Effects of adding methionine in low-protein diet and subsequently fed low-energy diet on productive performance, blood chemical profile, and lipid metabolism-related gene expression of broiler chickens

Effects of adding methionine in low-protein diet and subsequently fed low-energy diet on... ABSTRACT This study was conducted to evaluate the effects of supplementing methionine (Met) in a low-protein (Low-CP) diet during d 11 to 24 and subsequently feeding with a low-metabolizable energy diet (Low-ME; -75 kcal/kg) or a normal ME diet during d 25 to 42 on the productive performance, blood chemical profile, and lipid metabolism-related gene expression of broiler chickens. The 1,600 broiler chicks were divided into 5 groups as follows: 1) Normal CP, then Normal ME; 2) Low-CP, then Normal ME; 3) Low-CP, then Low-ME; 4) Low-CP+Met, then Normal ME; and 5) Low-CP+Met, then Low-ME. During d 11 to 24, the growth performance of the control group was better than those of the other groups (P < 0.01). In Low-CP diets, the addition of Met resulted in an improvement in the growth performance, breast meat yield, protein conversion ratio, plasma total protein, and albumin (P < 0.01). Moreover, the supplementation significantly increased the plasma triglyceride content (P < 0.01). Feeding Low-CP or Low-CP+Met diets increased the abdominal fat content compared to the control group (P < 0.01). Feeding the Low-CP+Met, then Normal ME (d 25 to 42) resulted in compensation in the feed conversion ratio (FCR), protein conversion ratio, and energy conversion ratio equal to or better than the control group (P < 0.01). The body weights of birds fed Low-CP diets were still inferior to the control group (P < 0.01), except in the Low-CP+Met group followed by the normal ME diet. Feeding with the Low-ME diet tended to decrease the expression of the carnitine palmitoyl transferase I gene in the liver (P = 0.08). In conclusion, supplementing Met in the Low-CP diet during the grower period and subsequently feeding with a control diet improved the feed and protein conversion ratios, reduced fat accumulation, and reduced the production cost of broiler chickens with regard to fat deposition compared to the control diet. INTRODUCTION Dietary energy and protein clearly affect the growth performance, production cost, and chemical body composition of broiler chickens (Collin et al., 2003; Kamran et al., 2004; Nawaz et al., 2006). Generally, feeding a low-crude protein (Low-CP) diet increases the fat content, while reducing the energy density decreases the fat content and increases protein deposition in the carcass (Lee and Leeson, 2001; Zhan et al., 2007). On the other hand, lowering the dietary protein concentration in a broiler diet commonly reduces the feed cost (Cauwenbreghe and Burnham, 2001; Kamran et al., 2008) and increases protein utilization (Yang et al., 2009). Adding synthetic amino acids prevents some negative effects of feeding Low-CP diets (Ospina-Rojas et al., 2014; Nukreaw and Bunchasak, 2015; Jariyahatthakij et al., 2016). However, a reduction of CP greater than 3% (meeting all essential amino acids requirement) still results in poor productive performance and carcass quality (Jiang et al., 2005; Dean et al., 2006; Namroud et al., 2008; Nukreaw et al., 2011) and high fat deposition (Yamazaki et al., 2006; Namroud et al., 2008; Abdel-Maksoud et al., 2010; Nukreaw et al., 2011) of broiler chickens. Chickens receiving a Low-CP diet require higher lysine and methionine (Met) compared to conventional diets (Labadan et al., 2001). Nukreaw et al. (2011) and more recently, Jariyahatthakij et al. (2016) suggested that reducing the dietary CP level by 3% with amino acids supplementation during the grower period, followed by a control or low-energy diet, could improve overall protein utilization and reduce fat accumulation via increasing lipolysis and/or disruption of triglyceride transportation in broiler chickens. Understanding the mechanism and factors involved in this improvement requires focusing on gene expression related to lipids and energy metabolism. It is generally known that acetyl CoA carboxylase (ACC), carnitine palmitoyl transferase (CPT-I), and avian adenine nucleotide translocator (avANT) are involved in the hepatic response to nutritional intervention (Hillgartner et al., 1996; Daval et al., 2000; Abe et al., 2006). The ACC gene could be a candidate gene or linked with a major gene that affects abdominal fat content (Richards et al., 2003; Tian et al., 2010), while fasting increases liver CPT-I gene expression in the chicken (Skiba-Cassy et al., 2007). Fasting also increases avANT gene expression due to the increase of ATP/ADP exchange via mitochondrial ATP export and ADP import (Toyomizu et al., 2002, 2006). Therefore, this study was conducted to determine the effect of supplemental Met in a Low-CP diet during the grower period (age 11 to 24 d) followed by a lower energy density diet during the finisher period (25 to 42 d) on the productive performance and gene expression in relation to the lipid and energy metabolism of broiler chickens. MATERIALS AND METHODS Animals And Management The experimental animals were kept, maintained, and treated in adherence with accepted standards for the humane treatment of animals according to the ethical committee of Kasetsart University. In total, 1,600 commercial male broiler chicks (Ross 308) were used from 11 to 42 d using a randomized complete block design (RCBD; 8 replicates and 8 blocks). At 10 d of age, the broiler chickens were randomized and divided into 5 experimental groups with 8 blocks per treatment (40 birds/pen). The chicks were kept in an evaporative cooling house system with a floor pen (0.12 m2/bird), and rice husks were used as bedding. Drinking water and feed were provided using a nipple drinker line (9 nipples per pen) and a tube feeder (70 birds/tube feeder), respectively. The broiler chickens were allowed access to water and feed ad libitum throughout the experimental period. Experimental diets were provided in pellet form (sieved crumbs for 0 to 10 d and 3.5 mm diameter pellets for 11 to 42 d). The temperature was around 32°C at hatching and then was decreased by 1°C every 3 d until a final temperature of 25°C was reached. The lighting regime consisted of 23 h of light and 1 h of darkness. Chicks were vaccinated at the hatchery for Newcastle disease and infectious bronchitis. Experimental Diets The chicks were divided into 5 groups according to the experimental diets, with each group consisting of 8 blocks with 40 chicks per block. The chicks were fed diets as follows: Normal CP, then Normal ME (Trt A); (21% CP and 3,175 ME kcal/kg for age 11 to 24 d, and 19% CP and 3,225 ME kcal/kg for age 25 to 42 d); all nutrient requirements were formulated according to the recommendations for the strain. Low-CP, then Normal ME (Trt B); the chicks were fed a Low-CP diet (18% CP and 3,175 ME kcal/kg) deficient in Met for age 11 to 24 d, followed by a normal ME (3,225 ME kcal/kg) diet for 25 to 42 d of age. Low-CP, then Low-ME (Trt C); the chicks were fed a Low-CP diet (18% CP and 3,175 ME kcal/kg) deficient in Met for age 11 to 24 d, then re-fed with a low energy (Low-ME; -75 ME kcal/kg) diet for 25 to 42 d of age. Low-CP+Met, then Normal ME (Trt D); the chicks were fed a Low-CP diet (18% CP and 3,175 ME kcal/kg) with sufficient in Met for age 11 to 24 d, then re-fed with a normal ME (3,225 ME kcal/kg) diet for 25 to 42 d of age. Low-CP+Met, then Low-ME (Trt E); the chicks were fed a Low-CP diet (18% CP and 3,175 ME kcal/kg) with sufficient in Met for age 11 to 24 d, then re-fed with a Low-ME (-75 ME kcal/kg) diet for 25 to 42 d of age. The feed and nutrient compositions of each experimental diet are shown in Table 1. All diets were analyzed for protein by Kjeldahl proceduce (N × 6.25) as described in AOAC official method 981.10 (Association of Official Analytical Chemists, 2016). The amino acid composition of the basal diet in both the grower and finisher periods was analyzed by ion-exchange chromatography using the Amino Acids Analyzer (AminoTac JEOL model JLC-500/v JEOL Ltd, Tokyo, Japan) with ninhydrin derivatization according to the instructions of the manufacturer (JEOL (Europe) Croissy sur Seine, France). Table 1. Composition and nutritional content of experimental diets. Grower period (age 11 to 24 d) Finisher period (age 25 to 42 d) Item Control (21% CP) Low-CP (18% CP) Low-CP+Met (18% CP) Normal ME Low-ME (-75 kcal/kg) Ingredient (%) Corn 55.40 63.48 63.48 60.46 62.15 Rice bran oil 4.00 3.09 3.09 3.22 1.79 Soybean meal 34.17 26.48 26.48 25.40 25.13 Full-fat soybean 2.00 2.00 2.00 7.00 7.00 Monodicalcium phosphate 21% 1.84 1.90 1.90 1.72 1.72 Limestone 1.26 1.29 1.29 1.21 1.21 Salt 0.33 0.22 0.22 0.22 0.22 L-Lysine 0.10 0.36 0.36 - 0.01 DL-MethionineB 0.29 - 0.37 0.19 0.18 L-Threonine - 0.12 0.12 - - Vitamin and trace mineral PremixA 0.50 0.50 0.50 0.50 0.50 AnticoccidialC 0.05 0.05 0.05 0.05 0.05 AntioxidantD 0.05 0.05 0.05 0.05 0.05 Corn starch - 0.47 0.10 - - Total 100 100 100 100 100 Nutrients by calculation (analysis)E Protein (%) 21.00 (22.36) 18.00 (17.58) 18.00 19.00 (19.20) 19.00 Energy (ME kcal/kg) 3175 3175 3175 3225 3150 Energy: protein ratio 151 176 176 170 166 Fat (%) 6.94 6.21 6.21 7.19 5.85 Calcium (%) 0.90 0.90 0.90 0.85 0.85 Non-phytate phosphorus (%) 0.45 0.45 0.45 0.42 0.42 Salt (%) 0.39 0.28 0.28 0.28 0.28 Lysine (%) 1.23(1.16) 1.23 (1.15) 1.23 1.02 (1.10) 1.02 Total sulfur amino acid (%) 0.95 (0.77) 0.59 (0.61) 0.95 0.80 (0.76) 0.80 Methionine (%) 0.61 (0.50) 0.29 (0.31) 0.65 0.48 (0.46) 0.48 Threonine (%) 0.81 (0.73) 0.80 (0.67) 0.80 0.73 (0.71) 0.73 Tryptophan (%) 0.26 (0.22) 0.22 (0.18) 0.28 0.23 (0.21) 0.23 Arginine (%) 1.45 (1.37) 1.22 (1.13) 1.21 1.29 (1.36) 1.29 Isoleucine (%) 0.94 (0.79) 0.79 (0.65) 0.79 0.84 (0.79) 0.84 Valine (%) 1.02 (1.06) 0.88 (0.87) 0.88 0.93 (1.05) 0.93 Feed cost/kg (THB)* 14.99 14.05 14.59 14.50 14.06 Grower period (age 11 to 24 d) Finisher period (age 25 to 42 d) Item Control (21% CP) Low-CP (18% CP) Low-CP+Met (18% CP) Normal ME Low-ME (-75 kcal/kg) Ingredient (%) Corn 55.40 63.48 63.48 60.46 62.15 Rice bran oil 4.00 3.09 3.09 3.22 1.79 Soybean meal 34.17 26.48 26.48 25.40 25.13 Full-fat soybean 2.00 2.00 2.00 7.00 7.00 Monodicalcium phosphate 21% 1.84 1.90 1.90 1.72 1.72 Limestone 1.26 1.29 1.29 1.21 1.21 Salt 0.33 0.22 0.22 0.22 0.22 L-Lysine 0.10 0.36 0.36 - 0.01 DL-MethionineB 0.29 - 0.37 0.19 0.18 L-Threonine - 0.12 0.12 - - Vitamin and trace mineral PremixA 0.50 0.50 0.50 0.50 0.50 AnticoccidialC 0.05 0.05 0.05 0.05 0.05 AntioxidantD 0.05 0.05 0.05 0.05 0.05 Corn starch - 0.47 0.10 - - Total 100 100 100 100 100 Nutrients by calculation (analysis)E Protein (%) 21.00 (22.36) 18.00 (17.58) 18.00 19.00 (19.20) 19.00 Energy (ME kcal/kg) 3175 3175 3175 3225 3150 Energy: protein ratio 151 176 176 170 166 Fat (%) 6.94 6.21 6.21 7.19 5.85 Calcium (%) 0.90 0.90 0.90 0.85 0.85 Non-phytate phosphorus (%) 0.45 0.45 0.45 0.42 0.42 Salt (%) 0.39 0.28 0.28 0.28 0.28 Lysine (%) 1.23(1.16) 1.23 (1.15) 1.23 1.02 (1.10) 1.02 Total sulfur amino acid (%) 0.95 (0.77) 0.59 (0.61) 0.95 0.80 (0.76) 0.80 Methionine (%) 0.61 (0.50) 0.29 (0.31) 0.65 0.48 (0.46) 0.48 Threonine (%) 0.81 (0.73) 0.80 (0.67) 0.80 0.73 (0.71) 0.73 Tryptophan (%) 0.26 (0.22) 0.22 (0.18) 0.28 0.23 (0.21) 0.23 Arginine (%) 1.45 (1.37) 1.22 (1.13) 1.21 1.29 (1.36) 1.29 Isoleucine (%) 0.94 (0.79) 0.79 (0.65) 0.79 0.84 (0.79) 0.84 Valine (%) 1.02 (1.06) 0.88 (0.87) 0.88 0.93 (1.05) 0.93 Feed cost/kg (THB)* 14.99 14.05 14.59 14.50 14.06 AVitamin and trace mineral premix content (per kg of feed): Vitamin A 12,000 IU, vitamin D 3,000 IU, vitamin E 15 IU, vitamin K 1.5 mg, thiamine 1.5 mg, riboflavin 5 mg, pyridoxine 2 mg, niacin 25 mg, vitamin B12 0.05 mg, pantothenic acid 8 mg, folic acid 3 mg, biotin 0.12 mg, manganese 80 mg, zinc 60 mg, iron 40 mg, copper 8 mg, iodine 0.50 mg, selenium 0.1 mg, cobalt 0.1 mg. BSupplied by Sumitomo Chemical, Tokyo, Japan. CSalinomycin sodium. DButylated hydroxy toluene and ethoxyquin. EValues in parentheses refer to analyzed values. *Cost based on ingredient prices as of May 2016 for Thailand, THB = Thai bath. View Large Table 1. Composition and nutritional content of experimental diets. Grower period (age 11 to 24 d) Finisher period (age 25 to 42 d) Item Control (21% CP) Low-CP (18% CP) Low-CP+Met (18% CP) Normal ME Low-ME (-75 kcal/kg) Ingredient (%) Corn 55.40 63.48 63.48 60.46 62.15 Rice bran oil 4.00 3.09 3.09 3.22 1.79 Soybean meal 34.17 26.48 26.48 25.40 25.13 Full-fat soybean 2.00 2.00 2.00 7.00 7.00 Monodicalcium phosphate 21% 1.84 1.90 1.90 1.72 1.72 Limestone 1.26 1.29 1.29 1.21 1.21 Salt 0.33 0.22 0.22 0.22 0.22 L-Lysine 0.10 0.36 0.36 - 0.01 DL-MethionineB 0.29 - 0.37 0.19 0.18 L-Threonine - 0.12 0.12 - - Vitamin and trace mineral PremixA 0.50 0.50 0.50 0.50 0.50 AnticoccidialC 0.05 0.05 0.05 0.05 0.05 AntioxidantD 0.05 0.05 0.05 0.05 0.05 Corn starch - 0.47 0.10 - - Total 100 100 100 100 100 Nutrients by calculation (analysis)E Protein (%) 21.00 (22.36) 18.00 (17.58) 18.00 19.00 (19.20) 19.00 Energy (ME kcal/kg) 3175 3175 3175 3225 3150 Energy: protein ratio 151 176 176 170 166 Fat (%) 6.94 6.21 6.21 7.19 5.85 Calcium (%) 0.90 0.90 0.90 0.85 0.85 Non-phytate phosphorus (%) 0.45 0.45 0.45 0.42 0.42 Salt (%) 0.39 0.28 0.28 0.28 0.28 Lysine (%) 1.23(1.16) 1.23 (1.15) 1.23 1.02 (1.10) 1.02 Total sulfur amino acid (%) 0.95 (0.77) 0.59 (0.61) 0.95 0.80 (0.76) 0.80 Methionine (%) 0.61 (0.50) 0.29 (0.31) 0.65 0.48 (0.46) 0.48 Threonine (%) 0.81 (0.73) 0.80 (0.67) 0.80 0.73 (0.71) 0.73 Tryptophan (%) 0.26 (0.22) 0.22 (0.18) 0.28 0.23 (0.21) 0.23 Arginine (%) 1.45 (1.37) 1.22 (1.13) 1.21 1.29 (1.36) 1.29 Isoleucine (%) 0.94 (0.79) 0.79 (0.65) 0.79 0.84 (0.79) 0.84 Valine (%) 1.02 (1.06) 0.88 (0.87) 0.88 0.93 (1.05) 0.93 Feed cost/kg (THB)* 14.99 14.05 14.59 14.50 14.06 Grower period (age 11 to 24 d) Finisher period (age 25 to 42 d) Item Control (21% CP) Low-CP (18% CP) Low-CP+Met (18% CP) Normal ME Low-ME (-75 kcal/kg) Ingredient (%) Corn 55.40 63.48 63.48 60.46 62.15 Rice bran oil 4.00 3.09 3.09 3.22 1.79 Soybean meal 34.17 26.48 26.48 25.40 25.13 Full-fat soybean 2.00 2.00 2.00 7.00 7.00 Monodicalcium phosphate 21% 1.84 1.90 1.90 1.72 1.72 Limestone 1.26 1.29 1.29 1.21 1.21 Salt 0.33 0.22 0.22 0.22 0.22 L-Lysine 0.10 0.36 0.36 - 0.01 DL-MethionineB 0.29 - 0.37 0.19 0.18 L-Threonine - 0.12 0.12 - - Vitamin and trace mineral PremixA 0.50 0.50 0.50 0.50 0.50 AnticoccidialC 0.05 0.05 0.05 0.05 0.05 AntioxidantD 0.05 0.05 0.05 0.05 0.05 Corn starch - 0.47 0.10 - - Total 100 100 100 100 100 Nutrients by calculation (analysis)E Protein (%) 21.00 (22.36) 18.00 (17.58) 18.00 19.00 (19.20) 19.00 Energy (ME kcal/kg) 3175 3175 3175 3225 3150 Energy: protein ratio 151 176 176 170 166 Fat (%) 6.94 6.21 6.21 7.19 5.85 Calcium (%) 0.90 0.90 0.90 0.85 0.85 Non-phytate phosphorus (%) 0.45 0.45 0.45 0.42 0.42 Salt (%) 0.39 0.28 0.28 0.28 0.28 Lysine (%) 1.23(1.16) 1.23 (1.15) 1.23 1.02 (1.10) 1.02 Total sulfur amino acid (%) 0.95 (0.77) 0.59 (0.61) 0.95 0.80 (0.76) 0.80 Methionine (%) 0.61 (0.50) 0.29 (0.31) 0.65 0.48 (0.46) 0.48 Threonine (%) 0.81 (0.73) 0.80 (0.67) 0.80 0.73 (0.71) 0.73 Tryptophan (%) 0.26 (0.22) 0.22 (0.18) 0.28 0.23 (0.21) 0.23 Arginine (%) 1.45 (1.37) 1.22 (1.13) 1.21 1.29 (1.36) 1.29 Isoleucine (%) 0.94 (0.79) 0.79 (0.65) 0.79 0.84 (0.79) 0.84 Valine (%) 1.02 (1.06) 0.88 (0.87) 0.88 0.93 (1.05) 0.93 Feed cost/kg (THB)* 14.99 14.05 14.59 14.50 14.06 AVitamin and trace mineral premix content (per kg of feed): Vitamin A 12,000 IU, vitamin D 3,000 IU, vitamin E 15 IU, vitamin K 1.5 mg, thiamine 1.5 mg, riboflavin 5 mg, pyridoxine 2 mg, niacin 25 mg, vitamin B12 0.05 mg, pantothenic acid 8 mg, folic acid 3 mg, biotin 0.12 mg, manganese 80 mg, zinc 60 mg, iron 40 mg, copper 8 mg, iodine 0.50 mg, selenium 0.1 mg, cobalt 0.1 mg. BSupplied by Sumitomo Chemical, Tokyo, Japan. CSalinomycin sodium. DButylated hydroxy toluene and ethoxyquin. EValues in parentheses refer to analyzed values. *Cost based on ingredient prices as of May 2016 for Thailand, THB = Thai bath. View Large For the Low-CP and Low-CP+Met diets, synthetic L-Lysine-HCl and L-Threonine were supplemented to meet the requirements of the strain recommendations (Aviagen, 2007). In order to induce an amino acid imbalance [decreased ratio of total sulfur amino acid (TSAA)/lysine], Met and TSAA deficiencies were formulated in the Low-CP diet (Supplemental Table). Growth Performance And Carcass Quality The feed intake, feed conversion ratio (FCR), average daily gain (ADG), protein, and energy intake during each period (11 to 24 and 25 to 42 d of age) and for the overall period (age 11 to 42 d) were determined. The body weight, feed intake, protein intake, and energy intake were determined at the end of each period and used to calculate the FCR, protein conversion ratio, energy conversion ratio, and feed cost per body weight gain (FCG). Mortality was checked twice daily, all chickens that died were weighed, and the weight was used to adjust feed conversion [FCR: g of feed consumed/(weight of live birds + weight of dead birds)]. The protein conversion ratio was calculated from the amount of protein consumed divided by the weight gain (protein intake/weight gain), and the energy conversion ratio was calculated using the amount of energy consumed divided by the weight gain (energy intake/weight gain). FCG was calculated as feed consumption per feeding period per chicken (g), divided by body weight gain (g), multiplied by feed cost (Thai baht). At 24 and 42 d of age, before the sampling processes, the experimental diets were removed for 12 hours. Four chickens from each replication (32 chickens/group) that had a body weight close to the group mean were chosen and killed using CO2 asphyxiation in an atmosphere of less than 2% oxygen (air displaced by CO2) for 1.5 to 2.0 minutes. The carcass yield was obtained by weighing the birds after they had been fasted for 12 h, bled, scalded, plucked, and manually eviscerated. The eviscerated carcass, breast meat yields (pectoralis major and minor muscles), drumsticks, thighs, and abdominal fat, including fat surrounding the gizzard, were determined from the live weights of the broilers selected for processing (Cabel et al., 1987). Blood Chemical Profile At 24 and 42 d of age, 16 chickens per group (2 chickens/replicate) were weighed and punctured at the wing vein to obtain a blood sample for chemical analysis. After collection, an aliquot of the blood sample was transferred into plastic vials containing EDTA as an anticoagulant, and the plasma was separated from the blood by centrifugation at 3,000 × g for 10 min at room temperature. The samples were stored at –20°C until further analysis. Frozen plasma samples of all chickens were thawed at room temperature (25°C) for determination of levels of total cholesterol (TC), total protein, triglyceride (TG), uric acid, albumin and non-esterified fatty acid (NEFA). Total cholesterol, total protein, TG, uric acid, and the albumin concentration were analyzed using the enzymatic colorimetric method (assay kit, HUMAN Gesellschaft für Biochemica und Diagnostic Co., Ltd, Max-planck-Ring21, D65205, Wiesbaden, Germany). The NEFA concentration was determined using the enzymatic colorimetric method (test kits from Randox Laboratories Ltd, London, United Kingdom). Gene Expression At 42 d of age, 4 chickens per treatment that had a body weight close to the group mean were chosen and put down using CO2 asphyxiation in an atmosphere of less than 2% oxygen (air displaced by CO2) for 1.5 to 2.0 min. Subsequently, the liver of each chicken was rapidly dissected and immediately placed in an appropriate volume of RNAlater stabilization reagent (Qiagen, Clifton Hill, Victoria, Australia) and stored at –80°C until RNA isolation. Quantitative Rt-Pcr Gene expression of CPT-I, ACC, and avANT was assessed using 2-step quantitative real-time reverse transcription-PCR (RT-PCR). The total RNA was extracted from the liver using TRIzol reagent (Qiagen, Hilden, Germany) following the manufacturer's instructions. Two micrograms of total RNA was reverse-transcribed to cDNA using an Omniscript Reverse Transcription Kit (Qiagen, Germany) following the manufacturer's instructions. All the RT-PCR reactions were carried out in 48-well plates at a final volume of 20 μL of SYBR green real-time PCR Master Mix Plus (Solis BioDyne, Tartu, Estonia) using a RT-PCR detection system (Eco system, PCRmax, Staffordshire, United Kingdom). The oligonucleotide sequences of sense and antisense primers are shown in Table 2. All measurements were carried out in triplicate, and average values were obtained. Temperature cycles are as follows: denaturation at 95°C for 15 min, 40 cycles of amplification at 95°C for 15 s, 68°C for 20 s, 72°C for 15 s, and melting curve analysis at 95°C for 1 second. A standard curve was quantified from the standard calibration curves run simultaneously with the samples. All quantifications used β-actin mRNA as the internal control, and a negative control (no sample) also was used for each primer set. The values were normalized with mRNA expression of β-actin and expressed as the ratio of β-actin mRNA values in arbitrary units. Table 2. Primer design for genes analyzed using real-time PCR. Gene1 Accession Number2 Primer sequence (5’-3’) Orientation Product size (bp) ACC J03541 CACTTCGAGGCGAAAAACTC Forward 447 GGAGCAAATCCATGACCACT Reverse avANT AB088686 TGTGGCTGGTGTGGTTTCCTA Forward 67 GCGTCCTGACTGCATCATCA Reverse CPT-I AY675193 CAATGCGGTACTCCCTGAAA Forward 337 CATTATTGGTCCACGCCCTC Reverse β-Actin L08165 TGCGTGACATCAAGGAGAAG Forward 300 TGCCAGGGTACATTGTGGTA Reverse Gene1 Accession Number2 Primer sequence (5’-3’) Orientation Product size (bp) ACC J03541 CACTTCGAGGCGAAAAACTC Forward 447 GGAGCAAATCCATGACCACT Reverse avANT AB088686 TGTGGCTGGTGTGGTTTCCTA Forward 67 GCGTCCTGACTGCATCATCA Reverse CPT-I AY675193 CAATGCGGTACTCCCTGAAA Forward 337 CATTATTGGTCCACGCCCTC Reverse β-Actin L08165 TGCGTGACATCAAGGAGAAG Forward 300 TGCCAGGGTACATTGTGGTA Reverse 1ACC = acetyl-CoA carboxylase; avANT = avian adenine nucleotide translocator; CPT-I = carnitine palmitoyl CoA transferase I. 2GenBank accession number. View Large Table 2. Primer design for genes analyzed using real-time PCR. Gene1 Accession Number2 Primer sequence (5’-3’) Orientation Product size (bp) ACC J03541 CACTTCGAGGCGAAAAACTC Forward 447 GGAGCAAATCCATGACCACT Reverse avANT AB088686 TGTGGCTGGTGTGGTTTCCTA Forward 67 GCGTCCTGACTGCATCATCA Reverse CPT-I AY675193 CAATGCGGTACTCCCTGAAA Forward 337 CATTATTGGTCCACGCCCTC Reverse β-Actin L08165 TGCGTGACATCAAGGAGAAG Forward 300 TGCCAGGGTACATTGTGGTA Reverse Gene1 Accession Number2 Primer sequence (5’-3’) Orientation Product size (bp) ACC J03541 CACTTCGAGGCGAAAAACTC Forward 447 GGAGCAAATCCATGACCACT Reverse avANT AB088686 TGTGGCTGGTGTGGTTTCCTA Forward 67 GCGTCCTGACTGCATCATCA Reverse CPT-I AY675193 CAATGCGGTACTCCCTGAAA Forward 337 CATTATTGGTCCACGCCCTC Reverse β-Actin L08165 TGCGTGACATCAAGGAGAAG Forward 300 TGCCAGGGTACATTGTGGTA Reverse 1ACC = acetyl-CoA carboxylase; avANT = avian adenine nucleotide translocator; CPT-I = carnitine palmitoyl CoA transferase I. 2GenBank accession number. View Large Statistical Analysis All data were statistically analyzed using analysis of variance (ANOVA) in SAS version 9. Significant differences among the treatment group means were evaluated using Duncan's multiple range test (Duncan, 1955). Only differences with P-values ≤ 0.05 were considered significant. To determine the effect of CP, ME, and Met during the grower and finisher periods, appropriated treatment means were grouped and compared using orthogonal contrast analysis. RESULTS AND DISCUSSION Growth Performance The effects of adding Met in a Low-CP diet during the grower period (11 to 24 d of age) on the productive performance of broiler chickens are presented in Table 3. Among the experimental groups, the Trt A showed the best productive performance (P < 0.01). The body weight, ADG, FCR, energy conversion ratio, and FCG of chickens fed the Trt B and C were the poorest (P < 0.01), whereas Trt D and E improved the growth rate and FCR. Feeding the Trt D and E diet has better protein conversion ratio than the Trt A and the Trt B and C groups (P < 0.01). There was no significant effect of experimental diet on the feed and energy intake, but lowering the CP level in the diet decreased the protein intake of the birds (P < 0.01). Considering the economics, the FCG values of birds fed the Trt B and C were more costly than those of the Trt A and the Trt D and E groups (P < 0.01). Table 3. Growth performance of broiler chickens fed a low-CP diet with or without sufficient Met from 11 to 24 d of age. Control Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, then Normal then Low then Normal then Low-ME Item (Trt A) ME (Trt B) -ME (Trt C) ME (Trt D) (Trt E) s.e.m.1 P-value Initial weight (g/chick) 233.140 235.466 233.596 233.338 236.355 1.174 0.87 Body weight (g/chick) 1132.930 A 981.633C 982.519C 1082.850B 1082.340B 11.162 <0.01 ADG2 64.271A 53.298C 53.496C 60.678B 60.428B 0.795 <0.01 Feed intake (g/chick) 1188.940 1202.490 1235.580 1203.590 1178.630 10.276 0.52 Met intake (g/chick) 7.251B 3.440C 3.535C 7.835A 7.674A 0.327 <0.01 TSAA intake (g/chick) 11.294A 7.046B 7.241B 11.435A 11.198A 0.336 <0.01 FCR3 1.321C 1.614A 1.653A 1.416B 1.395B,C 0.024 <0.01 Protein intake (g/chick) 249.678A 216.449B 222.406B 216.645B 212.155B 2.821 <0.01 Energy intake (kcal/chick) 3774.870 3817.910 3922.970 3821.400 3742.160 32.625 0.52 Protein conversion ratio4 0.279B 0.291A,B 0.298A 0.255C 0.251C 0.004 <0.01 Energy conversion ratio5 4.199C 5.128A 5.245A 4.498B 4.425B,C 0.077 <0.01 FCG (baht/kg)6 19.825B 22.691A 23.205A 20.673B 20.335B 0.281 <0.01 Total feed cost (baht/chicken) 17.823 16.895 17.359 17.559 17.195 0.150 0.39 Probability levels of contrast Body Feed Met TSAA Protein Energy Protein Energy Total weight ADG intake intake Intake FCR intake intake conversion conversion FCG feed Contrast statement ratio ratio cost Control vs. Low-CP <0.01 <0.01 0.31 <0.01 <0.01 <0.01 <0.01 0.31 0.01 <0.01 <0.01 0.11 Control vs. Low-CP+Met <0.01 <0.01 0.94 <0.01 0.92 0.02 <0.01 0.94 <0.01 0.02 0.18 0.29 Low-CP vs. Low-CP+Met <0.01 <0.01 0.25 <0.01 <0.01 <0.01 0.26 0.25 <0.01 <0.01 <0.01 0.47 Control Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, then Normal then Low then Normal then Low-ME Item (Trt A) ME (Trt B) -ME (Trt C) ME (Trt D) (Trt E) s.e.m.1 P-value Initial weight (g/chick) 233.140 235.466 233.596 233.338 236.355 1.174 0.87 Body weight (g/chick) 1132.930 A 981.633C 982.519C 1082.850B 1082.340B 11.162 <0.01 ADG2 64.271A 53.298C 53.496C 60.678B 60.428B 0.795 <0.01 Feed intake (g/chick) 1188.940 1202.490 1235.580 1203.590 1178.630 10.276 0.52 Met intake (g/chick) 7.251B 3.440C 3.535C 7.835A 7.674A 0.327 <0.01 TSAA intake (g/chick) 11.294A 7.046B 7.241B 11.435A 11.198A 0.336 <0.01 FCR3 1.321C 1.614A 1.653A 1.416B 1.395B,C 0.024 <0.01 Protein intake (g/chick) 249.678A 216.449B 222.406B 216.645B 212.155B 2.821 <0.01 Energy intake (kcal/chick) 3774.870 3817.910 3922.970 3821.400 3742.160 32.625 0.52 Protein conversion ratio4 0.279B 0.291A,B 0.298A 0.255C 0.251C 0.004 <0.01 Energy conversion ratio5 4.199C 5.128A 5.245A 4.498B 4.425B,C 0.077 <0.01 FCG (baht/kg)6 19.825B 22.691A 23.205A 20.673B 20.335B 0.281 <0.01 Total feed cost (baht/chicken) 17.823 16.895 17.359 17.559 17.195 0.150 0.39 Probability levels of contrast Body Feed Met TSAA Protein Energy Protein Energy Total weight ADG intake intake Intake FCR intake intake conversion conversion FCG feed Contrast statement ratio ratio cost Control vs. Low-CP <0.01 <0.01 0.31 <0.01 <0.01 <0.01 <0.01 0.31 0.01 <0.01 <0.01 0.11 Control vs. Low-CP+Met <0.01 <0.01 0.94 <0.01 0.92 0.02 <0.01 0.94 <0.01 0.02 0.18 0.29 Low-CP vs. Low-CP+Met <0.01 <0.01 0.25 <0.01 <0.01 <0.01 0.26 0.25 <0.01 <0.01 <0.01 0.47 A,B,CValues within the same row with different superscripts are significantly different (P < 0.01). 