Effects of aging on fat deposition and meat quality in Sheldrake duck

Effects of aging on fat deposition and meat quality in Sheldrake duck ABSTRACT Sheldrake is a duck breed widely used for its meat and eggs. In this study, the quantities of abdominal fat, sebum, intramuscular fat and liver fat, meat quality (pH, cooking loss, drip loss, and shear force), and expression and activity of several enzymes at different ages were determined. The results showed that the fat content increased (P < 0.05) during the aging process (90 d, 180 d, 270 d, and 360 d). Fatty acid synthase (FAS) and malic enzyme (ME) were chosen to represent the activity of lipid biosynthesis in Sheldrake ducks. The quantitative real-time PCR and enzymic activity data showed that the expression of both FAS and ME were generally up-regulated along with aging. Based on these results, the individual ducks were selected at 180 d and 360 d for analyzing the changes of serum lipid levels and related enzymic activities in liver. The contents of triglycerides (TG), total cholesterol (TCH), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in serum were found not significantly different (P > 0.05). However, we thought that the variation of TG/HDL (P < 0.05) might explain the increased fat deposition. Moreover, the activities of lipoprotein lipase (LPL) and hepatic lipase (HL) were both detected significantly up-regulated at 360 d (P < 0.05). The meat quality results of breast muscles indicated that pH, cooking loss, drip loss, and shear force values could all be affected by aging. Considering these results, we concluded that the best quality of Sheldrake duck meat occurs between 180 d and 270 d. These results might provide useful information for Sheldrake cultivation and research on lipid metabolism. INTRODUCTION Fat deposition in animals, including subcutaneous fat (SF), abdominal fat (AF) and intramuscular fat (IMF), can influence feed cost, meat quality, and human health (Gao and Zhao, 2009; Lee et al., 2010; Raj et al., 2010). Meat quality can be evaluated by measuring factors such as water holding capacity, pH, and tenderness. These indices were all reported to be influenced by IMF content (van Laack et al., 2001; Lyczynski et al., 2006; Jeleníková et al., 2008; Yuan et al., 2011; Pietruszka et al., 2015). Thus, IMF is considered correlated with meat quality. In lipid metabolism, data on various related enzymes are available. Fatty acid synthase (FAS) is a crucial, rate-limiting, multifunctional enzyme in lipogenesis and deposition. FAS can catalyze acetyl-CoA and malonyl-CoA to synthesize fatty acids. It is the primary source of fatty acids in lipid biosynthesis (Wakil, 1989; Smith et al., 2003). Malic enzyme (ME) can catalyze malic acid to generate pyruvic acid and CO2, accompanied with the reduction of nicotinamide adenine dinucleotide phosphate (NADP+). It provides materials and energy for acetyl-CoA transportation and fatty acid synthesis (Chang and Tang, 2003; Detarsio et al., 2004). ME has also been reported associated with IMF deposition (Heyer and Lebret, 2007). Lipase (LPS) (Winkler et al., 1990), lipoprotein lipase (LPL) (Enerback and Gimble, 1993), and hepatic lipase (HL) (Ramsamy et al., 2000) are other enzymes that represent the activity of lipid metabolism. Data on the relationship between lipid metabolism and meat quality have been reported in mammals, chicken, and meat-type duck (Lee et al., 2010; Jo et al., 2013; Zhang and Li, 2014; Li et al., 2016). The Sheldrake duck used in this study is a dual-purpose breed widely used for both meat and eggs. It is widely raised all over the world, especially in Asia. In poultry, lipid synthesis is primarily located in the liver (Fishman and Brady, 1976; Hermier 1997). Thus, it might be meaningful to study lipid biosynthesis in the liver and its potential effect on fat deposition at different positions and meat quality in Sheldrake duck. In this study, fat contents of SF, AF, and IMF at different ages were measured. Activities and expressions of related enzymes in liver and blood lipid changes were also determined to study their relationship to fat deposition in Sheldrake duck. Moreover, meat quality factors in breast muscle were also determined to learn their relationship with IMF deposition. These results might provide useful information for Sheldrake duck production and further research on duck lipid metabolism. MATERIALS AND METHODS Ethics Statement All experimental protocols were approved by Animal Ethics committee of Ningbo University (Ningbo, China) and met the guidelines of the Institutional Animal Care and Use Committee (IACUC). Sample Collection All Sheldrake ducks used in this study had the same genetic background. Ducks were sampled at 90 d, 180 d, 270 d, and 360 d. At each age, 6 ducks (3 male and 3 female) with similar weight at each age were selected and slaughtered by jugular venesection after fasting for 12 h. Liver and breast muscle samples were rapidly collected and put in liquid nitrogen, then store at –80°C. The residual muscles were stored at 4°C for meat quality measurement. Blood was collected, held at room temperature for 1 h, and centrifuged at 3,000 rpm, 4°C for 20 min. Serum was obtained and stored at –20°C. All the samples were collected within 3 h. The contents of SF and AF were measured according to the standard protocols (Qiu and Yang, 1993). pH Measurement Two grams of breast muscle, taken at 24 h postmortem, was homogenized at 10,000 rpm with an XHF-D homogenizer (Xinzhi, Ningbo, China) in 10 mL distilled water. Then the mixture was held at 4°C for 30 min and filtered. The pH of the filtrate was measured using an FE20 pH meter (Mettler-Toledo, Zurich, Switzerland). The pH meter was pre-standardized by a 2-point method against buffer standards of pH 6.86 and pH 4.0. Drip Loss One sample (about 4 cm × 3 cm × 1 cm) of each breast muscle was prepared (visible fat and epimysium removed), weighed (m1), and hung in an aerated plastic bag at 4°C for 24 h. Then the meat sample was weighed again (m2), and the drip loss was calculated with the following formula: Drip loss (%) = (m1 – m2)/m1 × 100. Cooking Loss and Shear Force Each sample was weighed (m3) accurately at 24 h postmortem. And the sample in cooking bag was immersed in 80°C water bath until reaching an internal endpoint of 75°C. Then the sample was taken out, cooled down to the internal temperature of room temperature, wiped to remove excess water with blotting paper and weighed (m4) immediately. Cooking loss was calculated as: Cooking loss (%) = (m3 – m4)/m3 × 100. The same sample was used for the shear force measurement. After cooking, the muscle strips were sampled along the fiber axis using an equipped sampler with a diameter of 1 cm, and the shear force values were determined with a C-LM3B digital tenderness meter (Harbin, China). Fat Content Determination in Muscle and Liver The fat content in breast muscle (IMF) and liver tissue were determined following the method of chloroform-methanol extraction (Danielson et al., 1997). RNA Extraction and Reverse Transcription Total RNA in liver tissue was extracted with Trizol reagent (Invitrogen, Carlsbad, CA) and treated with RQ1 DNase (Promega, Madison, WI) to remove DNA according to the manufacturers’ protocols. The quality and concentration of the extracted RNA was detected by measuring the absorbance at 260 nm/280 nm using NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA), and its integrity was further verified by 1.5% agarose gel electrophoresis. The first-strand cDNA was synthesized using M-MLV reverse transcriptase (Takara Bio, Shiga, Japan) following the manufacturer's protocols (He et al., 2016). qRT-PCR Analysis Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of liver tissue was performed on ABI 7300 system (Applied Biosystems, Hercules, CA). The 20.0 μL reaction mixture containing 10.0 μL 2 × SYBR qPCR Mix, 2.0 μL cDNA template, 0.4 μM F-/R-primer (Table 1), and 0.4 μL ROX reference dye (TransGen, Beijing, China). The cycling protocol was 94°C for 3 min, 40 cycles of denaturation at 94°C for 10 s, annealing and extension at 60°C for 30 s. Each reaction was performed in triplicate. