotide de novo synthesis and increases the amount of ATP and IMP. Zhang et al. (2008b) reported that exogenous IMP could significantly increase the amount of IMP in boiler chest muscle, with 0.25% supplementation providing the optimum level. In this experiment, supplementing with 0.2% and 0.3% exogenous IMP significantly increased the amount of IMP in muscle tissue; this result is similar to that of Wang et al. (2014). The added dietary IMP may have been absorbed and transformed into ATP, thereby increasing the ATP content, which increased the content of IMP in the tissues. The addition of nucleotides may also have affected enzyme activity related to IMP metabolism. The nutritional value and flavor of muscle tissues are determined by the species and content of free amino acids in the tissues. Five amino acids (aspartate, glutamate, glycine, alanine and arginine) are the precursor substances comprising meat flavor and directly affect how delicious meat is considered (Mohamed et al., 2014). Oike et al. (2006) reported that so-called delicious amino acids could directly activate the ion channel in the taste pathway in type II recipient cells, which determine flavor and sweetness, thus improving the flavor of chicken and keeping the muscles delicious, tender, and smooth. Higher contents of delicious amino acids in muscle tissues correspond with higher meat quality. In this experiment, 0.2% exogenous IMP significantly increased the contents of delicious amino acids and total free amino acids in breast and thigh muscles. The most important substances in delicious amino acids are glutamate and glycine, which can decrease bitterness and remove unpleasant tastes from food. Glutamate and glycine also provide a sweet fragrance. In contrast, arginine works through inositol and glycerol phosphocholine, enhancing the synthesis and deposition of body proteins and the degradation of fat, and improving carcass composition (He et al., 2009). The main factor affecting the content of IMP in animals is the presence of enzymes involved in the process of IMP anabolism. ATP is the primary enzyme in the IMP generation process, and 5΄-nucleotidase and phosphatase are the enzymes related to IMP degradation. The enzyme a+-K+∼ATP, a protein embedded in the lipid bilayer of the cytoplasmic membrane, is the main factor that determines the speed of ATP decomposition (Gorini et al., 2002). After animal death, the sarcoplasmic reticulum disintegrates and loses function, including the calcium pump. Calcium is released, activating the myosin ATP enzyme, which causes a large amount of ATP decomposition. Inosine monophosphate is produced by ATP degradation after animal death. Therefore, ATP degrading enzyme is involved in the synthesis of IMP. The results of this experiment showed that 0.3% exogenous IMP group had the highest ATPase enzyme activity in thigh muscle, which is similar to the results of Wang et al. (2014). However, Zhang et al. (2008a) demonstrated that there were no significant effects of exogenous IMP on ATP enzyme activity in muscle tissues. IMP degrading enzymes primarily include 5΄-nucleotidase and phosphatase. These enzymes can catalyze the partial 5΄-end carbon phosphate of ribose or deoxyribose in some nucleic acid molecules and thus affect the nucleic acid content in the cell (Gallier et al., 2011). Therefore, 5΄-nucleotidase is one of the compounds that effects the stability of IMP. Phosphatase primarily catalyzes nucleic acid molecules by removing the 5΄ phosphate group and reducing the content of IMP. To increase the content of IMP in the muscle tissues of livestock and poultry, IMP decomposition needs to be prevented. In our studies, dietary IMP supplementation had a quadratic effect on ALP enzyme activity in breast muscle, and 0.2% exogenous IMP group had the lowest 5΄-NT enzyme activity in breast muscle. The trend simultaneously indicated that more is not always better. Without considering the influence of