Effect of dietary xylooligosaccharides on intestinal characteristics, gut microbiota, cecal short-chain fatty acids, and plasma immune parameters of laying hens

Effect of dietary xylooligosaccharides on intestinal characteristics, gut microbiota, cecal... Abstract This study examined the prebiotic effects of xylooligosaccharides (XOS) on intestinal characteristics, gut microbiota, cecal short-chain fatty acids, plasma calcium metabolism, and immune parameters of laying hens. A total of 1,080 White Lohmann laying hens (28 wk of age) was assigned to 6 dietary treatments that included XOS at concentrations of 0, 0.01, 0.02, 0.03, 0.04, or 0.05% for 8 weeks. Each treatment had 6 replicates with 10 cages (3 birds/cage). Blood, intestinal tissues, and cecal digesta samples were collected from chickens at the end of the experiment. Villus height, crypt depth, the villus to crypt (VH: CD) ratio, and the relative length of different intestinal sections were evaluated. Additionally, the number of microorganisms and the content of short-chain fatty acids in cecal digesta samples were determined. Plasma concentrations of immunoglobulin A (IgA), immunoglobulin G, immunoglobulin M (IgM), interleukin 2 (IL-2), tumor necrosis factor-α(TNF-α), 1, 25-dihydroxyvitamin D3 (1,25(OH)2D3), calcitonin (CT), and parathyroid hormone (PTH) were also determined. The results showed that villus height and the VH: CD ratio of the jejunum were increased (linear, P < 0.01) with the increase in dietary XOS concentration, and the relative length of the jejunum (P = 0.03) was increased significantly in XOS diets. Dietary supplementation of XOS significantly increased (linear, P < 0.01) the number of Bifidobacteria in the cecum; however, total bacteria count, Lactobacillus, and Escherichia coli in the cecum were not affected by XOS supplementation. In addition, inclusion of XOS increased (linear, P < 0.01) the content of butyrate in the cecum; and the content of acetic acid showed a linear increasing trend (P = 0.053) with increasing concentration of XOS in the diets. Supplementation with XOS increased (quadratic, P < 0.05) the content of 1,25(OH)2D3 in plasma. There were no significant differences (P > 0.05) in the content of CT and PTH among dietary treatments. Furthermore, dietary XOS increased contents of IgA (linear, P < 0.05), TNF-α (linear, P < 0.05), IgM (linear, P < 0.05; quadratic, P < 0.05), and IL-2 (quadratic, P < 0.05). Taken together, it was suggested that supplemental XOS can enhance the intestinal health and immune function of laying hens by positively influencing the intestinal characteristics, gut microbiota, cecal short-chain fatty acids, and immune parameters. INTRODUCTION With the improvement of people's living standard, people pay more and more attention to personal health, and the expectation is that food is not only delicious to eat but is also safe and healthful. Since the discovery of antibiotics, they have been widely used in animal feed to promote growth and prevent diseases (Teillant et al., 2015). However, in recent decades, awareness of the potential hazards of antibiotic abuse has gradually increased, with problems including drug resistance and residues in animal tissues (Er et al., 2013). Consequently, the animal industry has been compelled to find alternatives to antibiotics or at least reduce the amount of antibiotics used in livestock diets. In recent years, many antibiotic substitutes have been developed, including prebiotics, acidifiers, and plant extracts, (Świątkiewicz et al., 2010; Kaya et al., 2013). The xylooligosaccharides (XOS) are a type of prebiotic, which is a mixture of oligosaccharides formed by xylose residues linked through β-(1–4)-linkages. The number of xylose residues involved in their formation can vary between 2 and 10, and they are called xylobiose, xylotriose, etc. (Aachary and Prapulla, 2011). The technological features of XOS are also favorable and include stability at acidic pH, heat resistance, the ability to achieve significant biological effects at low daily doses, low calorie content, and nontoxicity (Carvalho et al., 2013). An in vitro experimental study found that XOS as carbon and energy sources can promote the growth of beneficial bacteria, such as Bifidobacterium adolescentis, B. longum, Lactobacillus brevis, and L. fermentum (Moura et al., 2007). Based on these properties, XOS are considered as substitutes for the antibiotics used in poultry feed. Animal feed that contains certain functional oligosaccharides, including mannanoligosaccharides (MOS) and fructooligasaccharide (FOS), may improve intestinal morphology in broilers (Xu et al., 2003; Pourabedin et al., 2014). Early studies also found that the functional oligosaccharides may influence the availability of calcium and magnesium. Their main mechanisms include reducing PH in the intestinal tract and increasing solubility of minerals, and increasing the surface area of intestinal absorption by promoting the proliferation of intestinal epithelial cells (Lopez et al., 2000). As one of the functional oligosaccharides, XOS may have a similar effect. Additionally, studies show that dietary supplementation with 5–20 g/kg XOS increased growth performance and the levels of serum triiodothyronine, thyroxine, and insulin and improved immune function in broilers (Zhenping et al., 2013). Pourabedin et al. (2015) also reported that supplementation of XOS into male broiler chicken (Ross × Ross) diet at 2 g/kg increased the proportion of the genus Lactobacillus in the cecum and also increased the cecal concentrations of acetate and propionate. However, few studies have examined the effects of XOS in laying hens. Previous studies have shown that 0.01 to 0.05% XOS can improve performance and egg quality of laying hens (Zhou et al., 2009), but the effect of XOS on intestinal health and immune function in laying hens is unclear. Therefore, the present study was conducted to investigate the influence of supplemental XOS on intestinal morphology, gut microbiota, short-chain fatty acids, and immune response of laying hens. MATERIALS AND METHODS Experimental birds, diets, and management The present study was performed on a poultry farm (Ya’an, China), and the Animal Care and Use Committee of Sichuan Agricultural University approved all experimental procedures. A total of 1,080 White Lohmann laying hens (28 wk old) was assigned to 6 dietary treatments that included XOS concentrations of 0, 0.01, 0.02, 0.03, 0.04, or 0.05% for 8 weeks. Each treatment had 6 replicates with 10 cages (3 birds/cage). Each treatment was uniformly distributed in the layer house to minimize environment effects. All hens were housed in an environmentally controlled house with the temperature maintained at approximately 24°C. Ventilation and lighting (16L:8D) were automatically controlled in the house. All hens were supplied with feed and water ad libitum. The hens were fed diets in mash form during the experiment (28 to 36 wk of age). The basal diets (Table 1) were based on maize and soybean meal, with composition and nutrient levels consistent with the Agricultural Trade Standardization of China (NY/T33–2004). The basal diet contained 0, 0.01, 0.02, 0.03, 0.04. or 0.05% XOS in the 6 dietary treatments. To prepare the experimental diet, the maximum and minimum concentrations of the experimental diet were first mixed separately and then used to prepare the other experimental concentrations. Table 1. Ingredients and nutrient content of the basal diet fed to laying hens. Ingredients  Contents (%)  Corn  60.5  Soybean meal, 43%  27.2  Soybean oil  1.65  Limestone (coarse)  4.09  Limestone (fine)  4.09  CaHPO4  1.26  Common salt  0.4  Mineral premix1  0.5  Vitamin premix2  0.03  Choline chloride  0.1  DL-Met  0.18  Total  100  Calculated nutrient content    Apparent metabolizable energy, kcal/kg  2700  Crude protein, %  16.5  Calcium, %  3.6  Available phosphorus, %  0.32  Lysine, %  0.87  Methionine, %  0.43  Methionine+cysteine, %  0.95  Ingredients  Contents (%)  Corn  60.5  Soybean meal, 43%  27.2  Soybean oil  1.65  Limestone (coarse)  4.09  Limestone (fine)  4.09  CaHPO4  1.26  Common salt  0.4  Mineral premix1  0.5  Vitamin premix2  0.03  Choline chloride  0.1  DL-Met  0.18  Total  100  Calculated nutrient content    Apparent metabolizable energy, kcal/kg  2700  Crude protein, %  16.5  Calcium, %  3.6  Available phosphorus, %  0.32  Lysine, %  0.87  Methionine, %  0.43  Methionine+cysteine, %  0.95  1Supplied per kilogram of diet: 60 mg Fe (as FeSO4·H2O); 8 mg Cu (as CuSO4·5H2O); 60 mg Mn (as MnSO4·H2O) 80 mg Zn (as ZnSO4·H2O); 0.35 mg I (as KI); 0.3 mg Se (as Na2SeO3). 