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was chosen as endogenous internal control. Table 1. Primers used in this study. Genes Genbank accession No. Sequences (5΄→3΄) GAPDH XM_0,050,16745 F: agatgctggtgctgaatacg R: cggagatgatgacacgctta FAS AY613443 F: cggcagttggtcagttctct R: acggctctctctcacattgg ME XM_0,050,21387 F: ccctggaagatggaagaacc R: aatatgtcgaacgctgctga Genes Genbank accession No. Sequences (5΄→3΄) GAPDH XM_0,050,16745 F: agatgctggtgctgaatacg R: cggagatgatgacacgctta FAS AY613443 F: cggcagttggtcagttctct R: acggctctctctcacattgg ME XM_0,050,21387 F: ccctggaagatggaagaacc R: aatatgtcgaacgctgctga View Large Table 1. Primers used in this study. Genes Genbank accession No. Sequences (5΄→3΄) GAPDH XM_0,050,16745 F: agatgctggtgctgaatacg R: cggagatgatgacacgctta FAS AY613443 F: cggcagttggtcagttctct R: acggctctctctcacattgg ME XM_0,050,21387 F: ccctggaagatggaagaacc R: aatatgtcgaacgctgctga Genes Genbank accession No. Sequences (5΄→3΄) GAPDH XM_0,050,16745 F: agatgctggtgctgaatacg R: cggagatgatgacacgctta FAS AY613443 F: cggcagttggtcagttctct R: acggctctctctcacattgg ME XM_0,050,21387 F: ccctggaagatggaagaacc R: aatatgtcgaacgctgctga View Large Determinations of Serum Lipid and Enzyme Activities The contents of triglycerides (TG), total cholesterol (TCH), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and LPS activity in serum, and the enzymic activities of FAS, ME, LPL, and HL in liver were determined using related reagent kit products (Jiancheng, Nanjing, China) following the manufacturer's protocols. LPS Activity The substrate buffer (2.0 mL, pre-heated at 37°C for 5 min) provided with the kit and the serum sample (50 μL) were rapidly mixed and shaken. After reacting for 30 s, the absorbance value at 420 nm was determined (A1) using a spectrophotometer (standardized with Tris buffer). Then the mixture was immersed in 37°C water bath for 10 min, and the absorbance value determined at 420 nm again (A2). The LPS activity was calculated as: E = [(A1 – A2)/As] × S × (2.05/0.05)/10. E (U/L); enzyme activity as absorbance value of standard product (provide with the kit) at 420 nm; S, concentration of standard product, 454 μM. FAS Activity The liver sample was homogenized with physiological saline (1: 9, m/v) and centrifuged at 2,500 rpm for 10 min. The supernatant, reaction Buffer and NAPDH (100 μM) were mixed and kept at 37°C for 10 min. Then acetyl-CoA and malonyl-CoA were added in and shaken immediately. The changes of absorbance values in 5 min at 340 nm were determined. Distilled water was used as control. ME Activity Tris-Cl Buffer (50 mM), MnCl2 (1.0 mM), NAPD (0.17 mM), L-malic acid (1.5 mM) and the liver homogenate supernatant were mixed and shaken immediately. The changes of absorbance values in 5 min at 340 nm were determined. Distilled water was used as control. Both the activities of FAS and ME were calculated as: E = [V1/(ε × L × P × V2)] × (Δe/5) × 1000. E (U/L), enzyme activity; V1 (mL), final volume of reaction solution; ε, the coefficient at 340 nm; L (cm), light path length; P (mg/mL), protein concentration of liver homogenate; V2 (mL), volume of liver homogenate; Δe, the changes of absorbance values in 5 min at 340 nm. LPL and HL Activities TG can be hydrolyzed to glycerol and free fatty acids (FFA) by LPL or HL, and FFA will combine copper ions. It can be detected with copper reagent (DDTC). Unlike LPL, HL does not need to be activated by apolipoprotein C-ii and will not be inhibited by protamine or high-concentration salt solution. Based on this, the activities of LPL and HL were determined respectively with the kit following the manufacturer's protocols. Statistical Analysis The differential significance was analyzed with one-way analysis of variance (ANOVA) and multiple comparison using SPSS software, and shown as means ± SD. Differences at P < 0.05 were considered significant. RESULTS Fat Deposition in Different Positions Fat contents at 4 locations at the ages of 90 d, 180 d, 270 d, and 360 d, respectively, were measured (Figure 1). The results showed that the IMF contents at 270 d (2.15 ± 0.24% b) and 360 d (2.30 ± 0.28% b) were significantly higher than those at 90 d (1.55 ± 0.07% a) and 180 d (1.64 ± 0.22% a) (P < 0.05). Aging of 180 and 270 d could lead to significant fat deposition in liver (P < 0.05) (Figure 1A). The AF content at 360 d was significantly higher than at the other 3 ages (P < 0.05). And the SF content results represented a positive relation with aging (P < 0.05) (Figure 1B). Figure 1. View largeDownload slide Fat deposition in breast muscle and liver (A), abdominal fat (AF) and sebum fat (SF) (B) in Sheldrake duck at ages of 90 d, 180 d, 270 d, and 360 d. Differential significance analyses were performed among the fat contents at the same location. Data with different letters indicate significant differences at P < 0.05. Figure 1. View largeDownload slide Fat deposition in breast muscle and liver (A), abdominal fat (AF) and sebum fat (SF) (B) in Sheldrake duck at ages of 90 d, 180 d, 270 d, and 360 d. Differential significance analyses were performed among the fat contents at the same location. Data with different letters indicate significant differences at P < 0.05. Expression and Activity Determinations of FAS and ME The mRNA expressions and enzyme activities of FAS and ME in Sheldrake duck liver at 90 d, 180 d, 270 d, and 360 d were detected and shown in Figure 2. The results indicated that the expressions and activities of these 2 enzymes increased during aging process (P < 0.05). Figure 2. View largeDownload slide Gene expressions and activities of fatty acid synthase (FAS) and malic enzyme (ME) in liver. GAPDH was chosen as the endogenous internal control for qRT-PCR analysis. Data were shown as mean ± SD, and different letters indicated significant differences (P < 0.05) at different ages. Figure 2. View largeDownload slide Gene expressions and activities of fatty acid synthase (FAS) and malic enzyme (ME) in liver. GAPDH was chosen as the endogenous internal control for qRT-PCR analysis. Data were shown as mean ± SD, and different letters indicated significant differences (P < 0.05) at different ages. Meat quality determination Four meat quality-related characters of the selected ducks, including pH at 24 h postmortem, cooking