strain, sex, and size, enzymes associated with ATP metabolism could be the important factor that affected the amount of IMP in broilers’ muscle. The enzymes involved include ATPase, 5΄-nucleotidase, and phosphatase. Inosine 5΄-monophosphate is the intermediate product in ATP metabolism, so there should be a positive correlation between the concentration of IMP in muscle and ATP hydrolase activity as well as a negative correlation between the concentration of IMP in muscle and IMP degrading enzyme activity. Dietary nucleic acids and nucleotides should be enzymatically hydrolyzed before absorption and they were absorbed mainly in the form of nucleosides and small molecular nucleotides (Bronk and Hastewell, 1987). Nucleotides with highly negatively charged phosphate groups hinder absorption. Thus, nucleotides enter enterocytes mainly in the form of nucleosides and the effective process is carried out mainly by facilitated diffusion and by special sodium ion-dependent carrier mediated mechanisms (Bronk and Hastewell, 1987). Nucleosides, endogenous nucleotides, and partial dietary metabolic products are transported into muscle tissue through the circulation system. While one portion of the products were decomposed into uric acid or β-alanine and excreted, the others were resynthesized for nucleotides and participated in metabolism again (Carver and Walker, 1995; Thorell et al.,1996). Therefore, as a type of small molecular nucleotide, partial dietary IMP is likely to be absorbed directly. However, little IMP exists in muscle of live animals, and the deposition of IMP in muscle basically occurs during the progression of rigor mortis. Further studies may help to clarify the mechanism. There are 10 steps for the de novo synthesis of the nucleotide IMP. ADSL, AMPD1, and ATIC are essential enzymes involved in this de novo purine biosynthesis, which catalyzes 2 steps in the synthesis (Aimi et al., 1990). Considering the important role of these 3 genes in IMP synthesis, ADSL, AMPD1, and ATIC genes were chosen as a candidate gene for IMP content of chicken muscle in this study. The ADSL gene has typical housekeeping gene features. It plays an important role in the biological pathways of purine nucleotide de novo synthesis and maintains the proportion of ATP/ AMP in muscle tissues. ADSL is vitally important to the content of IMP and maintaining normal cell division and metabolism (Xu et al., 2011). ADSL gene mutations can decrease IMP synthetic ability in vivo and may result in a series of neurological disorders (Lundy et al., 2010). High ADSL gene expression can cause the mass synthesis of purine nucleotides. Purine nucleotides are the material of ATP synthesis, and muscle movement requires a large amount of ATP to provide energy. Therefore, ADSL expression is the highest in muscle tissues (Yuan et al., 2011). Single nucleotide polymorphisms in the ADSL gene have been shown to affect the content of IMP in muscle tissues (Shu et al., 2009; Ye et al., 2010), whereas the effects of exogenous IMP on gene expression in muscle tissues have not been reported. Our results haven’t showed strong correlation between the content of IMP in muscle and ADSL expression, which is probably because the purine-biosynthetic pathway is ultimately responsible for the generation of inosine 5΄-monophosphate from α-D-ribose-5-phosphate (Zhang et al., 2008a) and provides the essential purine nucleotides required for DNA replication and cell division. The pathway consists of 10 enzyme-catalyzed steps in vertebrates (Hartman and Buchanan, 1959) and 11 in Escherichia coli (Mueller et al., 1994); if one of the enzymes changed, the IMP content would be different, furthermore, we have showed the difference in mRNA expressional level of the ADSL gene, and have not studied the difference in protein level, future research would helpful for clearing the correlation of IMP content with ADSL gene expression. ATIC is the only bifunctional enzyme with 