2Supplied per kilogram of diet: vitamin A, 10,000 IU; vitamin D3, 3000 IU; vitamin E, 5 IU; vitamin K, 0.5 mg; vitamin B1, 0.8 mg; vitamin B2, 2.5 mg; vitamin B6, 0.1 mg; vitamin B12, 0.009 mg; pantothenic acid, 7.5 mg; folic acid, 0.15 mg; niacin, 20 mg; biotin, 0.135 mg. View Large Sample collection and preparation At the end of the experimental period, 6 birds from each treatment were randomly selected (one bird per replicate). Blood was drawn from the wing vein using sterilized needles and randomly selected syringes and placed in anticoagulant tubes containing heparin sodium to allow plasma collection. Feed was not withdrawn from the trough before the blood was collected. After the blood was collected, the tubes containing blood were centrifuged for 10 min (3,000 × g), and then plasma was collected in new tubes and stored at −20°C until further analysis. After decapitation, the duodenum, jejunum, and ileum were removed to determine relative length, which was expressed relative to body weight (cm per kg of live body weight). Then, tissue samples (duodenal and jejunal sections) were collected and processed according to the method described by Laika and Jahanian (2017). First, a 2-cm segment was removed from the middle part of the duodenum and jejunum of all euthanized birds; the tissue samples were washed in physiological saline solution and fixed in 10% buffered formalin and then dehydrated through consecutive embedding in graded ethanol solutions. Thereafter, the fixed samples were embedded in paraffin. Transverse and longitudinal sections with 5 μm in thickness were prepared using microtome, stained with hematoxyline-eosin. Finally, the prepared tissue slices were used for morphological observation. Furthermore, the fresh contents of the entire small intestine were collected from all euthanized hens (n = 6/treatment group) for analysis of intestinal microbial populations. Plasma 1, 25-dihydroxyvitamin D3 (1,25(OH)2D3), calcitonin (CT), parathyroid hormone (PTH), immunoglobulin A (IgA), immunoglobulin G (IgG), immunoglobulin M (IgM), interleukin 2 (IL-2), and tumor necrosis factor-a (TNF-a) were measured using ELISA kits (Beijing Yonghui Biological Technology Co., Ltd., Beijing, China). Short-chain fatty acids in the cecal digesta samples were determined using a gas chromatograph (CP-3800, Varian, America). Villus height and crypt depth were examined under the light microscope (OLYMPUS DP71, BX50F-3, Olympus Optical Co. Ltd., Tokyo, Japan). The examinations were made under the lens 40 x, all measurements were obtained using 15 villi per slide, and the mean values of 2 slides per pen were used for statistical analysis. Real-time quantitative PCR The number of microorganisms in the cecum was determined by real-time quantitative PCR. First, a kit was used to extract the total DNA, and then the fluorescent quantitative reaction was performed. Relative quantification was conducted with reference to total bacteria. The designs of primers and probes are shown in Table 2. Lactobacillus, Escherichia coli, and Bifidobacterium were measured with a SuperReal probe (TIANGEN, Beijing, China). The PCR reaction was performed on a total volume of 10 μl for Lactobacillus and Escherichia coli and 20 μl for Bifidobacterium. The 10 μl reaction included 5 μl of 2*SuperReal preMix, 0.3 μl of forward and 0.3μl of reverse primers, 0.2 μl of probe, 3.2 μl of ddH2O, and 1 μl of DNA template. The 20 μl reaction included 1 μl of probe enhance solution, 8 μl of Real Master Mix, 1 μl of forward and 1 μl of reverse primers, 1 μl of DNA template, 0.8 μl of probe, and 7.2 μl of ddH2O. Total bacteria were measured using a SYBR premix Ex TaqTM II (Tli RNaseH Plus) kit (TIANGEN, Beijing, China) and a 20 μl reaction system that included 10 μl of SYBR premix Ex Taq II, 0.8 μl of upstream and downstream primers, 0.4 μl of 50 × ROX Reference Dye, 6 μl of ddH2O, and 2 μl of DNA template. Table 2. Primers and probes used for the determination of microbial populations in cecal digesta of laying hens. Items  Primer and probe sequence (5΄-3΄)  Annealing temperature (°C)  Product length (bp)  Total bacteria  Forward: ACTCCTACGGGAGGCAGCAG  60  200    Reverse: ATTACCGCGGCTGCTGG      Lactobacillus  Forward: GAGGCAGCAGTAGGGAATCTTC  60  126    Reverse: CAACAGTTACTCTGACACCCGTTCTTC        Probe: AAGAAGGGTTTCGGCTCGTAAAACTCTGTT      Bifidobacterium  Forward: CGCGTCCGGTGT GAAAG  55  121    Reverse: CTTCCCGATATCTACACATTCCA        Probe: ATTCCACCGTTACACCGGGAA      Escherichia coli  Forward: CATGCCGCGTGTATGAAGAA  57.5  96    Reverse: CGGGTAACGTCAATGAGCAAA        Probe: AGGTATTAACTTTACTCCCTTCCTC      Items  Primer and probe sequence (5΄-3΄)  Annealing temperature (°C)  Product length (bp)  Total bacteria  Forward: ACTCCTACGGGAGGCAGCAG  60  200    Reverse: ATTACCGCGGCTGCTGG      Lactobacillus  Forward: GAGGCAGCAGTAGGGAATCTTC  60  126    Reverse: CAACAGTTACTCTGACACCCGTTCTTC        Probe: AAGAAGGGTTTCGGCTCGTAAAACTCTGTT      Bifidobacterium  Forward: CGCGTCCGGTGT GAAAG  55  121    Reverse: CTTCCCGATATCTACACATTCCA        Probe: ATTCCACCGTTACACCGGGAA      Escherichia coli  Forward: CATGCCGCGTGTATGAAGAA  57.5  96    Reverse: CGGGTAACGTCAATGAGCAAA        Probe: AGGTATTAACTTTACTCCCTTCCTC      View Large The reaction conditions for amplification of DNA were denaturated at 95°C for 15 min, 95°C for 3 s, and 60°C for 30 s, followed by 40 cycles for Escherichia coli and by 50 cycles for Lactobacillus. The Bifidobacterium reaction conditions for amplification of DNA were denaturated at 95°C for 10 s, 95°C for 5 s, 59.5°C for 25 s, and 95°C for 10 s, followed by 50 cycles. The total bacteria reaction conditions for amplification of DNA were denaturated at 95°C for 10 s, 95°C for 5 s, and 59.5°C for 25 s, followed by 40 cycles. The content of each sample was calculated by the Ct value and the standard curve, and the results were expressed as the logarithm of the number of bacteria per gram content (copies/g). Statistical analysis Statistical analysis was performed using a completely randomized design and the general linear model (GLM) procedure of the SAS statistical software package (2003, SAS Institute Inc., Cary, NC). Orthogonal polynomial contrasts were used to analyze the differences between the control group and XOS treatments and to determine the linear and quadratic effects of the increasing concentrations of XOS included in the diet, with the replicate serving as the experimental unit. Significance was declared at P < 0.05 and effect trend at P > 0.05 to P < 0.10; P-values less than 0.01 are expressed as “< 0.01” rather than the actual value. RESULTS Intestinal characteristics The effects of XOS on intestinal characteristics are shown in Table 3. There was a linear improvement in villus height (P < 0.01) and VH: CD (P < 0.01) ratio of the jejunum as dietary XOS concentration increased. In the duodenum, XOS supplementation had no effect on crypt depth or VH: CD ratio. However, as dietary XOS concentration increased, the villus height of the duodenum increased quadratically (P < 0.05). Comparing the control (0 g/kg) and XOS diets, the relative length of the jejunum (P < 0.05) was increased significantly in diets with XOS. Dietary XOS did not affect the relative length of the duodenum or ileum. Table 3. Effect of xylooligosaccharides (XOS) on intestinal development of laying hens.1,2   XOS (% of diet)    P-value  Item  0  0.01  0.02  0.03  0.04  0.05  SEM  C vs. XOS  Linear  Quadratic  Relative length of duodenum (cm/kg)  15.7  16  16.4  16.4  16.9  17.0  1.6  0.46  0.30  0.96  Relative length of jejunum (cm/kg)  33.7  38.1  37.6  37.3  38.8  36.9  1.6  0.03  0.21  0.13  Relative length of ileum (cm/kg)  33.9  34.3  36.9  34.3  36.8  34.6  1.9  0.48  0.67  0.44  Duodenum   Villus height (μm)  1309  1332  1445  1371  1378  1272  43  0.29  0.67  0.01   Crypt depth (μm)  137  156  151  143  134  147  8  0.28  0.63  0.53   VH:CD ratio  9.7  8.7  9.8  9.9  10.3  8.7  0.6  0.77  0.89  0.27  Jejunum   Villus height (μm)  1045  1185  1194  1098  1310  1246  43  <0.01  <0.01  0.61   Crypt depth (μm)  170  160  162  143  157  151  8  0.09  0.07  0.35  VH:CD ratio  6.3  7.4  7.5  7.9  8.5  8.3  0.5  <0.01  <0.01  0.29    XOS (% of diet)    P-value  Item  0  0.01  0.02  0.03  0.04  0.05  SEM  C vs. XOS  Linear  Quadratic  Relative length of duodenum (cm/kg)  15.7  16  16.4  16.4  16.9  17.0  1.6  0.46  0.30  0.96  Relative length of jejunum (cm/kg)  33.7  38.1  37.6  37.3  38.8  36.9  1.6  0.03  0.21  0.13  Relative length of ileum (cm/kg)  33.9  34.3  36.9  34.3  36.8  34.6  1.9  0.48  0.67  0.44  Duodenum   Villus height (μm)  1309  1332  1445  1371  1378  1272  43  0.29  0.67  0.01   Crypt depth (μm)  137  156  151  143  134  147  8  0.28  0.63  0.53   VH:CD ratio  9.7  8.7  9.8  9.9  10.3  8.7  0.6  0.77  0.89  0.27  Jejunum   Villus height (μm)  1045  1185  1194  1098  1310  1246  43  <0.01  <0.01  0.61   Crypt depth (μm)  170  160  162  143  157  151  8  0.09  0.07  0.35  VH:CD ratio  6.3  7.4  7.5  7.9  8.5  8.3  0.5  <0.01  <0.01  0.29  1Each mean represents values from 6 replicates (30 birds/replicate). 