1Standard error of the mean. 2Average daily gain. 3Feed conversion ratio (feed intake/gain). 4Protein intake/gain. 5Energy intake/gain. 6Feed cost per gain. View Large Table 3. Growth performance of broiler chickens fed a low-CP diet with or without sufficient Met from 11 to 24 d of age. Control Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, then Normal then Low then Normal then Low-ME Item (Trt A) ME (Trt B) -ME (Trt C) ME (Trt D) (Trt E) s.e.m.1 P-value Initial weight (g/chick) 233.140 235.466 233.596 233.338 236.355 1.174 0.87 Body weight (g/chick) 1132.930 A 981.633C 982.519C 1082.850B 1082.340B 11.162 <0.01 ADG2 64.271A 53.298C 53.496C 60.678B 60.428B 0.795 <0.01 Feed intake (g/chick) 1188.940 1202.490 1235.580 1203.590 1178.630 10.276 0.52 Met intake (g/chick) 7.251B 3.440C 3.535C 7.835A 7.674A 0.327 <0.01 TSAA intake (g/chick) 11.294A 7.046B 7.241B 11.435A 11.198A 0.336 <0.01 FCR3 1.321C 1.614A 1.653A 1.416B 1.395B,C 0.024 <0.01 Protein intake (g/chick) 249.678A 216.449B 222.406B 216.645B 212.155B 2.821 <0.01 Energy intake (kcal/chick) 3774.870 3817.910 3922.970 3821.400 3742.160 32.625 0.52 Protein conversion ratio4 0.279B 0.291A,B 0.298A 0.255C 0.251C 0.004 <0.01 Energy conversion ratio5 4.199C 5.128A 5.245A 4.498B 4.425B,C 0.077 <0.01 FCG (baht/kg)6 19.825B 22.691A 23.205A 20.673B 20.335B 0.281 <0.01 Total feed cost (baht/chicken) 17.823 16.895 17.359 17.559 17.195 0.150 0.39 Probability levels of contrast Body Feed Met TSAA Protein Energy Protein Energy Total weight ADG intake intake Intake FCR intake intake conversion conversion FCG feed Contrast statement ratio ratio cost Control vs. Low-CP <0.01 <0.01 0.31 <0.01 <0.01 <0.01 <0.01 0.31 0.01 <0.01 <0.01 0.11 Control vs. Low-CP+Met <0.01 <0.01 0.94 <0.01 0.92 0.02 <0.01 0.94 <0.01 0.02 0.18 0.29 Low-CP vs. Low-CP+Met <0.01 <0.01 0.25 <0.01 <0.01 <0.01 0.26 0.25 <0.01 <0.01 <0.01 0.47 Control Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, then Normal then Low then Normal then Low-ME Item (Trt A) ME (Trt B) -ME (Trt C) ME (Trt D) (Trt E) s.e.m.1 P-value Initial weight (g/chick) 233.140 235.466 233.596 233.338 236.355 1.174 0.87 Body weight (g/chick) 1132.930 A 981.633C 982.519C 1082.850B 1082.340B 11.162 <0.01 ADG2 64.271A 53.298C 53.496C 60.678B 60.428B 0.795 <0.01 Feed intake (g/chick) 1188.940 1202.490 1235.580 1203.590 1178.630 10.276 0.52 Met intake (g/chick) 7.251B 3.440C 3.535C 7.835A 7.674A 0.327 <0.01 TSAA intake (g/chick) 11.294A 7.046B 7.241B 11.435A 11.198A 0.336 <0.01 FCR3 1.321C 1.614A 1.653A 1.416B 1.395B,C 0.024 <0.01 Protein intake (g/chick) 249.678A 216.449B 222.406B 216.645B 212.155B 2.821 <0.01 Energy intake (kcal/chick) 3774.870 3817.910 3922.970 3821.400 3742.160 32.625 0.52 Protein conversion ratio4 0.279B 0.291A,B 0.298A 0.255C 0.251C 0.004 <0.01 Energy conversion ratio5 4.199C 5.128A 5.245A 4.498B 4.425B,C 0.077 <0.01 FCG (baht/kg)6 19.825B 22.691A 23.205A 20.673B 20.335B 0.281 <0.01 Total feed cost (baht/chicken) 17.823 16.895 17.359 17.559 17.195 0.150 0.39 Probability levels of contrast Body Feed Met TSAA Protein Energy Protein Energy Total weight ADG intake intake Intake FCR intake intake conversion conversion FCG feed Contrast statement ratio ratio cost Control vs. Low-CP <0.01 <0.01 0.31 <0.01 <0.01 <0.01 <0.01 0.31 0.01 <0.01 <0.01 0.11 Control vs. Low-CP+Met <0.01 <0.01 0.94 <0.01 0.92 0.02 <0.01 0.94 <0.01 0.02 0.18 0.29 Low-CP vs. Low-CP+Met <0.01 <0.01 0.25 <0.01 <0.01 <0.01 0.26 0.25 <0.01 <0.01 <0.01 0.47 A,B,CValues within the same row with different superscripts are significantly different (P < 0.01). 1Standard error of the mean. 2Average daily gain. 3Feed conversion ratio (feed intake/gain). 4Protein intake/gain. 5Energy intake/gain. 6Feed cost per gain. View Large Normally, a low TSAA intake depresses the feed intake and productive performance of broiler chickens (Khajali et al., 2002; Bunchasak, 2009), while the feed intake in the present study was not significantly affected by the Met deficiency. This indicated that a Met deficiency also can retard production performance without any effect on the feed intake. Adding Met to the Low-CP diets improved the body weight gain, protein efficiency ratio, and FCR of broiler chickens. Moreover, feeding a Low-CP+Met diet clearly promoted better protein efficiency ratio than the positive control diet, although the growth rate and FCR were still poorer. Accordingly, poor weight gain and FCR in broilers subjected to Low-CP diets or a Low-CP+Met diet have been reported (Nukreaw et al., 2011; Rakangtong and Bunchasak, 2011; Nukreaw and Bunchasak, 2015). Dean et al. (2006), Yamazaki et al. (2006), Kamran et al. (2008), and Namroud et al. (2008) also demonstrated that the addition of crystalline amino acids (lysine, methionine, threonine, or tryptophan) allows dietary levels to be reduced by 3%, whereas a greater decrease might have negative effects on growth performance because supplemental amino acids in a Low-CP diet might cause a sudden influx of amino acids that increase the catabolism of amino acids from muscles or those absorbed from diet to maintain homeostasis of plasma amino acids profile (Aftab et al., 2006; Abdel-Maksoud et al., 2010). Therefore, it can be said that reducing CP by less than 3% and supplementing with synthetic amino acids to meet the amino acids requirement significantly improved growth performance, but is still inferior to the conventional diet. The 25 to 42 d growth performance results are presented in Table 4. There was no significant difference in the ADG among the experimental groups during the finisher period (25 to 42 d of age). However, poor final body weight was observed in the Trt B, C, and E groups (P < 0.01), except for feeding with Trt D group, where the final body weight was equal to the Trt A. After the finisher phase, Trt D and E increased the body weight more than that of the Trt B and C (P < 0.05). The Trt A showed higher feed and nutrient (protein, Met, and energy) intakes than those of the other groups (P < 0.01). However, during this period, Trt C produced better energy conversion ratio, protein conversion ratio, FCR, and FCG values than those of the Trt A (P < 0.01). In particular, feeding with Trt D produced a better FCR than those of the Trt B (P < 0.01). Feeding with the Trt C and E diet resulted in a poorer FCR, while the energy intake, feed cost, and FCG were lower compared to the Trt B and D (P < 0.05). Table 4 Growth performance of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low-energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value Final body weight (g/chick) 3034.650A 2873.460C 2870.970C 2992.840A,B 2970.190B 18.683 <0.01 ADG2 105.650 105.101 104.913 106.109 104.880 0.660 0.79 Feed intake (g/chick) 3410.830A 3234.300B 3300.640B 3300.080B 3294.730B 18.590 <0.01 Met intake (g/chick) 16.474A 15.623B 15.908B 15.940B 15.880B 0.090 <0.01 TSAA intake (g/chick) 27.285A 25.875B 26.405B 26.400B 26.359B 0.149 <0.01 FCR3 1.795A 1.713C 1.746B 1.728B,C 1.745B 0.006 <0.01 Protein intake (g/chick) 648.058A 614.518B 627.124B 627.016B 625.999B 3.532 <0.01 Energy intake (kcal/chick) 10,999.920A 10,430.620B,C 10,397.020C 10,642.770B 10,378.390C 63.874 <0.01 Protein conversion ratio4 0.341A 0.325C 0.332B 0.329B,C 0.332B 0.001 <0.01 Energy conversion ratio5 5.786A 5.518B 5.508B 5.574B 5.498B 0.022 <0.01 FCG (baht/kg)6 26.021A 24.808B,C 24.580C 25.059B 24.545C 0.106 <0.01 Total feed cost (baht/chicken) 49.458A 46.899C 46.406C 47.850B 46.325C 0.298 <0.01 Probability levels of contrast Body ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total weight intake intake Intake Intake Intake conversion conversion feed Contrast statement ratio ratio cost Control vs Low-CP <0.01 0.53 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Control vs. Low-CP, or +Met <0.01 0.67 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.56 0.18 0.18 0.18 0.45 0.18 0.18 0.45 0.43 0.41 0.18 Control, Normal ME vs. Low-ME 0.01 0.34 0.39 0.23 0.40 0.94 0.39 <0.01 0.77 <0.01 <0.01 <0.01 Control vs. Low-ME <0.01 0.46 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Normal ME vs. Low-ME 0.51 0.40 0.18 0.30 0.18 <0.01 0.18 0.04 <0.01 0.15 <0.01 <0.01 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value Final body weight (g/chick) 3034.650A 2873.460C 2870.970C 2992.840A,B 2970.190B 18.683 <0.01 ADG2 105.650 105.101 104.913 106.109 104.880 0.660 0.79 Feed intake (g/chick) 3410.830A 3234.300B 3300.640B 3300.080B 3294.730B 18.590 <0.01 Met intake (g/chick) 16.474A 15.623B 15.908B 15.940B 15.880B 0.090 <0.01 TSAA intake (g/chick) 27.285A 25.875B 26.405B 26.400B 26.359B 0.149 <0.01 FCR3 1.795A 1.713C 1.746B 1.728B,C 1.745B 0.006 <0.01 Protein intake (g/chick) 648.058A 614.518B 627.124B 627.016B 625.999B 3.532 <0.01 Energy intake (kcal/chick) 10,999.920A 10,430.620B,C 10,397.020C 10,642.770B 10,378.390C 63.874 <0.01 Protein conversion ratio4 0.341A 0.325C 0.332B 0.329B,C 0.332B 0.001 <0.01 Energy conversion ratio5 5.786A 5.518B 5.508B 5.574B 5.498B 0.022 <0.01 FCG (baht/kg)6 26.021A 24.808B,C 24.580C 25.059B 24.545C 0.106 <0.01 Total feed cost (baht/chicken) 49.458A 46.899C 46.406C 47.850B 46.325C 0.298 <0.01 Probability levels of contrast Body ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total weight intake intake Intake Intake Intake conversion conversion feed Contrast statement ratio ratio cost Control vs Low-CP <0.01 0.53 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Control vs. Low-CP, or +Met <0.01 0.67 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.56 0.18 0.18 0.18 0.45 0.18 0.18 0.45 0.43 0.41 0.18 Control, Normal ME vs. Low-ME 0.01 0.34 0.39 0.23 0.40 0.94 0.39 <0.01 0.77 <0.01 <0.01 <0.01 Control vs. Low-ME <0.01 0.46 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Normal ME vs. Low-ME 0.51 0.40 0.18 0.30 0.18 <0.01 0.18 0.04 <0.01 0.15 <0.01 <0.01 A,B,CValues within the same row with different superscripts are significantly different (P<0.01) 1Standard error of the mean. 2Average daily gain. 3Feed conversion ratio (feed intake/gain). 4Protein intake/gain. 5Energy intake/gain. 6Feed cost per gain. View Large Table 4 Growth performance of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low-energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value Final body weight (g/chick) 3034.650A 2873.460C 2870.970C 2992.840A,B 2970.190B 18.683 <0.01 ADG2 105.650 105.101 104.913 106.109 104.880 0.660 0.79 Feed intake (g/chick) 3410.830A 3234.300B 3300.640B 3300.080B 3294.730B 18.590 <0.01 Met intake (g/chick) 16.474A 15.623B 15.908B 15.940B 15.880B 0.090 <0.01 TSAA intake (g/chick) 27.285A 25.875B 26.405B 26.400B 26.359B 0.149 <0.01 FCR3 1.795A 1.713C 1.746B 1.728B,C 1.745B 0.006 <0.01 Protein intake (g/chick) 648.058A 614.518B 627.124B 627.016B 625.999B 3.532 <0.01 Energy intake (kcal/chick) 10,999.920A 10,430.620B,C 10,397.020C 10,642.770B 10,378.390C 63.874 <0.01 Protein conversion ratio4 0.341A 0.325C 0.332B 0.329B,C 0.332B 0.001 <0.01 Energy conversion ratio5 5.786A 5.518B 5.508B 5.574B 5.498B 0.022 <0.01 FCG (baht/kg)6 26.021A 24.808B,C 24.580C 25.059B 24.545C 0.106 <0.01 Total feed cost (baht/chicken) 49.458A 46.899C 46.406C 47.850B 46.325C 0.298 <0.01 Probability levels of contrast Body ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total weight intake intake Intake Intake Intake conversion conversion feed Contrast statement ratio ratio cost Control vs Low-CP <0.01 0.53 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Control vs. Low-CP, or +Met <0.01 0.67 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.56 0.18 0.18 0.18 0.45 0.18 0.18 0.45 0.43 0.41 0.18 Control, Normal ME vs. Low-ME 0.01 0.34 0.39 0.23 0.40 0.94 0.39 <0.01 0.77 <0.01 <0.01 <0.01 Control vs. Low-ME <0.01 0.46 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Normal ME vs. Low-ME 0.51 0.40 0.18 0.30 0.18 <0.01 0.18 0.04 <0.01 0.15 <0.01 <0.01 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value Final body weight (g/chick) 3034.650A 2873.460C 2870.970C 2992.840A,B 2970.190B 18.683 <0.01 ADG2 105.650 105.101 104.913 106.109 104.880 0.660 0.79 Feed intake (g/chick) 3410.830A 3234.300B 3300.640B 3300.080B 3294.730B 18.590 <0.01 Met intake (g/chick) 16.474A 15.623B 15.908B 15.940B 15.880B 0.090 <0.01 TSAA intake (g/chick) 27.285A 25.875B 26.405B 26.400B 26.359B 0.149 <0.01 FCR3 1.795A 1.713C 1.746B 1.728B,C 1.745B 0.006 <0.01 Protein intake (g/chick) 648.058A 614.518B 627.124B 627.016B 625.999B 3.532 <0.01 Energy intake (kcal/chick) 10,999.920A 10,430.620B,C 10,397.020C 10,642.770B 10,378.390C 63.874 <0.01 Protein conversion ratio4 0.341A 0.325C 0.332B 0.329B,C 0.332B 0.001 <0.01 Energy conversion ratio5 5.786A 5.518B 5.508B 5.574B 5.498B 0.022 <0.01 FCG (baht/kg)6 26.021A 24.808B,C 24.580C 25.059B 24.545C 0.106 <0.01 Total feed cost (baht/chicken) 49.458A 46.899C 46.406C 47.850B 46.325C 0.298 <0.01 Probability levels of contrast Body ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total weight intake intake Intake Intake Intake conversion conversion feed Contrast statement ratio ratio cost Control vs Low-CP <0.01 0.53 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Control vs. Low-CP, or +Met <0.01 0.67 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.56 0.18 0.18 0.18 0.45 0.18 0.18 0.45 0.43 0.41 0.18 Control, Normal ME vs. Low-ME 0.01 0.34 0.39 0.23 0.40 0.94 0.39 <0.01 0.77 <0.01 <0.01 <0.01 Control vs. Low-ME <0.01 0.46 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Normal ME vs. Low-ME 0.51 0.40 0.18 0.30 0.18 <0.01 0.18 0.04 <0.01 0.15 <0.01 <0.01 A,B,CValues within the same row with different superscripts are significantly different (P<0.01) 1Standard error of the mean. 2Average daily gain. 3Feed conversion ratio (feed intake/gain). 4Protein intake/gain. 5Energy intake/gain. 6Feed cost per gain. View Large After feed restriction, animals usually increase their feed intake to catch up on their growth (Bikker et al., 1996; Zubair and Leeson, 1996; Nukreaw and Bunchasak, 2015). In addition, reducing the energy content of the diet also results in an increase in the feed intake (Leeson et al., 1996; Cheng et al., 1997). However, in the current study, chickens fed with a Low-ME or normal ME diet after receiving a Low-CP or Low-CP+Met diet did not increase their feed intake and could not regain the lost body weight compared to the control diet, except with the Low-CP+Met diet (followed by normal ME diet). Nonetheless, feeding normal ME or Low-ME diet during the finisher period clearly improved nutrient utilization (indicated by the FCR, protein conversion ratio, and energy conversion ratio) of chickens after being fed with the Low-CP+Met diet, although the exact mechanism is unclear. Similarly, Nukreaw and Bunchasak (2015) stated that the phenomenon of chickens fed low protein diets failing to regain body weight was caused by their inability to increase feed intake, and the mechanisms of compensatory response for the growth rate and the efficiency of nutrient utilization (FCR, protein conversion ratio, and energy conversion ratio) may be different. During the finisher period, it was assumed that chickens fed with the Low-CP+Met diet may have better quantitative (growth rate) and qualitative (feed or nutrient utilization) improvement, if their feed intake could be increased. The production performance for the overall period (age 11 to 42 d of age) is presented in Table 5. The growth rates of chickens fed Trt B, C, and E were less than that of the Trt A (P < 0.01), except for the Trt D. During the finisher period, Trt D and E significantly improved the productive performance and production cost (ADG, FCR, protein conversion ratio, energy conversion ratio, and FCG) (P < 0.01) compared to feeding with the Trt B and C, and protein conversion ratio, energy conversion ratio, and FCR better than those of the Trt A (P < 0.05). Reducing dietary energy (−75 ME Kcal/kg) caused poorer FCR and protein conversion ratio values with the Trt C (P < 0.05). The feed intakes in the Trt B and E were significantly lower than that of the Trt A (P < 0.05), while the feed cost of the Trt A was the most expensive (P < 0.01). Table 5. Growth performance of broiler chickens fed a low-protein diet with or without sufficient Met and subsequent feeding with a normal or low-energy diet during 11 to 42 d of age (overall period). Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value ADG2 87.546A 82.436C 82.418C 86.235A,B 85.433B 0.580 <0.01 Feed intake (g/chick) 4599.760a 4436.790b 4536.220a,b 4503.670a,b 4473.360b 23.193 0.02 Met intake (g/chick) 23.728A 19.061B 19.445B 23.774A 23.551A 0.363 <0.01 TSAA intake (g/chick) 38.581A 32.920C 33.644C 37.834A,B 37.555B 0.412 <0.01 FCR3 1.641C 1.683B 1.720A 1.633C 1.636C 0.007 <0.01 Protein intake(g/chick) 897.734A 830.966B 849.526B 843.661B 838.151B 5.535 <0.01 Energy intake(kcal/chick) 14,774.800A 14,248.530B,C 14,320.000B,C 14,464.160A,B 14,120.540C 76.990 <0.01 Protein conversion ratio4 0.321A 0.315B 0.322A 0.306C 0.307C 0.001 <0.01 Energy conversion ratio5 5.279B 5.404A 5.431A 5.244B,C 5.164C 0.022 <0.01 FCG (baht/kg)6 48.446A 48.049A,B 48.356A 47.486B,C 46.884C 0.160 <0.01 Total feed cost (baht/chicken) 135.648A 126.669C 127.514C 131.013B 128.160C 0.807 <0.01 Profit (bath/chicken)* 88.241A 84.710B 83.693B 89.854A 90.945A 0.864 <0.01 Probability levels of contrast ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total intake intake intake intake intake conversion conversion feed Contrast statement ratio ratio cost Control vs. Low-CP or +Met <0.01 <0.01 <0.01 <0.01 0.02 <0.01 <0.01 <0.01 0.34 0.02 <0.01 Control vs. Low-CP <0.01 0.01 <0.01 <0.01 <0.01 <0.01 <0.01 0.34 <0.01 0.46 <0.01 Control vs. Low-CP+Met 0.02 0.01 0.76 0.01 0.56 <0.01 <0.01 <0.01 0.05 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.95 <0.01 <0.01 <0.01 0.92 0.94 <0.01 <0.01 <0.01 0.02 Normal ME vs. Low-ME 0.47 0.32 0.65 0.43 0.04 0.32 0.22 0.03 0.38 0.58 0.31 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value ADG2 87.546A 82.436C 82.418C 86.235A,B 85.433B 0.580 <0.01 Feed intake (g/chick) 4599.760a 4436.790b 4536.220a,b 4503.670a,b 4473.360b 23.193 0.02 Met intake (g/chick) 23.728A 19.061B 19.445B 23.774A 23.551A 0.363 <0.01 TSAA intake (g/chick) 38.581A 32.920C 33.644C 37.834A,B 37.555B 0.412 <0.01 FCR3 1.641C 1.683B 1.720A 1.633C 1.636C 0.007 <0.01 Protein intake(g/chick) 897.734A 830.966B 849.526B 843.661B 838.151B 5.535 <0.01 Energy intake(kcal/chick) 14,774.800A 14,248.530B,C 14,320.000B,C 14,464.160A,B 14,120.540C 76.990 <0.01 Protein conversion ratio4 0.321A 0.315B 0.322A 0.306C 0.307C 0.001 <0.01 Energy conversion ratio5 5.279B 5.404A 5.431A 5.244B,C 5.164C 0.022 <0.01 FCG (baht/kg)6 48.446A 48.049A,B 48.356A 47.486B,C 46.884C 0.160 <0.01 Total feed cost (baht/chicken) 135.648A 126.669C 127.514C 131.013B 128.160C 0.807 <0.01 Profit (bath/chicken)* 88.241A 84.710B 83.693B 89.854A 90.945A 0.864 <0.01 Probability levels of contrast ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total intake intake intake intake intake conversion conversion feed Contrast statement ratio ratio cost Control vs. Low-CP or +Met <0.01 <0.01 <0.01 <0.01 0.02 <0.01 <0.01 <0.01 0.34 0.02 <0.01 Control vs. Low-CP <0.01 0.01 <0.01 <0.01 <0.01 <0.01 <0.01 0.34 <0.01 0.46 <0.01 Control vs. Low-CP+Met 0.02 0.01 0.76 0.01 0.56 <0.01 <0.01 <0.01 0.05 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.95 <0.01 <0.01 <0.01 0.92 0.94 <0.01 <0.01 <0.01 0.02 Normal ME vs. Low-ME 0.47 0.32 0.65 0.43 0.04 0.32 0.22 0.03 0.38 0.58 0.31 A,B,CValues within the same row with different superscripts are significantly different (P < 0.01). a,bValues within the same row with different superscripts are significantly different (P < 0.05) 1Standard error of the mean. 2Average daily gain. 3Feed conversion ratio (feed intake/gain). 4Protein intake/gain. 5Energy intake/gain. 6Feed cost per gain. *Profit = [(body weight × sale value of chicken)—(FCG × body weight), sale value of chicken = 77.50 THB/kg live weight. View Large Table 5. Growth performance of broiler chickens fed a low-protein diet with or without sufficient Met and subsequent feeding with a normal or low-energy diet during 11 to 42 d of age (overall period). Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value ADG2 87.546A 82.436C 82.418C 86.235A,B 85.433B 0.580 <0.01 Feed intake (g/chick) 4599.760a 4436.790b 4536.220a,b 4503.670a,b 4473.360b 23.193 0.02 Met intake (g/chick) 23.728A 19.061B 19.445B 23.774A 23.551A 0.363 <0.01 TSAA intake (g/chick) 38.581A 32.920C 33.644C 37.834A,B 37.555B 0.412 <0.01 FCR3 1.641C 1.683B 1.720A 1.633C 1.636C 0.007 <0.01 Protein intake(g/chick) 897.734A 830.966B 849.526B 843.661B 838.151B 5.535 <0.01 Energy intake(kcal/chick) 14,774.800A 14,248.530B,C 14,320.000B,C 14,464.160A,B 14,120.540C 76.990 <0.01 Protein conversion ratio4 0.321A 0.315B 0.322A 0.306C 0.307C 0.001 <0.01 Energy conversion ratio5 5.279B 5.404A 5.431A 5.244B,C 5.164C 0.022 <0.01 FCG (baht/kg)6 48.446A 48.049A,B 48.356A 47.486B,C 46.884C 0.160 <0.01 Total feed cost (baht/chicken) 135.648A 126.669C 127.514C 131.013B 128.160C 0.807 <0.01 Profit (bath/chicken)* 88.241A 84.710B 83.693B 89.854A 90.945A 0.864 <0.01 Probability levels of contrast ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total intake intake intake intake intake conversion conversion feed Contrast statement ratio ratio cost Control vs. Low-CP or +Met <0.01 <0.01 <0.01 <0.01 0.02 <0.01 <0.01 <0.01 0.34 0.02 <0.01 Control vs. Low-CP <0.01 0.01 <0.01 <0.01 <0.01 <0.01 <0.01 0.34 <0.01 0.46 <0.01 Control vs. Low-CP+Met 0.02 0.01 0.76 0.01 0.56 <0.01 <0.01 <0.01 0.05 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.95 <0.01 <0.01 <0.01 0.92 0.94 <0.01 <0.01 <0.01 0.02 Normal ME vs. Low-ME 0.47 0.32 0.65 0.43 0.04 0.32 0.22 0.03 0.38 0.58 0.31 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value ADG2 87.546A 82.436C 82.418C 86.235A,B 85.433B 0.580 <0.01 Feed intake (g/chick) 4599.760a 4436.790b 4536.220a,b 4503.670a,b 4473.360b 23.193 0.02 Met intake (g/chick) 23.728A 19.061B 19.445B 23.774A 23.551A 0.363 <0.01 TSAA intake (g/chick) 38.581A 32.920C 33.644C 37.834A,B 37.555B 0.412 <0.01 FCR3 1.641C 1.683B 1.720A 1.633C 1.636C 0.007 <0.01 Protein intake(g/chick) 897.734A 830.966B 849.526B 843.661B 838.151B 5.535 <0.01 Energy intake(kcal/chick) 14,774.800A 14,248.530B,C 14,320.000B,C 14,464.160A,B 14,120.540C 76.990 <0.01 Protein conversion ratio4 0.321A 0.315B 0.322A 0.306C 0.307C 0.001 <0.01 Energy conversion ratio5 5.279B 5.404A 5.431A 5.244B,C 5.164C 0.022 <0.01 FCG (baht/kg)6 48.446A 48.049A,B 48.356A 47.486B,C 46.884C 0.160 <0.01 Total feed cost (baht/chicken) 135.648A 126.669C 127.514C 131.013B 128.160C 0.807 <0.01 Profit (bath/chicken)* 88.241A 84.710B 83.693B 89.854A 90.945A 0.864 <0.01 Probability levels of contrast ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total intake intake intake intake intake conversion conversion feed Contrast statement ratio ratio cost Control vs. Low-CP or +Met <0.01 <0.01 <0.01 <0.01 0.02 <0.01 <0.01 <0.01 0.34 0.02 <0.01 Control vs. Low-CP <0.01 0.01 <0.01 <0.01 <0.01 <0.01 <0.01 0.34 <0.01 0.46 <0.01 Control vs. Low-CP+Met 0.02 0.01 0.76 0.01 0.56 <0.01 <0.01 <0.01 0.05 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.95 <0.01 <0.01 <0.01 0.92 0.94 <0.01 <0.01 <0.01 0.02 Normal ME vs. Low-ME 0.47 0.32 0.65 0.43 0.04 0.32 0.22 0.03 0.38 0.58 0.31 A,B,CValues within the same row with different superscripts are significantly different (P < 0.01). a,bValues within the same row with different superscripts are significantly different (P < 0.05) 1Standard error of the mean. 2Average daily gain. 3Feed conversion ratio (feed intake/gain). 