2 enzymes catalytic activity in the biosynthetic pathway of purine nucleotide synthesis. The research of Greasley et al. (2001) on the crystal structure of the chicken ATIC gene showed that the N-extremity of ATIC activates inosine 5΄-monophosphate dehydrogenase (IMPCH), while the C-extremity activates aminoimidazole carboxamide ribonucleotide transformylase (AICARTfase). The distance between the activity centers of the IMPCH and AICARTfase enzymes is approximately 50A. There is no intermediate connecting channel between these 2 activity centers, which plays an important regulatory role in the synthesis of IMP. ATIC gene expression in the thigh muscle of the 0.2% IMP group was significantly increased. The AMPD1 gene is primarily expressed in muscle tissues and involved in the metabolism of IMP. Therefore, the AMPD1 gene can be considered to be a candidate gene that affects the IMP content. Hu et al. (2015) reported that polymorphisms of AMPD1 (single nucleotide polymorphisms [SNPs]) in broiler chickens were related to the IMP content and could be a possible candidate marker for the IMP content. Here, 0.2% exogenous IMP group had the highest (AMPD1) gene expression of the breast muscle. The effects of exogenous IMP on related gene expression in muscle tissues of livestock and poultry has not been reported previously. The results of this experiment implied that diet supplementation with exogenous IMP probably play an important role in increasing related gene expression. CONCLUSION In summary, dietary supplementation with IMP did not affect growth performance of the broilers. Supplementation with 0.2 to 0.3% exogenous IMP promoted the deposition of IMP in the muscle tissues, increased FAA and DAA content in muscle, increased enzymes involved in the process of IMP generation, and decreased the enzymes related to IMP degradation. These results indicate that dietary IMP didn’t affect the growth performance of chicken, the diet with 0.2 to 0.3% exogenous IMP is optimal to improve the meat flavor quality in chicken. Acknowledgements This work was supported by the National Science Foundation of China (no.31302006) and Jiangsu Province Agricultural Science and Technology Autonomous Innovation Fund Project (CX(14)5034). REFERENCES Aimi J, Qiu H., Williams J., Zalkin H., Dixon J. E.. 1990. De novopurine nucleotide biosynthesis: cloning of human and avian cDNAs encoding the trifunctional glycinamide ribonucleotide synthetase-aminoimidazole ribonculeotide synthetase-glycinamide ribonucleotide transformylase by functional complementation in E. coli. Nucleic Acids Res . 18: 6665– 6672. Google Scholar CrossRef Search ADS PubMed  Bronk J. R., Hastewell J. G.. 1987. The transport of pyrimidines into tissue rings cut from rat small intestine. J. Physiol.  382: 475– 488. Google Scholar CrossRef Search ADS PubMed  Calkins C. R., Hodgen J. M.. 2007. A fresh look at meat flavor. Meat Sci . 77: 63– 80. Google Scholar CrossRef Search ADS PubMed  Carver J. D., Walker W. A.. 1995. The role of nucleotides in human nutrition. Nutr. Biochem.  6: 58– 72. Google Scholar CrossRef Search ADS   Frankič T., Pajk T., Rezar V., Levart A., Salobir J.. 2006. The role of dietary nucleotides in reduction of DNA damage induced by T-2 toxin and deoxynivalenol in chicken leukocytes. Food Chem. Toxicol.  44: 1838– 1844. Google Scholar CrossRef Search ADS PubMed  Fujimura S., Koga H., Takeda H., Tone N., Kadowaki M., Ishibashi T.. 1996. Role of taste-active components, glutamic acid, 5΄-inosinic acid and potassium ion in taste of chicken meat extract. Anim. Sci. Technol . 423– 429. Fujimura S., Kawano S., Koga H., Takeda H., Kadowaki M., Ishibashi T.. 1995. Identification of taste-active components in the chicken meat extract by omission test-involvement of glutamic acid, IMP and potassium ion. Anim. Sci. Technol . 43– 51. Gallier F., Lallemand P., Meurillon M.. 2011. Structural insights into the inhibition of cytosolic 5΄-nucleotidase II (cN-II) by ribonucleoside 5΄-monophosphate analogues. PLoS Comput. Biol . 