2Abbreviations: Villus to crypt ratio, VH: CD ratio; C vs. XOS, Control (without XOS) vs. XOS (0.01, 0.02, 0.03, 0.04, and 0.05% of XOS). View Large Gut microbiota and short-chain fatty acids The effects of XOS on gut microbiota are shown in Figure 1. The gut microbiota analyses revealed that supplemental XOS significantly increased the number of Bifidobacteria in the cecal contents, and the bacteria showed a linear (P < 0.05) response to increasing dietary XOS. Compared with the control group, gut Bifidobacteria content was increased linearly by 4.1, 7.3, 19.4, 20.4, and 15.7% with the increasing concentration of dietary XOS, respectively. In addition, cecal Escherichia coli enumeration was reduced linearly (P < 0.05) by supplemental XOS. However, XOS supplementation had no effect on total bacteria counts or Lactobacillus in the cecal contents. Figure 1. View largeDownload slide Effect of xylooligosaccharides (XOS) on cecal microbiota of laying hens. P1 = Control (without XOS) vs. XOS (0.01, 0.02, 0.03, 0.04, and 0.05% of XOS); P2 = linear; P3 = quadratic; SEM = standard error of the mean; each mean represents values from 6 replicates (30 birds/replicate). Figure 1. View largeDownload slide Effect of xylooligosaccharides (XOS) on cecal microbiota of laying hens. P1 = Control (without XOS) vs. XOS (0.01, 0.02, 0.03, 0.04, and 0.05% of XOS); P2 = linear; P3 = quadratic; SEM = standard error of the mean; each mean represents values from 6 replicates (30 birds/replicate). The effects of XOS on short-chain fatty acids are shown in Figure 2. XOS supplementation had no effect on the content of propionic acid in the cecal contents. However, the content of butyrate in the cecum was increased linearly (P < 0.01) with increasing concentration of XOS in the diets, and the content of acetic acid showed a linear (0.05 < P < 0.10) increasing trend. Figure 2. View largeDownload slide Effect of xylooligosaccharides (XOS) on cecal short-chain fatty acids of laying hens. P1 = Control (without XOS) vs. XOS (0.01, 0.02, 0.03, 0.04, and 0.05% of XOS); P2 = linear; P3 = quadratic; SEM = standard error of the mean; each mean represents values from 6 replicates (30 birds/replicate). Figure 2. View largeDownload slide Effect of xylooligosaccharides (XOS) on cecal short-chain fatty acids of laying hens. P1 = Control (without XOS) vs. XOS (0.01, 0.02, 0.03, 0.04, and 0.05% of XOS); P2 = linear; P3 = quadratic; SEM = standard error of the mean; each mean represents values from 6 replicates (30 birds/replicate). Plasma calcium metabolism and immune parameters As shown in Table 4, the results show levels of plasma 1,25(OH)2D3 was increased quadratically (P < 0.01) as dietary XOS concentration increased. However, There were no significant differences (P > 0.05) in plasma CT or PTH among dietary treatments. Table 4. Effect of xylooligosaccharides (XOS) on serum calcium metabolism and immune factors of laying hens.1,2   XOS (% of diet)    P-value  Item  0  0.01  0.02  0.03  0.04  0.05  SEM  C vs. XOS  Linear  Quadratic  Calcium metabolism  1,25(OH)2D3(pg/L)  297.7  318.8  405.8  424.0  403.9  254.9  38.7  0.14  0.74  <0.01  CT (ng/L)  161.4  164.7  188.7  181.0  177.2  134.9  22.5  0.75  0.61  0.11  PTH (pg/mL)  108.3  79.1  122.8  95.8  114.2  100.4  11.7  0.63  0.74  0.81  Immune parameters  IgA (mg/mL)  2.68  3.3  3.71  4.21  3.67  3.88  0.43  0.03  0.03  0.14  IgG (mg/mL)  2.76  2.45  3.02  3.23  2.66  2.57  0.39  0.94  0.97  0.31  IgM (mg/mL)  1.7  1.51  2  3.05  2.34  2.07  0.25  0.08  <0.01  0.03  IL-2 (ng/L)  3.42  3.46  4.33  4.01  4.28  3.73  0.23  0.04  0.06  0.01  TNF-α (ng/L)  163.1  178.1  220.7  215.3  215.5  235.2  15.3  <0.01  <0.01  0.29    XOS (% of diet)    P-value  Item  0  0.01  0.02  0.03  0.04  0.05  SEM  C vs. XOS  Linear  Quadratic  Calcium metabolism  1,25(OH)2D3(pg/L)  297.7  318.8  405.8  424.0  403.9  254.9  38.7  0.14  0.74  <0.01  CT (ng/L)  161.4  164.7  188.7  181.0  177.2  134.9  22.5  0.75  0.61  0.11  PTH (pg/mL)  108.3  79.1  122.8  95.8  114.2  100.4  11.7  0.63  0.74  0.81  Immune parameters  IgA (mg/mL)  2.68  3.3  3.71  4.21  3.67  3.88  0.43  0.03  0.03  0.14  IgG (mg/mL)  2.76  2.45  3.02  3.23  2.66  2.57  0.39  0.94  0.97  0.31  IgM (mg/mL)  1.7  1.51  2  3.05  2.34  2.07  0.25  0.08  <0.01  0.03  IL-2 (ng/L)  3.42  3.46  4.33  4.01  4.28  3.73  0.23  0.04  0.06  0.01  TNF-α (ng/L)  163.1  178.1  220.7  215.3  215.5  235.2  15.3  <0.01  <0.01  0.29  1Each mean represents values from 6 replicates (30 birds/replicate). 2Abbreviations: Calcitonin, CT; parathyroid hormone, PTH; immunoglobulin A, IgA; immunoglobulin G, IgG; immunoglobulin M, IgM; interleukin 2, IL-2; tumor necrosis factor-α, TNF-α; Control (without XOS) vs. XOS (0.01, 0.02, 0.03, 0.04, and 0.05% of XOS). View Large The effects of XOS on immune factors are shown in Table 4. Compared with the control diet, plasma IgA, IL-2, and TNF-α were significantly (P < 0.05) higher in the XOS diet, and increasing the dietary XOS concentration linearly improved (P < 0.05) the concentration of IgA and TNF-α in plasma. In addition, plasma IgM showed a linear or quadratic (P < 0.05) response to the increasing concentrations of dietary XOS, and plasma IL-2 was increased quadratically (P < 0.05). However, XOS supplementation had no effect on plasma IgG. DISCUSSION Functional oligosaccharides have been used as a good alternative to antibiotics in recent decades. The best known functional oligosaccharides include FOS, glucooligosaccharides, isomaltooligosaccharides, MOS, and XOS (Chung and Day, 2004; Sánchez et al., 2008; Grimoud et al., 2010; Aachary and Prapulla, 2011; Ghasemian and Jahanian, 2016). The XOS are a new type of prebiotic, and studies show greater improvement in physiological function with XOS than with other functional oligosaccharides (Rycroft et al., 2001). According to Abdullahi et al. (2015), XOS supplementation had no deleterious effect on intestinal morphology of broilers. In this experiment, the addition of XOS in the diet of layers increased linearly villus height and VH: CD ratio of the jejunum and significantly increased the relative length of the jejunum; the villus height of the duodenum was increased quadratically. Similar to our results, in previous studies, the addition of MOS in the diet of chickens increased villus height in the ileum and jejunum (Pourabedin et al., 2014). Research by Baurhoo et al. (2007) also showed that broiler chickens fed MOS had increased villi height in the jejunum. Moreover, compared with a heat-stressed group fed a basal diet, supplemental cello-oligosaccharide increased jejunal villus height and VH: CD ratio (Song et al., 2013). However, the addition of FOS in the diet of broiler chickens had no effect on villus height, crypt depth, or VH: CD ratio in the duodenum and jejunum (Yue et al., 2015). Studies also showed that the addition of XOS in the diet decreased the crypt depth of the duodenum (Suo et al., 2015). Furthermore, Sobayo (2013) found that the lengths of the jejunum and ileum of broilers fed diets containing ethanol-treated castor oil seed meal increased significantly. In this study, we found that XOS could improve the morphological development of the intestine. The fermentation of XOS in the gut could explain the results, with an increase in the absorption of nutrients. Previous studies revealed that butyrate and some probiotics can improve intestinal morphology (Abdelqader and Al-Fataftah, 2016). Hu and Guo (2007) also reported that dietary sodium butyrate increased linearly the VH: CD ratio in jejunum. More recently, Sikandar et al. (2017) observed significant increases in jejunal and duodenal villus height in broilers fed sodium butyrate. In this experiment, XOS in the chicken diet significantly increased butyric acid content and intestinal Bifidobacteria. So it can be assumed that the improvements in intestinal morphology and structure in the present study are related to the beneficial effects of XOS on the intestinal microflora population and bacterial metabolites (especially butyric acid), which influence the differentiation and proliferation of enterocytes. The balance of intestinal microflora is well known to play an important role in the health, growth, and productivity of poultry. XOS, like other functional oligosaccharides, are not hydrolyzed by digestive enzymes; therefore, they reach the distal parts of the intestinal intact and are assimilated by the gastrointestinal microbiota, particularly probiotic bacteria, which produce short-chain fatty acids (Patel and Goyal, 2011). In this study, dietary XOS increased linearly the cecal number of Bifidobacteria and concentrations of butyric