4Protein intake/gain. 5Energy intake/gain. 6Feed cost per gain. *Profit = [(body weight × sale value of chicken)—(FCG × body weight), sale value of chicken = 77.50 THB/kg live weight. View Large For the overall feeding period (11 to 42 d of age), the growth rate of chickens fed the Trt D was not significantly different from the Trt A, and clearly improved the FCR, protein conversion ratio, and energy conversion ratio. These results were in accordance with the results of Nukreaw et al. (2011). Feed intake is greatest during the finisher period, therefore proving Low-ME or normal ME after feeding Low-CP+Met improved the overall energy conversion ratio (0.76 to 0.33%) and protein conversion ratio (4.57 to 4.90%), reduced total feed cost (3.54 to 5.84%), reduced feed cost per gain (2.02 to 3.35%), and increased the profit (1.79 to 2.98%) compared to the conventional method. However, these phenomena would depend on some conditions: 1) the degree of amino acids or protein restriction, 2) the duration of protein restriction, and 3) the feed consumption response during the finisher period (as a reflection of metabolism) (Nukreaw and Bunchasak, 2015). Carcass Quality And Abdominal Fat The results for the 5 experimental groups with respect to carcass yields and the abdominal fat content at age 24 d are shown in Table 6. At 24 d of age, the carcass and edible meat (breast and leg) yields of the chickens fed the Trt B and C were significantly smaller than those of the other groups (P < 0.01). Feeding Trt D and E promoted carcass and breast meat yields not significantly different from those of the Trt A. The dietary treatments did not significantly affect the wing weight. The abdominal fat contents of the Trt B, C, D, and E were significantly heavier than that of the Trt A (P < 0.01). The liver weights of the chickens fed the Trt B and C were significantly less than that of the Trt A (P < 0.05). Table 6. Carcass quality and abdominal fat of broiler chickens fed a low-CP diet with or without sufficient Met from 11 to 24 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 74.423A 72.994B 73.293B 75.040A 74.580A 0.227 <0.01 Pectoralis major 14.675A 11.856B 11.905B 14.425A 14.285A 0.218 <0.01 Pectoralis minor 3.145A 2.571B 2.626B 3.074A 3.076A 0.044 <0.01 Leg 13.969A 13.100D 13.200C,D 13.651A,B 13.529B,C 0.075 <0.01 Wing 7.411 7.238 7.148 7.244 7.288 0.045 0.39 Abdominal fat 0.945B 1.318A 1.305A 1.226A 1.240A 0.030 <0.01 Liver 2.149b 2.395a 2.335a 2.264a,b 2.265a,b 0.026 0.04 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor Fat Control vs. Low-CP 0.01 <0.01 <0.01 <0.01 0.06 <0.01 <0.01 Control vs. Low-CP+Met 0.41 0.16 0.20 0.03 0.21 <0.01 0.10 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 <0.01 0.44 0.16 0.08 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 74.423A 72.994B 73.293B 75.040A 74.580A 0.227 <0.01 Pectoralis major 14.675A 11.856B 11.905B 14.425A 14.285A 0.218 <0.01 Pectoralis minor 3.145A 2.571B 2.626B 3.074A 3.076A 0.044 <0.01 Leg 13.969A 13.100D 13.200C,D 13.651A,B 13.529B,C 0.075 <0.01 Wing 7.411 7.238 7.148 7.244 7.288 0.045 0.39 Abdominal fat 0.945B 1.318A 1.305A 1.226A 1.240A 0.030 <0.01 Liver 2.149b 2.395a 2.335a 2.264a,b 2.265a,b 0.026 0.04 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor Fat Control vs. Low-CP 0.01 <0.01 <0.01 <0.01 0.06 <0.01 <0.01 Control vs. Low-CP+Met 0.41 0.16 0.20 0.03 0.21 <0.01 0.10 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 <0.01 0.44 0.16 0.08 A,B,C,DValues within the same row with different superscripts are significantly different (P < 0.01). a,bValues within the same row with different superscript are significantly different (P < 0.05). 1Standard error of the mean. View Large Table 6. Carcass quality and abdominal fat of broiler chickens fed a low-CP diet with or without sufficient Met from 11 to 24 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 74.423A 72.994B 73.293B 75.040A 74.580A 0.227 <0.01 Pectoralis major 14.675A 11.856B 11.905B 14.425A 14.285A 0.218 <0.01 Pectoralis minor 3.145A 2.571B 2.626B 3.074A 3.076A 0.044 <0.01 Leg 13.969A 13.100D 13.200C,D 13.651A,B 13.529B,C 0.075 <0.01 Wing 7.411 7.238 7.148 7.244 7.288 0.045 0.39 Abdominal fat 0.945B 1.318A 1.305A 1.226A 1.240A 0.030 <0.01 Liver 2.149b 2.395a 2.335a 2.264a,b 2.265a,b 0.026 0.04 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor Fat Control vs. Low-CP 0.01 <0.01 <0.01 <0.01 0.06 <0.01 <0.01 Control vs. Low-CP+Met 0.41 0.16 0.20 0.03 0.21 <0.01 0.10 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 <0.01 0.44 0.16 0.08 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 74.423A 72.994B 73.293B 75.040A 74.580A 0.227 <0.01 Pectoralis major 14.675A 11.856B 11.905B 14.425A 14.285A 0.218 <0.01 Pectoralis minor 3.145A 2.571B 2.626B 3.074A 3.076A 0.044 <0.01 Leg 13.969A 13.100D 13.200C,D 13.651A,B 13.529B,C 0.075 <0.01 Wing 7.411 7.238 7.148 7.244 7.288 0.045 0.39 Abdominal fat 0.945B 1.318A 1.305A 1.226A 1.240A 0.030 <0.01 Liver 2.149b 2.395a 2.335a 2.264a,b 2.265a,b 0.026 0.04 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor Fat Control vs. Low-CP 0.01 <0.01 <0.01 <0.01 0.06 <0.01 <0.01 Control vs. Low-CP+Met 0.41 0.16 0.20 0.03 0.21 <0.01 0.10 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 <0.01 0.44 0.16 0.08 A,B,C,DValues within the same row with different superscripts are significantly different (P < 0.01). a,bValues within the same row with different superscript are significantly different (P < 0.05). 1Standard error of the mean. View Large It is known that inadequate CP and amino acids in the diet negatively influence the carcass composition of broilers (Si et al., 2001; Furlan et al., 2004), and that the growth of breast meat is more sensitive to limiting the amino acid concentration in the diet than that of other edible components (Rakangtong and Bunchasak, 2011). Feeding Low-CP diets deficient in Met significantly decreased the carcass yield and breast meat yield, while adding Met prevented these negative effects. This finding was in accordance with the general acceptance that supplementation with Met in Low-CP diets promotes meat production (Moran, 1994; Schutte and Pack, 1995; Saki et al., 2007; Nukreaw et al., 2011) due to the improvement in the amino acid balance and protein synthesis (Boomgaardt and Baker, 1973; Bunchasak and Keawarun, 2006). It is well documented that diets with a high ME content or a high energy-to-protein ratio promote energy retention as fat (Aletor et al., 2000; Faria Filho et al., 2003; Swennen et al., 2004; Yang et al., 2009; Nukreaw and Bunchasak, 2015). In the present study, abdominal fat pads (% live body weight) of the chickens fed a Low-CP diet (with or without Met) were higher than those of the control group. Nukreaw et al. (2011) also reported that decreasing the dietary protein intake with or without Met supplementation increased abdominal fat pads compared to a control diet. In poultry, lipogenesis mainly occurs in the liver (Nukreaw et al., 2011) and is transported by the blood system and then taken up into adipose cells by lipoprotein lipase (Bunchasak et al., 1997). The results demonstrated that a Low-CP diet deficient in Met significantly increased the liver weight and abdominal fat accumulation. Because of enhanced de novo lipogenesis in the liver of chickens fed the Low-CP diet (Rosebrough and Steele, 1985; Aletor et al., 2000; Swennen et al., 2006), chickens are expected to have increased liver weights and deposit more abdominal fat. Moreover, an amino acid imbalance stimulates protein metabolism in the liver or an increased rate of amino acid synthesis to provide sufficient amino acids (Hiramoto et al., 1990), which is also a factor affecting liver enlargement. Therefore, adding Met to Low-CP diets reduces the liver weight and may cause an improvement in the amino acids balance. This indicated that the maximum breast meat yield can be achieved in a Low-CP diet with Met supplementation, while fat accumulation can still be high. The 42-day carcass yields and the abdominal fat content results are shown in Table 7. At 42 d of age, the dietary treatments did not significantly affect the carcass yield, pectoralis minor muscles, leg, wing, abdominal fat content, or liver, while the pectoralis major muscles of chickens fed the Trt B and C groups were smaller than the Trt A (P < 0.01). The addition of Met in the Low-CP diets during the grower period significantly enhanced the pectoralis major muscles at 42 d of age so that they were not significantly different from that of the Trt A, although feeding with the Low-ME diet reduced the breast meat yield (P < 0.05) compared to the normal ME diets. Table 7. Carcass quality and abdominal fat of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 80.513 80.039 79.543 80.414 80.324 0.124 0.07 Pectoralis major 17.123A 16.374B,C 15.831C 17.213A 16.823A,B 0.120 <0.01 Pectoralis minor 3.666 3.538 3.451 3.499 3.490 0.032 0.15 Leg 16.054 16.154 16.156 15.787 16.053 0.069 0.47 Wing 7.300 7.305 7.259 7.384 7.284 0.031 0.82 Abdominal fat 2.038 2.041 1.923 1.881 1.885 0.038 0.25 Liver 1.683 1.749 1.776 1.689 1.759 0.018 0.34 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor fat Control vs. Low-CP 0.03 <0.01 0.03 0.61 0.85 0.50 0.11 Control vs. Low-CP+Met 0.64 0.67 0.03 0.50 0.72 0.07 0.40 Low-CP vs. Low-CP+Met 0.03 <0.01 0.94 0.15 0.50 0.15 0.33 Control, Normal ME vs. Low-ME 0.10 <0.01 0.11 0.47 0.40 0.19 0.10 Control vs. Low-ME 0.07 <0.01 0.01 0.80 0.76 0.11 0.09 Normal ME vs. Low-ME 0.25 0.03 0.49 0.40 0.34 0.40 0.22 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 80.513 80.039 79.543 80.414 80.324 0.124 0.07 Pectoralis major 17.123A 16.374B,C 15.831C 17.213A 16.823A,B 0.120 <0.01 Pectoralis minor 3.666 3.538 3.451 3.499 3.490 0.032 0.15 Leg 16.054 16.154 16.156 15.787 16.053 0.069 0.47 Wing 7.300 7.305 7.259 7.384 7.284 0.031 0.82 Abdominal fat 2.038 2.041 1.923 1.881 1.885 0.038 0.25 Liver 1.683 1.749 1.776 1.689 1.759 0.018 0.34 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor fat Control vs. Low-CP 0.03 <0.01 0.03 0.61 0.85 0.50 0.11 Control vs. Low-CP+Met 0.64 0.67 0.03 0.50 0.72 0.07 0.40 Low-CP vs. Low-CP+Met 0.03 <0.01 0.94 0.15 0.50 0.15 0.33 Control, Normal ME vs. Low-ME 0.10 <0.01 0.11 0.47 0.40 0.19 0.10 Control vs. Low-ME 0.07 <0.01 0.01 0.80 0.76 0.11 0.09 Normal ME vs. Low-ME 0.25 0.03 0.49 0.40 0.34 0.40 0.22 A,B,CValues within the same row with different superscripts are significantly different (P < 0.01). 1Standard error of the mean. View Large Table 7. Carcass quality and abdominal fat of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 80.513 80.039 79.543 80.414 80.324 0.124 0.07 Pectoralis major 17.123A 16.374B,C 15.831C 17.213A 16.823A,B 0.120 <0.01 Pectoralis minor 3.666 3.538 3.451 3.499 3.490 0.032 0.15 Leg 16.054 16.154 16.156 15.787 16.053 0.069 0.47 Wing 7.300 7.305 7.259 7.384 7.284 0.031 0.82 Abdominal fat 2.038 2.041 1.923 1.881 1.885 0.038 0.25 Liver 1.683 1.749 1.776 1.689 1.759 0.018 0.34 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor fat Control vs. Low-CP 0.03 <0.01 0.03 0.61 0.85 0.50 0.11 Control vs. Low-CP+Met 0.64 0.67 0.03 0.50 0.72 0.07 0.40 Low-CP vs. Low-CP+Met 0.03 <0.01 0.94 0.15 0.50 0.15 0.33 Control, Normal ME vs. Low-ME 0.10 <0.01 0.11 0.47 0.40 0.19 0.10 Control vs. Low-ME 0.07 <0.01 0.01 0.80 0.76 0.11 0.09 Normal ME vs. Low-ME 0.25 0.03 0.49 0.40 0.34 0.40 0.22 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 80.513 80.039 79.543 80.414 80.324 0.124 0.07 Pectoralis major 17.123A 16.374B,C 15.831C 17.213A 16.823A,B 0.120 <0.01 Pectoralis minor 3.666 3.538 3.451 3.499 3.490 0.032 0.15 Leg 16.054 16.154 16.156 15.787 16.053 0.069 0.47 Wing 7.300 7.305 7.259 7.384 7.284 0.031 0.82 Abdominal fat 2.038 2.041 1.923 1.881 1.885 0.038 0.25 Liver 1.683 1.749 1.776 1.689 1.759 0.018 0.34 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor fat Control vs. Low-CP 0.03 <0.01 0.03 0.61 0.85 0.50 0.11 Control vs. Low-CP+Met 0.64 0.67 0.03 0.50 0.72 0.07 0.40 Low-CP vs. Low-CP+Met 0.03 <0.01 0.94 0.15 0.50 0.15 0.33 Control, Normal ME vs. Low-ME 0.10 <0.01 0.11 0.47 0.40 0.19 0.10 Control vs. Low-ME 0.07 <0.01 0.01 0.80 0.76 0.11 0.09 Normal ME vs. Low-ME 0.25 0.03 0.49 0.40 0.34 0.40 0.22 A,B,CValues within the same row with different superscripts are significantly different (P < 0.01). 1Standard error of the mean. View Large Similar to Nukreaw et al. (2011), at 42 d of age, the pectoralis major muscles of chickens fed with the Low-CP group was poor, while the breast meat yield was comparable to the control group when Met was added to the Low-CP diet because maximal breast meat production may already have been achieved with the Low-CP diet with amino acid balance provided, so compensation of protein synthesis (meat production) did not occur after feeding with the normal ME diet. Nevertheless, a decrease in the energy density in feed during the finisher period resulted in a reduction in the breast meat yield due to the inability to enhance feed intake. This indicated that the mechanism controlling voluntary feed intake is complicated, and chickens do not always increase their feed intake when they are fed on a low-energy diet. Energy deposition resulting in energy intake is controlled by multiple regulatory mechanisms (Swennen et al., 2004). Apart from genetic factors, exogenous factors such as environmental conditions and nutritional factors (e.g., diet and composition) interact strongly in the control and regulation of the energy flow (Swennen et al., 2004). At 42 d of age, the abdominal fat pads of chickens fed on Low-CP diets did not differ from the control group. It can be concluded that high fat accumulation caused by a restriction in the protein intake can be reduced after the finisher period. Nukreaw et al. (2011) and more recently Jariyahatthakij et al. (2016) reported that adding Met in a Low-CP diet during the grower period and subsequently feeding with a control diet reduced fat accumulation compared to the control group. Perhaps down expression of lipogenesis and/or an increase in lipolysis or β-oxidation may be stimulated during this period. Chemical Blood Test The effects of experimental diets on the TG, total protein, albumin, and uric acid in the blood at 24 d of age are shown in Table 8. The TG, total protein, and albumin in the plasma of chickens fed Trt B and C groups were significantly lower than those of Trt D and E groups (P < 0.05). These blood parameters in the Trt A did not significantly differ from those in other groups. Moreover, the dietary treatment did not significantly affect the uric acid level in plasma. Table 8. Chemical blood profiles of broiler chickens fed a low-CP diet with or without sufficient Met from 11 to 24 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low then Normal then Low Item (Trt A) ME(Trt B) -ME(Trt C) ME(Trt D) -ME(Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 36.183A,B 30.176B 31.056B 42.628A 42.993A 1.289 <0.01 Total protein (mg/dl) 26.418A,B 25.024B 25.596B 27.638A 27.463A 0.285 <0.01 Albumin (g/dl) 1.301a,b 1.215b 1.204b 1.356a 1.350a 0.020 0.03 Uric acid (mg/dl) 3.702 4.167 4.328 4.274 4.276 0.199 0.84 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid Control vs. Low-CP 0.08 0.13 0.08 0.31 Control vs. Low-CP+Met 0.04 0.12 0.32 0.28 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 0.95 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low then Normal then Low Item (Trt A) ME(Trt B) -ME(Trt C) ME(Trt D) -ME(Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 36.183A,B 30.176B 31.056B 42.628A 42.993A 1.289 <0.01 Total protein (mg/dl) 26.418A,B 25.024B 25.596B 27.638A 27.463A 0.285 <0.01 Albumin (g/dl) 1.301a,b 1.215b 1.204b 1.356a 1.350a 0.020 0.03 Uric acid (mg/dl) 3.702 4.167 4.328 4.274 4.276 0.199 0.84 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid Control vs. Low-CP 0.08 0.13 0.08 0.31 Control vs. Low-CP+Met 0.04 0.12 0.32 0.28 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 0.95 A,BValues within the same row with different superscripts are significantly different (P < 0.01). a,bValues within the same row with different superscript are significantly different (P < 0.05). 1Standard error of the mean. View Large Table 8. Chemical blood profiles of broiler chickens fed a low-CP diet with or without sufficient Met from 11 to 24 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low then Normal then Low Item (Trt A) ME(Trt B) -ME(Trt C) ME(Trt D) -ME(Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 36.183A,B 30.176B 31.056B 42.628A 42.993A 1.289 <0.01 Total protein (mg/dl) 26.418A,B 25.024B 25.596B 27.638A 27.463A 0.285 <0.01 Albumin (g/dl) 1.301a,b 1.215b 1.204b 1.356a 1.350a 0.020 0.03 Uric acid (mg/dl) 3.702 4.167 4.328 4.274 4.276 0.199 0.84 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid Control vs. Low-CP 0.08 0.13 0.08 0.31 Control vs. Low-CP+Met 0.04 0.12 0.32 0.28 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 0.95 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low then Normal then Low Item (Trt A) ME(Trt B) -ME(Trt C) ME(Trt D) -ME(Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 36.183A,B 30.176B 31.056B 42.628A 42.993A 1.289 <0.01 Total protein (mg/dl) 26.418A,B 25.024B 25.596B 27.638A 27.463A 0.285 <0.01 Albumin (g/dl) 1.301a,b 1.215b 1.204b 1.356a 1.350a 0.020 0.03 Uric acid (mg/dl) 3.702 4.167 4.328 4.274 4.276 0.199 0.84 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid Control vs. Low-CP 0.08 0.13 0.08 0.31 Control vs. Low-CP+Met 0.04 0.12 0.32 0.28 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 0.95 A,BValues within the same row with different superscripts are significantly different (P < 0.01). a,bValues within the same row with different superscript are significantly different (P < 0.05). 1Standard error of the mean. View Large In poultry, TG are synthesized in the liver and transported by the blood system and then taken up into adipose cells by lipoprotein lipase (LPL) (Bunchasak et al., 1997). Adding Met in the Low-CP diet increased the plasma TG level compared to that of chickens fed a low-CP diet. Nukreaw et al. (2011) and Nukreaw and Bunchasak (2015) also demonstrated that adding Met to a Low-CP diet linearly increased the plasma TG concentration. It seems that a high TG level caused by Met supplementation stimulates triglyceride-rich lipoprotein secretion from the liver (Ho et al., 1989) or by depression of the activity of LPL (Wegner et al., 1978; Bunchasak et al., 1997). Total protein, which consists of albumin and globulin, is commonly used in nutritional studies (Poosuwan et al., 2008), since plasma proteins are sensitive to nutritional influences (Kaneko, 1997) and albumin also acts as a mobile source of amino acids in a nutritional emergency (Butler, 1971). Generally, total protein and albumin directly respond to both protein quantity and quality (Tewe, 1985; Eggum, 1989). Ospina-Rojas et al. (2014) reported that supplementing synthetic amino acids in a Low-CP diet increases the total protein and albumin in plasma. Decreases in the levels of plasma albumin and total protein could be related to a deficit of amino acids and protein requirements (Corzo et al., 2009; Hernández et al., 2012), and this deficit may induce difficulty in maintaining homeostasis of protein synthesis in the tissues (Ospina-Rojas et al., 2014). In the present study, it was not surprising that supplementation of Met in the Low-CP diet resulted in higher levels of total plasma protein and albumin than those of the Low-CP diet without supplementation. The 42-day chemical blood test results are shown in Table 9. Triglyceride, total protein, albumin, uric acid, and NEFA levels in the plasma were not significantly affected by dietary treatment. However, in the orthogonal contrast analysis, feeding with the Low-ME diet resulted in a higher level of TG compared to the normal ME and control diets (P < 0.05). Table 9. Chemical blood profiles of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 34.608 36.342 41.504 33.633 42.678 1.212 0.05 Total protein (g/dl) 2.454 2.405 2.266 2.597 2.330 0.063 0.54 Albumin (g/dl) 1.113 1.081 1.085 1.155 1.003 0.036 0.76 Uric acid (mg/dl) 3.303 2.685 2.826 2.729 2.919 0.121 0.49 NEFA (mmol/l)2 0.886 0.908 1.041 0.881 0.882 0.044 0.78 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid NEFA Control vs. Low-CP 0.18 0.50 0.77 0.10 0.48 Control vs. Low-CP or +Met 0.18 0.73 0.73 0.09 0.72 Low-CP vs. Low-CP+Met 0.77 0.37 0.96 0.80 0.37 Control, Normal ME vs. Low-ME <0.01 0.16 0.34 0.89 0.46 Control vs. Normal ME 0.90 0.79 0.96 0.07 0.95 Control vs. Low-ME 0.02 0.38 0.49 0.19 0.55 Normal vs. Low-ME <0.01 0.16 0.37 0.53 0.52 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 34.608 36.342 41.504 33.633 42.678 1.212 0.05 Total protein (g/dl) 2.454 2.405 2.266 2.597 2.330 0.063 0.54 Albumin (g/dl) 1.113 1.081 1.085 1.155 1.003 0.036 0.76 Uric acid (mg/dl) 3.303 2.685 2.826 2.729 2.919 0.121 0.49 NEFA (mmol/l)2 0.886 0.908 1.041 0.881 0.882 0.044 0.78 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid NEFA Control vs. Low-CP 0.18 0.50 0.77 0.10 0.48 Control vs. Low-CP or +Met 0.18 0.73 0.73 0.09 0.72 Low-CP vs. Low-CP+Met 0.77 0.37 0.96 0.80 0.37 Control, Normal ME vs. Low-ME <0.01 0.16 0.34 0.89 0.46 Control vs. Normal ME 0.90 0.79 0.96 0.07 0.95 Control vs. Low-ME 0.02 0.38 0.49 0.19 0.55 Normal vs. Low-ME <0.01 0.16 0.37 0.53 0.52 1Standard error of the mean. 2Non-esterified fatty acid. View Large Table 9. Chemical blood profiles of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 34.608 36.342 41.504 33.633 42.678 1.212 0.05 Total protein (g/dl) 2.454 2.405 2.266 2.597 2.330 0.063 0.54 Albumin (g/dl) 1.113 1.081 1.085 1.155 1.003 0.036 0.76 Uric acid (mg/dl) 3.303 2.685 2.826 2.729 2.919 0.121 0.49 NEFA (mmol/l)2 0.886 0.908 1.041 0.881 0.882 0.044 0.78 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid NEFA Control vs. Low-CP 0.18 0.50 0.77 0.10 0.48 Control vs. Low-CP or +Met 0.18 0.73 0.73 0.09 0.72 Low-CP vs. Low-CP+Met 0.77 0.37 0.96 0.80 0.37 Control, Normal ME vs. Low-ME <0.01 0.16 0.34 0.89 0.46 Control vs. Normal ME 0.90 0.79 0.96 0.07 0.95 Control vs. Low-ME 0.02 0.38 0.49 0.19 0.55 Normal vs. Low-ME <0.01 0.16 0.37 0.53 0.52 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 34.608 36.342 41.504 33.633 42.678 1.212 0.05 Total protein (g/dl) 2.454 2.405 2.266 2.597 2.330 0.063 0.54 Albumin (g/dl) 1.113 1.081 1.085 1.155 1.003 0.036 0.76 Uric acid (mg/dl) 3.303 2.685 2.826 2.729 2.919 0.121 0.49 NEFA (mmol/l)2 0.886 0.908 1.041 0.881 0.882 0.044 0.78 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid NEFA Control vs. Low-CP 0.18 0.50 0.77 0.10 0.48 Control vs. Low-CP or +Met 0.18 0.73 0.73 0.09 0.72 Low-CP vs. Low-CP+Met 0.77 0.37 0.96 0.80 0.37 Control, Normal ME vs. Low-ME <0.01 0.16 0.34 0.89 0.46 Control vs. Normal ME 0.90 0.79 0.96 0.07 0.95 Control vs. Low-ME 0.02 0.38 0.49 0.19 0.55 Normal vs. Low-ME <0.01 0.16 0.37 0.53 0.52 1Standard error of the mean. 2Non-esterified fatty acid. View Large Lipid accumulation in cells depends upon the balance between lipogenesis and lipolysis of TG responsive to dietary modifications (Kersten, 2001). Fat deposition in adipose tissue also depends on a change in the relative activity of LPL, which mediates the uptake of fatty acid from the blood (plasma TG) and hormone-sensitive lipase, which mediates the output of fatty acid from adipose tissue (plasma NEFA) (Paik and Yearick, 1978). Since there were no significant differences among the treatment groups with regard to the uric acid, total protein, albumin, or NEFA levels, this indicated that chickens can harmonize their blood metabolism to normal metabolic status after the finisher period. This was in accordance with our recent study that found that a finisher period normalized plasma lipid levels via TG transportation and lipolysis pathways (Jariyahatthakij et al., 2016). Feeding with a Low-ME diet conversely increased plasma TG compared to a normal ME diet, while the abdominal fat content decreased. It may be assumed that a high plasma TG level in Low-ME groups may be caused by the interruption of TG uptake from blood to extrahepatic tissue. Lipid Gene Expression The effects of experimental diets on gene expression in the liver of chickens are presented in Table 10. At 42 d of age, the dietary treatments did not significantly affect the expression of the ACC, CPT-I, or avANT genes. However, adding Met in the Low-CP diet (Trt D and E) tended to decrease the expression of the ACC gene compared to the Trt A (P = 0.09). Additionally, feeding with Low-ME diets tended to decrease the expression of the CPT-I gene compared to the normal ME diets (P = 0.08). Table 10. Gene expression of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item1 (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.2 P-value ACC (AU*) 4.295 1.508 2.298 1.343 1.240 0.606 0.51 CPT-I (AU*) 0.068 0.072 0.032 0.065 0.028 0.009 0.44 avANT (AU*) 0.540 0.888 0.663 0.610 0.730 0.076 0.71 Probability levels of contrast Contrast statement ACC CPT-I avANT Control vs. Low-CP 0.18 0.54 0.30 Control vs. Low-CP+Met 0.09 0.41 0.56 Control, Normal ME v.s Low-ME 0.63 0.06 0.92 Control vs. Low-ME 0.15 0.15 0.49 Normal ME vs. Low-ME 0.81 0.08 0.77 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item1 (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.2 P-value ACC (AU*) 4.295 1.508 2.298 1.343 1.240 0.606 0.51 CPT-I (AU*) 0.068 0.072 0.032 0.065 0.028 0.009 0.44 avANT (AU*) 0.540 0.888 0.663 0.610 0.730 0.076 0.71 Probability levels of contrast Contrast statement ACC CPT-I avANT Control vs. Low-CP 0.18 0.54 0.30 Control vs. Low-CP+Met 0.09 0.41 0.56 Control, Normal ME v.s Low-ME 0.63 0.06 0.92 Control vs. Low-ME 0.15 0.15 0.49 Normal ME vs. Low-ME 0.81 0.08 0.77 1ACC = acetyl-CoA carboxylase; CPT-I = carnitine palmitoyl CoA transferase I; avANT = avian adenine nucleotide translocator. 