7: e1002295. Google Scholar CrossRef Search ADS PubMed  Gorini A., Canosi U., Devecchi E.. 2002. ATPases enzyme activities during ageing in different types of somatic and synaptic plasma membranes from rat frontal cerebral cortex. Prog. Neuro-Psychopharmacol. Biol. Psychiatry  26: 81– 90. Google Scholar CrossRef Search ADS   Greasley S. E., PIorton P. A., Ramcharan J.. 2001. Crystal structure of a bifunctional transformylase and cyclohydrolase enzyme in purine biosynthesis. Nat. Struct. Biol.  8: 402– 406. Google Scholar CrossRef Search ADS PubMed  Hartman S. C., Buchanan J. M.. 1959. Nucleic acids, purines, pyrimidines (nucleotide synthesis). Annu. Rev. Biochem . 28: 365– 410. Google Scholar CrossRef Search ADS PubMed  He Q., Kong X., Wu G.. 2009. Metabolomic analysis of the response of growing pigs to dietary L- arginine supplementation. Amino Acids . 37: 199– 208. Google Scholar CrossRef Search ADS PubMed  Hofbauer P., Smulders F. J. M., Vodnansky M.. 2010. A note on meat quality traits of pheasants (Phasianus colchicus). Eur. J. Wildl. Res . 56: 809– 813. Google Scholar CrossRef Search ADS   Hu J., Yu P., Ding X. L.. 2015. Genetic polymorphisms of the AMPD1 gene and their correlations with IMP contents in Fast Partridge and Lingshan chickens. J. Gene.  574: 204– 209. Google Scholar CrossRef Search ADS   Jayasena D. D., Ahn D. U., Nam K. C., Jo C.. 2013. Flavour chemistry of chicken meat: A review. Asian-Australas. J. Anim. Sci.  26: 732– 742. Google Scholar CrossRef Search ADS PubMed  Jung S., Bae Y. S., Kim H. J., Jayasena D. D., Lee J. H., Park H. B., Heo K. N., Jo C.. 2013. Carnosine, anserine, creatine, and inosine 5΄-monophosphate contents in breast and thigh meats from five lines of Korean native chicken. Poult. Sci.  92: 3275– 3282. Google Scholar CrossRef Search ADS PubMed  Joo S. T., Kim G. D.. 2011. Meat quality traits and control technologies. In: Control of Meat Quality  (Ed. Joo S. T). Research Signpost, Kerala: pp. 1– 20. Kobayashi H., Nakashima K., Ishida A., Ashihara A., Katsumata M.. 2013. Effects of low protein diet and low protein diet supplemented with synthetic essential amino acids on meat quality of broiler chickens. Anim Sci J . 84: 489– 495. Google Scholar CrossRef Search ADS PubMed  Kubitza F., Lovshin L. L., Lovell R. T.. 1997. Identification of feed enhancers for juvenile largemouth bass Micropterus salmoides. Aquaculture . 148: 191– 200. Google Scholar CrossRef Search ADS   Lee D. N., Liu S. R., Chen Y. T., Wang R. C., Lin S. Y., Weng C. F.. 2007. Effects of diets supplemented with organic acids and nucleotides on growth, immune responses and digestive tract development in weaned pigs. J. Anim. Physiol. Anim. Nutr.  91: 508– 518. Google Scholar CrossRef Search ADS   Lee H. Y., Kim J. M., Byun M. J.. 2011. Structure and polymorphisms of the 5΄ regulatory region of porcine adenylate kinase 3-like 1 gene and effect on trait of meat quality. Genes Genom . 33: 147– 153. Google Scholar CrossRef Search ADS   Li W. G., Jiao F. L., Wu Z. J., Yan Y., Shen C., Sui C.. 2011. Improvement of flavor and pork quality. J. Food Eng.  4: 7– 10. Lundy C. T., Jungbluth H., Pohl K. R.. 2010. Adenylosuccinate lyase deficiency in the United Kingdom pediatric population: first 3 cases. Pediatr. Neurol.  43: 351– 354. Google Scholar CrossRef Search ADS PubMed  Masic U., Yeomans M. R.. 2014. Umami flavor enhances appetite but also increases satiety. Am. J. Clin. Nutr.  100: 532– 538. Google Scholar CrossRef Search ADS PubMed  Mateo C. D. 2005. Aspects of Nucleotide Nutrition in Pigs . PhD Diss. South Dakota State Univ., Brookings, SD. Mohamed A. R., Cidalia P., Xavier Malcata F.. 2014. Evolution of amino acids and biogenic amines throughout storage in sausages made of horse, beef and turkey meats. Meat Sci . 