acid, and reduced linearly Escherichia coli enumeration. Consistent with these findings, previous studies also showed that supplementation with 2 g/kg XOS in the diet increased the proportion of the genus Lactobacillus in the cecum and cecal concentrations of acetate and propionate (Pourabedin et al., 2015). Additionally, in the research of Maesschalck et al. (2015), dietary XOS significantly increased the butyric acid content in broilers and also Clostridium cluster XIVa bacteria in the ceca and lactic acid bacteria in the colon of birds. Baurhoo et al. (2007) reported that supplemental MOS increased populations of Lactobacillus and Bifidobacteria in the cecal contents of broiler chicks and decreased populations of cecal Escherichia coli. Supplemental MOS at 1 g/kg decreased (P < 0.05) ileal counts of Escherichia coli and total bacteria in aged laying hens (Ghasemian and Jahanian, 2016). By contrast, Suo et al. (2015) found that supplemental XOS had no effect (P > 0.38) on the populations of Escherichia coli, Salmonella, Lactobacilli, or Bifidobacterium in the cecum. The number of Bifidobacteria was significantly increased in this experiment; this can be attributed to the ability of Bifidobacteria to metabolize XOS, depending on the efficiency of their xylanolytic enzyme systems, as Zeng et al. (2007) reported, and a few arabinosidases have been purified and characterized from bifidobacteria (Van Laere et al., 1997; Laere et al., 1999; Shin et al., 2003). Furthermore, there are 2 main reasons for the reduction of the number of cecal Escherichia coli by XOS. For one thing, the increase in the number of beneficial bacteria such as Bifidobacteria in the cecum makes them dominant bacteria, and thereby these beneficial bacteria can competitively inhibit the growth of harmful bacteria such as Escherichia coli; for another, the colonization of bacteria on mucosal tissues is an important and prerequisite step for infection, and to colonize the mucosal surface, bacteria must first bind to the epithelial cells (Jahanian and Ashnagar, 2015), so XOS may be similar to the receptor structures of Gram-negative pathogens on the intestinal surface, whereby XOS can serve as the attachment sites for Gram-negative pathogens and prevent attachment of bacteria onto the enterocytes. In the current experiment, we found that the addition of XOS in the diet of laying hens significantly increased the concentration of 1,25(OH)2D3 in plasma but had no effect on concentrations of CT or PTH. As a metabolite of vitamin D, 1, 25-dihydroxyvitamin D3 is the most active form of vitamin D in an animal body and promotes the absorption of calcium in intestinal epithelial cells (DeLuca et al., 1979). In a previous study, we found that dietary XOS increased the absorption of calcium (Li et al., 2017). It might be a good explanation for the increase in calcium absorption observed in the previous study. Vitamin D3, the main dietary source of vitamin D, is converted by sequential hydroxylations to 25 hydroxycholecalciferol in the liver and then to 1,25(OH)2D3 in the kidney before functioning (Światkiewicz et al., 2017). 25-hydroxylase and 1alpha-hydroxylase are key enzymes in this process; thus, the increase in plasma 1,25(OH)2D3 may be due to the influence of XOS on the activity of these enzymes. Little research has been conducted in this area, which deserves further study. Immunoglobulins are produced by lymphocytes in response to the intrusion of foreign, harmful substances into a living body. Immunoglobulin binds to the foreign antigen, which is then swallowed and digested by macrophages (Ohashi et al., 2014). Lymphocytes initially produce IgM immunoglobulin with a short lag phase before other immunoglobulin is produced (Rezaei et al., 2015). Interleukin-2 is a lymphokine that has an immunomodulatory effect and is secreted by T lymphocytes after stimulation by an antigen. Tumor necrosis factor-α is a proinflammatory cytokine produced primarily by macrophages and monocytes and is involved in general inflammation and immune response. In the present experiment, XOS supplementation significantly increased the concentration of IgM, IgA, IL-2, and TNF-α in plasma. Gómez-verduzco et al. (2009) found that dietary supplementation with 0.05% MOS increased local mucosal IgA secretions and humoral and cell-mediated immune responses. Our findings are similar to those of Deng et al. (2008), which showed that birds receiving 100 mg/kg chitooligosaccharide had higher serum concentrations of IL-1β, IL-6, and IgM than birds in the control treatment. Rezaei et al. (2015) reported that blood IgA concentration increased significantly when birds were fed 1% oligosaccharide extract from palm kernel expeller in the diet compared with the control treatment. This increase may be due to an increase in the number of beneficial intestinal microorganisms produced by the fermentation of XOS. Studies have shown that the addition of live microorganisms to the diet can stimulate the immune system (Koenen et al., 2004) and strengthen nonspecific immunity (Placha et al., 2010). CONCLUSIONS In conclusion, this study demonstrated that dietary supplementation of XOS to layer diets increased villus height, VH: CD ratio, and relative length of the jejunum; additionally, a beneficial effect was detected for Escherichia Coli and Bifidobacterium levels and concentration of butyric acid. Furthermore, XOS supplementation improved immunity by increasing plasma IgA, IgM, IL-2, and TNF-α of laying hens. ACKNOWLEDGEMENTS The authors are grateful for the funding and research support from the program of main livestock standardized breeding technology research and demonstration (2016NYZ0052) and the National Scientific and Technical Supporting Program (2014BAD13B04). REFERENCES Aachary A. A., Prapulla S. G.. 2011. Xylooligosaccharides (XOS) as an emerging prebiotic: Microbial synthesis, utilization, structural characterization, bioactive properties, and applications. Compr. Pev. Food Sci. F.  10: 2– 16. Google Scholar CrossRef Search ADS   Abdelqader A., Al-Fataftah A. R.. 2016. Effect of dietary butyric acid on performance, intestinal morphology, microflora composition and intestinal recovery of heat-stressed broilers. Livest. Sci.  183: 78– 83. Google Scholar CrossRef Search ADS   Abdullahi A. Y., Zuo J. J., Tan H. Z., Xia M. H., Guan W. T., Feng D. Y., Li G. Q.. 2015. Effects of xylanase, Lactobacillus and xylo-oligosaccharide on intestinal organs and tissue development of broiler chickens. Proceeding of the, Academic Conference of Chinese Feed Safety and Biotechnology and the Conference of Feed Enzyme about Academy and Technology , Guangzhou China. November 6–8. PP66. Baurhoo B., Phillip L., Ruizferia C. A.. 2007. Effects of purified lignin and mannan oligosaccharides on intestinal integrity and microbial populations in the ceca and litter of broiler chickens. Poult. Sci.  86: 1070– 1078. Google Scholar CrossRef Search ADS PubMed  Carvalho A. F. A., Oliva Neto P. D., Silva D. F. D., Pastore G. M.. 2013. Xylo-oligosaccharides from lignocellulosic materials: chemical structure, health benefits and production by chemical and enzymatic hydrolysis. Food Res. Int.  51: 75– 85. Google Scholar CrossRef Search ADS   Chung C. H., Day D. F.. 2004. Efficacy of Leuconostoc mesenteroides isomaltooligosaccharides as a poultry prebiotic. Poult. Sci.  83: 1302– 1306. Google Scholar CrossRef Search ADS PubMed  DeLuca H. F., Paaren H. E., Schnoes H. K.. 1979. Vitamin D and calcium metabolism. Top. Curr. Chem.  83: 1– 65. Google Scholar CrossRef Search ADS PubMed  Deng X., Li X., Liu P., Yuan S., Zang J., Li S., Xiangshu P.. 2008. Effect of chito-oligosaccharide supplementation on immunity in broiler chickens. Asian-Aust. j. Anim. Sci.  21: 81– 88. Google Scholar CrossRef Search ADS   Er B., Onurdag F. K., Demirhan B., Ö. Ozgacar S., Oktem A. B., Abbasoglu U.. 2013. Screening of quinolone antibiotic residues in chicken meat and beef sold in the markets of Ankara, Turkey. Poult. Sci . 92: 2212– 2215. Google Scholar CrossRef Search ADS PubMed  Ghasemian M., Jahanian R.. 2016. Dietary mannan-oligosaccharides supplementation could affect performance, immunocompetence, serum lipid metabolites, intestinal bacterial populations, and ileal nutrient digestibility in aged laying hens. Anim. Feed Sci. Technol.  213: 81– 89. Google Scholar CrossRef Search ADS   Gómez-Verduzco G., Cortes-Cuevas A., López-Coello C., Ávila-González E., Nava G. M.. 2009. Dietary supplementation of mannan-oligosaccharide enhances neonatal immune responses in chickens during natural exposure to Eimeria spp. Acta Vet. Scand.  51: 1– 7. Google Scholar CrossRef Search ADS PubMed  Grimoud J., Durand H., Courtin C., Monsan P., Ouarné F., Theodorou V., Roques C.. 2010. In vitro screening of probiotic lactic acid bacteria and prebiotic glucooligosaccharides to select effective synbiotics. Anaerobe . 