2Standard error of the mean. *The mRNA values (in arbitrary units, AU) are expressed as ratio of the β-actin mRNA values. View Large Table 10. Gene expression of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item1 (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.2 P-value ACC (AU*) 4.295 1.508 2.298 1.343 1.240 0.606 0.51 CPT-I (AU*) 0.068 0.072 0.032 0.065 0.028 0.009 0.44 avANT (AU*) 0.540 0.888 0.663 0.610 0.730 0.076 0.71 Probability levels of contrast Contrast statement ACC CPT-I avANT Control vs. Low-CP 0.18 0.54 0.30 Control vs. Low-CP+Met 0.09 0.41 0.56 Control, Normal ME v.s Low-ME 0.63 0.06 0.92 Control vs. Low-ME 0.15 0.15 0.49 Normal ME vs. Low-ME 0.81 0.08 0.77 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item1 (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.2 P-value ACC (AU*) 4.295 1.508 2.298 1.343 1.240 0.606 0.51 CPT-I (AU*) 0.068 0.072 0.032 0.065 0.028 0.009 0.44 avANT (AU*) 0.540 0.888 0.663 0.610 0.730 0.076 0.71 Probability levels of contrast Contrast statement ACC CPT-I avANT Control vs. Low-CP 0.18 0.54 0.30 Control vs. Low-CP+Met 0.09 0.41 0.56 Control, Normal ME v.s Low-ME 0.63 0.06 0.92 Control vs. Low-ME 0.15 0.15 0.49 Normal ME vs. Low-ME 0.81 0.08 0.77 1ACC = acetyl-CoA carboxylase; CPT-I = carnitine palmitoyl CoA transferase I; avANT = avian adenine nucleotide translocator. 2Standard error of the mean. *The mRNA values (in arbitrary units, AU) are expressed as ratio of the β-actin mRNA values. View Large The avian liver is the most important organ for the intermediary metabolism of lipids and energy (Huang et al., 2013). The hepatic total lipid content is highly regulated by several metabolic pathways such as fatty acid synthesis, lipid transport, and β-oxidation (Kikusato et al., 2015). Body fat accumulation is considered the net result of the balance among dietary absorbed fat, fat synthesis, and catabolism (Huang et al., 2013; Tu et al., 2016). Increasing activity of ACC increases body fat because it is the rate-limiting enzyme of the biosynthesis of fatty acids by catalyzing ACC to malonyl-CoA (Donaldson, 1985). Therefore, ACC transcription was low in the liver of starved chickens (Hillgartner et al., 1996). In the present study, adding Met in the Low-CP diet tended to decrease the expression of the ACC gene (P = 0.09) and significantly decreased the abdominal fat content compared to the control group after the finisher period. This indicated that adding Met may have a long-term effect on the depression of fatty acids synthesis after feeding with normal ME or Low-ME diets. The β-oxidation of fatty acids in mitochondria is an important source of NADH, FADH2, and ATP production (Kikusato et al., 2015). The β-oxidation rate is mainly dependent on the actual capacity of the carnitine transport system (Brouns and Vusse, 1998). In chickens, mitochondrial CPT-I activity has been characterized mostly in the liver (Ishii et al., 1985; Lien and Horng, 2001) and rarely in muscle (Blomstrand et al., 1983). Furthermore, avANT is responsible for the exchange of cytosolic adenine diphosphate for mitochondrial matrix ATP across the inner mitochondrial membrane (Ojano-Dirain et al., 2007). It has been reported that some lipogenic genes such as ACC and CPT-I are involved in the hepatic response to nutritional intervention (Daval et al., 2000), although the role of these genes in the hepatic lipid metabolism after early feed restriction in broilers has not been fully clarified (Yang et al., 2010). We hypothesized that fatty acid imported through CPT-I and avANT may be increased by feeding with a Low-ME diet. Surprisingly, the expression of the CPT-I gene tended to decrease when feeding with a Low-ME diet (P = 0.08). Due to low energy intake of the Low-CP diet groups during the finisher period and the decline in the abdominal fat to a level equal to the control group, the chickens may attempt to maintain their body energy reserve as fat via homeostatic processes, resulting in a tendency for low CPT-I gene expression. Consequently, lipolysis (NEFA) and the expression of gene-related ATP synthesis (avANT) were not significantly affected. In conclusion, reducing dietary protein with Met supplementation during the grower period (age 11 to 24 d) and subsequently feeding with a conventional or Low-ME diet to market age is an appropriate strategy for improving the efficiency of nutrient utilization and carcass and breast meat yield in regard to body energy reserve (fat deposit) and the homeostatic processes (lipogenesis and β-oxidation). SUPPLEMENTARY DATA Supplementary data are available at Poultry Science online. Supplemental Table. Amino acids pattern of experimental diets. ACKNOWLEDGMENTS The authors gratefully acknowledge funding from Charoen Pokphand Group Co., Ltd. The authors would like to acknowledge the Thailand Research Fund for a scholarship and financial support of P. Jariyahatthakij under the Royal Golden Jubilee PhD program. Thanks are also recorded to the Center of Advanced Study for Agriculture and Food, Institute for Advanced Studies, Kasetsart University, Bangkok, Thailand, and to the staff of the Department of Animal Science, Kasetsart University. REFERENCES Abdel-Maksoud A. , Yan F. , Cerrate S. , Coto C. , Wang Z. , Waldroup P. W. . 2010 . Effects of dietary crude protein, lysine level and amino acid balance on performance of broilers 0 to 18 days of age . Int. J. Poult. Sci . 9 : 21 – 27 . Google Scholar CrossRef Search ADS Abe T. , Mujahid A. , Sato K. , Akiba Y. , Toyomizu M. . 2006 . Possible role of avian uncoupling protein in down-regulating mitochondrial superoxide production in skeletal muscle of fasted chickens . FEBS Lett . 580 : 4815 – 4822 . Google Scholar CrossRef Search ADS PubMed Aftab U. , Ashraf M. , Jiang Z. . 2006 . Low protein diets for broilers . World's Poult. Sci. J . 62 : 688 – 701 . Google Scholar CrossRef Search ADS Aletor V. A , Hamid I. I. , Niess E. , Pfeffer E. . 2000 . Low protein amino acids supplemented diets in broiler chickens: Effects on performance, carcass characteristics, whole body composition and efficiencies of nutrient utilization . J. Sci. Food Agric . 80 : 547 – 554 . Google Scholar CrossRef Search ADS Association of Official Analytical Chemists (AOAC) . 2016 . Official methods of analysis . 20th edn . Association of Official Analytical Chemists : Washington, DC . Aviagen . 2007 . Ross 308: broiler nutrition specification . Aviagen Inc. : 5 Huntsville, AL . Bikker P. M. , Verstegen W. A. , Kemp B. , Bosch M. W. . 1996 . Performance and body composition of finishing gilts (45 to 85 kilograms) as affected by energy intake and nutrition in earlier life: 1. Growth of the body and body components . J. Anim. Sci . 74 : 806 – 816 . Google Scholar CrossRef Search ADS PubMed Blomstrand E. , Challiss R. A. , Cooney G. J. , Newsholme E. A. . 1983 . Maximal activities of hexokinase, 6-phosphofructokinase, oxoglutarate dehydroge- nase, and carnitine palmitoyltransferase in rat and avian muscles . Biosci. Rep . 3 : 1149 – 1153 . Google Scholar CrossRef Search ADS PubMed Boomgaardt J. , Baker D. H. . 1973 . Effect of dietary energy concentration on sulfur amino acid requirements and body composition of young chicks . J. Anim. Sci . 36 : 307 – 311 . Google Scholar CrossRef Search ADS PubMed Brouns F. , Vusse G. J. . 1998 . Utilisation of lipids in human subjects: Metabolic and dietary constrains . Br. J. Nutr . 79 : 117 . Google Scholar CrossRef Search ADS PubMed Bunchasak C. 2009 . Role of dietary methionine in poultry production . J. Poult. Sci. 46 : 169 – 179 . Google Scholar CrossRef Search ADS Bunchasak C. , Keawarun N. . 2006 . Effect of methionine hydroxyl analog-free acid on growth performance and chemical composition of liver of broiler chicks fed a corn-soybean based diet from 0 to 6 weeks of age . Anim. Sci. J . 77 : 95 – 102 . Google Scholar CrossRef Search ADS Bunchasak C. , Satoso U. , Tanaka K. , Ohtani S. , Collado C. M. . 1997 . The effect of supplementing methionine plus cysteine to a low-protein diet on the growth performance and fat accumulation of growing broiler chicks . Asian-Australian J. Anim. Sci . 10 : 185 – 191 . Google Scholar CrossRef Search ADS Butler E. J. 1971 . Physiology and Biochemistry of Domestic Fowl . Academic Press , London, UK . Cabel M. C. , Goodwin T. L. , Waldroup P. W. . 1987 . Reduction in abdominal fat content of broiler chickens by the addition of feather meal to finisher diets . Poult. Sci . 66 : 1644 – 1651 . Google Scholar CrossRef Search ADS Cauwenbreghe S. V. , Burnham D. . 2001 . New developments in amino acid and protein nutrition of poultry, as related to optimal performance and reduced nitrogen excretion . 13th European Symposium Poultry Nutrition Blankenberg , Belgium . Cheng T. K , Hamre M. L. , Coon C. N. . 1997 . Effect of environmental temperature, dietary protein, and energy levels on broiler performance . J. Appl. Poult. Res . 6 : 1 – 17 . Google Scholar CrossRef Search ADS Collin A. , Malheiros R. D. , Moraes V. M. B. , Van As P. , Darras V. M. , Taouis M. , Decuypere E. , Buyse J. . 2003 . Effects of dietary macronutrient content on energy metabolism and uncoupling protein mRNA expression in broiler chickens . Br. J. Nutr . 20 : 261 – 269 . Google Scholar CrossRef Search ADS Corzo A. , Loar R. E. II , Kidd M. T. . 2009 . Limitations of dietary isoleucine and valine in broiler chicks diets . Poult. Sci . 88 : 1934 – 1938 . Google Scholar CrossRef Search ADS PubMed Daval S. , Lagarrigue S. , Douaire M. . 2000 . Messenger RNA levels and transcription rates of hepatic lipogenesis genes in genetically lean and fat chickens . Gen. Select. Evol . 32 : 521 – 531 . Google Scholar CrossRef Search ADS Dean D. W. , Bidner T. D. , Southern L. L. . 2006 . Glycine supplementation to low protein, amino acid-supplemented diets supports optimal performance of broiler chicks . Poult. Sci . 85 : 288 – 296 . Google Scholar CrossRef Search ADS PubMed Donaldson W. E. 1985 . Lipogenesis and body fat in chicks: Effects of calorie–protein ratio and dietary fat . Poult. Sci. 64 : 1199 – 1204 . Google Scholar CrossRef Search ADS PubMed Duncan D. M. 1955 . Multiple range and multiple F test . Biometrics . 11 : 42 . Google Scholar CrossRef Search ADS Eggum B. O. 1989 . Biochemical and methodological principles . In: Bock H. D. , Eggum B. , Low A. G. , Simon O. , Zebrowska T. (eds). Protein Metabolism in Farm Animals. Evaluation, Digestion, Absorption and Metabolism . Oxford Science Publication . Deutscher Handwirtschafts Verlag. Berlin , pp. 1 – 52 . Faria Filho F. D. E. , Rosa P. S. , Vieira B. S. , Macari M. , Furlan R. L. . 2003 . Protein levels and environmental temperature effects on carcass characteristics, performance and nitrogen excretion of broiler chickens from 7 to 21 days of age . Braz. J. Poult. Sci . 7 : 247 – 253 . Furlan R. L. , Faria Filho DE. De. , Rosa P. S. , Macari M. . 2004 . Does low-protein diet improve broiler performance under heat stress conditions? Braz. J. Poult. Sci. 6 : 71 – 79 . Hernández F. , López M. , Martínez S. , Megías M. D. , Catalá P. , Madrid J. . 2012 . Effect of low-protein diets and single sex on production performance, plasma metabolites, digestibility, and nitrogen excretion in 1- to 48 day-old broiler . Poult. Sci . 91 : 683 – 692 . Google Scholar CrossRef Search ADS PubMed Hillgartner F. B. , Charron T. , Chesnut K. A. . 1996 . Alterations in nutritional status regulate acetyl-CoA carboxylase expression in avian liver by a transcriptional mechanism . Biochem. J. 319 : 263 – 268 . Google Scholar CrossRef Search ADS PubMed Hiramoto K. , Muramatsu T. , Okumura J. . 1990 . Effect of methionine and lysine deficiencies on protein synthesis in the liver and oviduct and in the whole body of laying hens . Poult. Sci . 69 : 84 – 89 . Google Scholar CrossRef Search ADS PubMed Ho H. T. , Kim D. N. , Lee K. T. . 1989 . Intestinal apolipoprotein B-48 synthesis and lymphatic cholesterol transport are lower in swine fed high fat, high cholesterol diet with soy protein than with casein . Atherosclerosis . 77 : 15 . Google Scholar CrossRef Search ADS PubMed Huang J. , Zhang Y. , Zhou Y. , Zhang Z. , Xie Z. , Zhang J. , Wan X. . 2013 . Green tea polyphenols alleviate obesity in broiler chickens through the regulation of lipid-metabolism-related genes and transcription factor expression . J. Agric. Food Chem . 61 : 8565 – 8572 . Google Scholar CrossRef Search ADS PubMed Ishii H. , Ishii S. , Suga T. , Kazama M. . 1985 . Developmental changes in the activities of peroxisomal and mitochondrial beta-oxidation in chicken liver . Arch. Biochem. Biophys . 237 : 151 – 159 . Google Scholar CrossRef Search ADS PubMed Jariyahatthakij P. , Chomtee B. , Poeikhampha T. , Loongyai W. , Bunchasak C. . 2016 . Methionine supplementation of low-protein diet and subsequent feeding of low-energy diet on the performance and blood chemical profile of broiler chickens . Anim. Prod. Sci.(Abs). Jiang Q. , Waldroup P. W. , Fritts C. A. . 2005 . Improving the utilization of diets low in crude protein for broiler chicken. 1. Evaluation of special amino acid supplementation to diets low in crude protein . In. J. Poult. Sci . 4 : 115 – 122 . Google Scholar CrossRef Search ADS Kamran Z. , Mirza M. A. , Haq A. U. , Mahmood S. . 2004 . Effects of decreasing dietary protein levels with optimum amino acids profile on the performance of broiler . Pakistan Vet. J. 24 : 165 – 168 . Kamran Z. , Sarwar M. , Nisa M. , Nedeem M. A. , Mahmood S. , Babars M. E. , Ahmed S . 2008 . Effect of low-protein diets having constant energy to protein ratio on performance and carcass characteristics of broiler chickens from one to thirty-five day of age . Poult. Sci . 87 : 468 – 474 . Google Scholar CrossRef Search ADS PubMed Kaneko J. J. 1997 . Serum proteins and the dysproteinemias . In: Kaneko J. J. , Harvey J. W. , Bruss M. L. (eds). Clinical Biochemistry of Domestic Animals , 5th ed . ( San Diego, CA : Academic Press ). Kersten S. 2001 . Mechanisms of nutritional and hormonal regulation of lipogenesis . Embo. Rep. 2 : 282 – 286 . Google Scholar CrossRef Search ADS PubMed Khajali F. , Moghaddam N. , Mesgaran M. D. , Shareghi B. . 2002 . Growth performance and efficiency of nitrogen utilization of broiler as affected by methionine deficiency . Iranian Journal of Agricultural Science and Nature Resource . 9 : 193 – 204 . Kikusato M. , Sudo S. , Toyomizu M. . 2015 . Methionine deficiency leads to hepatic fat accretion via impairment of fatty acid import by carnitine palmitoyltransferase I . Br. Poult. Sci . 56 : 225 – 231 . Google Scholar CrossRef Search ADS PubMed Labadan M. C. Jr. , Hsu K. N. , Austic R. E. . 2001 . Lysine and arginine requirements of broiler chickens at two- to three-week intervals to eight weeks of age . Poult. Sci . 80 : 599 – 606 . Google Scholar CrossRef Search ADS PubMed Lee K. H. , Leeson S. . 2001 . Performance of broilers fed limited quantities of feed or nutrient during seven to fourteen days of age . Poult. Sci . 80 : 446 – 454 . Google Scholar CrossRef Search ADS PubMed Leeson S. , Caston L. , Summers J. D. . 1996 . Broiler response to energy or energy and protein dilution in the finisher diet . Poult. Sci . 75 : 522 – 528 . Google Scholar CrossRef Search ADS PubMed Lien T. F. , Horng Y. M. . 2001 . The effect of supplementary dietary L-carnitine on the growth performance, serum components, carcase traits and enzyme activities in relation to fatty acid beta-oxidation of broiler chickens . Br. Poult. Sci . 42 : 92 – 95 . Google Scholar CrossRef Search ADS PubMed Moran E. T. Jr . 1994 . Response of broiler strains differing in body fat to inadequate methionine: Live performance and processing yields . Poult. Sci. 73 : 1116 – 1126 . Google Scholar CrossRef Search ADS PubMed Namroud N. F. , Shivazad M. , Zaghari M. . 2008 . Effects of fortifying low crude protein diet with crystalline amino acids on performance, blood ammonia level, and excreta characteristics of broiler chicks . Poult. Sci . 87 : 2250 – 2258 . Google Scholar CrossRef Search ADS PubMed Nawaz H. , Mushtaq T. , Yaqoob M. . 2006 . Effect of varying levels of energy and protein on live performance and carcass characteristics of broiler chicks . J. Poult. Sci . 43 : 388 – 393 . Google Scholar CrossRef Search ADS Nukreaw R. , Bunchasak C. . 2015 . Effects on supplementing synthetic amino acids in low-protein diet and subsequent re-feeding on growth performance, serum lipid profile and chemical body composition of broiler chickens . J. Poult. Sci . 52 : 127 – 136 . Google Scholar CrossRef Search ADS Nukreaw R. , Bunchasak C. , Markvichitr K. , Choothesa A. , Prasanpanich S. , Loongyai W. . 2011 . Effects of methionine supplementation in low-protein diets and subsequent re-feeding in growth performance, liver and serum lipid profile, body composition and carcass quality of broiler chickens at 42 days of age . J. Poult. Sci . 48 : 229 – 238 . Google Scholar CrossRef Search ADS Ojano-Dirain C. , Toyomizu M. , Wing T. , Cooper M. , Bottje W. G. . 2007 . Gene expression in breast muscle and duodenum from low and high feed efficient broilers . Poult. Sci . 86 : 372 – 381 . Google Scholar CrossRef Search ADS PubMed Ospina-Rojas I. C. , Murakami A. E. , Duarte C. R. A. , Eyng C. , Oliveira C. A. L. , Janeiro V. . 2014 . Valine, isoleucine, arginine and glycine supplementation of low-protein diets for broiler chickens during the starter and grower phases . Br. Poult. Sci . 55 : 766 – 773 . Google Scholar CrossRef Search ADS PubMed Paik H. S. , Yearick E. S. . 1978 . Influence of dietary and meal frequency on lipoprotein lipase and hormone sensitive lipase in rat adipose tissue . J. Nutr . 108 : 179 – 185 . Google Scholar CrossRef Search ADS Poosuwan K. , Bunchasak C. , Kaewtapee C. . 2008 . Long-term feeding effects of dietary protein levels on egg production, immunocompetence and plasma amino acids of laying hens in subtropical condition . J. Anim. Physiol. Anim. Nutr . 94 : 186 – 195 . Google Scholar CrossRef Search ADS Rakangtong C. , Bunchasak C. . 2011 . Effects of total sulfur amino acids in corn-cassava-soybean diets on growth performance, carcass yield and blood chemical profile of male chickens from 1 to 42 days of age . Anim. Prod. Sci . 51 : 198 – 203 . Google Scholar CrossRef Search ADS Richards M. P. , Poch S. M. , Coon C. N. , Rosebrough R. W. , Ashwell C. M. , McMurtry J. P. . 2003 . Feed restriction significantly alters lipogenic gene exoression in broiler breeder chickens . J. Nutr . 133 : 707 – 715 . Google Scholar CrossRef Search ADS PubMed Rosebrough R. W. , Steele N. C. . 1985 . Energy and protein relationships in broilers: Effect of protein levels and feeding regimens on growth, body composition and in vitro lipogenesis of broiler chicks . Poult. Sci . 64 : 126 – 199 . Saki A. A. , Mohammad Pour H. A. , Ahmdi A. , Akhzar M. T. , Tabatabie M. M. . 2007 . Decreasing broiler crude protein requirement by methionine supplementation . Pakistan J. Biol. Sci . 10 : 757 – 762 . Google Scholar CrossRef Search ADS Schutte J. B. , Pack M. . 1995 . Sulfur amino acid requirement of broiler chicks from fourteen to thirty-eight days of age. 1. Performance and carcass yield . Poult. Sci . 74 : 480 – 487 . Google Scholar CrossRef Search ADS PubMed Si J. , Fritts C. A. , Burnham D. J. , Waldroup P. W. . 2001 . Relationship of dietary lysine level to the concentration of all essential amino acids in broiler diets . Poult. Sci . 80 : 1472 – 1479 . Google Scholar CrossRef Search ADS PubMed Skiba-Cassy S. , Collin A. , Chartrin P. , Medale F. , Simon J. , Duclos M. J. , Tesseraud S. . 2007 . Chicken liver and muscle carnitine palmitoyltransferase 1: Nutritional regula- tion of messengers . Comparative Biochemistry and Physiology Part B. Biochem. Mol. Biol . 147 : 278 – 287 . Google Scholar CrossRef Search ADS Swennen Q. , Janssens G. P. J. , Collin A. , Bihan-Duval E. L. , Verbeke K. , Decuypere E. , Buyse J. . 2006 . Diet-induced thermogenesis and glucose oxidation in broiler chickens: Influence of genotype and diet composition . Poult. Sci . 85 : 731 – 742 . Google Scholar CrossRef Search ADS PubMed Swennen Q. , Janssens G. P. J. , Decuypere E. , Buyse J. . 2004 . Effects of substitution between fat and protein on feed intake and its regulatory mechanisms in broiler chickens: Energy and protein metabolism and diet-induced thermogenesis . Poult. Sci . 83 : 1997 – 2004 . Google Scholar CrossRef Search ADS PubMed Tewe O. O. 1985 . Protein metabolism in growing pigs fed corn or cassava peel based diets containing graded protein levels . Res. Vet. Sci. 29 : 259 – 263 . Tian J. , Wang S. , Wang Q. , Leng L. , Hu X. , Li H. . 2010 . A single nucleotide polymorphism of chicken acetyl CoA carboxylase A gene associated with fatness trials . Anim. Biotech. 21 : 42 – 50 . Google Scholar CrossRef Search ADS Toyomizu M. , Ueda M. , Sato S. , Seki Y. , Sato K. , Akiba Y. . 2002 . Cold-induced mitochondrial uncoupling and expression of chicken UCP and ANT mRNA in chicken skeletal muscle . FEBS Lett . 529 : 313 – 318 . Google Scholar CrossRef Search ADS PubMed Toyomizu M. , Abe T. , Ueda M. , Akiba Y. . 2006 . Progressive alteration of UCP and ANT in skeletal muscle of fasted chicken . J. Poult. Sci . 43 : 167 – 172 . Google Scholar CrossRef Search ADS Tu Y. , Su Y. , Li G. , Zhang X. , Tong H. 2016 . Expression of lipid metabolism-associated genes in male and female white feather chicken . J. Poult. Sci. 53 : 118 – 123 . Google Scholar CrossRef Search ADS Wegner M. S. , Kelley J. L. , Nelson E. C. , Alaupovic P. , Thayer R. H. . 1978 . Lipid metabolism in laying hen: the relationship of plasma lipid and liver fatty acid synthetase activity to changes in liver composition . Poult. Sci . 25 : 573 – 582 . Yamazaki M. , Murakami H. , Nakashima K. , Abe H. , Takemasa M. . 2006 . Effects of excess essential amino acids in low protein diet on abdominal fat deposition and nitrogen excretion of the broiler chicks . J. Poult. Sci . 43 : 150 – 155 . Google Scholar CrossRef Search ADS Yang X. , Zhuang J. , Rao K. , Li X. , Zhao R. . 2010 . Effect of early feed restriction on hepatic lipid metabolism and expression of lipogenic genes in broiler chickens . Res. Vet. Sci . 89 : 438 – 444 . Google Scholar CrossRef Search ADS PubMed Yang Y. X. , Guo J. , Yoon S. Y. , Jin Z. , Choi J. Y. , Piao X. S. , Kim B. W. , Ohh S. J. , Wang M. H. , Chae B. J. . 2009 . Early energy and protein reduction: Effects on growth, blood profiles and expression of genes related to protein and fat metabolism in broilers . Br. Poult. Sci . 50 : 218 – 227 . Google Scholar CrossRef Search ADS PubMed Zhan X. A. , Wang M. , Ren H. , Zhao R. Q. , Li J. X. , Tan Z. L. . 2007 . Effect of early feed restriction on metabolic programming and compensatory growth in broiler chickens . Poult. Sci . 86 : 654 – 660 . Google Scholar CrossRef Search ADS PubMed Zubair A. K. , Leeson S. . 1996 . Compensatory growth in the broiler chicken: A review . World's Poult. Sci . 52 : 189 – 182 Google Scholar CrossRef Search ADS © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Effects of adding methionine in low-protein diet and subsequently fed low-energy diet on productive performance, blood chemical profile, and lipid metabolism-related gene expression of broiler chickens

Loading next page...