loss at 75°C, drip loss of 24 h and shear force values were measured and summarized in Table 2. Significant differences of the cooking loss and pH values were observed during aging process (P < 0.05). Drip loss at 180 d and shear force value at 360 d were both found significantly higher than at the other 3 ages (P < 0.05). Table 2. Meat quality characters of Sheldrake duck at different ages. Age (d) pH1 Cooking loss (%)2 Drip loss (%)3 Shear force (kg·f) 90 5.76 ± 0.15a 24.83 ± 1.97a 3.54 ± 0.44a 1.89 ± 0.15a 180 5.93 ± 0.16a 22.37 ± 1.96a 4.53 ± 0.71b 1.96 ± 0.13a 270 6.45 ± 0.17b 15.78 ± 1.76b 3.24 ± 0.43a 2.10 ± 0.16a 360 6.49 ± 0.13b 13.21 ± 1.32c 2.85 ± 0.16a 2.85 ± 0.13b Age (d) pH1 Cooking loss (%)2 Drip loss (%)3 Shear force (kg·f) 90 5.76 ± 0.15a 24.83 ± 1.97a 3.54 ± 0.44a 1.89 ± 0.15a 180 5.93 ± 0.16a 22.37 ± 1.96a 4.53 ± 0.71b 1.96 ± 0.13a 270 6.45 ± 0.17b 15.78 ± 1.76b 3.24 ± 0.43a 2.10 ± 0.16a 360 6.49 ± 0.13b 13.21 ± 1.32c 2.85 ± 0.16a 2.85 ± 0.13b a-cDifferent superscripted letters indicate significant differences (P < 0.05) at different ages. 1pH values at 24 h postmortem were measured. 2Cooking loss at 75°C was measured. 3Shear force values of chest muscle strips with a diameter of 1 cm were determined using a digital tenderness meter. View Large Table 2. Meat quality characters of Sheldrake duck at different ages. Age (d) pH1 Cooking loss (%)2 Drip loss (%)3 Shear force (kg·f) 90 5.76 ± 0.15a 24.83 ± 1.97a 3.54 ± 0.44a 1.89 ± 0.15a 180 5.93 ± 0.16a 22.37 ± 1.96a 4.53 ± 0.71b 1.96 ± 0.13a 270 6.45 ± 0.17b 15.78 ± 1.76b 3.24 ± 0.43a 2.10 ± 0.16a 360 6.49 ± 0.13b 13.21 ± 1.32c 2.85 ± 0.16a 2.85 ± 0.13b Age (d) pH1 Cooking loss (%)2 Drip loss (%)3 Shear force (kg·f) 90 5.76 ± 0.15a 24.83 ± 1.97a 3.54 ± 0.44a 1.89 ± 0.15a 180 5.93 ± 0.16a 22.37 ± 1.96a 4.53 ± 0.71b 1.96 ± 0.13a 270 6.45 ± 0.17b 15.78 ± 1.76b 3.24 ± 0.43a 2.10 ± 0.16a 360 6.49 ± 0.13b 13.21 ± 1.32c 2.85 ± 0.16a 2.85 ± 0.13b a-cDifferent superscripted letters indicate significant differences (P < 0.05) at different ages. 1pH values at 24 h postmortem were measured. 2Cooking loss at 75°C was measured. 3Shear force values of chest muscle strips with a diameter of 1 cm were determined using a digital tenderness meter. View Large Detection of Conventional Lipid Metabolism Related Indexes in Serum and Liver Sheldrake ducks at 180 d and 360 d were chosen to determine conventional characters in liver (Table 3) and serum lipid levels (Table 4). Activities of LPL, HL, and LPL+HL in liver at 360 d were significantly higher than those at 180 d (P < 0.05). However, the differences of TG, TCH, HDL, and LDL levels in serum did not appear significant between 180 d and 360 d (P > 0.05). Table 3. Activities of LPS in serum, LPL and HL in duck liver at 180 d and 360 d. Age(d) LPS (U/L) LPL (U/L) HL (U/L) LPL+HL (U/L) 180 12.95 ± 2.36 0.75 ± 0.03a 0.45 ± 0.03a 1.20 ± 0.06a 360 13.87 ± 2.99 1.12 ± 0.12b 0.69 ± 0.03b 1.81 ± 0.09b Age(d) LPS (U/L) LPL (U/L) HL (U/L) LPL+HL (U/L) 180 12.95 ± 2.36 0.75 ± 0.03a 0.45 ± 0.03a 1.20 ± 0.06a 360 13.87 ± 2.99 1.12 ± 0.12b 0.69 ± 0.03b 1.81 ± 0.09b a,bDifferent Superscripted letters indicated significant differences (P < 0.05) at different ages. View Large Table 3. Activities of LPS in serum, LPL and HL in duck liver at 180 d and 360 d. Age(d) LPS (U/L) LPL (U/L) HL (U/L) LPL+HL (U/L) 180 12.95 ± 2.36 0.75 ± 0.03a 0.45 ± 0.03a 1.20 ± 0.06a 360 13.87 ± 2.99 1.12 ± 0.12b 0.69 ± 0.03b 1.81 ± 0.09b Age(d) LPS (U/L) LPL (U/L) HL (U/L) LPL+HL (U/L) 180 12.95 ± 2.36 0.75 ± 0.03a 0.45 ± 0.03a 1.20 ± 0.06a 360 13.87 ± 2.99 1.12 ± 0.12b 0.69 ± 0.03b 1.81 ± 0.09b a,bDifferent Superscripted letters indicated significant differences (P < 0.05) at different ages. View Large Table 4. Serum lipid levels in Sheldrake duck at 180 d and 360 d. Age TG TCH HDL LDL R1 R2 (d) (mM) (mM) (mM) (mM) (TG/HDL) (LDL/HDL) 180 5.76 ± 1.03 3.22 ± 0.44 1.45 ± 0.14 1.11 ± 0.16 3.93 ±0.38 a 0.75 ± 0.12 360 7.10 ± 1.05 3.01 ± 0.51 1.18 ± 0.28 1.35 ± 0.23 6.08 ± 1.10 b 1.10 ± 0.20 Age TG TCH HDL LDL R1 R2 (d) (mM) (mM) (mM) (mM) (TG/HDL) (LDL/HDL) 180 5.76 ± 1.03 3.22 ± 0.44 1.45 ± 0.14 1.11 ± 0.16 3.93 ±0.38 a 0.75 ± 0.12 360 7.10 ± 1.05 3.01 ± 0.51 1.18 ± 0.28 1.35 ± 0.23 6.08 ± 1.10 b 1.10 ± 0.20 a,bDifferent superscripted letters indicated significant differences (P < 0.05) at different ages. View Large Table 4. Serum lipid levels in Sheldrake duck at 180 d and 360 d. Age TG TCH HDL LDL R1 R2 (d) (mM) (mM) (mM) (mM) (TG/HDL) (LDL/HDL) 180 5.76 ± 1.03 3.22 ± 0.44 1.45 ± 0.14 1.11 ± 0.16 3.93 ±0.38 a 0.75 ± 0.12 360 7.10 ± 1.05 3.01 ± 0.51 1.18 ± 0.28 1.35 ± 0.23 6.08 ± 1.10 b 1.10 ± 0.20 Age TG TCH HDL LDL R1 R2 (d) (mM) (mM) (mM) (mM) (TG/HDL) (LDL/HDL) 180 5.76 ± 1.03 3.22 ± 0.44 1.45 ± 0.14 1.11 ± 0.16 3.93 ±0.38 a 0.75 ± 0.12 360 7.10 ± 1.05 3.01 ± 0.51 1.18 ± 0.28 1.35 ± 0.23 6.08 ± 1.10 b 1.10 ± 0.20 a,bDifferent superscripted letters indicated significant differences (P < 0.05) at different ages. View Large DISCUSSION Fat deposition is an important factor in duck cultivation that influencing feed cost, meat quality, flavor, and so on. In this study, fat contents in different tissues at 90 d, 180 d, 270 d, and 360 d were measured to learn fat deposition in Sheldrake duck. Overall, fat contents in the 4 selected locations and activities of FAS and ME increased during aging process. Considering these results, 2 ages, 180 d and 360 d, were selected to determine the serum lipid levels and the conventional lipid metabolism related indexes in liver. The LPS activity in serum showed that the fat digestion and absorption of Sheldrake ducks were not significantly different at 180 d and 360 d. The activities of LPL, HL, and whole lipase (LPL + HL) at 360 d were observed significantly higher than those at 180 d, while the LPS activity showed no significant differences (P > 0.05). LPL was reported able to hydrolyze TG in chylomicron (CM) and very low density lipoprotein (VLDL) into glycerol and fatty acids (Detarsio et al., 2004). LPL was reported to be either not expressed or expressed at low levels in adult mammals’ livers (Enerback and Gimble, 1993). Our former experiments (unpublished data) showed that duck LPL was moderately expressed in liver tissue and participated in lipid metabolism in cultured hepatocytes (He et al., 2013). We thought that LPL might function more widely in ducks, and the LPL activity in liver was determined in this study. In duck, LPL could promote fat deposition in extrahepatic tissues and inhibit fatty liver degeneration (Chang and Tang, 2003). HL could hydrolyze high density lipoprotein (HDL). LPL and HL were considered to influence the lipid levels in serum. But the results in this study showed that all the levels of TG, TCH, HDL, and LDL were detected not significantly different between the ages of 180 d and 360 d. Moreover, TG is an intermediate metabolite in lipid metabolism (Hermier, 1997), HDL could hydrolyze lipid in extrahepatic tissues and LDL could transport cholesterol synthesized by liver to other tissues (Heyer and Lebret, 2007). So we thought that the significant difference of R1 (TG/HDL) at 180 d and 360 d might explain the increased fat deposition during aging process. However, as the data also indicated that, the