16: 493– 500. Google Scholar CrossRef Search ADS PubMed  Hu Z., Guo Y.. 2007. Effects of dietary sodium butyrate supplementation on the intestinal morphological structure, absorptive function and gut flora in chickens. Anim. Feed Sci. Technol . 132: 240– 249. Google Scholar CrossRef Search ADS   Jahanian R., Ashnagar M.. 2015. Effect of dietary supplementation of mannan-oligosaccharides on performance, blood metabolites, ileal nutrient digestibility, and gut microflora in escherichia coli-challenged laying hens. Poult. Sci.  94: 2165– 2172. Google Scholar CrossRef Search ADS PubMed  Kaya A., Kaya H., MaciT M., ÇElebi S., EsenbuğA N., Yörük M. A., KaraoĞlu M.. 2013. Effects of dietary inclusion of plant extract mixture and copper into layer diets on egg yield and quality, yolk cholesterol and fatty acid composition. Kafkas Univ Vet. Fak. Derg.  19: 673– 679. Koenen M. E., Kramer J., v. d. Hulst R., Heres L., Jeurissen S. H. M., Boersma W. J. A.. 2004. Immunomodulation by probiotic Lactobacilli in layer- and meat-type chickens. Br. Poult. Sci.  45: 355– 366. Google Scholar CrossRef Search ADS PubMed  Laere K. M. J. V., Voragen C. H. L., Kroef T., Broek L. A. M. V. D., Beldman G., Voragen A. G. J.. 1999. Purification and mode of action of two different arabinoxylan arabinofuranohydrolases from Bifidobacterium adolescentis DSM 20083. Appl. Microbiol. Biotechnol . 51: 606– 613. Google Scholar CrossRef Search ADS   Laika M., Jahanian R.. 2017. Increase in dietary arginine level could ameliorate detrimental impacts of coccidial infection in broiler chickens. Livest. Sci.  195: 38– 44. Google Scholar CrossRef Search ADS   Li D. D., Ding X. M., Zhang K. Y., Bai S. P., Wang J. P., Zeng Q. F., Su Z. W., Kang L.. 2017. Effects of dietary xylooligosaccharides on the performance, egg quality, nutrient digestibility and plasma parameters of laying hens. Anim. Feed Sci. Technol.  225: 20– 26. Google Scholar CrossRef Search ADS   Lopez H. W., Coudray C., M. A., Levratverny, Feilletcoudray C., Demigné C., Rémésy C. 2000. Fructooligosaccharides enhance mineral apparent absorption and counteract the deleterious effects of phytic acid on mineral homeostasis. J. Nutr. Biochem.  11: 500– 508. Google Scholar CrossRef Search ADS PubMed  Maesschalck C. D., Eeckhaut V., Maertens L., Lange L. D., Marchal L., Nezer C., De Baere S., Croubels S., Daube G., Dewulf J., Haesebrouck F., Ducatelle R., Taminau B., Van Immerseel F.. 2015. Effects of xylo-oligosaccharides on broiler chicken performance and microbiota. Appl. Environ. Microb.  81: 5880– 5888. Google Scholar CrossRef Search ADS   Ministry of Agriculture of the People's Republic of China, 2004. Chicken feeding standard (NY/T33-2004) . Moura P., Barata R., Carvalheiro F., Gírio F., Loureirodias M. C., Esteves M. P.. 2007. In vitro fermentation of xylo-oligosaccharides from corn cobs autohydrolysis by Bifidobacterium and Lactobacillus strains. LWT-Food Sci Technol . 40: 963– 972. Google Scholar CrossRef Search ADS   Ohashi Y., Hiraguchi M., Ushida K.. 2014. The composition of intestinal bacteria affects the level of luminal IgA. Biosci. Biotechnol. Biochem . 70: 3031– 3035. Google Scholar CrossRef Search ADS   Patel S., Goyal A.. 2011. Functional oligosaccharides: Production, properties and applications. World J. Microbiol. Biotechnol.  27: 1119– 1128. Google Scholar CrossRef Search ADS   Placha I., Simonova M. P., Cobanova K., Laukova A., Faix S.. 2010. Effect of Enterococcus faecium AL41 and Thymus vulgaris essential oil on small intestine integrity and antioxidative status of laying hens. Res. Vet. Sci.  89: 257– 261. Google Scholar CrossRef Search ADS PubMed  Pourabedin M., Guan L., Zhao X.. 2015. Xylo-oligosaccharides and virginiamycin differentially modulate gut microbial composition in chickens. Microbiome . 3: 1– 12. Google Scholar CrossRef Search ADS PubMed  Pourabedin M., Xu Z., Baurhoo B., Chevaux E., Zhao X.. 2014. Effects of mannan oligosaccharide and virginiamycin on the cecal microbial community and intestinal morphology of chickens raised under suboptimal conditions. Can. J. Microbiol.  60: 255– 266. Google Scholar CrossRef Search ADS PubMed  Rezaei S., Faseleh J. M., Liang J. B., Zulkifli I., Farjam A. S., Laudadio V., Tufarelli V.. 2015. Effect of oligosaccharides extract from palm kernel expeller on growth performance, gut microbiota and immune response in broiler chickens. Poult. Sci.  94: 2414. Google Scholar CrossRef Search ADS PubMed  Rycroft C. E., Jones M. R., Gibson G. R., Rastall R. A.. 2001. A comparative in vitro evaluation of the fermentation properties of prebiotic oligosaccharides. J. Appl. Microbiol.  91: 878– 887. Google Scholar CrossRef Search ADS PubMed  Sánchez O., Guio F., Garcia D., Silva E., Caicedo L.. 2008. Fructooligosaccharides production by Aspergillus sp. N74 in a mechanically agitated airlift reactor. Food Bioprod. Process.  86: 109– 115. Google Scholar CrossRef Search ADS   Shin H. Y., Park S. Y., Sung J. H., Kim D. H.. 2003. Purification and characterization of alpha-L-arabinopyranosidase and alpha-L- arabinofuranosidase from Bifidobacterium breve K-110, a human intestinal anaerobic bacterium metabolizing ginsenoside Rb2 and Rc. Appl. Environ. Microbiol . 69: 7116– 7123. Google Scholar CrossRef Search ADS PubMed  Sikandar A., Zaneb H., Younus M., Khattak F., Masood S., Aslam A., Khattak F., Ashraf S., Yousaf M. S., Rehman H.. 2017. Effect of sodium butyrate on performance, immune status, microarchitecture of small intestinal mucosa and lymphoid organs in broiler chickens. Asian-Aust. j. Anim. Sci.  30: 690– 699. Google Scholar CrossRef Search ADS   Sobayo R. A. 2013. Changes in growth, digestibility and gut anatomy by broilers fed diets containing ethanol-treated castor oil seed (Ricinus communis L.) meal. Rev. Cient. Agr.  12: 660– 667. Song J., Jiao L. F., Xiao K., Luan Z. S., Hu C. H., Shi B., Zhan X. A.. 2013. Cello-oligosaccharide ameliorates heat stress-induced impairment of intestinal microflora, morphology and barrier integrity in broilers. Anim. Feed Sci. Technol.  185: 175– 181. Google Scholar CrossRef Search ADS   Suo H. Q., Lin L. U., Guo-Hui X. U., Lin X., Chen X. G., Xia R. R., Zhang L. Y., Luo X. G.. 2015. Effectiveness of dietary xylo-oligosaccharides for broilers fed a conventional corn-soybean meal diet. J. Integr. Agr.  14: 2050– 2057. Google Scholar CrossRef Search ADS   Światkiewicz S., Arczewska-Wlosek A., Bederska-Lojewska D., JÓzefiak D.. 2017. Efficacy of dietary vitamin d and its metabolites in poultry - Review and implications of the recent studies. World's Poult. Sci. J.  73: 57– 68. Google Scholar CrossRef Search ADS   Światkiewicz S., Koreleski J., Arczewska A.. 2010. Effect of organic acids and prebiotics on bone quality in laying hens fed diets with two levels of calcium and phosphorus. Acta. Vet. Brno.  79: 185– 193. Google Scholar CrossRef Search ADS   Teillant A., Brower C. H., Laxminarayan R.. 2015. Economics of antibiotic growth promoters in livestock. Annu. Rev. Resour. Econ . 17: 1– 26. Van Laere K. M., Beldman G., Voragen A. G.. 1997. A new arabinofuranohydrolase from Bifidobacterium adolescentis able to remove arabinosyl residues from double-substituted xylose units in arabinoxylan. Appl. Microbiol. Biotechnol.  47: 231– 235. Google Scholar CrossRef Search ADS PubMed  Xu Z. R., Hu C. H., Xia M. S., Zhan X. A., Wang M. Q.. 2003. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of growing pigs. Poult. Sci.  82: 1030– 1036. Google Scholar CrossRef Search ADS PubMed  Yue S., Regassa A., Ji H. K., Kim W. K.. 2015. The effect of dietary fructooligosaccharide supplementation on growth performance, intestinal morphology, and immune responses in broiler chickens challenged with Salmonella Enteritidis lipopolysaccharides. Poult. Sci.  94: 77– 89. Zeng H., Xue Y., Peng T., Shao W.. 2007. Properties of xylanolytic enzyme system in bifidobacteria and their effects on the utilization of xylooligosaccharides. Food Chem . 101: 1172– 1177. Google Scholar CrossRef Search ADS   Zhenping S., Wenting L., Ruikui Y., Jia L., Honghong L., Wei S., Zhongmie W., Jingpan L., Zhe S., Yuling Q.. 2013. Effect of a straw-derived xylooligosaccharide on broiler growth performance, endocrine metabolism, and immune response. Can. J. Vet. Res.  77: 105– 109. Google Scholar PubMed  Zhou E., Pan X. L., Tian X. Z.. 2009. Application study of xylo-oligosaccharide in layer production. Mod. Appl. Sci.  3: 103– 107. © 2017 Poultry Science Association Inc. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Effect of dietary xylooligosaccharides on intestinal characteristics, gut microbiota, cecal short-chain fatty acids, and plasma immune parameters of laying hens

Loading next page...