 
/lp/ou_press/effects-of-adding-methionine-in-low-protein-diet-and-subsequently-fed-yPSjz7FvmG
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pey034
Publisher site
See Article on Publisher Site

Abstract

ABSTRACT This study was conducted to evaluate the effects of supplementing methionine (Met) in a low-protein (Low-CP) diet during d 11 to 24 and subsequently feeding with a low-metabolizable energy diet (Low-ME; -75 kcal/kg) or a normal ME diet during d 25 to 42 on the productive performance, blood chemical profile, and lipid metabolism-related gene expression of broiler chickens. The 1,600 broiler chicks were divided into 5 groups as follows: 1) Normal CP, then Normal ME; 2) Low-CP, then Normal ME; 3) Low-CP, then Low-ME; 4) Low-CP+Met, then Normal ME; and 5) Low-CP+Met, then Low-ME. During d 11 to 24, the growth performance of the control group was better than those of the other groups (P < 0.01). In Low-CP diets, the addition of Met resulted in an improvement in the growth performance, breast meat yield, protein conversion ratio, plasma total protein, and albumin (P < 0.01). Moreover, the supplementation significantly increased the plasma triglyceride content (P < 0.01). Feeding Low-CP or Low-CP+Met diets increased the abdominal fat content compared to the control group (P < 0.01). Feeding the Low-CP+Met, then Normal ME (d 25 to 42) resulted in compensation in the feed conversion ratio (FCR), protein conversion ratio, and energy conversion ratio equal to or better than the control group (P < 0.01). The body weights of birds fed Low-CP diets were still inferior to the control group (P < 0.01), except in the Low-CP+Met group followed by the normal ME diet. Feeding with the Low-ME diet tended to decrease the expression of the carnitine palmitoyl transferase I gene in the liver (P = 0.08). In conclusion, supplementing Met in the Low-CP diet during the grower period and subsequently feeding with a control diet improved the feed and protein conversion ratios, reduced fat accumulation, and reduced the production cost of broiler chickens with regard to fat deposition compared to the control diet. INTRODUCTION Dietary energy and protein clearly affect the growth performance, production cost, and chemical body composition of broiler chickens (Collin et al., 2003; Kamran et al., 2004; Nawaz et al., 2006). Generally, feeding a low-crude protein (Low-CP) diet increases the fat content, while reducing the energy density decreases the fat content and increases protein deposition in the carcass (Lee and Leeson, 2001; Zhan et al., 2007). On the other hand, lowering the dietary protein concentration in a broiler diet commonly reduces the feed cost (Cauwenbreghe and Burnham, 2001; Kamran et al., 2008) and increases protein utilization (Yang et al., 2009). Adding synthetic amino acids prevents some negative effects of feeding Low-CP diets (Ospina-Rojas et al., 2014; Nukreaw and Bunchasak, 2015; Jariyahatthakij et al., 2016). However, a reduction of CP greater than 3% (meeting all essential amino acids requirement) still results in poor productive performance and carcass quality (Jiang et al., 2005; Dean et al., 2006; Namroud et al., 2008; Nukreaw et al., 2011) and high fat deposition (Yamazaki et al., 2006; Namroud et al., 2008; Abdel-Maksoud et al., 2010; Nukreaw et al., 2011) of broiler chickens. Chickens receiving a Low-CP diet require higher lysine and methionine (Met) compared to conventional diets (Labadan et al., 2001). Nukreaw et al. (2011) and more recently, Jariyahatthakij et al. (2016) suggested that reducing the dietary CP level by 3% with amino acids supplementation during the grower period, followed by a control or low-energy diet, could improve overall protein utilization and reduce fat accumulation via increasing lipolysis and/or disruption of triglyceride transportation in broiler chickens. Understanding the mechanism and factors involved in this improvement requires focusing on gene expression related to lipids and energy metabolism. It is generally known that acetyl CoA carboxylase (ACC), carnitine palmitoyl transferase (CPT-I), and avian adenine nucleotide translocator (avANT) are involved in the hepatic response to nutritional intervention (Hillgartner et al., 1996; Daval et al., 2000; Abe et al., 2006). The ACC gene could be a candidate gene or linked with a major gene that affects abdominal fat content (Richards et al., 2003; Tian et al., 2010), while fasting increases liver CPT-I gene expression in the chicken (Skiba-Cassy et al., 2007). Fasting also increases avANT gene expression due to the increase of ATP/ADP exchange via mitochondrial ATP export and ADP import (Toyomizu et al., 2002, 2006). Therefore, this study was conducted to determine the effect of supplemental Met in a Low-CP diet during the grower period (age 11 to 24 d) followed by a lower energy density diet during the finisher period (25 to 42 d) on the productive performance and gene expression in relation to the lipid and energy metabolism of broiler chickens. MATERIALS AND METHODS Animals And Management The experimental animals were kept, maintained, and treated in adherence with accepted standards for the humane treatment of animals according to the ethical committee of Kasetsart University. In total, 1,600 commercial male broiler chicks (Ross 308) were used from 11 to 42 d using a randomized complete block design (RCBD; 8 replicates and 8 blocks). At 10 d of age, the broiler chickens were randomized and divided into 5 experimental groups with 8 blocks per treatment (40 birds/pen). The chicks were kept in an evaporative cooling house system with a floor pen (0.12 m2/bird), and rice husks were used as bedding. Drinking water and feed were provided using a nipple drinker line (9 nipples per pen) and a tube feeder (70 birds/tube feeder), respectively. The broiler chickens were allowed access to water and feed ad libitum throughout the experimental period. Experimental diets were provided in pellet form (sieved crumbs for 0 to 10 d and 3.5 mm diameter pellets for 11 to 42 d). The temperature was around 32°C at hatching and then was decreased by 1°C every 3 d until a final temperature of 25°C was reached. The lighting regime consisted of 23 h of light and 1 h of darkness. Chicks were vaccinated at the hatchery for Newcastle disease and infectious bronchitis. Experimental Diets The chicks were divided into 5 groups according to the experimental diets, with each group consisting of 8 blocks with 40 chicks per block. The chicks were fed diets as follows: Normal CP, then Normal ME (Trt A); (21% CP and 3,175 ME kcal/kg for age 11 to 24 d, and 19% CP and 3,225 ME kcal/kg for age 25 to 42 d); all nutrient requirements were formulated according to the recommendations for the strain. Low-CP, then Normal ME (Trt B); the chicks were fed a Low-CP diet (18% CP and 3,175 ME kcal/kg) deficient in Met for age 11 to 24 d, followed by a normal ME (3,225 ME kcal/kg) diet for 25 to 42 d of age. Low-CP, then Low-ME (Trt C); the chicks were fed a Low-CP diet (18% CP and 3,175 ME kcal/kg) deficient in Met for age 11 to 24 d, then re-fed with a low energy (Low-ME; -75 ME kcal/kg) diet for 25 to 42 d of age. Low-CP+Met, then Normal ME (Trt D); the chicks were fed a Low-CP diet (18% CP and 3,175 ME kcal/kg) with sufficient in Met for age 11 to 24 d, then re-fed with a normal ME (3,225 ME kcal/kg) diet for 25 to 42 d of age. Low-CP+Met, then Low-ME (Trt E); the chicks were fed a Low-CP diet (18% CP and 3,175 ME kcal/kg) with sufficient in Met for age 11 to 24 d, then re-fed with a Low-ME (-75 ME kcal/kg) diet for 25 to 42 d of age. The feed and nutrient compositions of each experimental diet are shown in Table 1. All diets were analyzed for protein by Kjeldahl proceduce (N × 6.25) as described in AOAC official method 981.10 (Association of Official Analytical Chemists, 2016). The amino acid composition of the basal diet in both the grower and finisher periods was analyzed by ion-exchange chromatography using the Amino Acids Analyzer (AminoTac JEOL model JLC-500/v JEOL Ltd, Tokyo, Japan) with ninhydrin derivatization according to the instructions of the manufacturer (JEOL (Europe) Croissy sur Seine, France). Table 1. Composition and nutritional content of experimental diets. Grower period (age 11 to 24 d) Finisher period (age 25 to 42 d) Item Control (21% CP) Low-CP (18% CP) Low-CP+Met (18% CP) Normal ME Low-ME (-75 kcal/kg) Ingredient (%) Corn 55.40 63.48 63.48 60.46 62.15 Rice bran oil 4.00 3.09 3.09 3.22 1.79 Soybean meal 34.17 26.48 26.48 25.40 25.13 Full-fat soybean 2.00 2.00 2.00 7.00 7.00 Monodicalcium phosphate 21% 1.84 1.90 1.90 1.72 1.72 Limestone 1.26 1.29 1.29 1.21 1.21 Salt 0.33 0.22 0.22 0.22 0.22 L-Lysine 0.10 0.36 0.36 - 0.01 DL-MethionineB 0.29 - 0.37 0.19 0.18 L-Threonine - 0.12 0.12 - - Vitamin and trace mineral PremixA 0.50 0.50 0.50 0.50 0.50 AnticoccidialC 0.05 0.05 0.05 0.05 0.05 AntioxidantD 0.05 0.05 0.05 0.05 0.05 Corn starch - 0.47 0.10 - - Total 100 100 100 100 100 Nutrients by calculation (analysis)E Protein (%) 21.00 (22.36) 18.00 (17.58) 18.00 19.00 (19.20) 19.00 Energy (ME kcal/kg) 3175 3175 3175 3225 3150 Energy: protein ratio 151 176 176 170 166 Fat (%) 6.94 6.21 6.21 7.19 5.85 Calcium (%) 0.90 0.90 0.90 0.85 0.85 Non-phytate phosphorus (%) 0.45 0.45 0.45 0.42 0.42 Salt (%) 0.39 0.28 0.28 0.28 0.28 Lysine (%) 1.23(1.16) 1.23 (1.15) 1.23 1.02 (1.10) 1.02 Total sulfur amino acid (%) 0.95 (0.77) 0.59 (0.61) 0.95 0.80 (0.76) 0.80 Methionine (%) 0.61 (0.50) 0.29 (0.31) 0.65 0.48 (0.46) 0.48 Threonine (%) 0.81 (0.73) 0.80 (0.67) 0.80 0.73 (0.71) 0.73 Tryptophan (%) 0.26 (0.22) 0.22 (0.18) 0.28 0.23 (0.21) 0.23 Arginine (%) 1.45 (1.37) 1.22 (1.13) 1.21 1.29 (1.36) 1.29 Isoleucine (%) 0.94 (0.79) 0.79 (0.65) 0.79 0.84 (0.79) 0.84 Valine (%) 1.02 (1.06) 0.88 (0.87) 0.88 0.93 (1.05) 0.93 Feed cost/kg (THB)* 14.99 14.05 14.59 14.50 14.06 Grower period (age 11 to 24 d) Finisher period (age 25 to 42 d) Item Control (21% CP) Low-CP (18% CP) Low-CP+Met (18% CP) Normal ME Low-ME (-75 kcal/kg) Ingredient (%) Corn 55.40 63.48 63.48 60.46 62.15 Rice bran oil 4.00 3.09 3.09 3.22 1.79 Soybean meal 34.17 26.48 26.48 25.40 25.13 Full-fat soybean 2.00 2.00 2.00 7.00 7.00 Monodicalcium phosphate 21% 1.84 1.90 1.90 1.72 1.72 Limestone 1.26 1.29 1.29 1.21 1.21 Salt 0.33 0.22 0.22 0.22 0.22 L-Lysine 0.10 0.36 0.36 - 0.01 DL-MethionineB 0.29 - 0.37 0.19 0.18 L-Threonine - 0.12 0.12 - - Vitamin and trace mineral PremixA 0.50 0.50 0.50 0.50 0.50 AnticoccidialC 0.05 0.05 0.05 0.05 0.05 AntioxidantD 0.05 0.05 0.05 0.05 0.05 Corn starch - 0.47 0.10 - - Total 100 100 100 100 100 Nutrients by calculation (analysis)E Protein (%) 21.00 (22.36) 18.00 (17.58) 18.00 19.00 (19.20) 19.00 Energy (ME kcal/kg) 3175 3175 3175 3225 3150 Energy: protein ratio 151 176 176 170 166 Fat (%) 6.94 6.21 6.21 7.19 5.85 Calcium (%) 0.90 0.90 0.90 0.85 0.85 Non-phytate phosphorus (%) 0.45 0.45 0.45 0.42 0.42 Salt (%) 0.39 0.28 0.28 0.28 0.28 Lysine (%) 1.23(1.16) 1.23 (1.15) 1.23 1.02 (1.10) 1.02 Total sulfur amino acid (%) 0.95 (0.77) 0.59 (0.61) 0.95 0.80 (0.76) 0.80 Methionine (%) 0.61 (0.50) 0.29 (0.31) 0.65 0.48 (0.46) 0.48 Threonine (%) 0.81 (0.73) 0.80 (0.67) 0.80 0.73 (0.71) 0.73 Tryptophan (%) 0.26 (0.22) 0.22 (0.18) 0.28 0.23 (0.21) 0.23 Arginine (%) 1.45 (1.37) 1.22 (1.13) 1.21 1.29 (1.36) 1.29 Isoleucine (%) 0.94 (0.79) 0.79 (0.65) 0.79 0.84 (0.79) 0.84 Valine (%) 1.02 (1.06) 0.88 (0.87) 0.88 0.93 (1.05) 0.93 Feed cost/kg (THB)* 14.99 14.05 14.59 14.50 14.06 AVitamin and trace mineral premix content (per kg of feed): Vitamin A 12,000 IU, vitamin D 3,000 IU, vitamin E 15 IU, vitamin K 1.5 mg, thiamine 1.5 mg, riboflavin 5 mg, pyridoxine 2 mg, niacin 25 mg, vitamin B12 0.05 mg, pantothenic acid 8 mg, folic acid 3 mg, biotin 0.12 mg, manganese 80 mg, zinc 60 mg, iron 40 mg, copper 8 mg, iodine 0.50 mg, selenium 0.1 mg, cobalt 0.1 mg. BSupplied by Sumitomo Chemical, Tokyo, Japan. CSalinomycin sodium. DButylated hydroxy toluene and ethoxyquin. EValues in parentheses refer to analyzed values. *Cost based on ingredient prices as of May 2016 for Thailand, THB = Thai bath. View Large Table 1. Composition and nutritional content of experimental diets. Grower period (age 11 to 24 d) Finisher period (age 25 to 42 d) Item Control (21% CP) Low-CP (18% CP) Low-CP+Met (18% CP) Normal ME Low-ME (-75 kcal/kg) Ingredient (%) Corn 55.40 63.48 63.48 60.46 62.15 Rice bran oil 4.00 3.09 3.09 3.22 1.79 Soybean meal 34.17 26.48 26.48 25.40 25.13 Full-fat soybean 2.00 2.00 2.00 7.00 7.00 Monodicalcium phosphate 21% 1.84 1.90 1.90 1.72 1.72 Limestone 1.26 1.29 1.29 1.21 1.21 Salt 0.33 0.22 0.22 0.22 0.22 L-Lysine 0.10 0.36 0.36 - 0.01 DL-MethionineB 0.29 - 0.37 0.19 0.18 L-Threonine - 0.12 0.12 - - Vitamin and trace mineral PremixA 0.50 0.50 0.50 0.50 0.50 AnticoccidialC 0.05 0.05 0.05 0.05 0.05 AntioxidantD 0.05 0.05 0.05 0.05 0.05 Corn starch - 0.47 0.10 - - Total 100 100 100 100 100 Nutrients by calculation (analysis)E Protein (%) 21.00 (22.36) 18.00 (17.58) 18.00 19.00 (19.20) 19.00 Energy (ME kcal/kg) 3175 3175 3175 3225 3150 Energy: protein ratio 151 176 176 170 166 Fat (%) 6.94 6.21 6.21 7.19 5.85 Calcium (%) 0.90 0.90 0.90 0.85 0.85 Non-phytate phosphorus (%) 0.45 0.45 0.45 0.42 0.42 Salt (%) 0.39 0.28 0.28 0.28 0.28 Lysine (%) 1.23(1.16) 1.23 (1.15) 1.23 1.02 (1.10) 1.02 Total sulfur amino acid (%) 0.95 (0.77) 0.59 (0.61) 0.95 0.80 (0.76) 0.80 Methionine (%) 0.61 (0.50) 0.29 (0.31) 0.65 0.48 (0.46) 0.48 Threonine (%) 0.81 (0.73) 0.80 (0.67) 0.80 0.73 (0.71) 0.73 Tryptophan (%) 0.26 (0.22) 0.22 (0.18) 0.28 0.23 (0.21) 0.23 Arginine (%) 1.45 (1.37) 1.22 (1.13) 1.21 1.29 (1.36) 1.29 Isoleucine (%) 0.94 (0.79) 0.79 (0.65) 0.79 0.84 (0.79) 0.84 Valine (%) 1.02 (1.06) 0.88 (0.87) 0.88 0.93 (1.05) 0.93 Feed cost/kg (THB)* 14.99 14.05 14.59 14.50 14.06 Grower period (age 11 to 24 d) Finisher period (age 25 to 42 d) Item Control (21% CP) Low-CP (18% CP) Low-CP+Met (18% CP) Normal ME Low-ME (-75 kcal/kg) Ingredient (%) Corn 55.40 63.48 63.48 60.46 62.15 Rice bran oil 4.00 3.09 3.09 3.22 1.79 Soybean meal 34.17 26.48 26.48 25.40 25.13 Full-fat soybean 2.00 2.00 2.00 7.00 7.00 Monodicalcium phosphate 21% 1.84 1.90 1.90 1.72 1.72 Limestone 1.26 1.29 1.29 1.21 1.21 Salt 0.33 0.22 0.22 0.22 0.22 L-Lysine 0.10 0.36 0.36 - 0.01 DL-MethionineB 0.29 - 0.37 0.19 0.18 L-Threonine - 0.12 0.12 - - Vitamin and trace mineral PremixA 0.50 0.50 0.50 0.50 0.50 AnticoccidialC 0.05 0.05 0.05 0.05 0.05 AntioxidantD 0.05 0.05 0.05 0.05 0.05 Corn starch - 0.47 0.10 - - Total 100 100 100 100 100 Nutrients by calculation (analysis)E Protein (%) 21.00 (22.36) 18.00 (17.58) 18.00 19.00 (19.20) 19.00 Energy (ME kcal/kg) 3175 3175 3175 3225 3150 Energy: protein ratio 151 176 176 170 166 Fat (%) 6.94 6.21 6.21 7.19 5.85 Calcium (%) 0.90 0.90 0.90 0.85 0.85 Non-phytate phosphorus (%) 0.45 0.45 0.45 0.42 0.42 Salt (%) 0.39 0.28 0.28 0.28 0.28 Lysine (%) 1.23(1.16) 1.23 (1.15) 1.23 1.02 (1.10) 1.02 Total sulfur amino acid (%) 0.95 (0.77) 0.59 (0.61) 0.95 0.80 (0.76) 0.80 Methionine (%) 0.61 (0.50) 0.29 (0.31) 0.65 0.48 (0.46) 0.48 Threonine (%) 0.81 (0.73) 0.80 (0.67) 0.80 0.73 (0.71) 0.73 Tryptophan (%) 0.26 (0.22) 0.22 (0.18) 0.28 0.23 (0.21) 0.23 Arginine (%) 1.45 (1.37) 1.22 (1.13) 1.21 1.29 (1.36) 1.29 Isoleucine (%) 0.94 (0.79) 0.79 (0.65) 0.79 0.84 (0.79) 0.84 Valine (%) 1.02 (1.06) 0.88 (0.87) 0.88 0.93 (1.05) 0.93 Feed cost/kg (THB)* 14.99 14.05 14.59 14.50 14.06 AVitamin and trace mineral premix content (per kg of feed): Vitamin A 12,000 IU, vitamin D 3,000 IU, vitamin E 15 IU, vitamin K 1.5 mg, thiamine 1.5 mg, riboflavin 5 mg, pyridoxine 2 mg, niacin 25 mg, vitamin B12 0.05 mg, pantothenic acid 8 mg, folic acid 3 mg, biotin 0.12 mg, manganese 80 mg, zinc 60 mg, iron 40 mg, copper 8 mg, iodine 0.50 mg, selenium 0.1 mg, cobalt 0.1 mg. BSupplied by Sumitomo Chemical, Tokyo, Japan. CSalinomycin sodium. DButylated hydroxy toluene and ethoxyquin. EValues in parentheses refer to analyzed values. *Cost based on ingredient prices as of May 2016 for Thailand, THB = Thai bath. View Large For the Low-CP and Low-CP+Met diets, synthetic L-Lysine-HCl and L-Threonine were supplemented to meet the requirements of the strain recommendations (Aviagen, 2007). In order to induce an amino acid imbalance [decreased ratio of total sulfur amino acid (TSAA)/lysine], Met and TSAA deficiencies were formulated in the Low-CP diet (Supplemental Table). Growth Performance And Carcass Quality The feed intake, feed conversion ratio (FCR), average daily gain (ADG), protein, and energy intake during each period (11 to 24 and 25 to 42 d of age) and for the overall period (age 11 to 42 d) were determined. The body weight, feed intake, protein intake, and energy intake were determined at the end of each period and used to calculate the FCR, protein conversion ratio, energy conversion ratio, and feed cost per body weight gain (FCG). Mortality was checked twice daily, all chickens that died were weighed, and the weight was used to adjust feed conversion [FCR: g of feed consumed/(weight of live birds + weight of dead birds)]. The protein conversion ratio was calculated from the amount of protein consumed divided by the weight gain (protein intake/weight gain), and the energy conversion ratio was calculated using the amount of energy consumed divided by the weight gain (energy intake/weight gain). FCG was calculated as feed consumption per feeding period per chicken (g), divided by body weight gain (g), multiplied by feed cost (Thai baht). At 24 and 42 d of age, before the sampling processes, the experimental diets were removed for 12 hours. Four chickens from each replication (32 chickens/group) that had a body weight close to the group mean were chosen and killed using CO2 asphyxiation in an atmosphere of less than 2% oxygen (air displaced by CO2) for 1.5 to 2.0 minutes. The carcass yield was obtained by weighing the birds after they had been fasted for 12 h, bled, scalded, plucked, and manually eviscerated. The eviscerated carcass, breast meat yields (pectoralis major and minor muscles), drumsticks, thighs, and abdominal fat, including fat surrounding the gizzard, were determined from the live weights of the broilers selected for processing (Cabel et al., 1987). Blood Chemical Profile At 24 and 42 d of age, 16 chickens per group (2 chickens/replicate) were weighed and punctured at the wing vein to obtain a blood sample for chemical analysis. After collection, an aliquot of the blood sample was transferred into plastic vials containing EDTA as an anticoagulant, and the plasma was separated from the blood by centrifugation at 3,000 × g for 10 min at room temperature. The samples were stored at –20°C until further analysis. Frozen plasma samples of all chickens were thawed at room temperature (25°C) for determination of levels of total cholesterol (TC), total protein, triglyceride (TG), uric acid, albumin and non-esterified fatty acid (NEFA). Total cholesterol, total protein, TG, uric acid, and the albumin concentration were analyzed using the enzymatic colorimetric method (assay kit, HUMAN Gesellschaft für Biochemica und Diagnostic Co., Ltd, Max-planck-Ring21, D65205, Wiesbaden, Germany). The NEFA concentration was determined using the enzymatic colorimetric method (test kits from Randox Laboratories Ltd, London, United Kingdom). Gene Expression At 42 d of age, 4 chickens per treatment that had a body weight close to the group mean were chosen and put down using CO2 asphyxiation in an atmosphere of less than 2% oxygen (air displaced by CO2) for 1.5 to 2.0 min. Subsequently, the liver of each chicken was rapidly dissected and immediately placed in an appropriate volume of RNAlater stabilization reagent (Qiagen, Clifton Hill, Victoria, Australia) and stored at –80°C until RNA isolation. Quantitative Rt-Pcr Gene expression of CPT-I, ACC, and avANT was assessed using 2-step quantitative real-time reverse transcription-PCR (RT-PCR). The total RNA was extracted from the liver using TRIzol reagent (Qiagen, Hilden, Germany) following the manufacturer's instructions. Two micrograms of total RNA was reverse-transcribed to cDNA using an Omniscript Reverse Transcription Kit (Qiagen, Germany) following the manufacturer's instructions. All the RT-PCR reactions were carried out in 48-well plates at a final volume of 20 μL of SYBR green real-time PCR Master Mix Plus (Solis BioDyne, Tartu, Estonia) using a RT-PCR detection system (Eco system, PCRmax, Staffordshire, United Kingdom). The oligonucleotide sequences of sense and antisense primers are shown in Table 2. All measurements were carried out in triplicate, and average values were obtained. Temperature cycles are as follows: denaturation at 95°C for 15 min, 40 cycles of amplification at 95°C for 15 s, 68°C for 20 s, 72°C for 15 s, and melting curve analysis at 95°C for 1 second. A standard curve was quantified from the standard calibration curves run simultaneously with the samples. All quantifications used β-actin mRNA as the internal control, and a negative control (no sample) also was used for each primer set. The values were normalized with mRNA expression of β-actin and expressed as the ratio of β-actin mRNA values in arbitrary units. Table 2. Primer design for genes analyzed using real-time PCR. Gene1 Accession Number2 Primer sequence (5’-3’) Orientation Product size (bp) ACC J03541 CACTTCGAGGCGAAAAACTC Forward 447 GGAGCAAATCCATGACCACT Reverse avANT AB088686 TGTGGCTGGTGTGGTTTCCTA Forward 67 GCGTCCTGACTGCATCATCA Reverse CPT-I AY675193 CAATGCGGTACTCCCTGAAA Forward 337 CATTATTGGTCCACGCCCTC Reverse β-Actin L08165 TGCGTGACATCAAGGAGAAG Forward 300 TGCCAGGGTACATTGTGGTA Reverse Gene1 Accession Number2 Primer sequence (5’-3’) Orientation Product size (bp) ACC J03541 CACTTCGAGGCGAAAAACTC Forward 447 GGAGCAAATCCATGACCACT Reverse avANT AB088686 TGTGGCTGGTGTGGTTTCCTA Forward 67 GCGTCCTGACTGCATCATCA Reverse CPT-I AY675193 CAATGCGGTACTCCCTGAAA Forward 337 CATTATTGGTCCACGCCCTC Reverse β-Actin L08165 TGCGTGACATCAAGGAGAAG Forward 300 TGCCAGGGTACATTGTGGTA Reverse 1ACC = acetyl-CoA carboxylase; avANT = avian adenine nucleotide translocator; CPT-I = carnitine palmitoyl CoA transferase I. 2GenBank accession number. View Large Table 2. Primer design for genes analyzed using real-time PCR. Gene1 Accession Number2 Primer sequence (5’-3’) Orientation Product size (bp) ACC J03541 CACTTCGAGGCGAAAAACTC Forward 447 GGAGCAAATCCATGACCACT Reverse avANT AB088686 TGTGGCTGGTGTGGTTTCCTA Forward 67 GCGTCCTGACTGCATCATCA Reverse CPT-I AY675193 CAATGCGGTACTCCCTGAAA Forward 337 CATTATTGGTCCACGCCCTC Reverse β-Actin L08165 TGCGTGACATCAAGGAGAAG Forward 300 TGCCAGGGTACATTGTGGTA Reverse Gene1 Accession Number2 Primer sequence (5’-3’) Orientation Product size (bp) ACC J03541 CACTTCGAGGCGAAAAACTC Forward 447 GGAGCAAATCCATGACCACT Reverse avANT AB088686 TGTGGCTGGTGTGGTTTCCTA Forward 67 GCGTCCTGACTGCATCATCA Reverse CPT-I AY675193 CAATGCGGTACTCCCTGAAA Forward 337 CATTATTGGTCCACGCCCTC Reverse β-Actin L08165 TGCGTGACATCAAGGAGAAG Forward 300 TGCCAGGGTACATTGTGGTA Reverse 1ACC = acetyl-CoA carboxylase; avANT = avian adenine nucleotide translocator; CPT-I = carnitine palmitoyl CoA transferase I. 2GenBank accession number. View Large Statistical Analysis All data were statistically analyzed using analysis of variance (ANOVA) in SAS version 9. Significant differences among the treatment group means were evaluated using Duncan's multiple range test (Duncan, 1955). Only differences with P-values ≤ 0.05 were considered significant. To determine the effect of CP, ME, and Met during the grower and finisher periods, appropriated treatment means were grouped and compared using orthogonal contrast analysis. RESULTS AND DISCUSSION Growth Performance The effects of adding Met in a Low-CP diet during the grower period (11 to 24 d of age) on the productive performance of broiler chickens are presented in Table 3. Among the experimental groups, the Trt A showed the best productive performance (P < 0.01). The body weight, ADG, FCR, energy conversion ratio, and FCG of chickens fed the Trt B and C were the poorest (P < 0.01), whereas Trt D and E improved the growth rate and FCR. Feeding the Trt D and E diet has better protein conversion ratio than the Trt A and the Trt B and C groups (P < 0.01). There was no significant effect of experimental diet on the feed and energy intake, but lowering the CP level in the diet decreased the protein intake of the birds (P < 0.01). Considering the economics, the FCG values of birds fed the Trt B and C were more costly than those of the Trt A and the Trt D and E groups (P < 0.01). Table 3. Growth performance of broiler chickens fed a low-CP diet with or without sufficient Met from 11 to 24 d of age. Control Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, then Normal then Low then Normal then Low-ME Item (Trt A) ME (Trt B) -ME (Trt C) ME (Trt D) (Trt E) s.e.m.1 P-value Initial weight (g/chick) 233.140 235.466 233.596 233.338 236.355 1.174 0.87 Body weight (g/chick) 1132.930 A 981.633C 982.519C 1082.850B 1082.340B 11.162 <0.01 ADG2 64.271A 53.298C 53.496C 60.678B 60.428B 0.795 <0.01 Feed intake (g/chick) 1188.940 1202.490 1235.580 1203.590 1178.630 10.276 0.52 Met intake (g/chick) 7.251B 3.440C 3.535C 7.835A 7.674A 0.327 <0.01 TSAA intake (g/chick) 11.294A 7.046B 7.241B 11.435A 11.198A 0.336 <0.01 FCR3 1.321C 1.614A 1.653A 1.416B 1.395B,C 0.024 <0.01 Protein intake (g/chick) 249.678A 216.449B 222.406B 216.645B 212.155B 2.821 <0.01 Energy intake (kcal/chick) 3774.870 3817.910 3922.970 3821.400 3742.160 32.625 0.52 Protein conversion ratio4 0.279B 0.291A,B 0.298A 0.255C 0.251C 0.004 <0.01 Energy conversion ratio5 4.199C 5.128A 5.245A 4.498B 4.425B,C 0.077 <0.01 FCG (baht/kg)6 19.825B 22.691A 23.205A 20.673B 20.335B 0.281 <0.01 Total feed cost (baht/chicken) 17.823 16.895 17.359 17.559 17.195 0.150 0.39 Probability levels of contrast Body Feed Met TSAA Protein Energy Protein Energy Total weight ADG intake intake Intake FCR intake intake conversion conversion FCG feed Contrast statement ratio ratio cost Control vs. Low-CP <0.01 <0.01 0.31 <0.01 <0.01 <0.01 <0.01 0.31 0.01 <0.01 <0.01 0.11 Control vs. Low-CP+Met <0.01 <0.01 0.94 <0.01 0.92 0.02 <0.01 0.94 <0.01 0.02 0.18 0.29 Low-CP vs. Low-CP+Met <0.01 <0.01 0.25 <0.01 <0.01 <0.01 0.26 0.25 <0.01 <0.01 <0.01 0.47 Control Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, then Normal then Low then Normal then Low-ME Item (Trt A) ME (Trt B) -ME (Trt C) ME (Trt D) (Trt E) s.e.m.1 P-value Initial weight (g/chick) 233.140 235.466 233.596 233.338 236.355 1.174 0.87 Body weight (g/chick) 1132.930 A 981.633C 982.519C 1082.850B 1082.340B 11.162 <0.01 ADG2 64.271A 53.298C 53.496C 60.678B 60.428B 0.795 <0.01 Feed intake (g/chick) 1188.940 1202.490 1235.580 1203.590 1178.630 10.276 0.52 Met intake (g/chick) 7.251B 3.440C 3.535C 7.835A 7.674A 0.327 <0.01 TSAA intake (g/chick) 11.294A 7.046B 7.241B 11.435A 11.198A 0.336 <0.01 FCR3 1.321C 1.614A 1.653A 1.416B 1.395B,C 0.024 <0.01 Protein intake (g/chick) 249.678A 216.449B 222.406B 216.645B 212.155B 2.821 <0.01 Energy intake (kcal/chick) 3774.870 3817.910 3922.970 3821.400 3742.160 32.625 0.52 Protein conversion ratio4 0.279B 0.291A,B 0.298A 0.255C 0.251C 0.004 <0.01 Energy conversion ratio5 4.199C 5.128A 5.245A 4.498B 4.425B,C 0.077 <0.01 FCG (baht/kg)6 19.825B 22.691A 23.205A 20.673B 20.335B 0.281 <0.01 Total feed cost (baht/chicken) 17.823 16.895 17.359 17.559 17.195 0.150 0.39 Probability levels of contrast Body Feed Met TSAA Protein Energy Protein Energy Total weight ADG intake intake Intake FCR intake intake conversion conversion FCG feed Contrast statement ratio ratio cost Control vs. Low-CP <0.01 <0.01 0.31 <0.01 <0.01 <0.01 <0.01 0.31 0.01 <0.01 <0.01 0.11 Control vs. Low-CP+Met <0.01 <0.01 0.94 <0.01 0.92 0.02 <0.01 0.94 <0.01 0.02 0.18 0.29 Low-CP vs. Low-CP+Met <0.01 <0.01 0.25 <0.01 <0.01 <0.01 0.26 0.25 <0.01 <0.01 <0.01 0.47 A,B,CValues within the same row with different superscripts are significantly different (P < 0.01). 