most significant fat deposition at different ages was found in sebum. It could be inferred that the rising lipid metabolism mainly contributed to sebum fat deposition, which is unexpected for both producers and consumers. Fat deposition in muscle is beneficial to meat quality and flavor. Data in this study show that aging significantly affects IMF content and meat quality in Sheldrake duck. Duck breast muscles with higher IMF contents at 270 d and 360 d is accompanied by higher pH and less cooking loss. There might be a potential relation between IMF content and pH or cooking loss. Whereas, the shear force results indicate that IMF content does not significantly improve duck tenderness, which is not consistent with previous reports (Jeleníková et al., 2008; Pietruszka et al., 2015). It might be due to the muscle fiber development. CONCLUSION It was demonstrated that aging significantly affects fat deposition in Sheldrake duck, including IMF, AF, SF, and fat in liver, most obviously in SF. Aging also influences meat quality, including pH, cooking loss, drip loss and tenderness. And there might be a potential relationship between IMF content and pH or cooking loss in Sheldrake duck. It was concluded that the best quality of Sheldrake duck meat occurs between 180 d and 270 d. ACKNOWLEDGMENTS We acknowledge funding support from Science and Technology Program of Zhejiang (2017C02G2070312), Modern Agricultural Technical Foundation of China (CARS-42–25), and Kuancheng Wong Magna Fund at Ningbo University. REFERENCES Chang G. G. , Tang L. . 2003 . Structure and function of malic enzymes, a new class of oxidative decarboxylases . Biochemistry 42 : 12721 – 12733 . Google Scholar CrossRef Search ADS PubMed Danielson K. G. , Baribault H. , Holmes D. F. , Graham H. , Kadler K. E. , Iozzo R. V. . 1997 . Targeted disruption of decorin leads to abnormal collagen fibril morphology and skin fragility . J. Cell Biol . 136 : 729 – 743 . Google Scholar CrossRef Search ADS PubMed Detarsio E. , Andreo C. S. , Drincovich M. F. . 2004 . Basic residues play key roles in catalysis and NADP(+)-specificity in maize (Zea mays L.) photosynthetic NADP(+)-dependent malic enzyme . Biochem. J . 382 : 1025 – 1030 . Google Scholar CrossRef Search ADS PubMed Enerback S. , Gimble J. M. . 1993 . Lipoprotein lipase gene expression: physiological regulators at the transcriptional and post-transcriptional level . Biochim. Biophys. Acta 1169 : 107 – 125 . Google Scholar CrossRef Search ADS PubMed Fishman P. H. , Brady R. O. . 1976 . Biosynthesis and function of gangliosides . Science 194 : 906 – 915 . Google Scholar CrossRef Search ADS PubMed Gao S. Z. , Zhao S. M. . 2009 . Physiology, affecting factors and strategies for control of pig meat intramuscular fat . Recent Patents Food Nutr. Agric . 1 : 59 – 74 . Google Scholar CrossRef Search ADS He J. , Wang W. , Lu L. , Tian Y. , Niu D. , Ren J. , Dong L. , Sun S. , Zhao Y. , Chen L. , Shen J. , Li X. . 2016 . Analysis of miRNAs and their target genes associated with lipid metabolism in duck liver . Sci. Rep . 6 : 27418 . Google Scholar CrossRef Search ADS PubMed He J. , Tian Y. , Li J. , Shen J. , Tao Z. , Fu Y. , Niu D. , Lu L. . 2013 . Expression pattern of L-FABP gene in different tissues and its regulation of fat metabolism-related genes in duck . Mol. Biol. Rep . 40 : 189 – 195 . Google Scholar CrossRef Search ADS PubMed Hermier D. 1997 . Lipoprotein metabolism and fattening in poultry . J. Nutr . 127 : 805S – 808S . Google Scholar CrossRef Search ADS PubMed Heyer A. , Lebret B. . 2007 . Compensatory growth response in pigs: Effects on growth performance, composition of weight gain at carcass and muscle levels, and meat quality1 . J. Anim. Sci . 85 : 769 – 778 . Google Scholar CrossRef Search ADS PubMed Jeleníková J. , Pipek P. , Miyahara M. . 2008 . The effects of breed, sex, intramuscular fat and ultimate pH on pork tenderness . Eur. Food Res. Technol . 227 : 989 – 994 . Google Scholar CrossRef Search ADS Jo C. , Jayasena D. D. , Lim D.-G. , Lee K.-H. , Kim J.-J. , Cha J.-S. , Nam K.-C. . 2013 . Effect of intramuscular fat content on the meat quality and antioxidative dipeptides of Hanwoo beef . Korean J. Food Nutr . 26 : 117 – 124 . Google Scholar CrossRef Search ADS Lee S. H. , Choi Y. M. , Choe J. H. , Kim J. M. , Hong K. C. , Park H. C. , Kim B. C. . 2010 . Association between polymorphisms of the heart fatty acid binding protein gene and intramuscular fat content, fatty acid composition, and meat quality in Berkshire breed . Meat Sci . 86 : 794 – 800 . Google Scholar CrossRef Search ADS PubMed Li X. K. , Wang J. Z. , Wang C. Q. , Zhang C. H. , Li X. , Tang C. H. , Wei X. L. . 2016 . Effect of dietary phosphorus levels on meat quality and lipid metabolism in broiler chickens . Food Chem . 205 : 289 – 296 . Google Scholar CrossRef Search ADS PubMed Lyczynski A. , Pospiech E. , Rzosinska E. , Czyzak-Runowska G. , Grzes B. , Mikolajczak B. , Iwanska E. . 2006 . Quality of porcine meat in relation to pig genotype and intramuscular fat content . Anim. Sci. Pap. Rep . 24 : 195 – 204 . Pietruszka A. , Jacyno E. , Kawęcka M. , Biel W. . 2015 . The relation between intramuscular fat level in the longissimus muscle and the quality of pig carcasses and meat . Ann. Anim. Sci . 15 : 1031 – 1041 . Google Scholar CrossRef Search ADS Qiu X. P. , Yang S. . 1993 . Poultry science (the third version). Sichuan Sci . Technol. Press : 74 . Raj S. , Skiba G. , Weremko D. , Fandrejewski H. , Migdal W. , Borowiec F. , Polawska E. . 2010 . The relationship between the chemical composition of the carcass and the fatty acid composition of intramuscular fat and backfat of several pig breeds slaughtered at different weights . Meat Sci . 86 : 324 – 330 . Google Scholar CrossRef Search ADS PubMed Ramsamy T. A. , Neville T. A. M. , Chauhan B. M. , Aggarwal D. , Sparks D. L. . 2000 . Apolipoprotein A-I regulates lipid hydrolysis by hepatic lipase . J. Biol. Chem. 275 : 33480 – 33486 . Google Scholar CrossRef Search ADS PubMed Smith S. , Witkowski A. , Joshi A. K. . 2003 . Structural and functional organization of the animal fatty acid synthase . Prog. Lipid Res . 42 : 289 – 317 . Google Scholar CrossRef Search ADS PubMed van Laack R. L. , Stevens S. G. , Stalder K. J. . 2001 . The influence of ultimate pH and intramuscular fat content on pork tenderness and tenderization . J. Anim. Sci . 79 : 392 . Google Scholar CrossRef Search ADS PubMed Wakil S. J. 1989 . Fatty acid synthase, a proficient multifunctional enzyme . Biochemistry 28 : 4523 – 4530 . Google Scholar CrossRef Search ADS PubMed Winkler F. K. , D’Arcy A. , Hunziker W. . 1990 . Structure of human pancreatic lipase . Nature 343 : 771 – 774 . Google Scholar CrossRef Search ADS PubMed Yuan H. B. K. , Frandsen M. , Rosenvold K. . 2011 . Effect of ageing prior to freezing on colour stability of ovine longissimus muscle . Meat Sci . 88 : 332 – 337 . Google Scholar CrossRef Search ADS PubMed Zhang Y. , Li W. . 2014 . A novel SNP of LXRα gene associated with meat quality traits in Cherry Valley ducks . Pak. J. Zool . 46 : 1039 – 1044 . © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Effects of aging on fat deposition and meat quality in Sheldrake duck

Loading next page...