 
/lp/ou_press/effect-of-dietary-xylooligosaccharides-on-intestinal-characteristics-hRFxXVEOXF
Publisher
Oxford University Press
Copyright
© 2017 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pex372
Publisher site
See Article on Publisher Site

Abstract

Abstract This study examined the prebiotic effects of xylooligosaccharides (XOS) on intestinal characteristics, gut microbiota, cecal short-chain fatty acids, plasma calcium metabolism, and immune parameters of laying hens. A total of 1,080 White Lohmann laying hens (28 wk of age) was assigned to 6 dietary treatments that included XOS at concentrations of 0, 0.01, 0.02, 0.03, 0.04, or 0.05% for 8 weeks. Each treatment had 6 replicates with 10 cages (3 birds/cage). Blood, intestinal tissues, and cecal digesta samples were collected from chickens at the end of the experiment. Villus height, crypt depth, the villus to crypt (VH: CD) ratio, and the relative length of different intestinal sections were evaluated. Additionally, the number of microorganisms and the content of short-chain fatty acids in cecal digesta samples were determined. Plasma concentrations of immunoglobulin A (IgA), immunoglobulin G, immunoglobulin M (IgM), interleukin 2 (IL-2), tumor necrosis factor-α(TNF-α), 1, 25-dihydroxyvitamin D3 (1,25(OH)2D3), calcitonin (CT), and parathyroid hormone (PTH) were also determined. The results showed that villus height and the VH: CD ratio of the jejunum were increased (linear, P < 0.01) with the increase in dietary XOS concentration, and the relative length of the jejunum (P = 0.03) was increased significantly in XOS diets. Dietary supplementation of XOS significantly increased (linear, P < 0.01) the number of Bifidobacteria in the cecum; however, total bacteria count, Lactobacillus, and Escherichia coli in the cecum were not affected by XOS supplementation. In addition, inclusion of XOS increased (linear, P < 0.01) the content of butyrate in the cecum; and the content of acetic acid showed a linear increasing trend (P = 0.053) with increasing concentration of XOS in the diets. Supplementation with XOS increased (quadratic, P < 0.05) the content of 1,25(OH)2D3 in plasma. There were no significant differences (P > 0.05) in the content of CT and PTH among dietary treatments. Furthermore, dietary XOS increased contents of IgA (linear, P < 0.05), TNF-α (linear, P < 0.05), IgM (linear, P < 0.05; quadratic, P < 0.05), and IL-2 (quadratic, P < 0.05). Taken together, it was suggested that supplemental XOS can enhance the intestinal health and immune function of laying hens by positively influencing the intestinal characteristics, gut microbiota, cecal short-chain fatty acids, and immune parameters. INTRODUCTION With the improvement of people's living standard, people pay more and more attention to personal health, and the expectation is that food is not only delicious to eat but is also safe and healthful. Since the discovery of antibiotics, they have been widely used in animal feed to promote growth and prevent diseases (Teillant et al., 2015). However, in recent decades, awareness of the potential hazards of antibiotic abuse has gradually increased, with problems including drug resistance and residues in animal tissues (Er et al., 2013). Consequently, the animal industry has been compelled to find alternatives to antibiotics or at least reduce the amount of antibiotics used in livestock diets. In recent years, many antibiotic substitutes have been developed, including prebiotics, acidifiers, and plant extracts, (Świątkiewicz et al., 2010; Kaya et al., 2013). The xylooligosaccharides (XOS) are a type of prebiotic, which is a mixture of oligosaccharides formed by xylose residues linked through β-(1–4)-linkages. The number of xylose residues involved in their formation can vary between 2 and 10, and they are called xylobiose, xylotriose, etc. (Aachary and Prapulla, 2011). The technological features of XOS are also favorable and include stability at acidic pH, heat resistance, the ability to achieve significant biological effects at low daily doses, low calorie content, and nontoxicity (Carvalho et al., 2013). An in vitro experimental study found that XOS as carbon and energy sources can promote the growth of beneficial bacteria, such as Bifidobacterium adolescentis, B. longum, Lactobacillus brevis, and L. fermentum (Moura et al., 2007). Based on these properties, XOS are considered as substitutes for the antibiotics used in poultry feed. Animal feed that contains certain functional oligosaccharides, including mannanoligosaccharides (MOS) and fructooligasaccharide (FOS), may improve intestinal morphology in broilers (Xu et al., 2003; Pourabedin et al., 2014). Early studies also found that the functional oligosaccharides may influence the availability of calcium and magnesium. Their main mechanisms include reducing PH in the intestinal tract and increasing solubility of minerals, and increasing the surface area of intestinal absorption by promoting the proliferation of intestinal epithelial cells (Lopez et al., 2000). As one of the functional oligosaccharides, XOS may have a similar effect. Additionally, studies show that dietary supplementation with 5–20 g/kg XOS increased growth performance and the levels of serum triiodothyronine, thyroxine, and insulin and improved immune function in broilers (Zhenping et al., 2013). Pourabedin et al. (2015) also reported that supplementation of XOS into male broiler chicken (Ross × Ross) diet at 2 g/kg increased the proportion of the genus Lactobacillus in the cecum and also increased the cecal concentrations of acetate and propionate. However, few studies have examined the effects of XOS in laying hens. Previous studies have shown that 0.01 to 0.05% XOS can improve performance and egg quality of laying hens (Zhou et al., 2009), but the effect of XOS on intestinal health and immune function in laying hens is unclear. Therefore, the present study was conducted to investigate the influence of supplemental XOS on intestinal morphology, gut microbiota, short-chain fatty acids, and immune response of laying hens. MATERIALS AND METHODS Experimental birds, diets, and management The present study was performed on a poultry farm (Ya’an, China), and the Animal Care and Use Committee of Sichuan Agricultural University approved all experimental procedures. A total of 1,080 White Lohmann laying hens (28 wk old) was assigned to 6 dietary treatments that included XOS concentrations of 0, 0.01, 0.02, 0.03, 0.04, or 0.05% for 8 weeks. Each treatment had 6 replicates with 10 cages (3 birds/cage). Each treatment was uniformly distributed in the layer house to minimize environment effects. All hens were housed in an environmentally controlled house with the temperature maintained at approximately 24°C. Ventilation and lighting (16L:8D) were automatically controlled in the house. All hens were supplied with feed and water ad libitum. The hens were fed diets in mash form during the experiment (28 to 36 wk of age). The basal diets (Table 1) were based on maize and soybean meal, with composition and nutrient levels consistent with the Agricultural Trade Standardization of China (NY/T33–2004). The basal diet contained 0, 0.01, 0.02, 0.03, 0.04. or 0.05% XOS in the 6 dietary treatments. To prepare the experimental diet, the maximum and minimum concentrations of the experimental diet were first mixed separately and then used to prepare the other experimental concentrations. Table 1. Ingredients and nutrient content of the basal diet fed to laying hens. Ingredients  Contents (%)  Corn  60.5  Soybean meal, 43%  27.2  Soybean oil  1.65  Limestone (coarse)  4.09  Limestone (fine)  4.09  CaHPO4  1.26  Common salt  0.4  Mineral premix1  0.5  Vitamin premix2  0.03  Choline chloride  0.1  DL-Met  0.18  Total  100  Calculated nutrient content    Apparent metabolizable energy, kcal/kg  2700  Crude protein, %  16.5  Calcium, %  3.6  Available phosphorus, %  0.32  Lysine, %  0.87  Methionine, %  0.43  Methionine+cysteine, %  0.95  Ingredients  Contents (%)  Corn  60.5  Soybean meal, 43%  27.2  Soybean oil  1.65  Limestone (coarse)  4.09  Limestone (fine)  4.09  CaHPO4  1.26  Common salt  0.4  Mineral premix1  0.5  Vitamin premix2  0.03  Choline chloride  0.1  DL-Met  0.18  Total  100  Calculated nutrient content    Apparent metabolizable energy, kcal/kg  2700  Crude protein, %  16.5  Calcium, %  3.6  Available phosphorus, %  0.32  Lysine, %  0.87  Methionine, %  0.43  Methionine+cysteine, %  0.95  1Supplied per kilogram of diet: 60 mg Fe (as FeSO4·H2O); 8 mg Cu (as CuSO4·5H2O); 60 mg Mn (as MnSO4·H2O) 80 mg Zn (as ZnSO4·H2O); 0.35 mg I (as KI); 0.3 mg Se (as Na2SeO3). 