1Standard error of the mean. 2Average daily gain. 3Feed conversion ratio (feed intake/gain). 4Protein intake/gain. 5Energy intake/gain. 6Feed cost per gain. View Large Table 3. Growth performance of broiler chickens fed a low-CP diet with or without sufficient Met from 11 to 24 d of age. Control Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, then Normal then Low then Normal then Low-ME Item (Trt A) ME (Trt B) -ME (Trt C) ME (Trt D) (Trt E) s.e.m.1 P-value Initial weight (g/chick) 233.140 235.466 233.596 233.338 236.355 1.174 0.87 Body weight (g/chick) 1132.930 A 981.633C 982.519C 1082.850B 1082.340B 11.162 <0.01 ADG2 64.271A 53.298C 53.496C 60.678B 60.428B 0.795 <0.01 Feed intake (g/chick) 1188.940 1202.490 1235.580 1203.590 1178.630 10.276 0.52 Met intake (g/chick) 7.251B 3.440C 3.535C 7.835A 7.674A 0.327 <0.01 TSAA intake (g/chick) 11.294A 7.046B 7.241B 11.435A 11.198A 0.336 <0.01 FCR3 1.321C 1.614A 1.653A 1.416B 1.395B,C 0.024 <0.01 Protein intake (g/chick) 249.678A 216.449B 222.406B 216.645B 212.155B 2.821 <0.01 Energy intake (kcal/chick) 3774.870 3817.910 3922.970 3821.400 3742.160 32.625 0.52 Protein conversion ratio4 0.279B 0.291A,B 0.298A 0.255C 0.251C 0.004 <0.01 Energy conversion ratio5 4.199C 5.128A 5.245A 4.498B 4.425B,C 0.077 <0.01 FCG (baht/kg)6 19.825B 22.691A 23.205A 20.673B 20.335B 0.281 <0.01 Total feed cost (baht/chicken) 17.823 16.895 17.359 17.559 17.195 0.150 0.39 Probability levels of contrast Body Feed Met TSAA Protein Energy Protein Energy Total weight ADG intake intake Intake FCR intake intake conversion conversion FCG feed Contrast statement ratio ratio cost Control vs. Low-CP <0.01 <0.01 0.31 <0.01 <0.01 <0.01 <0.01 0.31 0.01 <0.01 <0.01 0.11 Control vs. Low-CP+Met <0.01 <0.01 0.94 <0.01 0.92 0.02 <0.01 0.94 <0.01 0.02 0.18 0.29 Low-CP vs. Low-CP+Met <0.01 <0.01 0.25 <0.01 <0.01 <0.01 0.26 0.25 <0.01 <0.01 <0.01 0.47 Control Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, then Normal then Low then Normal then Low-ME Item (Trt A) ME (Trt B) -ME (Trt C) ME (Trt D) (Trt E) s.e.m.1 P-value Initial weight (g/chick) 233.140 235.466 233.596 233.338 236.355 1.174 0.87 Body weight (g/chick) 1132.930 A 981.633C 982.519C 1082.850B 1082.340B 11.162 <0.01 ADG2 64.271A 53.298C 53.496C 60.678B 60.428B 0.795 <0.01 Feed intake (g/chick) 1188.940 1202.490 1235.580 1203.590 1178.630 10.276 0.52 Met intake (g/chick) 7.251B 3.440C 3.535C 7.835A 7.674A 0.327 <0.01 TSAA intake (g/chick) 11.294A 7.046B 7.241B 11.435A 11.198A 0.336 <0.01 FCR3 1.321C 1.614A 1.653A 1.416B 1.395B,C 0.024 <0.01 Protein intake (g/chick) 249.678A 216.449B 222.406B 216.645B 212.155B 2.821 <0.01 Energy intake (kcal/chick) 3774.870 3817.910 3922.970 3821.400 3742.160 32.625 0.52 Protein conversion ratio4 0.279B 0.291A,B 0.298A 0.255C 0.251C 0.004 <0.01 Energy conversion ratio5 4.199C 5.128A 5.245A 4.498B 4.425B,C 0.077 <0.01 FCG (baht/kg)6 19.825B 22.691A 23.205A 20.673B 20.335B 0.281 <0.01 Total feed cost (baht/chicken) 17.823 16.895 17.359 17.559 17.195 0.150 0.39 Probability levels of contrast Body Feed Met TSAA Protein Energy Protein Energy Total weight ADG intake intake Intake FCR intake intake conversion conversion FCG feed Contrast statement ratio ratio cost Control vs. Low-CP <0.01 <0.01 0.31 <0.01 <0.01 <0.01 <0.01 0.31 0.01 <0.01 <0.01 0.11 Control vs. Low-CP+Met <0.01 <0.01 0.94 <0.01 0.92 0.02 <0.01 0.94 <0.01 0.02 0.18 0.29 Low-CP vs. Low-CP+Met <0.01 <0.01 0.25 <0.01 <0.01 <0.01 0.26 0.25 <0.01 <0.01 <0.01 0.47 A,B,CValues within the same row with different superscripts are significantly different (P < 0.01). 1Standard error of the mean. 2Average daily gain. 3Feed conversion ratio (feed intake/gain). 4Protein intake/gain. 5Energy intake/gain. 6Feed cost per gain. View Large Normally, a low TSAA intake depresses the feed intake and productive performance of broiler chickens (Khajali et al., 2002; Bunchasak, 2009), while the feed intake in the present study was not significantly affected by the Met deficiency. This indicated that a Met deficiency also can retard production performance without any effect on the feed intake. Adding Met to the Low-CP diets improved the body weight gain, protein efficiency ratio, and FCR of broiler chickens. Moreover, feeding a Low-CP+Met diet clearly promoted better protein efficiency ratio than the positive control diet, although the growth rate and FCR were still poorer. Accordingly, poor weight gain and FCR in broilers subjected to Low-CP diets or a Low-CP+Met diet have been reported (Nukreaw et al., 2011; Rakangtong and Bunchasak, 2011; Nukreaw and Bunchasak, 2015). Dean et al. (2006), Yamazaki et al. (2006), Kamran et al. (2008), and Namroud et al. (2008) also demonstrated that the addition of crystalline amino acids (lysine, methionine, threonine, or tryptophan) allows dietary levels to be reduced by 3%, whereas a greater decrease might have negative effects on growth performance because supplemental amino acids in a Low-CP diet might cause a sudden influx of amino acids that increase the catabolism of amino acids from muscles or those absorbed from diet to maintain homeostasis of plasma amino acids profile (Aftab et al., 2006; Abdel-Maksoud et al., 2010). Therefore, it can be said that reducing CP by less than 3% and supplementing with synthetic amino acids to meet the amino acids requirement significantly improved growth performance, but is still inferior to the conventional diet. The 25 to 42 d growth performance results are presented in Table 4. There was no significant difference in the ADG among the experimental groups during the finisher period (25 to 42 d of age). However, poor final body weight was observed in the Trt B, C, and E groups (P < 0.01), except for feeding with Trt D group, where the final body weight was equal to the Trt A. After the finisher phase, Trt D and E increased the body weight more than that of the Trt B and C (P < 0.05). The Trt A showed higher feed and nutrient (protein, Met, and energy) intakes than those of the other groups (P < 0.01). However, during this period, Trt C produced better energy conversion ratio, protein conversion ratio, FCR, and FCG values than those of the Trt A (P < 0.01). In particular, feeding with Trt D produced a better FCR than those of the Trt B (P < 0.01). Feeding with the Trt C and E diet resulted in a poorer FCR, while the energy intake, feed cost, and FCG were lower compared to the Trt B and D (P < 0.05). Table 4 Growth performance of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low-energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value Final body weight (g/chick) 3034.650A 2873.460C 2870.970C 2992.840A,B 2970.190B 18.683 <0.01 ADG2 105.650 105.101 104.913 106.109 104.880 0.660 0.79 Feed intake (g/chick) 3410.830A 3234.300B 3300.640B 3300.080B 3294.730B 18.590 <0.01 Met intake (g/chick) 16.474A 15.623B 15.908B 15.940B 15.880B 0.090 <0.01 TSAA intake (g/chick) 27.285A 25.875B 26.405B 26.400B 26.359B 0.149 <0.01 FCR3 1.795A 1.713C 1.746B 1.728B,C 1.745B 0.006 <0.01 Protein intake (g/chick) 648.058A 614.518B 627.124B 627.016B 625.999B 3.532 <0.01 Energy intake (kcal/chick) 10,999.920A 10,430.620B,C 10,397.020C 10,642.770B 10,378.390C 63.874 <0.01 Protein conversion ratio4 0.341A 0.325C 0.332B 0.329B,C 0.332B 0.001 <0.01 Energy conversion ratio5 5.786A 5.518B 5.508B 5.574B 5.498B 0.022 <0.01 FCG (baht/kg)6 26.021A 24.808B,C 24.580C 25.059B 24.545C 0.106 <0.01 Total feed cost (baht/chicken) 49.458A 46.899C 46.406C 47.850B 46.325C 0.298 <0.01 Probability levels of contrast Body ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total weight intake intake Intake Intake Intake conversion conversion feed Contrast statement ratio ratio cost Control vs Low-CP <0.01 0.53 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Control vs. Low-CP, or +Met <0.01 0.67 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.56 0.18 0.18 0.18 0.45 0.18 0.18 0.45 0.43 0.41 0.18 Control, Normal ME vs. Low-ME 0.01 0.34 0.39 0.23 0.40 0.94 0.39 <0.01 0.77 <0.01 <0.01 <0.01 Control vs. Low-ME <0.01 0.46 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Normal ME vs. Low-ME 0.51 0.40 0.18 0.30 0.18 <0.01 0.18 0.04 <0.01 0.15 <0.01 <0.01 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value Final body weight (g/chick) 3034.650A 2873.460C 2870.970C 2992.840A,B 2970.190B 18.683 <0.01 ADG2 105.650 105.101 104.913 106.109 104.880 0.660 0.79 Feed intake (g/chick) 3410.830A 3234.300B 3300.640B 3300.080B 3294.730B 18.590 <0.01 Met intake (g/chick) 16.474A 15.623B 15.908B 15.940B 15.880B 0.090 <0.01 TSAA intake (g/chick) 27.285A 25.875B 26.405B 26.400B 26.359B 0.149 <0.01 FCR3 1.795A 1.713C 1.746B 1.728B,C 1.745B 0.006 <0.01 Protein intake (g/chick) 648.058A 614.518B 627.124B 627.016B 625.999B 3.532 <0.01 Energy intake (kcal/chick) 10,999.920A 10,430.620B,C 10,397.020C 10,642.770B 10,378.390C 63.874 <0.01 Protein conversion ratio4 0.341A 0.325C 0.332B 0.329B,C 0.332B 0.001 <0.01 Energy conversion ratio5 5.786A 5.518B 5.508B 5.574B 5.498B 0.022 <0.01 FCG (baht/kg)6 26.021A 24.808B,C 24.580C 25.059B 24.545C 0.106 <0.01 Total feed cost (baht/chicken) 49.458A 46.899C 46.406C 47.850B 46.325C 0.298 <0.01 Probability levels of contrast Body ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total weight intake intake Intake Intake Intake conversion conversion feed Contrast statement ratio ratio cost Control vs Low-CP <0.01 0.53 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Control vs. Low-CP, or +Met <0.01 0.67 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.56 0.18 0.18 0.18 0.45 0.18 0.18 0.45 0.43 0.41 0.18 Control, Normal ME vs. Low-ME 0.01 0.34 0.39 0.23 0.40 0.94 0.39 <0.01 0.77 <0.01 <0.01 <0.01 Control vs. Low-ME <0.01 0.46 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Normal ME vs. Low-ME 0.51 0.40 0.18 0.30 0.18 <0.01 0.18 0.04 <0.01 0.15 <0.01 <0.01 A,B,CValues within the same row with different superscripts are significantly different (P<0.01) 1Standard error of the mean. 2Average daily gain. 3Feed conversion ratio (feed intake/gain). 4Protein intake/gain. 5Energy intake/gain. 6Feed cost per gain. View Large Table 4 Growth performance of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low-energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value Final body weight (g/chick) 3034.650A 2873.460C 2870.970C 2992.840A,B 2970.190B 18.683 <0.01 ADG2 105.650 105.101 104.913 106.109 104.880 0.660 0.79 Feed intake (g/chick) 3410.830A 3234.300B 3300.640B 3300.080B 3294.730B 18.590 <0.01 Met intake (g/chick) 16.474A 15.623B 15.908B 15.940B 15.880B 0.090 <0.01 TSAA intake (g/chick) 27.285A 25.875B 26.405B 26.400B 26.359B 0.149 <0.01 FCR3 1.795A 1.713C 1.746B 1.728B,C 1.745B 0.006 <0.01 Protein intake (g/chick) 648.058A 614.518B 627.124B 627.016B 625.999B 3.532 <0.01 Energy intake (kcal/chick) 10,999.920A 10,430.620B,C 10,397.020C 10,642.770B 10,378.390C 63.874 <0.01 Protein conversion ratio4 0.341A 0.325C 0.332B 0.329B,C 0.332B 0.001 <0.01 Energy conversion ratio5 5.786A 5.518B 5.508B 5.574B 5.498B 0.022 <0.01 FCG (baht/kg)6 26.021A 24.808B,C 24.580C 25.059B 24.545C 0.106 <0.01 Total feed cost (baht/chicken) 49.458A 46.899C 46.406C 47.850B 46.325C 0.298 <0.01 Probability levels of contrast Body ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total weight intake intake Intake Intake Intake conversion conversion feed Contrast statement ratio ratio cost Control vs Low-CP <0.01 0.53 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Control vs. Low-CP, or +Met <0.01 0.67 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.56 0.18 0.18 0.18 0.45 0.18 0.18 0.45 0.43 0.41 0.18 Control, Normal ME vs. Low-ME 0.01 0.34 0.39 0.23 0.40 0.94 0.39 <0.01 0.77 <0.01 <0.01 <0.01 Control vs. Low-ME <0.01 0.46 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Normal ME vs. Low-ME 0.51 0.40 0.18 0.30 0.18 <0.01 0.18 0.04 <0.01 0.15 <0.01 <0.01 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value Final body weight (g/chick) 3034.650A 2873.460C 2870.970C 2992.840A,B 2970.190B 18.683 <0.01 ADG2 105.650 105.101 104.913 106.109 104.880 0.660 0.79 Feed intake (g/chick) 3410.830A 3234.300B 3300.640B 3300.080B 3294.730B 18.590 <0.01 Met intake (g/chick) 16.474A 15.623B 15.908B 15.940B 15.880B 0.090 <0.01 TSAA intake (g/chick) 27.285A 25.875B 26.405B 26.400B 26.359B 0.149 <0.01 FCR3 1.795A 1.713C 1.746B 1.728B,C 1.745B 0.006 <0.01 Protein intake (g/chick) 648.058A 614.518B 627.124B 627.016B 625.999B 3.532 <0.01 Energy intake (kcal/chick) 10,999.920A 10,430.620B,C 10,397.020C 10,642.770B 10,378.390C 63.874 <0.01 Protein conversion ratio4 0.341A 0.325C 0.332B 0.329B,C 0.332B 0.001 <0.01 Energy conversion ratio5 5.786A 5.518B 5.508B 5.574B 5.498B 0.022 <0.01 FCG (baht/kg)6 26.021A 24.808B,C 24.580C 25.059B 24.545C 0.106 <0.01 Total feed cost (baht/chicken) 49.458A 46.899C 46.406C 47.850B 46.325C 0.298 <0.01 Probability levels of contrast Body ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total weight intake intake Intake Intake Intake conversion conversion feed Contrast statement ratio ratio cost Control vs Low-CP <0.01 0.53 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Control vs. Low-CP, or +Met <0.01 0.67 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.56 0.18 0.18 0.18 0.45 0.18 0.18 0.45 0.43 0.41 0.18 Control, Normal ME vs. Low-ME 0.01 0.34 0.39 0.23 0.40 0.94 0.39 <0.01 0.77 <0.01 <0.01 <0.01 Control vs. Low-ME <0.01 0.46 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 Normal ME vs. Low-ME 0.51 0.40 0.18 0.30 0.18 <0.01 0.18 0.04 <0.01 0.15 <0.01 <0.01 A,B,CValues within the same row with different superscripts are significantly different (P<0.01) 1Standard error of the mean. 2Average daily gain. 3Feed conversion ratio (feed intake/gain). 4Protein intake/gain. 5Energy intake/gain. 6Feed cost per gain. View Large After feed restriction, animals usually increase their feed intake to catch up on their growth (Bikker et al., 1996; Zubair and Leeson, 1996; Nukreaw and Bunchasak, 2015). In addition, reducing the energy content of the diet also results in an increase in the feed intake (Leeson et al., 1996; Cheng et al., 1997). However, in the current study, chickens fed with a Low-ME or normal ME diet after receiving a Low-CP or Low-CP+Met diet did not increase their feed intake and could not regain the lost body weight compared to the control diet, except with the Low-CP+Met diet (followed by normal ME diet). Nonetheless, feeding normal ME or Low-ME diet during the finisher period clearly improved nutrient utilization (indicated by the FCR, protein conversion ratio, and energy conversion ratio) of chickens after being fed with the Low-CP+Met diet, although the exact mechanism is unclear. Similarly, Nukreaw and Bunchasak (2015) stated that the phenomenon of chickens fed low protein diets failing to regain body weight was caused by their inability to increase feed intake, and the mechanisms of compensatory response for the growth rate and the efficiency of nutrient utilization (FCR, protein conversion ratio, and energy conversion ratio) may be different. During the finisher period, it was assumed that chickens fed with the Low-CP+Met diet may have better quantitative (growth rate) and qualitative (feed or nutrient utilization) improvement, if their feed intake could be increased. The production performance for the overall period (age 11 to 42 d of age) is presented in Table 5. The growth rates of chickens fed Trt B, C, and E were less than that of the Trt A (P < 0.01), except for the Trt D. During the finisher period, Trt D and E significantly improved the productive performance and production cost (ADG, FCR, protein conversion ratio, energy conversion ratio, and FCG) (P < 0.01) compared to feeding with the Trt B and C, and protein conversion ratio, energy conversion ratio, and FCR better than those of the Trt A (P < 0.05). Reducing dietary energy (−75 ME Kcal/kg) caused poorer FCR and protein conversion ratio values with the Trt C (P < 0.05). The feed intakes in the Trt B and E were significantly lower than that of the Trt A (P < 0.05), while the feed cost of the Trt A was the most expensive (P < 0.01). Table 5. Growth performance of broiler chickens fed a low-protein diet with or without sufficient Met and subsequent feeding with a normal or low-energy diet during 11 to 42 d of age (overall period). Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value ADG2 87.546A 82.436C 82.418C 86.235A,B 85.433B 0.580 <0.01 Feed intake (g/chick) 4599.760a 4436.790b 4536.220a,b 4503.670a,b 4473.360b 23.193 0.02 Met intake (g/chick) 23.728A 19.061B 19.445B 23.774A 23.551A 0.363 <0.01 TSAA intake (g/chick) 38.581A 32.920C 33.644C 37.834A,B 37.555B 0.412 <0.01 FCR3 1.641C 1.683B 1.720A 1.633C 1.636C 0.007 <0.01 Protein intake(g/chick) 897.734A 830.966B 849.526B 843.661B 838.151B 5.535 <0.01 Energy intake(kcal/chick) 14,774.800A 14,248.530B,C 14,320.000B,C 14,464.160A,B 14,120.540C 76.990 <0.01 Protein conversion ratio4 0.321A 0.315B 0.322A 0.306C 0.307C 0.001 <0.01 Energy conversion ratio5 5.279B 5.404A 5.431A 5.244B,C 5.164C 0.022 <0.01 FCG (baht/kg)6 48.446A 48.049A,B 48.356A 47.486B,C 46.884C 0.160 <0.01 Total feed cost (baht/chicken) 135.648A 126.669C 127.514C 131.013B 128.160C 0.807 <0.01 Profit (bath/chicken)* 88.241A 84.710B 83.693B 89.854A 90.945A 0.864 <0.01 Probability levels of contrast ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total intake intake intake intake intake conversion conversion feed Contrast statement ratio ratio cost Control vs. Low-CP or +Met <0.01 <0.01 <0.01 <0.01 0.02 <0.01 <0.01 <0.01 0.34 0.02 <0.01 Control vs. Low-CP <0.01 0.01 <0.01 <0.01 <0.01 <0.01 <0.01 0.34 <0.01 0.46 <0.01 Control vs. Low-CP+Met 0.02 0.01 0.76 0.01 0.56 <0.01 <0.01 <0.01 0.05 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.95 <0.01 <0.01 <0.01 0.92 0.94 <0.01 <0.01 <0.01 0.02 Normal ME vs. Low-ME 0.47 0.32 0.65 0.43 0.04 0.32 0.22 0.03 0.38 0.58 0.31 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value ADG2 87.546A 82.436C 82.418C 86.235A,B 85.433B 0.580 <0.01 Feed intake (g/chick) 4599.760a 4436.790b 4536.220a,b 4503.670a,b 4473.360b 23.193 0.02 Met intake (g/chick) 23.728A 19.061B 19.445B 23.774A 23.551A 0.363 <0.01 TSAA intake (g/chick) 38.581A 32.920C 33.644C 37.834A,B 37.555B 0.412 <0.01 FCR3 1.641C 1.683B 1.720A 1.633C 1.636C 0.007 <0.01 Protein intake(g/chick) 897.734A 830.966B 849.526B 843.661B 838.151B 5.535 <0.01 Energy intake(kcal/chick) 14,774.800A 14,248.530B,C 14,320.000B,C 14,464.160A,B 14,120.540C 76.990 <0.01 Protein conversion ratio4 0.321A 0.315B 0.322A 0.306C 0.307C 0.001 <0.01 Energy conversion ratio5 5.279B 5.404A 5.431A 5.244B,C 5.164C 0.022 <0.01 FCG (baht/kg)6 48.446A 48.049A,B 48.356A 47.486B,C 46.884C 0.160 <0.01 Total feed cost (baht/chicken) 135.648A 126.669C 127.514C 131.013B 128.160C 0.807 <0.01 Profit (bath/chicken)* 88.241A 84.710B 83.693B 89.854A 90.945A 0.864 <0.01 Probability levels of contrast ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total intake intake intake intake intake conversion conversion feed Contrast statement ratio ratio cost Control vs. Low-CP or +Met <0.01 <0.01 <0.01 <0.01 0.02 <0.01 <0.01 <0.01 0.34 0.02 <0.01 Control vs. Low-CP <0.01 0.01 <0.01 <0.01 <0.01 <0.01 <0.01 0.34 <0.01 0.46 <0.01 Control vs. Low-CP+Met 0.02 0.01 0.76 0.01 0.56 <0.01 <0.01 <0.01 0.05 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.95 <0.01 <0.01 <0.01 0.92 0.94 <0.01 <0.01 <0.01 0.02 Normal ME vs. Low-ME 0.47 0.32 0.65 0.43 0.04 0.32 0.22 0.03 0.38 0.58 0.31 A,B,CValues within the same row with different superscripts are significantly different (P < 0.01). a,bValues within the same row with different superscripts are significantly different (P < 0.05) 1Standard error of the mean. 2Average daily gain. 3Feed conversion ratio (feed intake/gain). 4Protein intake/gain. 5Energy intake/gain. 6Feed cost per gain. *Profit = [(body weight × sale value of chicken)—(FCG × body weight), sale value of chicken = 77.50 THB/kg live weight. View Large Table 5. Growth performance of broiler chickens fed a low-protein diet with or without sufficient Met and subsequent feeding with a normal or low-energy diet during 11 to 42 d of age (overall period). Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value ADG2 87.546A 82.436C 82.418C 86.235A,B 85.433B 0.580 <0.01 Feed intake (g/chick) 4599.760a 4436.790b 4536.220a,b 4503.670a,b 4473.360b 23.193 0.02 Met intake (g/chick) 23.728A 19.061B 19.445B 23.774A 23.551A 0.363 <0.01 TSAA intake (g/chick) 38.581A 32.920C 33.644C 37.834A,B 37.555B 0.412 <0.01 FCR3 1.641C 1.683B 1.720A 1.633C 1.636C 0.007 <0.01 Protein intake(g/chick) 897.734A 830.966B 849.526B 843.661B 838.151B 5.535 <0.01 Energy intake(kcal/chick) 14,774.800A 14,248.530B,C 14,320.000B,C 14,464.160A,B 14,120.540C 76.990 <0.01 Protein conversion ratio4 0.321A 0.315B 0.322A 0.306C 0.307C 0.001 <0.01 Energy conversion ratio5 5.279B 5.404A 5.431A 5.244B,C 5.164C 0.022 <0.01 FCG (baht/kg)6 48.446A 48.049A,B 48.356A 47.486B,C 46.884C 0.160 <0.01 Total feed cost (baht/chicken) 135.648A 126.669C 127.514C 131.013B 128.160C 0.807 <0.01 Profit (bath/chicken)* 88.241A 84.710B 83.693B 89.854A 90.945A 0.864 <0.01 Probability levels of contrast ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total intake intake intake intake intake conversion conversion feed Contrast statement ratio ratio cost Control vs. Low-CP or +Met <0.01 <0.01 <0.01 <0.01 0.02 <0.01 <0.01 <0.01 0.34 0.02 <0.01 Control vs. Low-CP <0.01 0.01 <0.01 <0.01 <0.01 <0.01 <0.01 0.34 <0.01 0.46 <0.01 Control vs. Low-CP+Met 0.02 0.01 0.76 0.01 0.56 <0.01 <0.01 <0.01 0.05 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.95 <0.01 <0.01 <0.01 0.92 0.94 <0.01 <0.01 <0.01 0.02 Normal ME vs. Low-ME 0.47 0.32 0.65 0.43 0.04 0.32 0.22 0.03 0.38 0.58 0.31 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low-ME then Normal then Low-ME Item (Trt A) ME(Trt B) (Trt C) ME(Trt D) (Trt E) s.e.m.1 P-value ADG2 87.546A 82.436C 82.418C 86.235A,B 85.433B 0.580 <0.01 Feed intake (g/chick) 4599.760a 4436.790b 4536.220a,b 4503.670a,b 4473.360b 23.193 0.02 Met intake (g/chick) 23.728A 19.061B 19.445B 23.774A 23.551A 0.363 <0.01 TSAA intake (g/chick) 38.581A 32.920C 33.644C 37.834A,B 37.555B 0.412 <0.01 FCR3 1.641C 1.683B 1.720A 1.633C 1.636C 0.007 <0.01 Protein intake(g/chick) 897.734A 830.966B 849.526B 843.661B 838.151B 5.535 <0.01 Energy intake(kcal/chick) 14,774.800A 14,248.530B,C 14,320.000B,C 14,464.160A,B 14,120.540C 76.990 <0.01 Protein conversion ratio4 0.321A 0.315B 0.322A 0.306C 0.307C 0.001 <0.01 Energy conversion ratio5 5.279B 5.404A 5.431A 5.244B,C 5.164C 0.022 <0.01 FCG (baht/kg)6 48.446A 48.049A,B 48.356A 47.486B,C 46.884C 0.160 <0.01 Total feed cost (baht/chicken) 135.648A 126.669C 127.514C 131.013B 128.160C 0.807 <0.01 Profit (bath/chicken)* 88.241A 84.710B 83.693B 89.854A 90.945A 0.864 <0.01 Probability levels of contrast ADG Feed Met TSAA FCR Protein Energy Protein Energy FCG Total intake intake intake intake intake conversion conversion feed Contrast statement ratio ratio cost Control vs. Low-CP or +Met <0.01 <0.01 <0.01 <0.01 0.02 <0.01 <0.01 <0.01 0.34 0.02 <0.01 Control vs. Low-CP <0.01 0.01 <0.01 <0.01 <0.01 <0.01 <0.01 0.34 <0.01 0.46 <0.01 Control vs. Low-CP+Met 0.02 0.01 0.76 0.01 0.56 <0.01 <0.01 <0.01 0.05 <0.01 <0.01 Low-CP vs. Low-CP+Met <0.01 0.95 <0.01 <0.01 <0.01 0.92 0.94 <0.01 <0.01 <0.01 0.02 Normal ME vs. Low-ME 0.47 0.32 0.65 0.43 0.04 0.32 0.22 0.03 0.38 0.58 0.31 A,B,CValues within the same row with different superscripts are significantly different (P < 0.01). a,bValues within the same row with different superscripts are significantly different (P < 0.05) 1Standard error of the mean. 2Average daily gain. 3Feed conversion ratio (feed intake/gain). 