 
/lp/ou_press/effects-of-aging-on-fat-deposition-and-meat-quality-in-sheldrake-duck-PiBglRyIPW
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pey077
Publisher site
See Article on Publisher Site

Abstract

ABSTRACT Sheldrake is a duck breed widely used for its meat and eggs. In this study, the quantities of abdominal fat, sebum, intramuscular fat and liver fat, meat quality (pH, cooking loss, drip loss, and shear force), and expression and activity of several enzymes at different ages were determined. The results showed that the fat content increased (P < 0.05) during the aging process (90 d, 180 d, 270 d, and 360 d). Fatty acid synthase (FAS) and malic enzyme (ME) were chosen to represent the activity of lipid biosynthesis in Sheldrake ducks. The quantitative real-time PCR and enzymic activity data showed that the expression of both FAS and ME were generally up-regulated along with aging. Based on these results, the individual ducks were selected at 180 d and 360 d for analyzing the changes of serum lipid levels and related enzymic activities in liver. The contents of triglycerides (TG), total cholesterol (TCH), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in serum were found not significantly different (P > 0.05). However, we thought that the variation of TG/HDL (P < 0.05) might explain the increased fat deposition. Moreover, the activities of lipoprotein lipase (LPL) and hepatic lipase (HL) were both detected significantly up-regulated at 360 d (P < 0.05). The meat quality results of breast muscles indicated that pH, cooking loss, drip loss, and shear force values could all be affected by aging. Considering these results, we concluded that the best quality of Sheldrake duck meat occurs between 180 d and 270 d. These results might provide useful information for Sheldrake cultivation and research on lipid metabolism. INTRODUCTION Fat deposition in animals, including subcutaneous fat (SF), abdominal fat (AF) and intramuscular fat (IMF), can influence feed cost, meat quality, and human health (Gao and Zhao, 2009; Lee et al., 2010; Raj et al., 2010). Meat quality can be evaluated by measuring factors such as water holding capacity, pH, and tenderness. These indices were all reported to be influenced by IMF content (van Laack et al., 2001; Lyczynski et al., 2006; Jeleníková et al., 2008; Yuan et al., 2011; Pietruszka et al., 2015). Thus, IMF is considered correlated with meat quality. In lipid metabolism, data on various related enzymes are available. Fatty acid synthase (FAS) is a crucial, rate-limiting, multifunctional enzyme in lipogenesis and deposition. FAS can catalyze acetyl-CoA and malonyl-CoA to synthesize fatty acids. It is the primary source of fatty acids in lipid biosynthesis (Wakil, 1989; Smith et al., 2003). Malic enzyme (ME) can catalyze malic acid to generate pyruvic acid and CO2, accompanied with the reduction of nicotinamide adenine dinucleotide phosphate (NADP+). It provides materials and energy for acetyl-CoA transportation and fatty acid synthesis (Chang and Tang, 2003; Detarsio et al., 2004). ME has also been reported associated with IMF deposition (Heyer and Lebret, 2007). Lipase (LPS) (Winkler et al., 1990), lipoprotein lipase (LPL) (Enerback and Gimble, 1993), and hepatic lipase (HL) (Ramsamy et al., 2000) are other enzymes that represent the activity of lipid metabolism. Data on the relationship between lipid metabolism and meat quality have been reported in mammals, chicken, and meat-type duck (Lee et al., 2010; Jo et al., 2013; Zhang and Li, 2014; Li et al., 2016). The Sheldrake duck used in this study is a dual-purpose breed widely used for both meat and eggs. It is widely raised all over the world, especially in Asia. In poultry, lipid synthesis is primarily located in the liver (Fishman and Brady, 1976; Hermier 1997). Thus, it might be meaningful to study lipid biosynthesis in the liver and its potential effect on fat deposition at different positions and meat quality in Sheldrake duck. In this study, fat contents of SF, AF, and IMF at different ages were measured. Activities and expressions of related enzymes in liver and blood lipid changes were also determined to study their relationship to fat deposition in Sheldrake duck. Moreover, meat quality factors in breast muscle were also determined to learn their relationship with IMF deposition. These results might provide useful information for Sheldrake duck production and further research on duck lipid metabolism. MATERIALS AND METHODS Ethics Statement All experimental protocols were approved by Animal Ethics committee of Ningbo University (Ningbo, China) and met the guidelines of the Institutional Animal Care and Use Committee (IACUC). Sample Collection All Sheldrake ducks used in this study had the same genetic background. Ducks were sampled at 90 d, 180 d, 270 d, and 360 d. At each age, 6 ducks (3 male and 3 female) with similar weight at each age were selected and slaughtered by jugular venesection after fasting for 12 h. Liver and breast muscle samples were rapidly collected and put in liquid nitrogen, then store at –80°C. The residual muscles were stored at 4°C for meat quality measurement. Blood was collected, held at room temperature for 1 h, and centrifuged at 3,000 rpm, 4°C for 20 min. Serum was obtained and stored at –20°C. All the samples were collected within 3 h. The contents of SF and AF were measured according to the standard protocols (Qiu and Yang, 1993). pH Measurement Two grams of breast muscle, taken at 24 h postmortem, was homogenized at 10,000 rpm with an XHF-D homogenizer (Xinzhi, Ningbo, China) in 10 mL distilled water. Then the mixture was held at 4°C for 30 min and filtered. The pH of the filtrate was measured using an FE20 pH meter (Mettler-Toledo, Zurich, Switzerland). The pH meter was pre-standardized by a 2-point method against buffer standards of pH 6.86 and pH 4.0. Drip Loss One sample (about 4 cm × 3 cm × 1 cm) of each breast muscle was prepared (visible fat and epimysium removed), weighed (m1), and hung in an aerated plastic bag at 4°C for 24 h. Then the meat sample was weighed again (m2), and the drip loss was calculated with the following formula: Drip loss (%) = (m1 – m2)/m1 × 100. Cooking Loss and Shear Force Each sample was weighed (m3) accurately at 24 h postmortem. And the sample in cooking bag was immersed in 80°C water bath until reaching an internal endpoint of 75°C. Then the sample was taken out, cooled down to the internal temperature of room temperature, wiped to remove excess water with blotting paper and weighed (m4) immediately. Cooking loss was calculated as: Cooking loss (%) = (m3 – m4)/m3 × 100. The same sample was used for the shear force measurement. After cooking, the muscle strips were sampled along the fiber axis using an equipped sampler with a diameter of 1 cm, and the shear force values were determined with a C-LM3B digital tenderness meter (Harbin, China). Fat Content Determination in Muscle and Liver The fat content in breast muscle (IMF) and liver tissue were determined following the method of chloroform-methanol extraction (Danielson et al., 1997). RNA Extraction and Reverse Transcription Total RNA in liver tissue was extracted with Trizol reagent (Invitrogen, Carlsbad, CA) and treated with RQ1 DNase (Promega, Madison, WI) to remove DNA according to the manufacturers’ protocols. The quality and concentration of the extracted RNA was detected by measuring the absorbance at 260 nm/280 nm using NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA), and its integrity was further verified by 1.5% agarose gel electrophoresis. The first-strand cDNA was synthesized using M-MLV reverse transcriptase (Takara Bio, Shiga, Japan) following the manufacturer's protocols (He et al., 2016). qRT-PCR Analysis Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of liver tissue was performed on ABI 7300 system (Applied Biosystems, Hercules, CA). The 20.0 μL reaction mixture containing 10.0 μL 2 × SYBR qPCR Mix, 2.0 μL cDNA template, 0.4 μM F-/R-primer (Table 1), and 0.4 μL ROX reference dye (TransGen, Beijing, China). The cycling protocol was 94°C for 3 min, 40 cycles of denaturation at 94°C for 10 s, annealing and extension at 60°C for 30 s. Each reaction was performed in triplicate. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was chosen as endogenous internal control. Table 1. Primers used in this study. Genes Genbank accession No. Sequences (5΄→3΄) GAPDH XM_0,050,16745 F: agatgctggtgctgaatacg R: cggagatgatgacacgctta FAS AY613443 F: cggcagttggtcagttctct R: acggctctctctcacattgg ME XM_0,050,21387 F: ccctggaagatggaagaacc R: aatatgtcgaacgctgctga Genes Genbank accession No. Sequences (5΄→3΄) GAPDH XM_0,050,16745 F: agatgctggtgctgaatacg R: cggagatgatgacacgctta FAS AY613443 F: cggcagttggtcagttctct R: acggctctctctcacattgg ME XM_0,050,21387 F: ccctggaagatggaagaacc R: aatatgtcgaacgctgctga View Large Table 1. Primers used in this study. Genes Genbank accession No. Sequences (5΄→3΄) GAPDH XM_0,050,16745 F: agatgctggtgctgaatacg R: cggagatgatgacacgctta FAS AY613443 F: cggcagttggtcagttctct R: acggctctctctcacattgg ME XM_0,050,21387 F: ccctggaagatggaagaacc R: aatatgtcgaacgctgctga Genes Genbank accession No. Sequences (5΄→3΄) GAPDH XM_0,050,16745 F: agatgctggtgctgaatacg R: cggagatgatgacacgctta FAS AY613443 F: cggcagttggtcagttctct R: acggctctctctcacattgg ME XM_0,050,21387 F: ccctggaagatggaagaacc R: aatatgtcgaacgctgctga View Large Determinations of Serum Lipid and Enzyme Activities The contents of triglycerides (TG), total cholesterol (TCH), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and LPS activity in serum, and the enzymic activities of FAS, ME, LPL, and HL in liver were determined using related reagent kit products (Jiancheng, Nanjing, China) following the manufacturer's protocols. LPS Activity The substrate buffer (2.0 mL, pre-heated at 37°C for 5 min) provided with the kit and the serum sample (50 μL) were rapidly mixed and shaken. After reacting for 30 s, the absorbance value at 420 nm was determined (A1) using a spectrophotometer (standardized with Tris buffer). Then the mixture was immersed in 37°C water bath for 10 min, and the absorbance value determined at 420 nm again (A2). The LPS activity was calculated as: E = [(A1 – A2)/As] × S × (2.05/0.05)/10. E (U/L); enzyme activity as absorbance value of standard product (provide with the kit) at 420 nm; S, concentration of standard product, 454 μM. FAS Activity The liver sample was homogenized with physiological saline (1: 9, m/v) and centrifuged at 2,500 rpm for 10 min. The supernatant, reaction Buffer and NAPDH (100 μM) were mixed and kept at 37°C for 10 min. Then acetyl-CoA and malonyl-CoA were added in and shaken immediately. The changes of absorbance values in 5 min at 340 nm were determined. Distilled water was used as control. ME Activity Tris-Cl Buffer (50 mM), MnCl2 (1.0 mM), NAPD (0.17 mM), L-malic acid (1.5 mM) and the liver homogenate supernatant were mixed and shaken immediately. The changes of absorbance values in 5 min at 340 nm were determined. Distilled water was used as control. Both the activities of FAS and ME were calculated as: E = [V1/(ε × L × P × V2)] × (Δe/5) × 1000. E (U/L), enzyme activity; V1 (mL), final volume of reaction solution; ε, the coefficient at 340 nm; L (cm), light path length; P (mg/mL), protein concentration of liver homogenate; V2 (mL), volume of liver homogenate; Δe, the changes of absorbance values in 5 min at 340 nm. LPL and HL Activities TG can be hydrolyzed to glycerol and free fatty acids (FFA) by LPL or HL, and FFA will combine copper ions. It can be detected with copper reagent (DDTC). Unlike LPL, HL does not need to be activated by apolipoprotein C-ii and will not be inhibited by protamine or high-concentration salt solution. Based on this, the activities of LPL and HL were determined respectively with the kit following the manufacturer's protocols. Statistical Analysis The differential significance was analyzed with one-way analysis of variance (ANOVA) and multiple comparison using SPSS software, and shown as means ± SD. Differences at P < 0.05 were considered significant. RESULTS Fat Deposition in Different Positions Fat contents at 4 locations at the ages of 90 d, 180 d, 270 d, and 360 d, respectively, were measured (Figure 1). The results showed that the IMF contents at 270 d (2.15 ± 0.24% b) and 360 d (2.30 ± 0.28% b) were significantly higher than those at 90 d (1.55 ± 0.07% a) and 180 d (1.64 ± 0.22% a) (P < 0.05). Aging of 180 and 270 d could lead to significant fat deposition in liver (P < 0.05) (Figure 1A). The AF content at 360 d was significantly higher than at the other 3 ages (P < 0.05). And the SF content results represented a positive relation with aging (P < 0.05) (Figure 1B). Figure 1. View largeDownload slide Fat deposition in breast muscle and liver (A), abdominal fat (AF) and sebum fat (SF) (B) in Sheldrake duck at ages of 90 d, 180 d, 270 d, and 360 d. Differential significance analyses were performed among the fat contents at the same location. Data with different letters indicate significant differences at P < 0.05. Figure 1. View largeDownload slide Fat deposition in breast muscle and liver (A), abdominal fat (AF) and sebum fat (SF) (B) in Sheldrake duck at ages of 90 d, 180 d, 270 d, and 360 d. Differential significance analyses were performed among the fat contents at the same location. Data with different letters indicate significant differences at P < 0.05. Expression and Activity Determinations of FAS and ME The mRNA expressions and enzyme activities of FAS and ME in Sheldrake duck liver at 90 d, 180 d, 270 d, and 360 d were detected and shown in Figure 2. The results indicated that the expressions and activities of these 2 enzymes increased during aging process (P < 0.05). Figure 2. View largeDownload slide Gene expressions and activities of fatty acid synthase (FAS) and malic enzyme (ME) in liver. GAPDH was chosen as the endogenous internal control for qRT-PCR analysis. Data were shown as mean ± SD, and different letters indicated significant differences (P < 0.05) at different ages. Figure 2. View largeDownload slide Gene expressions and activities of fatty acid synthase (FAS) and malic enzyme (ME) in liver. GAPDH was chosen as the endogenous internal control for qRT-PCR analysis. Data were shown as mean ± SD, and different letters indicated significant differences (P < 0.05) at different ages. Meat quality determination Four meat quality-related characters of the selected ducks, including pH at 