2Supplied per kilogram of diet: vitamin A, 10,000 IU; vitamin D3, 3000 IU; vitamin E, 5 IU; vitamin K, 0.5 mg; vitamin B1, 0.8 mg; vitamin B2, 2.5 mg; vitamin B6, 0.1 mg; vitamin B12, 0.009 mg; pantothenic acid, 7.5 mg; folic acid, 0.15 mg; niacin, 20 mg; biotin, 0.135 mg. View Large Sample collection and preparation At the end of the experimental period, 6 birds from each treatment were randomly selected (one bird per replicate). Blood was drawn from the wing vein using sterilized needles and randomly selected syringes and placed in anticoagulant tubes containing heparin sodium to allow plasma collection. Feed was not withdrawn from the trough before the blood was collected. After the blood was collected, the tubes containing blood were centrifuged for 10 min (3,000 × g), and then plasma was collected in new tubes and stored at −20°C until further analysis. After decapitation, the duodenum, jejunum, and ileum were removed to determine relative length, which was expressed relative to body weight (cm per kg of live body weight). Then, tissue samples (duodenal and jejunal sections) were collected and processed according to the method described by Laika and Jahanian (2017). First, a 2-cm segment was removed from the middle part of the duodenum and jejunum of all euthanized birds; the tissue samples were washed in physiological saline solution and fixed in 10% buffered formalin and then dehydrated through consecutive embedding in graded ethanol solutions. Thereafter, the fixed samples were embedded in paraffin. Transverse and longitudinal sections with 5 μm in thickness were prepared using microtome, stained with hematoxyline-eosin. Finally, the prepared tissue slices were used for morphological observation. Furthermore, the fresh contents of the entire small intestine were collected from all euthanized hens (n = 6/treatment group) for analysis of intestinal microbial populations. Plasma 1, 25-dihydroxyvitamin D3 (1,25(OH)2D3), calcitonin (CT), parathyroid hormone (PTH), immunoglobulin A (IgA), immunoglobulin G (IgG), immunoglobulin M (IgM), interleukin 2 (IL-2), and tumor necrosis factor-a (TNF-a) were measured using ELISA kits (Beijing Yonghui Biological Technology Co., Ltd., Beijing, China). Short-chain fatty acids in the cecal digesta samples were determined using a gas chromatograph (CP-3800, Varian, America). Villus height and crypt depth were examined under the light microscope (OLYMPUS DP71, BX50F-3, Olympus Optical Co. Ltd., Tokyo, Japan). The examinations were made under the lens 40 x, all measurements were obtained using 15 villi per slide, and the mean values of 2 slides per pen were used for statistical analysis. Real-time quantitative PCR The number of microorganisms in the cecum was determined by real-time quantitative PCR. First, a kit was used to extract the total DNA, and then the fluorescent quantitative reaction was performed. Relative quantification was conducted with reference to total bacteria. The designs of primers and probes are shown in Table 2. Lactobacillus, Escherichia coli, and Bifidobacterium were measured with a SuperReal probe (TIANGEN, Beijing, China). The PCR reaction was performed on a total volume of 10 μl for Lactobacillus and Escherichia coli and 20 μl for Bifidobacterium. The 10 μl reaction included 5 μl of 2*SuperReal preMix, 0.3 μl of forward and 0.3μl of reverse primers, 0.2 μl of probe, 3.2 μl of ddH2O, and 1 μl of DNA template. The 20 μl reaction included 1 μl of probe enhance solution, 8 μl of Real Master Mix, 1 μl of forward and 1 μl of reverse primers, 1 μl of DNA template, 0.8 μl of probe, and 7.2 μl of ddH2O. Total bacteria were measured using a SYBR premix Ex TaqTM II (Tli RNaseH Plus) kit (TIANGEN, Beijing, China) and a 20 μl reaction system that included 10 μl of SYBR premix Ex Taq II, 0.8 μl of upstream and downstream primers, 0.4 μl of 50 × ROX Reference Dye, 6 μl of ddH2O, and 2 μl of DNA template. Table 2. Primers and probes used for the determination of microbial populations in cecal digesta of laying hens. Items  Primer and probe sequence (5΄-3΄)  Annealing temperature (°C)  Product length (bp)  Total bacteria  Forward: ACTCCTACGGGAGGCAGCAG  60  200    Reverse: ATTACCGCGGCTGCTGG      Lactobacillus  Forward: GAGGCAGCAGTAGGGAATCTTC  60  126    Reverse: CAACAGTTACTCTGACACCCGTTCTTC        Probe: AAGAAGGGTTTCGGCTCGTAAAACTCTGTT      Bifidobacterium  Forward: CGCGTCCGGTGT GAAAG  55  121    Reverse: CTTCCCGATATCTACACATTCCA        Probe: ATTCCACCGTTACACCGGGAA      Escherichia coli  Forward: CATGCCGCGTGTATGAAGAA  57.5  96    Reverse: CGGGTAACGTCAATGAGCAAA        Probe: AGGTATTAACTTTACTCCCTTCCTC      Items  Primer and probe sequence (5΄-3΄)  Annealing temperature (°C)  Product length (bp)  Total bacteria  Forward: ACTCCTACGGGAGGCAGCAG  60  200    Reverse: ATTACCGCGGCTGCTGG      Lactobacillus  Forward: GAGGCAGCAGTAGGGAATCTTC  60  126    Reverse: CAACAGTTACTCTGACACCCGTTCTTC        Probe: AAGAAGGGTTTCGGCTCGTAAAACTCTGTT      Bifidobacterium  Forward: CGCGTCCGGTGT GAAAG  55  121    Reverse: CTTCCCGATATCTACACATTCCA        Probe: ATTCCACCGTTACACCGGGAA      Escherichia coli  Forward: CATGCCGCGTGTATGAAGAA  57.5  96    Reverse: CGGGTAACGTCAATGAGCAAA        Probe: AGGTATTAACTTTACTCCCTTCCTC      View Large The reaction conditions for amplification of DNA were denaturated at 95°C for 15 min, 95°C for 3 s, and 60°C for 30 s, followed by 40 cycles for Escherichia coli and by 50 cycles for Lactobacillus. The Bifidobacterium reaction conditions for amplification of DNA were denaturated at 95°C for 10 s, 95°C for 5 s, 59.5°C for 25 s, and 95°C for 10 s, followed by 50 cycles. The total bacteria reaction conditions for amplification of DNA were denaturated at 95°C for 10 s, 95°C for 5 s, and 59.5°C for 25 s, followed by 40 cycles. The content of each sample was calculated by the Ct value and the standard curve, and the results were expressed as the logarithm of the number of bacteria per gram content (copies/g). Statistical analysis Statistical analysis was performed using a completely randomized design and the general linear model (GLM) procedure of the SAS statistical software package (2003, SAS Institute Inc., Cary, NC). Orthogonal polynomial contrasts were used to analyze the differences between the control group and XOS treatments and to determine the linear and quadratic effects of the increasing concentrations of XOS included in the diet, with the replicate serving as the experimental unit. Significance was declared at P < 0.05 and effect trend at P > 0.05 to P < 0.10; P-values less than 0.01 are expressed as “< 0.01” rather than the actual value. RESULTS Intestinal characteristics The effects of XOS on intestinal characteristics are shown in Table 3. There was a linear improvement in villus height (P < 0.01) and VH: CD (P < 0.01) ratio of the jejunum as dietary XOS concentration increased. In the duodenum, XOS supplementation had no effect on crypt depth or VH: CD ratio. However, as dietary XOS concentration increased, the villus height of the duodenum increased quadratically (P < 0.05). Comparing the control (0 g/kg) and XOS diets, the relative length of the jejunum (P < 0.05) was increased significantly in diets with XOS. Dietary XOS did not affect the relative length of the duodenum or ileum. Table 3. Effect of xylooligosaccharides (XOS) on intestinal development of laying hens.1,2   XOS (% of diet)    P-value  Item  0  0.01  0.02  0.03  0.04  0.05  SEM  C vs. XOS  Linear  Quadratic  Relative length of duodenum (cm/kg)  15.7  16  16.4  16.4  16.9  17.0  1.6  0.46  0.30  0.96  Relative length of jejunum (cm/kg)  33.7  38.1  37.6  37.3  38.8  36.9  1.6  0.03  0.21  0.13  Relative length of ileum (cm/kg)  33.9  34.3  36.9  34.3  36.8  34.6  1.9  0.48  0.67  0.44  Duodenum   Villus height (μm)  1309  1332  1445  1371  1378  1272  