4Protein intake/gain. 5Energy intake/gain. 6Feed cost per gain. *Profit = [(body weight × sale value of chicken)—(FCG × body weight), sale value of chicken = 77.50 THB/kg live weight. View Large For the overall feeding period (11 to 42 d of age), the growth rate of chickens fed the Trt D was not significantly different from the Trt A, and clearly improved the FCR, protein conversion ratio, and energy conversion ratio. These results were in accordance with the results of Nukreaw et al. (2011). Feed intake is greatest during the finisher period, therefore proving Low-ME or normal ME after feeding Low-CP+Met improved the overall energy conversion ratio (0.76 to 0.33%) and protein conversion ratio (4.57 to 4.90%), reduced total feed cost (3.54 to 5.84%), reduced feed cost per gain (2.02 to 3.35%), and increased the profit (1.79 to 2.98%) compared to the conventional method. However, these phenomena would depend on some conditions: 1) the degree of amino acids or protein restriction, 2) the duration of protein restriction, and 3) the feed consumption response during the finisher period (as a reflection of metabolism) (Nukreaw and Bunchasak, 2015). Carcass Quality And Abdominal Fat The results for the 5 experimental groups with respect to carcass yields and the abdominal fat content at age 24 d are shown in Table 6. At 24 d of age, the carcass and edible meat (breast and leg) yields of the chickens fed the Trt B and C were significantly smaller than those of the other groups (P < 0.01). Feeding Trt D and E promoted carcass and breast meat yields not significantly different from those of the Trt A. The dietary treatments did not significantly affect the wing weight. The abdominal fat contents of the Trt B, C, D, and E were significantly heavier than that of the Trt A (P < 0.01). The liver weights of the chickens fed the Trt B and C were significantly less than that of the Trt A (P < 0.05). Table 6. Carcass quality and abdominal fat of broiler chickens fed a low-CP diet with or without sufficient Met from 11 to 24 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 74.423A 72.994B 73.293B 75.040A 74.580A 0.227 <0.01 Pectoralis major 14.675A 11.856B 11.905B 14.425A 14.285A 0.218 <0.01 Pectoralis minor 3.145A 2.571B 2.626B 3.074A 3.076A 0.044 <0.01 Leg 13.969A 13.100D 13.200C,D 13.651A,B 13.529B,C 0.075 <0.01 Wing 7.411 7.238 7.148 7.244 7.288 0.045 0.39 Abdominal fat 0.945B 1.318A 1.305A 1.226A 1.240A 0.030 <0.01 Liver 2.149b 2.395a 2.335a 2.264a,b 2.265a,b 0.026 0.04 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor Fat Control vs. Low-CP 0.01 <0.01 <0.01 <0.01 0.06 <0.01 <0.01 Control vs. Low-CP+Met 0.41 0.16 0.20 0.03 0.21 <0.01 0.10 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 <0.01 0.44 0.16 0.08 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 74.423A 72.994B 73.293B 75.040A 74.580A 0.227 <0.01 Pectoralis major 14.675A 11.856B 11.905B 14.425A 14.285A 0.218 <0.01 Pectoralis minor 3.145A 2.571B 2.626B 3.074A 3.076A 0.044 <0.01 Leg 13.969A 13.100D 13.200C,D 13.651A,B 13.529B,C 0.075 <0.01 Wing 7.411 7.238 7.148 7.244 7.288 0.045 0.39 Abdominal fat 0.945B 1.318A 1.305A 1.226A 1.240A 0.030 <0.01 Liver 2.149b 2.395a 2.335a 2.264a,b 2.265a,b 0.026 0.04 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor Fat Control vs. Low-CP 0.01 <0.01 <0.01 <0.01 0.06 <0.01 <0.01 Control vs. Low-CP+Met 0.41 0.16 0.20 0.03 0.21 <0.01 0.10 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 <0.01 0.44 0.16 0.08 A,B,C,DValues within the same row with different superscripts are significantly different (P < 0.01). a,bValues within the same row with different superscript are significantly different (P < 0.05). 1Standard error of the mean. View Large Table 6. Carcass quality and abdominal fat of broiler chickens fed a low-CP diet with or without sufficient Met from 11 to 24 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 74.423A 72.994B 73.293B 75.040A 74.580A 0.227 <0.01 Pectoralis major 14.675A 11.856B 11.905B 14.425A 14.285A 0.218 <0.01 Pectoralis minor 3.145A 2.571B 2.626B 3.074A 3.076A 0.044 <0.01 Leg 13.969A 13.100D 13.200C,D 13.651A,B 13.529B,C 0.075 <0.01 Wing 7.411 7.238 7.148 7.244 7.288 0.045 0.39 Abdominal fat 0.945B 1.318A 1.305A 1.226A 1.240A 0.030 <0.01 Liver 2.149b 2.395a 2.335a 2.264a,b 2.265a,b 0.026 0.04 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor Fat Control vs. Low-CP 0.01 <0.01 <0.01 <0.01 0.06 <0.01 <0.01 Control vs. Low-CP+Met 0.41 0.16 0.20 0.03 0.21 <0.01 0.10 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 <0.01 0.44 0.16 0.08 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 74.423A 72.994B 73.293B 75.040A 74.580A 0.227 <0.01 Pectoralis major 14.675A 11.856B 11.905B 14.425A 14.285A 0.218 <0.01 Pectoralis minor 3.145A 2.571B 2.626B 3.074A 3.076A 0.044 <0.01 Leg 13.969A 13.100D 13.200C,D 13.651A,B 13.529B,C 0.075 <0.01 Wing 7.411 7.238 7.148 7.244 7.288 0.045 0.39 Abdominal fat 0.945B 1.318A 1.305A 1.226A 1.240A 0.030 <0.01 Liver 2.149b 2.395a 2.335a 2.264a,b 2.265a,b 0.026 0.04 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor Fat Control vs. Low-CP 0.01 <0.01 <0.01 <0.01 0.06 <0.01 <0.01 Control vs. Low-CP+Met 0.41 0.16 0.20 0.03 0.21 <0.01 0.10 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 <0.01 0.44 0.16 0.08 A,B,C,DValues within the same row with different superscripts are significantly different (P < 0.01). a,bValues within the same row with different superscript are significantly different (P < 0.05). 1Standard error of the mean. View Large It is known that inadequate CP and amino acids in the diet negatively influence the carcass composition of broilers (Si et al., 2001; Furlan et al., 2004), and that the growth of breast meat is more sensitive to limiting the amino acid concentration in the diet than that of other edible components (Rakangtong and Bunchasak, 2011). Feeding Low-CP diets deficient in Met significantly decreased the carcass yield and breast meat yield, while adding Met prevented these negative effects. This finding was in accordance with the general acceptance that supplementation with Met in Low-CP diets promotes meat production (Moran, 1994; Schutte and Pack, 1995; Saki et al., 2007; Nukreaw et al., 2011) due to the improvement in the amino acid balance and protein synthesis (Boomgaardt and Baker, 1973; Bunchasak and Keawarun, 2006). It is well documented that diets with a high ME content or a high energy-to-protein ratio promote energy retention as fat (Aletor et al., 2000; Faria Filho et al., 2003; Swennen et al., 2004; Yang et al., 2009; Nukreaw and Bunchasak, 2015). In the present study, abdominal fat pads (% live body weight) of the chickens fed a Low-CP diet (with or without Met) were higher than those of the control group. Nukreaw et al. (2011) also reported that decreasing the dietary protein intake with or without Met supplementation increased abdominal fat pads compared to a control diet. In poultry, lipogenesis mainly occurs in the liver (Nukreaw et al., 2011) and is transported by the blood system and then taken up into adipose cells by lipoprotein lipase (Bunchasak et al., 1997). The results demonstrated that a Low-CP diet deficient in Met significantly increased the liver weight and abdominal fat accumulation. Because of enhanced de novo lipogenesis in the liver of chickens fed the Low-CP diet (Rosebrough and Steele, 1985; Aletor et al., 2000; Swennen et al., 2006), chickens are expected to have increased liver weights and deposit more abdominal fat. Moreover, an amino acid imbalance stimulates protein metabolism in the liver or an increased rate of amino acid synthesis to provide sufficient amino acids (Hiramoto et al., 1990), which is also a factor affecting liver enlargement. Therefore, adding Met to Low-CP diets reduces the liver weight and may cause an improvement in the amino acids balance. This indicated that the maximum breast meat yield can be achieved in a Low-CP diet with Met supplementation, while fat accumulation can still be high. The 42-day carcass yields and the abdominal fat content results are shown in Table 7. At 42 d of age, the dietary treatments did not significantly affect the carcass yield, pectoralis minor muscles, leg, wing, abdominal fat content, or liver, while the pectoralis major muscles of chickens fed the Trt B and C groups were smaller than the Trt A (P < 0.01). The addition of Met in the Low-CP diets during the grower period significantly enhanced the pectoralis major muscles at 42 d of age so that they were not significantly different from that of the Trt A, although feeding with the Low-ME diet reduced the breast meat yield (P < 0.05) compared to the normal ME diets. Table 7. Carcass quality and abdominal fat of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 80.513 80.039 79.543 80.414 80.324 0.124 0.07 Pectoralis major 17.123A 16.374B,C 15.831C 17.213A 16.823A,B 0.120 <0.01 Pectoralis minor 3.666 3.538 3.451 3.499 3.490 0.032 0.15 Leg 16.054 16.154 16.156 15.787 16.053 0.069 0.47 Wing 7.300 7.305 7.259 7.384 7.284 0.031 0.82 Abdominal fat 2.038 2.041 1.923 1.881 1.885 0.038 0.25 Liver 1.683 1.749 1.776 1.689 1.759 0.018 0.34 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor fat Control vs. Low-CP 0.03 <0.01 0.03 0.61 0.85 0.50 0.11 Control vs. Low-CP+Met 0.64 0.67 0.03 0.50 0.72 0.07 0.40 Low-CP vs. Low-CP+Met 0.03 <0.01 0.94 0.15 0.50 0.15 0.33 Control, Normal ME vs. Low-ME 0.10 <0.01 0.11 0.47 0.40 0.19 0.10 Control vs. Low-ME 0.07 <0.01 0.01 0.80 0.76 0.11 0.09 Normal ME vs. Low-ME 0.25 0.03 0.49 0.40 0.34 0.40 0.22 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 80.513 80.039 79.543 80.414 80.324 0.124 0.07 Pectoralis major 17.123A 16.374B,C 15.831C 17.213A 16.823A,B 0.120 <0.01 Pectoralis minor 3.666 3.538 3.451 3.499 3.490 0.032 0.15 Leg 16.054 16.154 16.156 15.787 16.053 0.069 0.47 Wing 7.300 7.305 7.259 7.384 7.284 0.031 0.82 Abdominal fat 2.038 2.041 1.923 1.881 1.885 0.038 0.25 Liver 1.683 1.749 1.776 1.689 1.759 0.018 0.34 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor fat Control vs. Low-CP 0.03 <0.01 0.03 0.61 0.85 0.50 0.11 Control vs. Low-CP+Met 0.64 0.67 0.03 0.50 0.72 0.07 0.40 Low-CP vs. Low-CP+Met 0.03 <0.01 0.94 0.15 0.50 0.15 0.33 Control, Normal ME vs. Low-ME 0.10 <0.01 0.11 0.47 0.40 0.19 0.10 Control vs. Low-ME 0.07 <0.01 0.01 0.80 0.76 0.11 0.09 Normal ME vs. Low-ME 0.25 0.03 0.49 0.40 0.34 0.40 0.22 A,B,CValues within the same row with different superscripts are significantly different (P < 0.01). 1Standard error of the mean. View Large Table 7. Carcass quality and abdominal fat of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 80.513 80.039 79.543 80.414 80.324 0.124 0.07 Pectoralis major 17.123A 16.374B,C 15.831C 17.213A 16.823A,B 0.120 <0.01 Pectoralis minor 3.666 3.538 3.451 3.499 3.490 0.032 0.15 Leg 16.054 16.154 16.156 15.787 16.053 0.069 0.47 Wing 7.300 7.305 7.259 7.384 7.284 0.031 0.82 Abdominal fat 2.038 2.041 1.923 1.881 1.885 0.038 0.25 Liver 1.683 1.749 1.776 1.689 1.759 0.018 0.34 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor fat Control vs. Low-CP 0.03 <0.01 0.03 0.61 0.85 0.50 0.11 Control vs. Low-CP+Met 0.64 0.67 0.03 0.50 0.72 0.07 0.40 Low-CP vs. Low-CP+Met 0.03 <0.01 0.94 0.15 0.50 0.15 0.33 Control, Normal ME vs. Low-ME 0.10 <0.01 0.11 0.47 0.40 0.19 0.10 Control vs. Low-ME 0.07 <0.01 0.01 0.80 0.76 0.11 0.09 Normal ME vs. Low-ME 0.25 0.03 0.49 0.40 0.34 0.40 0.22 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value % of body weight Carcass dressing 80.513 80.039 79.543 80.414 80.324 0.124 0.07 Pectoralis major 17.123A 16.374B,C 15.831C 17.213A 16.823A,B 0.120 <0.01 Pectoralis minor 3.666 3.538 3.451 3.499 3.490 0.032 0.15 Leg 16.054 16.154 16.156 15.787 16.053 0.069 0.47 Wing 7.300 7.305 7.259 7.384 7.284 0.031 0.82 Abdominal fat 2.038 2.041 1.923 1.881 1.885 0.038 0.25 Liver 1.683 1.749 1.776 1.689 1.759 0.018 0.34 Probability levels of contrast Carcass Pectoralis Pectoralis Leg Wing Abdominal Liver Contrast statement dressing major minor fat Control vs. Low-CP 0.03 <0.01 0.03 0.61 0.85 0.50 0.11 Control vs. Low-CP+Met 0.64 0.67 0.03 0.50 0.72 0.07 0.40 Low-CP vs. Low-CP+Met 0.03 <0.01 0.94 0.15 0.50 0.15 0.33 Control, Normal ME vs. Low-ME 0.10 <0.01 0.11 0.47 0.40 0.19 0.10 Control vs. Low-ME 0.07 <0.01 0.01 0.80 0.76 0.11 0.09 Normal ME vs. Low-ME 0.25 0.03 0.49 0.40 0.34 0.40 0.22 A,B,CValues within the same row with different superscripts are significantly different (P < 0.01). 1Standard error of the mean. View Large Similar to Nukreaw et al. (2011), at 42 d of age, the pectoralis major muscles of chickens fed with the Low-CP group was poor, while the breast meat yield was comparable to the control group when Met was added to the Low-CP diet because maximal breast meat production may already have been achieved with the Low-CP diet with amino acid balance provided, so compensation of protein synthesis (meat production) did not occur after feeding with the normal ME diet. Nevertheless, a decrease in the energy density in feed during the finisher period resulted in a reduction in the breast meat yield due to the inability to enhance feed intake. This indicated that the mechanism controlling voluntary feed intake is complicated, and chickens do not always increase their feed intake when they are fed on a low-energy diet. Energy deposition resulting in energy intake is controlled by multiple regulatory mechanisms (Swennen et al., 2004). Apart from genetic factors, exogenous factors such as environmental conditions and nutritional factors (e.g., diet and composition) interact strongly in the control and regulation of the energy flow (Swennen et al., 2004). At 42 d of age, the abdominal fat pads of chickens fed on Low-CP diets did not differ from the control group. It can be concluded that high fat accumulation caused by a restriction in the protein intake can be reduced after the finisher period. Nukreaw et al. (2011) and more recently Jariyahatthakij et al. (2016) reported that adding Met in a Low-CP diet during the grower period and subsequently feeding with a control diet reduced fat accumulation compared to the control group. Perhaps down expression of lipogenesis and/or an increase in lipolysis or β-oxidation may be stimulated during this period. Chemical Blood Test The effects of experimental diets on the TG, total protein, albumin, and uric acid in the blood at 24 d of age are shown in Table 8. The TG, total protein, and albumin in the plasma of chickens fed Trt B and C groups were significantly lower than those of Trt D and E groups (P < 0.05). These blood parameters in the Trt A did not significantly differ from those in other groups. Moreover, the dietary treatment did not significantly affect the uric acid level in plasma. Table 8. Chemical blood profiles of broiler chickens fed a low-CP diet with or without sufficient Met from 11 to 24 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low then Normal then Low Item (Trt A) ME(Trt B) -ME(Trt C) ME(Trt D) -ME(Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 36.183A,B 30.176B 31.056B 42.628A 42.993A 1.289 <0.01 Total protein (mg/dl) 26.418A,B 25.024B 25.596B 27.638A 27.463A 0.285 <0.01 Albumin (g/dl) 1.301a,b 1.215b 1.204b 1.356a 1.350a 0.020 0.03 Uric acid (mg/dl) 3.702 4.167 4.328 4.274 4.276 0.199 0.84 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid Control vs. Low-CP 0.08 0.13 0.08 0.31 Control vs. Low-CP+Met 0.04 0.12 0.32 0.28 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 0.95 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low then Normal then Low Item (Trt A) ME(Trt B) -ME(Trt C) ME(Trt D) -ME(Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 36.183A,B 30.176B 31.056B 42.628A 42.993A 1.289 <0.01 Total protein (mg/dl) 26.418A,B 25.024B 25.596B 27.638A 27.463A 0.285 <0.01 Albumin (g/dl) 1.301a,b 1.215b 1.204b 1.356a 1.350a 0.020 0.03 Uric acid (mg/dl) 3.702 4.167 4.328 4.274 4.276 0.199 0.84 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid Control vs. Low-CP 0.08 0.13 0.08 0.31 Control vs. Low-CP+Met 0.04 0.12 0.32 0.28 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 0.95 A,BValues within the same row with different superscripts are significantly different (P < 0.01). a,bValues within the same row with different superscript are significantly different (P < 0.05). 1Standard error of the mean. View Large Table 8. Chemical blood profiles of broiler chickens fed a low-CP diet with or without sufficient Met from 11 to 24 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low then Normal then Low Item (Trt A) ME(Trt B) -ME(Trt C) ME(Trt D) -ME(Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 36.183A,B 30.176B 31.056B 42.628A 42.993A 1.289 <0.01 Total protein (mg/dl) 26.418A,B 25.024B 25.596B 27.638A 27.463A 0.285 <0.01 Albumin (g/dl) 1.301a,b 1.215b 1.204b 1.356a 1.350a 0.020 0.03 Uric acid (mg/dl) 3.702 4.167 4.328 4.274 4.276 0.199 0.84 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid Control vs. Low-CP 0.08 0.13 0.08 0.31 Control vs. Low-CP+Met 0.04 0.12 0.32 0.28 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 0.95 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal then Low then Normal then Low Item (Trt A) ME(Trt B) -ME(Trt C) ME(Trt D) -ME(Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 36.183A,B 30.176B 31.056B 42.628A 42.993A 1.289 <0.01 Total protein (mg/dl) 26.418A,B 25.024B 25.596B 27.638A 27.463A 0.285 <0.01 Albumin (g/dl) 1.301a,b 1.215b 1.204b 1.356a 1.350a 0.020 0.03 Uric acid (mg/dl) 3.702 4.167 4.328 4.274 4.276 0.199 0.84 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid Control vs. Low-CP 0.08 0.13 0.08 0.31 Control vs. Low-CP+Met 0.04 0.12 0.32 0.28 Low-CP vs. Low-CP+Met <0.01 <0.01 <0.01 0.95 A,BValues within the same row with different superscripts are significantly different (P < 0.01). a,bValues within the same row with different superscript are significantly different (P < 0.05). 1Standard error of the mean. View Large In poultry, TG are synthesized in the liver and transported by the blood system and then taken up into adipose cells by lipoprotein lipase (LPL) (Bunchasak et al., 1997). Adding Met in the Low-CP diet increased the plasma TG level compared to that of chickens fed a low-CP diet. Nukreaw et al. (2011) and Nukreaw and Bunchasak (2015) also demonstrated that adding Met to a Low-CP diet linearly increased the plasma TG concentration. It seems that a high TG level caused by Met supplementation stimulates triglyceride-rich lipoprotein secretion from the liver (Ho et al., 1989) or by depression of the activity of LPL (Wegner et al., 1978; Bunchasak et al., 1997). Total protein, which consists of albumin and globulin, is commonly used in nutritional studies (Poosuwan et al., 2008), since plasma proteins are sensitive to nutritional influences (Kaneko, 1997) and albumin also acts as a mobile source of amino acids in a nutritional emergency (Butler, 1971). Generally, total protein and albumin directly respond to both protein quantity and quality (Tewe, 1985; Eggum, 1989). Ospina-Rojas et al. (2014) reported that supplementing synthetic amino acids in a Low-CP diet increases the total protein and albumin in plasma. Decreases in the levels of plasma albumin and total protein could be related to a deficit of amino acids and protein requirements (Corzo et al., 2009; Hernández et al., 2012), and this deficit may induce difficulty in maintaining homeostasis of protein synthesis in the tissues (Ospina-Rojas et al., 2014). In the present study, it was not surprising that supplementation of Met in the Low-CP diet resulted in higher levels of total plasma protein and albumin than those of the Low-CP diet without supplementation. The 42-day chemical blood test results are shown in Table 9. Triglyceride, total protein, albumin, uric acid, and NEFA levels in the plasma were not significantly affected by dietary treatment. However, in the orthogonal contrast analysis, feeding with the Low-ME diet resulted in a higher level of TG compared to the normal ME and control diets (P < 0.05). Table 9. Chemical blood profiles of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 34.608 36.342 41.504 33.633 42.678 1.212 0.05 Total protein (g/dl) 2.454 2.405 2.266 2.597 2.330 0.063 0.54 Albumin (g/dl) 1.113 1.081 1.085 1.155 1.003 0.036 0.76 Uric acid (mg/dl) 3.303 2.685 2.826 2.729 2.919 0.121 0.49 NEFA (mmol/l)2 0.886 0.908 1.041 0.881 0.882 0.044 0.78 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid NEFA Control vs. Low-CP 0.18 0.50 0.77 0.10 0.48 Control vs. Low-CP or +Met 0.18 0.73 0.73 0.09 0.72 Low-CP vs. Low-CP+Met 0.77 0.37 0.96 0.80 0.37 Control, Normal ME vs. Low-ME <0.01 0.16 0.34 0.89 0.46 Control vs. Normal ME 0.90 0.79 0.96 0.07 0.95 Control vs. Low-ME 0.02 0.38 0.49 0.19 0.55 Normal vs. Low-ME <0.01 0.16 0.37 0.53 0.52 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 34.608 36.342 41.504 33.633 42.678 1.212 0.05 Total protein (g/dl) 2.454 2.405 2.266 2.597 2.330 0.063 0.54 Albumin (g/dl) 1.113 1.081 1.085 1.155 1.003 0.036 0.76 Uric acid (mg/dl) 3.303 2.685 2.826 2.729 2.919 0.121 0.49 NEFA (mmol/l)2 0.886 0.908 1.041 0.881 0.882 0.044 0.78 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid NEFA Control vs. Low-CP 0.18 0.50 0.77 0.10 0.48 Control vs. Low-CP or +Met 0.18 0.73 0.73 0.09 0.72 Low-CP vs. Low-CP+Met 0.77 0.37 0.96 0.80 0.37 Control, Normal ME vs. Low-ME <0.01 0.16 0.34 0.89 0.46 Control vs. Normal ME 0.90 0.79 0.96 0.07 0.95 Control vs. Low-ME 0.02 0.38 0.49 0.19 0.55 Normal vs. Low-ME <0.01 0.16 0.37 0.53 0.52 1Standard error of the mean. 2Non-esterified fatty acid. View Large Table 9. Chemical blood profiles of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 34.608 36.342 41.504 33.633 42.678 1.212 0.05 Total protein (g/dl) 2.454 2.405 2.266 2.597 2.330 0.063 0.54 Albumin (g/dl) 1.113 1.081 1.085 1.155 1.003 0.036 0.76 Uric acid (mg/dl) 3.303 2.685 2.826 2.729 2.919 0.121 0.49 NEFA (mmol/l)2 0.886 0.908 1.041 0.881 0.882 0.044 0.78 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid NEFA Control vs. Low-CP 0.18 0.50 0.77 0.10 0.48 Control vs. Low-CP or +Met 0.18 0.73 0.73 0.09 0.72 Low-CP vs. Low-CP+Met 0.77 0.37 0.96 0.80 0.37 Control, Normal ME vs. Low-ME <0.01 0.16 0.34 0.89 0.46 Control vs. Normal ME 0.90 0.79 0.96 0.07 0.95 Control vs. Low-ME 0.02 0.38 0.49 0.19 0.55 Normal vs. Low-ME <0.01 0.16 0.37 0.53 0.52 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.1 P-value Triglyceride (mg/dl) 34.608 36.342 41.504 33.633 42.678 1.212 0.05 Total protein (g/dl) 2.454 2.405 2.266 2.597 2.330 0.063 0.54 Albumin (g/dl) 1.113 1.081 1.085 1.155 1.003 0.036 0.76 Uric acid (mg/dl) 3.303 2.685 2.826 2.729 2.919 0.121 0.49 NEFA (mmol/l)2 0.886 0.908 1.041 0.881 0.882 0.044 0.78 Probability levels of contrast Contrast statement Triglyceride Total protein Albumin Uric acid NEFA Control vs. Low-CP 0.18 0.50 0.77 0.10 0.48 Control vs. Low-CP or +Met 0.18 0.73 0.73 0.09 0.72 Low-CP vs. Low-CP+Met 0.77 0.37 0.96 0.80 0.37 Control, Normal ME vs. Low-ME <0.01 0.16 0.34 0.89 0.46 Control vs. Normal ME 0.90 0.79 0.96 0.07 0.95 Control vs. Low-ME 0.02 0.38 0.49 0.19 0.55 Normal vs. Low-ME <0.01 0.16 0.37 0.53 0.52 1Standard error of the mean. 2Non-esterified fatty acid. View Large Lipid accumulation in cells depends upon the balance between lipogenesis and lipolysis of TG responsive to dietary modifications (Kersten, 2001). Fat deposition in adipose tissue also depends on a change in the relative activity of LPL, which mediates the uptake of fatty acid from the blood (plasma TG) and hormone-sensitive lipase, which mediates the output of fatty acid from adipose tissue (plasma NEFA) (Paik and Yearick, 1978). Since there were no significant differences among the treatment groups with regard to the uric acid, total protein, albumin, or NEFA levels, this indicated that chickens can harmonize their blood metabolism to normal metabolic status after the finisher period. This was in accordance with our recent study that found that a finisher period normalized plasma lipid levels via TG transportation and lipolysis pathways (Jariyahatthakij et al., 2016). Feeding with a Low-ME diet conversely increased plasma TG compared to a normal ME diet, while the abdominal fat content decreased. It may be assumed that a high plasma TG level in Low-ME groups may be caused by the interruption of TG uptake from blood to extrahepatic tissue. Lipid Gene Expression The effects of experimental diets on gene expression in the liver of chickens are presented in Table 10. At 42 d of age, the dietary treatments did not significantly affect the expression of the ACC, CPT-I, or avANT genes. However, adding Met in the Low-CP diet (Trt D and E) tended to decrease the expression of the ACC gene compared to the Trt A (P = 0.09). Additionally, feeding with Low-ME diets tended to decrease the expression of the CPT-I gene compared to the normal ME diets (P = 0.08). Table 10. Gene expression of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item1 (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.2 P-value ACC (AU*) 4.295 1.508 2.298 1.343 1.240 0.606 0.51 CPT-I (AU*) 0.068 0.072 0.032 0.065 0.028 0.009 0.44 avANT (AU*) 0.540 0.888 0.663 0.610 0.730 0.076 0.71 Probability levels of contrast Contrast statement ACC CPT-I avANT Control vs. Low-CP 0.18 0.54 0.30 Control vs. Low-CP+Met 0.09 0.41 0.56 Control, Normal ME v.s Low-ME 0.63 0.06 0.92 Control vs. Low-ME 0.15 0.15 0.49 Normal ME vs. Low-ME 0.81 0.08 0.77 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item1 (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.2 P-value ACC (AU*) 4.295 1.508 2.298 1.343 1.240 0.606 0.51 CPT-I (AU*) 0.068 0.072 0.032 0.065 0.028 0.009 0.44 avANT (AU*) 0.540 0.888 0.663 0.610 0.730 0.076 0.71 Probability levels of contrast Contrast statement ACC CPT-I avANT Control vs. Low-CP 0.18 0.54 0.30 Control vs. Low-CP+Met 0.09 0.41 0.56 Control, Normal ME v.s Low-ME 0.63 0.06 0.92 Control vs. Low-ME 0.15 0.15 0.49 Normal ME vs. Low-ME 0.81 0.08 0.77 1ACC = acetyl-CoA carboxylase; CPT-I = carnitine palmitoyl CoA transferase I; avANT = avian adenine nucleotide translocator. 