24 h postmortem, cooking loss at 75°C, drip loss of 24 h and shear force values were measured and summarized in Table 2. Significant differences of the cooking loss and pH values were observed during aging process (P < 0.05). Drip loss at 180 d and shear force value at 360 d were both found significantly higher than at the other 3 ages (P < 0.05). Table 2. Meat quality characters of Sheldrake duck at different ages. Age (d) pH1 Cooking loss (%)2 Drip loss (%)3 Shear force (kg·f) 90 5.76 ± 0.15a 24.83 ± 1.97a 3.54 ± 0.44a 1.89 ± 0.15a 180 5.93 ± 0.16a 22.37 ± 1.96a 4.53 ± 0.71b 1.96 ± 0.13a 270 6.45 ± 0.17b 15.78 ± 1.76b 3.24 ± 0.43a 2.10 ± 0.16a 360 6.49 ± 0.13b 13.21 ± 1.32c 2.85 ± 0.16a 2.85 ± 0.13b Age (d) pH1 Cooking loss (%)2 Drip loss (%)3 Shear force (kg·f) 90 5.76 ± 0.15a 24.83 ± 1.97a 3.54 ± 0.44a 1.89 ± 0.15a 180 5.93 ± 0.16a 22.37 ± 1.96a 4.53 ± 0.71b 1.96 ± 0.13a 270 6.45 ± 0.17b 15.78 ± 1.76b 3.24 ± 0.43a 2.10 ± 0.16a 360 6.49 ± 0.13b 13.21 ± 1.32c 2.85 ± 0.16a 2.85 ± 0.13b a-cDifferent superscripted letters indicate significant differences (P < 0.05) at different ages. 1pH values at 24 h postmortem were measured. 2Cooking loss at 75°C was measured. 3Shear force values of chest muscle strips with a diameter of 1 cm were determined using a digital tenderness meter. View Large Table 2. Meat quality characters of Sheldrake duck at different ages. Age (d) pH1 Cooking loss (%)2 Drip loss (%)3 Shear force (kg·f) 90 5.76 ± 0.15a 24.83 ± 1.97a 3.54 ± 0.44a 1.89 ± 0.15a 180 5.93 ± 0.16a 22.37 ± 1.96a 4.53 ± 0.71b 1.96 ± 0.13a 270 6.45 ± 0.17b 15.78 ± 1.76b 3.24 ± 0.43a 2.10 ± 0.16a 360 6.49 ± 0.13b 13.21 ± 1.32c 2.85 ± 0.16a 2.85 ± 0.13b Age (d) pH1 Cooking loss (%)2 Drip loss (%)3 Shear force (kg·f) 90 5.76 ± 0.15a 24.83 ± 1.97a 3.54 ± 0.44a 1.89 ± 0.15a 180 5.93 ± 0.16a 22.37 ± 1.96a 4.53 ± 0.71b 1.96 ± 0.13a 270 6.45 ± 0.17b 15.78 ± 1.76b 3.24 ± 0.43a 2.10 ± 0.16a 360 6.49 ± 0.13b 13.21 ± 1.32c 2.85 ± 0.16a 2.85 ± 0.13b a-cDifferent superscripted letters indicate significant differences (P < 0.05) at different ages. 1pH values at 24 h postmortem were measured. 2Cooking loss at 75°C was measured. 3Shear force values of chest muscle strips with a diameter of 1 cm were determined using a digital tenderness meter. View Large Detection of Conventional Lipid Metabolism Related Indexes in Serum and Liver Sheldrake ducks at 180 d and 360 d were chosen to determine conventional characters in liver (Table 3) and serum lipid levels (Table 4). Activities of LPL, HL, and LPL+HL in liver at 360 d were significantly higher than those at 180 d (P < 0.05). However, the differences of TG, TCH, HDL, and LDL levels in serum did not appear significant between 180 d and 360 d (P > 0.05). Table 3. Activities of LPS in serum, LPL and HL in duck liver at 180 d and 360 d. Age(d) LPS (U/L) LPL (U/L) HL (U/L) LPL+HL (U/L) 180 12.95 ± 2.36 0.75 ± 0.03a 0.45 ± 0.03a 1.20 ± 0.06a 360 13.87 ± 2.99 1.12 ± 0.12b 0.69 ± 0.03b 1.81 ± 0.09b Age(d) LPS (U/L) LPL (U/L) HL (U/L) LPL+HL (U/L) 180 12.95 ± 2.36 0.75 ± 0.03a 0.45 ± 0.03a 1.20 ± 0.06a 360 13.87 ± 2.99 1.12 ± 0.12b 0.69 ± 0.03b 1.81 ± 0.09b a,bDifferent Superscripted letters indicated significant differences (P < 0.05) at different ages. View Large Table 3. Activities of LPS in serum, LPL and HL in duck liver at 180 d and 360 d. Age(d) LPS (U/L) LPL (U/L) HL (U/L) LPL+HL (U/L) 180 12.95 ± 2.36 0.75 ± 0.03a 0.45 ± 0.03a 1.20 ± 0.06a 360 13.87 ± 2.99 1.12 ± 0.12b 0.69 ± 0.03b 1.81 ± 0.09b Age(d) LPS (U/L) LPL (U/L) HL (U/L) LPL+HL (U/L) 180 12.95 ± 2.36 0.75 ± 0.03a 0.45 ± 0.03a 1.20 ± 0.06a 360 13.87 ± 2.99 1.12 ± 0.12b 0.69 ± 0.03b 1.81 ± 0.09b a,bDifferent Superscripted letters indicated significant differences (P < 0.05) at different ages. View Large Table 4. Serum lipid levels in Sheldrake duck at 180 d and 360 d. Age TG TCH HDL LDL R1 R2 (d) (mM) (mM) (mM) (mM) (TG/HDL) (LDL/HDL) 180 5.76 ± 1.03 3.22 ± 0.44 1.45 ± 0.14 1.11 ± 0.16 3.93 ±0.38 a 0.75 ± 0.12 360 7.10 ± 1.05 3.01 ± 0.51 1.18 ± 0.28 1.35 ± 0.23 6.08 ± 1.10 b 1.10 ± 0.20 Age TG TCH HDL LDL R1 R2 (d) (mM) (mM) (mM) (mM) (TG/HDL) (LDL/HDL) 180 5.76 ± 1.03 3.22 ± 0.44 1.45 ± 0.14 1.11 ± 0.16 3.93 ±0.38 a 0.75 ± 0.12 360 7.10 ± 1.05 3.01 ± 0.51 1.18 ± 0.28 1.35 ± 0.23 6.08 ± 1.10 b 1.10 ± 0.20 a,bDifferent superscripted letters indicated significant differences (P < 0.05) at different ages. View Large Table 4. Serum lipid levels in Sheldrake duck at 180 d and 360 d. Age TG TCH HDL LDL R1 R2 (d) (mM) (mM) (mM) (mM) (TG/HDL) (LDL/HDL) 180 5.76 ± 1.03 3.22 ± 0.44 1.45 ± 0.14 1.11 ± 0.16 3.93 ±0.38 a 0.75 ± 0.12 360 7.10 ± 1.05 3.01 ± 0.51 1.18 ± 0.28 1.35 ± 0.23 6.08 ± 1.10 b 1.10 ± 0.20 Age TG TCH HDL LDL R1 R2 (d) (mM) (mM) (mM) (mM) (TG/HDL) (LDL/HDL) 180 5.76 ± 1.03 3.22 ± 0.44 1.45 ± 0.14 1.11 ± 0.16 3.93 ±0.38 a 0.75 ± 0.12 360 7.10 ± 1.05 3.01 ± 0.51 1.18 ± 0.28 1.35 ± 0.23 6.08 ± 1.10 b 1.10 ± 0.20 a,bDifferent superscripted letters indicated significant differences (P < 0.05) at different ages. View Large DISCUSSION Fat deposition is an important factor in duck cultivation that influencing feed cost, meat quality, flavor, and so on. In this study, fat contents in different tissues at 90 d, 180 d, 270 d, and 360 d were measured to learn fat deposition in Sheldrake duck. Overall, fat contents in the 4 selected locations and activities of FAS and ME increased during aging process. Considering these results, 2 ages, 180 d and 360 d, were selected to determine the serum lipid levels and the conventional lipid metabolism related indexes in liver. The LPS activity in serum showed that the fat digestion and absorption of Sheldrake ducks were not significantly different at 180 d and 360 d. The activities of LPL, HL, and whole lipase (LPL + HL) at 360 d were observed significantly higher than those at 180 d, while the LPS activity showed no significant differences (P > 0.05). LPL was reported able to hydrolyze TG in chylomicron (CM) and very low density lipoprotein (VLDL) into glycerol and fatty acids (Detarsio et al., 2004). LPL was reported to be either not expressed or expressed at low levels in adult mammals’ livers (Enerback and Gimble, 1993). Our former experiments (unpublished data) showed that duck LPL was moderately expressed in liver tissue and participated in lipid metabolism in cultured hepatocytes (He et al., 2013). We thought that LPL might function more widely in ducks, and the LPL activity in liver was determined in this study. In duck, LPL could promote fat deposition in extrahepatic tissues and inhibit fatty liver degeneration (Chang and Tang, 2003). HL could hydrolyze high density lipoprotein (HDL). LPL and HL were considered to influence the lipid levels in serum. But the results in this study showed that all the levels of TG, TCH, HDL, and LDL were detected not significantly different between the ages of 180 d and 360 d. Moreover, TG is an intermediate metabolite in lipid metabolism (Hermier, 1997), HDL could hydrolyze lipid in extrahepatic tissues and LDL could transport cholesterol synthesized by liver to other tissues (Heyer and Lebret, 2007). So we thought that the significant difference of R1 (TG/HDL) at 180 d and 360 d might explain the increased fat deposition during aging process. However, as the data also indicated that, the