96: 82– 87. Google Scholar CrossRef Search ADS PubMed  Mueller E. J., Meyer E., Rudolph J., Davisson V. J., Stubbe J. 1994. N5-carboxyaminoimidazole ribonucleotide: evidence for a new intermediate and two new enzymatic activities in the de novo purine biosynthetic pathway of Escherichia coli. Biochemistry . 33: 2269– 2278. Google Scholar CrossRef Search ADS PubMed  Narukawa M., Morita K., Hayashi Y.. 2008. L-theanine elicits an umami taste with inosine 5΄-monophosphate. Biosci. Biotechnol. Biochem . 72: 3015– 3017. Google Scholar CrossRef Search ADS PubMed  Oike H., Wakamori M., Mori Y.. 2006. Arachidonic acid can function as a signaling modulator by activating the TRPM5 cation channel in taste receptor cells. Biochim. Biophys. Acta.  1761: 1078– 1084. Google Scholar CrossRef Search ADS PubMed  Sasaki K., Motoyama M., Mitsumoto M.. 2007. Changes in the amounts of water-soluble umami-related substances in porcine longissimus and biceps femoris muscles during moist heat cooking. Meat Sci . 77: 167– 172. Google Scholar CrossRef Search ADS PubMed  Sauer N., Eklund M., Bauer E., Gänzle M. G., Field C. J., Zijlstra R. T., Mosenthin R.. 2012. The effects of pure nucleotides on performance, humoral immunity, gut structure and numbers of intestinal bacteria of newly weaned pigs. J. Anim. Sci.  90: 3126– 3134. Google Scholar CrossRef Search ADS PubMed  Shu J. T., Bao W. B., Zhang H. X., Chen K. W.. 2009. Combined effect of mutations in ADSL and GARS-AIRS-GART genes on IMP content in chickens. Br. Poult. Sci.  50: 680– 686. Google Scholar CrossRef Search ADS PubMed  Song J. W., Limb S. J., Lee K. J.. 2012. Effects of dietary supplementation of inosine monophosphate on growth performance, innate immunity and disease resistance of olive flounder (Paralichthys olivaceus). Fish Shellfish Immunol . 33: 1050– 1054. Google Scholar CrossRef Search ADS PubMed  Stein H. H., Kil D. Y.. 2006. Reduced use of antibiotic growth promoters in diets fed to weanling pigs: Dietary tools, part 2. Anim. Biotechnol . 17: 217– 231. Google Scholar CrossRef Search ADS PubMed  Suzuki A., Kojima N., Ikeuchi Y., Ikarashi S., Moriyama N., Ishizuka T., Tokushige H.. 1991. Carcass composition and meat quality of Chinese purebred and European × Chinese crossbred pigs. Meat Sci . 29: 31– 41. Google Scholar CrossRef Search ADS PubMed  Thorell L., Sjoberg L. B., Hernell O.. 1996. Nucleotides in human milk: Sources and metabolism by the newborn infant. Pediatr. Res.  40: 845– 852. Google Scholar CrossRef Search ADS PubMed  Wang X. F., Liu G. H., Cai H. Y.. 2014. Attempts to increase inosinic acid in broiler meat by using feed additives. Poult. Sci.  93: 1– 7. Google Scholar CrossRef Search ADS PubMed  Weaver A. C., Kim S. W.. 2014. Supplemental nucleotides high in inosine 5΄-monophosphate to improve the growth and health of nursery pigs. J. Anim. Sci.  92: 645– 651. Google Scholar CrossRef Search ADS PubMed  Xu S. J., Yu D. B., Du W. X.. 2011. Current research advances in IMP and related enzymes. Biotechnol. Bull.  3: 44– 53. Ye M. H., Chen J. L., Zhao G. P.. 2010. Correlation between polymorphisms in ADSL and GARS-AIRS-GART genes with inosine 5΄-monophosphate (IMP) contents in Beijing-you chickens. Br. Poult. Sci.  51: 609– 613. Google Scholar CrossRef Search ADS PubMed  Yuan T., Gu J. R., Gu W. B.. 2011. Molecular cloning, characterization and expression analysis of adenylosuccinate lyase gene in grass carp (Ctenopharyngodon idella). Mol. Biol. Rep.  38: 2059– 2065. Google Scholar CrossRef Search ADS PubMed  Zhang Y., Morar M., Ealick. S. E. 2008a. Structural biology of the purine biosynthetic pathway. Cel. Mol. Life. Sci.  65: 3699– 3724. Google Scholar CrossRef Search ADS   Zhang G. Q., Ma Q. G., Ji C.. 2008b. Effects of dietary inosinic acid on carcass characteristics, meat quality, and deposition of inosinic acid in broilers. Poult. Sci.  87: 1364– 1369. Google Scholar CrossRef Search ADS   © 2018 Poultry Science Association Inc.

Journal

Poultry ScienceOxford University Press

Published: Apr 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off