2Standard error of the mean. *The mRNA values (in arbitrary units, AU) are expressed as ratio of the β-actin mRNA values. View Large Table 10. Gene expression of broiler chickens fed a low-protein diet with or without sufficient Met from 11 to 24 d of age and subsequent feeding with a normal or low energy diet from 25 to 42 d of age. Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item1 (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.2 P-value ACC (AU*) 4.295 1.508 2.298 1.343 1.240 0.606 0.51 CPT-I (AU*) 0.068 0.072 0.032 0.065 0.028 0.009 0.44 avANT (AU*) 0.540 0.888 0.663 0.610 0.730 0.076 0.71 Probability levels of contrast Contrast statement ACC CPT-I avANT Control vs. Low-CP 0.18 0.54 0.30 Control vs. Low-CP+Met 0.09 0.41 0.56 Control, Normal ME v.s Low-ME 0.63 0.06 0.92 Control vs. Low-ME 0.15 0.15 0.49 Normal ME vs. Low-ME 0.81 0.08 0.77 Low-CP, Low-CP, Low-CP+Met, Low-CP+Met, Control then Normal ME then Low-ME then Normal ME then Low-ME Item1 (Trt A) (Trt B) (Trt C) (Trt D) (Trt E) s.e.m.2 P-value ACC (AU*) 4.295 1.508 2.298 1.343 1.240 0.606 0.51 CPT-I (AU*) 0.068 0.072 0.032 0.065 0.028 0.009 0.44 avANT (AU*) 0.540 0.888 0.663 0.610 0.730 0.076 0.71 Probability levels of contrast Contrast statement ACC CPT-I avANT Control vs. Low-CP 0.18 0.54 0.30 Control vs. Low-CP+Met 0.09 0.41 0.56 Control, Normal ME v.s Low-ME 0.63 0.06 0.92 Control vs. Low-ME 0.15 0.15 0.49 Normal ME vs. Low-ME 0.81 0.08 0.77 1ACC = acetyl-CoA carboxylase; CPT-I = carnitine palmitoyl CoA transferase I; avANT = avian adenine nucleotide translocator. 2Standard error of the mean. *The mRNA values (in arbitrary units, AU) are expressed as ratio of the β-actin mRNA values. View Large The avian liver is the most important organ for the intermediary metabolism of lipids and energy (Huang et al., 2013). The hepatic total lipid content is highly regulated by several metabolic pathways such as fatty acid synthesis, lipid transport, and β-oxidation (Kikusato et al., 2015). Body fat accumulation is considered the net result of the balance among dietary absorbed fat, fat synthesis, and catabolism (Huang et al., 2013; Tu et al., 2016). Increasing activity of ACC increases body fat because it is the rate-limiting enzyme of the biosynthesis of fatty acids by catalyzing ACC to malonyl-CoA (Donaldson, 1985). Therefore, ACC transcription was low in the liver of starved chickens (Hillgartner et al., 1996). In the present study, adding Met in the Low-CP diet tended to decrease the expression of the ACC gene (P = 0.09) and significantly decreased the abdominal fat content compared to the control group after the finisher period. This indicated that adding Met may have a long-term effect on the depression of fatty acids synthesis after feeding with normal ME or Low-ME diets. The β-oxidation of fatty acids in mitochondria is an important source of NADH, FADH2, and ATP production (Kikusato et al., 2015). The β-oxidation rate is mainly dependent on the actual capacity of the carnitine transport system (Brouns and Vusse, 1998). In chickens, mitochondrial CPT-I activity has been characterized mostly in the liver (Ishii et al., 1985; Lien and Horng, 2001) and rarely in muscle (Blomstrand et al., 1983). Furthermore, avANT is responsible for the exchange of cytosolic adenine diphosphate for mitochondrial matrix ATP across the inner mitochondrial membrane (Ojano-Dirain et al., 2007). It has been reported that some lipogenic genes such as ACC and CPT-I are involved in the hepatic response to nutritional intervention (Daval et al., 2000), although the role of these genes in the hepatic lipid metabolism after early feed restriction in broilers has not been fully clarified (Yang et al., 2010). We hypothesized that fatty acid imported through CPT-I and avANT may be increased by feeding with a Low-ME diet. Surprisingly, the expression of the CPT-I gene tended to decrease when feeding with a Low-ME diet (P = 0.08). Due to low energy intake of the Low-CP diet groups during the finisher period and the decline in the abdominal fat to a level equal to the control group, the chickens may attempt to maintain their body energy reserve as fat via homeostatic processes, resulting in a tendency for low CPT-I gene expression. Consequently, lipolysis (NEFA) and the expression of gene-related ATP synthesis (avANT) were not significantly affected. In conclusion, reducing dietary protein with Met supplementation during the grower period (age 11 to 24 d) and subsequently feeding with a conventional or Low-ME diet to market age is an appropriate strategy for improving the efficiency of nutrient utilization and carcass and breast meat yield in regard to body energy reserve (fat deposit) and the homeostatic processes (lipogenesis and β-oxidation). SUPPLEMENTARY DATA Supplementary data are available at Poultry Science online. Supplemental Table. Amino acids pattern of experimental diets. ACKNOWLEDGMENTS The authors gratefully acknowledge funding from Charoen Pokphand Group Co., Ltd. The authors would like to acknowledge the Thailand Research Fund for a scholarship and financial support of P. Jariyahatthakij under the Royal Golden Jubilee PhD program. Thanks are also recorded to the Center of Advanced Study for Agriculture and Food, Institute for Advanced Studies, Kasetsart University, Bangkok, Thailand, and to the staff of the Department of Animal Science, Kasetsart University. REFERENCES Abdel-Maksoud A. , Yan F. , Cerrate S. , Coto C. , Wang Z. , Waldroup P. W. . 2010 . Effects of dietary crude protein, lysine level and amino acid balance on performance of broilers 0 to 18 days of age . Int. J. Poult. Sci . 9 : 21 – 27 . Google Scholar CrossRef Search ADS Abe T. , Mujahid A. , Sato K. , Akiba Y. , Toyomizu M. . 2006 . Possible role of avian uncoupling protein in down-regulating mitochondrial superoxide production in skeletal muscle of fasted chickens . FEBS Lett . 580 : 4815 – 4822 . Google Scholar CrossRef Search ADS PubMed Aftab U. , Ashraf M. , Jiang Z. . 2006 . Low protein diets for broilers . World's Poult. Sci. J . 62 : 688 – 701 . Google Scholar CrossRef Search ADS Aletor V. A , Hamid I. I. , Niess E. , Pfeffer E. . 2000 . Low protein amino acids supplemented diets in broiler chickens: Effects on performance, carcass characteristics, whole body composition and efficiencies of nutrient utilization . J. Sci. Food Agric . 80 : 547 – 554 . Google Scholar CrossRef Search ADS Association of Official Analytical Chemists (AOAC) . 2016 . Official methods of analysis . 20th edn . Association of Official Analytical Chemists : Washington, DC . Aviagen . 2007 . Ross 308: broiler nutrition specification . Aviagen Inc. : 5 Huntsville, AL . Bikker P. M. , Verstegen W. A. , Kemp B. , Bosch M. W. . 1996 . Performance and body composition of finishing gilts (45 to 85 kilograms) as affected by energy intake and nutrition in earlier life: 1. Growth of the body and body components . J. Anim. Sci . 74 : 806 – 816 . Google Scholar CrossRef Search ADS PubMed Blomstrand E. , Challiss R. A. , Cooney G. J. , Newsholme E. A. . 1983 . Maximal activities of hexokinase, 6-phosphofructokinase, oxoglutarate dehydroge- nase, and carnitine palmitoyltransferase in rat and avian muscles . Biosci. Rep . 3 : 1149 – 1153 . Google Scholar CrossRef Search ADS PubMed Boomgaardt J. , Baker D. H. . 1973 . Effect of dietary energy concentration on sulfur amino acid requirements and body composition of young chicks . J. Anim. Sci . 36 : 307 – 311 . Google Scholar CrossRef Search ADS PubMed Brouns F. , Vusse G. J. . 1998 . Utilisation of lipids in human subjects: Metabolic and dietary constrains . Br. J. Nutr . 79 : 117 . Google Scholar CrossRef Search ADS PubMed Bunchasak C. 2009 . Role of dietary methionine in poultry production . J. Poult. Sci. 46 : 169 – 179 . Google Scholar CrossRef Search ADS Bunchasak C. , Keawarun N. . 2006 . Effect of methionine hydroxyl analog-free acid on growth performance and chemical composition of liver of broiler chicks fed a corn-soybean based diet from 0 to 6 weeks of age . Anim. Sci. J . 77 : 95 – 102 . Google Scholar CrossRef Search ADS Bunchasak C. , Satoso U. , Tanaka K. , Ohtani S. , Collado C. M. . 1997 . The effect of supplementing methionine plus cysteine to a low-protein diet on the growth performance and fat accumulation of growing broiler chicks . Asian-Australian J. Anim. Sci . 10 : 185 – 191 . Google Scholar CrossRef Search ADS Butler E. J. 1971 . Physiology and Biochemistry of Domestic Fowl . Academic Press , London, UK . Cabel M. C. , Goodwin T. L. , Waldroup P. W. . 1987 . Reduction in abdominal fat content of broiler chickens by the addition of feather meal to finisher diets . Poult. Sci . 66 : 1644 – 1651 . Google Scholar CrossRef Search ADS Cauwenbreghe S. V. , Burnham D. . 2001 . New developments in amino acid and protein nutrition of poultry, as related to optimal performance and reduced nitrogen excretion . 13th European Symposium Poultry Nutrition Blankenberg , Belgium . Cheng T. K , Hamre M. L. , Coon C. N. . 1997 . Effect of environmental temperature, dietary protein, and energy levels on broiler performance . J. Appl. Poult. Res . 6 : 1 – 17 . Google Scholar CrossRef Search ADS Collin A. , Malheiros R. D. , Moraes V. M. B. , Van As P. , Darras V. M. , Taouis M. , Decuypere E. , Buyse J. . 2003 . Effects of dietary macronutrient content on energy metabolism and uncoupling protein mRNA expression in broiler chickens . Br. J. Nutr . 20 : 261 – 269 . Google Scholar CrossRef Search ADS Corzo A. , Loar R. E. II , Kidd M. T. . 2009 . Limitations of dietary isoleucine and valine in broiler chicks diets . Poult. Sci . 88 : 1934 – 1938 . Google Scholar CrossRef Search ADS PubMed Daval S. , Lagarrigue S. , Douaire M. . 2000 . Messenger RNA levels and transcription rates of hepatic lipogenesis genes in genetically lean and fat chickens . Gen. Select. Evol . 32 : 521 – 531 . Google Scholar CrossRef Search ADS Dean D. W. , Bidner T. D. , Southern L. L. . 2006 . Glycine supplementation to low protein, amino acid-supplemented diets supports optimal performance of broiler chicks . Poult. Sci . 85 : 288 – 296 . Google Scholar CrossRef Search ADS PubMed Donaldson W. E. 1985 . Lipogenesis and body fat in chicks: Effects of calorie–protein ratio and dietary fat . Poult. Sci. 64 : 1199 – 1204 . Google Scholar CrossRef Search ADS PubMed Duncan D. M. 1955 . Multiple range and multiple F test . Biometrics . 11 : 42 . Google Scholar CrossRef Search ADS Eggum B. O. 1989 . Biochemical and methodological principles . In: Bock H. D. , Eggum B. , Low A. G. , Simon O. , Zebrowska T. (eds). Protein Metabolism in Farm Animals. Evaluation, Digestion, Absorption and Metabolism . Oxford Science Publication . Deutscher Handwirtschafts Verlag. Berlin , pp. 1 – 52 . Faria Filho F. D. E. , Rosa P. S. , Vieira B. S. , Macari M. , Furlan R. L. . 2003 . Protein levels and environmental temperature effects on carcass characteristics, performance and nitrogen excretion of broiler chickens from 7 to 21 days of age . Braz. J. Poult. Sci . 7 : 247 – 253 . Furlan R. L. , Faria Filho DE. De. , Rosa P. S. , Macari M. . 2004 . Does low-protein diet improve broiler performance under heat stress conditions? Braz. J. Poult. Sci. 6 : 71 – 79 . Hernández F. , López M. , Martínez S. , Megías M. D. , Catalá P. , Madrid J. . 2012 . Effect of low-protein diets and single sex on production performance, plasma metabolites, digestibility, and nitrogen excretion in 1- to 48 day-old broiler . Poult. Sci . 91 : 683 – 692 . Google Scholar CrossRef Search ADS PubMed Hillgartner F. B. , Charron T. , Chesnut K. A. . 1996 . Alterations in nutritional status regulate acetyl-CoA carboxylase expression in avian liver by a transcriptional mechanism . Biochem. J. 319 : 263 – 268 . Google Scholar CrossRef Search ADS PubMed Hiramoto K. , Muramatsu T. , Okumura J. . 1990 . Effect of methionine and lysine deficiencies on protein synthesis in the liver and oviduct and in the whole body of laying hens . Poult. Sci . 69 : 84 – 89 . Google Scholar CrossRef Search ADS PubMed Ho H. T. , Kim D. N. , Lee K. T. . 1989 . Intestinal apolipoprotein B-48 synthesis and lymphatic cholesterol transport are lower in swine fed high fat, high cholesterol diet with soy protein than with casein . Atherosclerosis . 77 : 15 . Google Scholar CrossRef Search ADS PubMed Huang J. , Zhang Y. , Zhou Y. , Zhang Z. , Xie Z. , Zhang J. , Wan X. . 2013 . Green tea polyphenols alleviate obesity in broiler chickens through the regulation of lipid-metabolism-related genes and transcription factor expression . J. Agric. Food Chem . 61 : 8565 – 8572 . Google Scholar CrossRef Search ADS PubMed Ishii H. , Ishii S. , Suga T. , Kazama M. . 1985 . Developmental changes in the activities of peroxisomal and mitochondrial beta-oxidation in chicken liver . Arch. Biochem. Biophys . 237 : 151 – 159 . Google Scholar CrossRef Search ADS PubMed Jariyahatthakij P. , Chomtee B. , Poeikhampha T. , Loongyai W. , Bunchasak C. . 2016 . Methionine supplementation of low-protein diet and subsequent feeding of low-energy diet on the performance and blood chemical profile of broiler chickens . Anim. Prod. Sci.(Abs). Jiang Q. , Waldroup P. W. , Fritts C. A. . 2005 . Improving the utilization of diets low in crude protein for broiler chicken. 1. Evaluation of special amino acid supplementation to diets low in crude protein . In. J. Poult. Sci . 4 : 115 – 122 . Google Scholar CrossRef Search ADS Kamran Z. , Mirza M. A. , Haq A. U. , Mahmood S. . 2004 . Effects of decreasing dietary protein levels with optimum amino acids profile on the performance of broiler . Pakistan Vet. J. 24 : 165 – 168 . Kamran Z. , Sarwar M. , Nisa M. , Nedeem M. A. , Mahmood S. , Babars M. E. , Ahmed S . 2008 . Effect of low-protein diets having constant energy to protein ratio on performance and carcass characteristics of broiler chickens from one to thirty-five day of age . Poult. Sci . 87 : 468 – 474 . Google Scholar CrossRef Search ADS PubMed Kaneko J. J. 1997 . Serum proteins and the dysproteinemias . In: Kaneko J. J. , Harvey J. W. , Bruss M. L. (eds). Clinical Biochemistry of Domestic Animals , 5th ed . ( San Diego, CA : Academic Press ). Kersten S. 2001 . Mechanisms of nutritional and hormonal regulation of lipogenesis . Embo. Rep. 2 : 282 – 286 . Google Scholar CrossRef Search ADS PubMed Khajali F. , Moghaddam N. , Mesgaran M. D. , Shareghi B. . 2002 . Growth performance and efficiency of nitrogen utilization of broiler as affected by methionine deficiency . Iranian Journal of Agricultural Science and Nature Resource . 9 : 193 – 204 . Kikusato M. , Sudo S. , Toyomizu M. . 2015 . Methionine deficiency leads to hepatic fat accretion via impairment of fatty acid import by carnitine palmitoyltransferase I . Br. Poult. Sci . 56 : 225 – 231 . Google Scholar CrossRef Search ADS PubMed Labadan M. C. Jr. , Hsu K. N. , Austic R. E. . 2001 . Lysine and arginine requirements of broiler chickens at two- to three-week intervals to eight weeks of age . Poult. Sci . 80 : 599 – 606 . Google Scholar CrossRef Search ADS PubMed Lee K. H. , Leeson S. . 2001 . Performance of broilers fed limited quantities of feed or nutrient during seven to fourteen days of age . Poult. Sci . 80 : 446 – 454 . Google Scholar CrossRef Search ADS PubMed Leeson S. , Caston L. , Summers J. D. . 1996 . Broiler response to energy or energy and protein dilution in the finisher diet . Poult. Sci . 75 : 522 – 528 . Google Scholar CrossRef Search ADS PubMed Lien T. F. , Horng Y. M. . 2001 . The effect of supplementary dietary L-carnitine on the growth performance, serum components, carcase traits and enzyme activities in relation to fatty acid beta-oxidation of broiler chickens . Br. Poult. Sci . 42 : 92 – 95 . Google Scholar CrossRef Search ADS PubMed Moran E. T. Jr . 1994 . Response of broiler strains differing in body fat to inadequate methionine: Live performance and processing yields . Poult. Sci. 73 : 1116 – 1126 . Google Scholar CrossRef Search ADS PubMed Namroud N. F. , Shivazad M. , Zaghari M. . 2008 . Effects of fortifying low crude protein diet with crystalline amino acids on performance, blood ammonia level, and excreta characteristics of broiler chicks . Poult. Sci . 87 : 2250 – 2258 . Google Scholar CrossRef Search ADS PubMed Nawaz H. , Mushtaq T. , Yaqoob M. . 2006 . Effect of varying levels of energy and protein on live performance and carcass characteristics of broiler chicks . J. Poult. Sci . 43 : 388 – 393 . Google Scholar CrossRef Search ADS Nukreaw R. , Bunchasak C. . 2015 . Effects on supplementing synthetic amino acids in low-protein diet and subsequent re-feeding on growth performance, serum lipid profile and chemical body composition of broiler chickens . J. Poult. Sci . 52 : 127 – 136 . Google Scholar CrossRef Search ADS Nukreaw R. , Bunchasak C. , Markvichitr K. , Choothesa A. , Prasanpanich S. , Loongyai W. . 2011 . Effects of methionine supplementation in low-protein diets and subsequent re-feeding in growth performance, liver and serum lipid profile, body composition and carcass quality of broiler chickens at 42 days of age . J. Poult. Sci . 48 : 229 – 238 . Google Scholar CrossRef Search ADS Ojano-Dirain C. , Toyomizu M. , Wing T. , Cooper M. , Bottje W. G. . 2007 . Gene expression in breast muscle and duodenum from low and high feed efficient broilers . Poult. Sci . 86 : 372 – 381 . Google Scholar CrossRef Search ADS PubMed Ospina-Rojas I. C. , Murakami A. E. , Duarte C. R. A. , Eyng C. , Oliveira C. A. L. , Janeiro V. . 2014 . Valine, isoleucine, arginine and glycine supplementation of low-protein diets for broiler chickens during the starter and grower phases . Br. Poult. Sci . 55 : 766 – 773 . Google Scholar CrossRef Search ADS PubMed Paik H. S. , Yearick E. S. . 1978 . Influence of dietary and meal frequency on lipoprotein lipase and hormone sensitive lipase in rat adipose tissue . J. Nutr . 108 : 179 – 185 . Google Scholar CrossRef Search ADS Poosuwan K. , Bunchasak C. , Kaewtapee C. . 2008 . Long-term feeding effects of dietary protein levels on egg production, immunocompetence and plasma amino acids of laying hens in subtropical condition . J. Anim. Physiol. Anim. Nutr . 94 : 186 – 195 . Google Scholar CrossRef Search ADS Rakangtong C. , Bunchasak C. . 2011 . Effects of total sulfur amino acids in corn-cassava-soybean diets on growth performance, carcass yield and blood chemical profile of male chickens from 1 to 42 days of age . Anim. Prod. Sci . 51 : 198 – 203 . Google Scholar CrossRef Search ADS Richards M. P. , Poch S. M. , Coon C. N. , Rosebrough R. W. , Ashwell C. M. , McMurtry J. P. . 2003 . Feed restriction significantly alters lipogenic gene exoression in broiler breeder chickens . J. Nutr . 133 : 707 – 715 . Google Scholar CrossRef Search ADS PubMed Rosebrough R. W. , Steele N. C. . 1985 . Energy and protein relationships in broilers: Effect of protein levels and feeding regimens on growth, body composition and in vitro lipogenesis of broiler chicks . Poult. Sci . 64 : 126 – 199 . Saki A. A. , Mohammad Pour H. A. , Ahmdi A. , Akhzar M. T. , Tabatabie M. M. . 2007 . Decreasing broiler crude protein requirement by methionine supplementation . Pakistan J. Biol. Sci . 10 : 757 – 762 . Google Scholar CrossRef Search ADS Schutte J. B. , Pack M. . 1995 . Sulfur amino acid requirement of broiler chicks from fourteen to thirty-eight days of age. 1. Performance and carcass yield . Poult. Sci . 74 : 480 – 487 . Google Scholar CrossRef Search ADS PubMed Si J. , Fritts C. A. , Burnham D. J. , Waldroup P. W. . 2001 . Relationship of dietary lysine level to the concentration of all essential amino acids in broiler diets . Poult. Sci . 80 : 1472 – 1479 . Google Scholar CrossRef Search ADS PubMed Skiba-Cassy S. , Collin A. , Chartrin P. , Medale F. , Simon J. , Duclos M. J. , Tesseraud S. . 2007 . Chicken liver and muscle carnitine palmitoyltransferase 1: Nutritional regula- tion of messengers . Comparative Biochemistry and Physiology Part B. Biochem. Mol. Biol . 147 : 278 – 287 . Google Scholar CrossRef Search ADS Swennen Q. , Janssens G. P. J. , Collin A. , Bihan-Duval E. L. , Verbeke K. , Decuypere E. , Buyse J. . 2006 . Diet-induced thermogenesis and glucose oxidation in broiler chickens: Influence of genotype and diet composition . Poult. Sci . 85 : 731 – 742 . Google Scholar CrossRef Search ADS PubMed Swennen Q. , Janssens G. P. J. , Decuypere E. , Buyse J. . 2004 . Effects of substitution between fat and protein on feed intake and its regulatory mechanisms in broiler chickens: Energy and protein metabolism and diet-induced thermogenesis . Poult. Sci . 83 : 1997 – 2004 . Google Scholar CrossRef Search ADS PubMed Tewe O. O. 1985 . Protein metabolism in growing pigs fed corn or cassava peel based diets containing graded protein levels . Res. Vet. Sci. 29 : 259 – 263 . Tian J. , Wang S. , Wang Q. , Leng L. , Hu X. , Li H. . 2010 . A single nucleotide polymorphism of chicken acetyl CoA carboxylase A gene associated with fatness trials . Anim. Biotech. 21 : 42 – 50 . Google Scholar CrossRef Search ADS Toyomizu M. , Ueda M. , Sato S. , Seki Y. , Sato K. , Akiba Y. . 2002 . Cold-induced mitochondrial uncoupling and expression of chicken UCP and ANT mRNA in chicken skeletal muscle . FEBS Lett . 529 : 313 – 318 . Google Scholar CrossRef Search ADS PubMed Toyomizu M. , Abe T. , Ueda M. , Akiba Y. . 2006 . Progressive alteration of UCP and ANT in skeletal muscle of fasted chicken . J. Poult. Sci . 43 : 167 – 172 . Google Scholar CrossRef Search ADS Tu Y. , Su Y. , Li G. , Zhang X. , Tong H. 2016 . Expression of lipid metabolism-associated genes in male and female white feather chicken . J. Poult. Sci. 53 : 118 – 123 . Google Scholar CrossRef Search ADS Wegner M. S. , Kelley J. L. , Nelson E. C. , Alaupovic P. , Thayer R. H. . 1978 . Lipid metabolism in laying hen: the relationship of plasma lipid and liver fatty acid synthetase activity to changes in liver composition . Poult. Sci . 25 : 573 – 582 . Yamazaki M. , Murakami H. , Nakashima K. , Abe H. , Takemasa M. . 2006 . Effects of excess essential amino acids in low protein diet on abdominal fat deposition and nitrogen excretion of the broiler chicks . J. Poult. Sci . 43 : 150 – 155 . Google Scholar CrossRef Search ADS Yang X. , Zhuang J. , Rao K. , Li X. , Zhao R. . 2010 . Effect of early feed restriction on hepatic lipid metabolism and expression of lipogenic genes in broiler chickens . Res. Vet. Sci . 89 : 438 – 444 . Google Scholar CrossRef Search ADS PubMed Yang Y. X. , Guo J. , Yoon S. Y. , Jin Z. , Choi J. Y. , Piao X. S. , Kim B. W. , Ohh S. J. , Wang M. H. , Chae B. J. . 2009 . Early energy and protein reduction: Effects on growth, blood profiles and expression of genes related to protein and fat metabolism in broilers . Br. Poult. Sci . 50 : 218 – 227 . Google Scholar CrossRef Search ADS PubMed Zhan X. A. , Wang M. , Ren H. , Zhao R. Q. , Li J. X. , Tan Z. L. . 2007 . Effect of early feed restriction on metabolic programming and compensatory growth in broiler chickens . Poult. Sci . 86 : 654 – 660 . Google Scholar CrossRef Search ADS PubMed Zubair A. K. , Leeson S. . 1996 . Compensatory growth in the broiler chicken: A review . World's Poult. Sci . 52 : 189 – 182 Google Scholar CrossRef Search ADS © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Poultry ScienceOxford University Press

Published: Mar 5, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off