most significant fat deposition at different ages was found in sebum. It could be inferred that the rising lipid metabolism mainly contributed to sebum fat deposition, which is unexpected for both producers and consumers. Fat deposition in muscle is beneficial to meat quality and flavor. Data in this study show that aging significantly affects IMF content and meat quality in Sheldrake duck. Duck breast muscles with higher IMF contents at 270 d and 360 d is accompanied by higher pH and less cooking loss. There might be a potential relation between IMF content and pH or cooking loss. Whereas, the shear force results indicate that IMF content does not significantly improve duck tenderness, which is not consistent with previous reports (Jeleníková et al., 2008; Pietruszka et al., 2015). It might be due to the muscle fiber development. CONCLUSION It was demonstrated that aging significantly affects fat deposition in Sheldrake duck, including IMF, AF, SF, and fat in liver, most obviously in SF. Aging also influences meat quality, including pH, cooking loss, drip loss and tenderness. And there might be a potential relationship between IMF content and pH or cooking loss in Sheldrake duck. It was concluded that the best quality of Sheldrake duck meat occurs between 180 d and 270 d. ACKNOWLEDGMENTS We acknowledge funding support from Science and Technology Program of Zhejiang (2017C02G2070312), Modern Agricultural Technical Foundation of China (CARS-42–25), and Kuancheng Wong Magna Fund at Ningbo University. REFERENCES Chang G. G. , Tang L. . 2003 . Structure and function of malic enzymes, a new class of oxidative decarboxylases . Biochemistry 42 : 12721 – 12733 . Google Scholar CrossRef Search ADS PubMed Danielson K. G. , Baribault H. , Holmes D. F. , Graham H. , Kadler K. E. , Iozzo R. V. . 1997 . Targeted disruption of decorin leads to abnormal collagen fibril morphology and skin fragility . J. Cell Biol . 136 : 729 – 743 . Google Scholar CrossRef Search ADS PubMed Detarsio E. , Andreo C. S. , Drincovich M. F. . 2004 . Basic residues play key roles in catalysis and NADP(+)-specificity in maize (Zea mays L.) photosynthetic NADP(+)-dependent malic enzyme . Biochem. J . 382 : 1025 – 1030 . Google Scholar CrossRef Search ADS PubMed Enerback S. , Gimble J. M. . 1993 . Lipoprotein lipase gene expression: physiological regulators at the transcriptional and post-transcriptional level . Biochim. Biophys. Acta 1169 : 107 – 125 . Google Scholar CrossRef Search ADS PubMed Fishman P. H. , Brady R. O. . 1976 . Biosynthesis and function of gangliosides . Science 194 : 906 – 915 . Google Scholar CrossRef Search ADS PubMed Gao S. Z. , Zhao S. M. . 2009 . Physiology, affecting factors and strategies for control of pig meat intramuscular fat . Recent Patents Food Nutr. Agric . 1 : 59 – 74 . Google Scholar CrossRef Search ADS He J. , Wang W. , Lu L. , Tian Y. , Niu D. , Ren J. , Dong L. , Sun S. , Zhao Y. , Chen L. , Shen J. , Li X. . 2016 . Analysis of miRNAs and their target genes associated with lipid metabolism in duck liver . Sci. Rep . 6 : 27418 . Google Scholar CrossRef Search ADS PubMed He J. , Tian Y. , Li J. , Shen J. , Tao Z. , Fu Y. , Niu D. , Lu L. . 2013 . Expression pattern of L-FABP gene in different tissues and its regulation of fat metabolism-related genes in duck . Mol. Biol. Rep . 40 : 189 – 195 . Google Scholar CrossRef Search ADS PubMed Hermier D. 1997 . Lipoprotein metabolism and fattening in poultry . J. Nutr . 127 : 805S – 808S . Google Scholar CrossRef Search ADS PubMed Heyer A. , Lebret B. . 2007 . Compensatory growth response in pigs: Effects on growth performance, composition of weight gain at carcass and muscle levels, and meat quality1 . J. Anim. Sci . 85 : 769 – 778 . Google Scholar CrossRef Search ADS PubMed Jeleníková J. , Pipek P. , Miyahara M. . 2008 . The effects of breed, sex, intramuscular fat and ultimate pH on pork tenderness . Eur. Food Res. Technol . 227 : 989 – 994 . Google Scholar CrossRef Search ADS Jo C. , Jayasena D. D. , Lim D.-G. , Lee K.-H. , Kim J.-J. , Cha J.-S. , Nam K.-C. . 2013 . Effect of intramuscular fat content on the meat quality and antioxidative dipeptides of Hanwoo beef . Korean J. Food Nutr . 26 : 117 – 124 . Google Scholar CrossRef Search ADS Lee S. H. , Choi Y. M. , Choe J. H. , Kim J. M. , Hong K. C. , Park H. C. , Kim B. C. . 2010 . Association between polymorphisms of the heart fatty acid binding protein gene and intramuscular fat content, fatty acid composition, and meat quality in Berkshire breed . Meat Sci . 86 : 794 – 800 . Google Scholar CrossRef Search ADS PubMed Li X. K. , Wang J. Z. , Wang C. Q. , Zhang C. H. , Li X. , Tang C. H. , Wei X. L. . 2016 . Effect of dietary phosphorus levels on meat quality and lipid metabolism in broiler chickens . Food Chem . 205 : 289 – 296 . Google Scholar CrossRef Search ADS PubMed Lyczynski A. , Pospiech E. , Rzosinska E. , Czyzak-Runowska G. , Grzes B. , Mikolajczak B. , Iwanska E. . 2006 . Quality of porcine meat in relation to pig genotype and intramuscular fat content . Anim. Sci. Pap. Rep . 24 : 195 – 204 . Pietruszka A. , Jacyno E. , Kawęcka M. , Biel W. . 2015 . The relation between intramuscular fat level in the longissimus muscle and the quality of pig carcasses and meat . Ann. Anim. Sci . 15 : 1031 – 1041 . Google Scholar CrossRef Search ADS Qiu X. P. , Yang S. . 1993 . Poultry science (the third version). Sichuan Sci . Technol. Press : 74 . Raj S. , Skiba G. , Weremko D. , Fandrejewski H. , Migdal W. , Borowiec F. , Polawska E. . 2010 . The relationship between the chemical composition of the carcass and the fatty acid composition of intramuscular fat and backfat of several pig breeds slaughtered at different weights . Meat Sci . 86 : 324 – 330 . Google Scholar CrossRef Search ADS PubMed Ramsamy T. A. , Neville T. A. M. , Chauhan B. M. , Aggarwal D. , Sparks D. L. . 2000 . Apolipoprotein A-I regulates lipid hydrolysis by hepatic lipase . J. Biol. Chem. 275 : 33480 – 33486 . Google Scholar CrossRef Search ADS PubMed Smith S. , Witkowski A. , Joshi A. K. . 2003 . Structural and functional organization of the animal fatty acid synthase . Prog. Lipid Res . 42 : 289 – 317 . Google Scholar CrossRef Search ADS PubMed van Laack R. L. , Stevens S. G. , Stalder K. J. . 2001 . The influence of ultimate pH and intramuscular fat content on pork tenderness and tenderization . J. Anim. Sci . 79 : 392 . Google Scholar CrossRef Search ADS PubMed Wakil S. J. 1989 . Fatty acid synthase, a proficient multifunctional enzyme . Biochemistry 28 : 4523 – 4530 . Google Scholar CrossRef Search ADS PubMed Winkler F. K. , D’Arcy A. , Hunziker W. . 1990 . Structure of human pancreatic lipase . Nature 343 : 771 – 774 . Google Scholar CrossRef Search ADS PubMed Yuan H. B. K. , Frandsen M. , Rosenvold K. . 2011 . Effect of ageing prior to freezing on colour stability of ovine longissimus muscle . Meat Sci . 88 : 332 – 337 . Google Scholar CrossRef Search ADS PubMed Zhang Y. , Li W. . 2014 . A novel SNP of LXRα gene associated with meat quality traits in Cherry Valley ducks . Pak. J. Zool . 46 : 1039 – 1044 . © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Poultry ScienceOxford University Press

Published: Mar 15, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off