43  0.29  0.67  0.01   Crypt depth (μm)  137  156  151  143  134  147  8  0.28  0.63  0.53   VH:CD ratio  9.7  8.7  9.8  9.9  10.3  8.7  0.6  0.77  0.89  0.27  Jejunum   Villus height (μm)  1045  1185  1194  1098  1310  1246  43  <0.01  <0.01  0.61   Crypt depth (μm)  170  160  162  143  157  151  8  0.09  0.07  0.35  VH:CD ratio  6.3  7.4  7.5  7.9  8.5  8.3  0.5  <0.01  <0.01  0.29    XOS (% of diet)    P-value  Item  0  0.01  0.02  0.03  0.04  0.05  SEM  C vs. XOS  Linear  Quadratic  Relative length of duodenum (cm/kg)  15.7  16  16.4  16.4  16.9  17.0  1.6  0.46  0.30  0.96  Relative length of jejunum (cm/kg)  33.7  38.1  37.6  37.3  38.8  36.9  1.6  0.03  0.21  0.13  Relative length of ileum (cm/kg)  33.9  34.3  36.9  34.3  36.8  34.6  1.9  0.48  0.67  0.44  Duodenum   Villus height (μm)  1309  1332  1445  1371  1378  1272  43  0.29  0.67  0.01   Crypt depth (μm)  137  156  151  143  134  147  8  0.28  0.63  0.53   VH:CD ratio  9.7  8.7  9.8  9.9  10.3  8.7  0.6  0.77  0.89  0.27  Jejunum   Villus height (μm)  1045  1185  1194  1098  1310  1246  43  <0.01  <0.01  0.61   Crypt depth (μm)  170  160  162  143  157  151  8  0.09  0.07  0.35  VH:CD ratio  6.3  7.4  7.5  7.9  8.5  8.3  0.5  <0.01  <0.01  0.29  1Each mean represents values from 6 replicates (30 birds/replicate). 2Abbreviations: Villus to crypt ratio, VH: CD ratio; C vs. XOS, Control (without XOS) vs. XOS (0.01, 0.02, 0.03, 0.04, and 0.05% of XOS). View Large Gut microbiota and short-chain fatty acids The effects of XOS on gut microbiota are shown in Figure 1. The gut microbiota analyses revealed that supplemental XOS significantly increased the number of Bifidobacteria in the cecal contents, and the bacteria showed a linear (P < 0.05) response to increasing dietary XOS. Compared with the control group, gut Bifidobacteria content was increased linearly by 4.1, 7.3, 19.4, 20.4, and 15.7% with the increasing concentration of dietary XOS, respectively. In addition, cecal Escherichia coli enumeration was reduced linearly (P < 0.05) by supplemental XOS. However, XOS supplementation had no effect on total bacteria counts or Lactobacillus in the cecal contents. Figure 1. View largeDownload slide Effect of xylooligosaccharides (XOS) on cecal microbiota of laying hens. P1 = Control (without XOS) vs. XOS (0.01, 0.02, 0.03, 0.04, and 0.05% of XOS); P2 = linear; P3 = quadratic; SEM = standard error of the mean; each mean represents values from 6 replicates (30 birds/replicate). Figure 1. View largeDownload slide Effect of xylooligosaccharides (XOS) on cecal microbiota of laying hens. P1 = Control (without XOS) vs. XOS (0.01, 0.02, 0.03, 0.04, and 0.05% of XOS); P2 = linear; P3 = quadratic; SEM = standard error of the mean; each mean represents values from 6 replicates (30 birds/replicate). The effects of XOS on short-chain fatty acids are shown in Figure 2. XOS supplementation had no effect on the content of propionic acid in the cecal contents. However, the content of butyrate in the cecum was increased linearly (P < 0.01) with increasing concentration of XOS in the diets, and the content of acetic acid showed a linear (0.05 < P < 0.10) increasing trend. Figure 2. View largeDownload slide Effect of xylooligosaccharides (XOS) on cecal short-chain fatty acids of laying hens. P1 = Control (without XOS) vs. XOS (0.01, 0.02, 0.03, 0.04, and 0.05% of XOS); P2 = linear; P3 = quadratic; SEM = standard error of the mean; each mean represents values from 6 replicates (30 birds/replicate). Figure 2. View largeDownload slide Effect of xylooligosaccharides (XOS) on cecal short-chain fatty acids of laying hens. P1 = Control (without XOS) vs. XOS (0.01, 0.02, 0.03, 0.04, and 0.05% of XOS); P2 = linear; P3 = quadratic; SEM = standard error of the mean; each mean represents values from 6 replicates (30 birds/replicate). Plasma calcium metabolism and immune parameters As shown in Table 4, the results show levels of plasma 1,25(OH)2D3 was increased quadratically (P < 0.01) as dietary XOS concentration increased. However, There were no significant differences (P > 0.05) in plasma CT or PTH among dietary treatments. Table 4. Effect of xylooligosaccharides (XOS) on serum calcium metabolism and immune factors of laying hens.1,2   XOS (% of diet)    P-value  Item  0  0.01  0.02  0.03  0.04  0.05  SEM  C vs. XOS  Linear  Quadratic  Calcium metabolism  1,25(OH)2D3(pg/L)  297.7  318.8  405.8  424.0  403.9  254.9  38.7  0.14  0.74  <0.01  CT (ng/L)  161.4  164.7  188.7  181.0  177.2  134.9  22.5  0.75  0.61  0.11  PTH (pg/mL)  108.3  79.1  122.8  95.8  114.2  100.4  11.7  0.63  0.74  0.81  Immune parameters  IgA (mg/mL)  2.68  3.3  3.71  4.21  3.67  3.88  0.43  0.03  0.03  0.14  IgG (mg/mL)  2.76  2.45  3.02  3.23  2.66  2.57  0.39  0.94  0.97  0.31  IgM (mg/mL)  1.7  1.51  2  3.05  2.34  2.07  0.25  0.08  <0.01  0.03  IL-2 (ng/L)  3.42  3.46  4.33  4.01  4.28  3.73  0.23  0.04  0.06  0.01  TNF-α (ng/L)  163.1  178.1  220.7  215.3  215.5  235.2  15.3  <0.01  <0.01  0.29    XOS (% of diet)    P-value  Item  0  0.01  0.02  0.03  0.04  0.05  SEM  C vs. XOS  Linear  Quadratic  Calcium metabolism  1,25(OH)2D3(pg/L)  297.7  318.8  405.8  424.0  403.9  254.9  38.7  0.14  0.74  <0.01  CT (ng/L)  161.4  164.7  188.7  181.0  177.2  134.9  22.5  0.75  0.61  0.11  PTH (pg/mL)  108.3  79.1  122.8  95.8  114.2  100.4  11.7  0.63  0.74  0.81  Immune parameters  IgA (mg/mL)  2.68  3.3  3.71  4.21  3.67  3.88  0.43  0.03  0.03  0.14  IgG (mg/mL)  2.76  2.45  3.02  3.23  2.66  2.57  0.39  0.94  0.97  0.31  IgM (mg/mL)  1.7  1.51  2  3.05  2.34  2.07  0.25  0.08  <0.01  0.03  IL-2 (ng/L)  3.42  3.46  4.33  4.01  4.28  3.73  0.23  0.04  0.06  0.01  TNF-α (ng/L)  163.1  178.1  220.7  215.3  215.5  235.2  15.3  <0.01  <0.01  0.29  1Each mean represents values from 6 replicates (30 birds/replicate). 2Abbreviations: Calcitonin, CT; parathyroid hormone, PTH; immunoglobulin A, IgA; immunoglobulin G, IgG; immunoglobulin M, IgM; interleukin 2, IL-2; tumor necrosis factor-α, TNF-α; Control (without XOS) vs. XOS (0.01, 0.02, 0.03, 0.04, and 0.05% of XOS). View Large The effects of XOS on immune factors are shown in Table 4. Compared with the control diet, plasma IgA, IL-2, and TNF-α were significantly (P < 0.05) higher in the XOS diet, and increasing the dietary XOS concentration linearly improved (P < 0.05) the concentration of IgA and TNF-α in plasma. In addition, plasma IgM showed a linear or quadratic (P < 0.05) response to the increasing concentrations of dietary XOS, and plasma IL-2 was increased quadratically (P < 0.05). However, XOS supplementation had no effect on plasma IgG. DISCUSSION Functional oligosaccharides have been used as a good alternative to antibiotics in recent decades. The best known functional oligosaccharides include FOS, glucooligosaccharides, isomaltooligosaccharides, MOS, and XOS (Chung and Day, 2004; Sánchez et al., 2008; Grimoud et al., 2010; Aachary and Prapulla, 2011; Ghasemian and Jahanian, 2016). The XOS are a new type of prebiotic, and studies show greater improvement in physiological function with XOS than with other functional oligosaccharides (Rycroft et al., 2001). According to Abdullahi et al. (2015), XOS supplementation had no deleterious effect on intestinal morphology of broilers. In this experiment, the addition of XOS in the diet of layers increased linearly villus height and VH: CD ratio of the jejunum and significantly increased the relative length of the jejunum; the villus height of the duodenum was increased quadratically. Similar to our results, in previous studies, the addition of MOS in the diet of chickens increased villus height in the ileum and jejunum (Pourabedin et al., 2014). Research by Baurhoo et al. (2007) also showed that broiler chickens fed MOS had increased villi height in the jejunum. Moreover, compared with a heat-stressed group fed a basal diet, supplemental cello-oligosaccharide increased jejunal villus height and VH: CD ratio (Song et al., 2013). However, the addition of FOS in the diet of broiler chickens had no effect on villus height, crypt depth, or VH: CD ratio in the duodenum and jejunum (Yue et al., 2015). Studies also showed that the addition of XOS in the diet decreased the crypt depth of the duodenum (Suo et al., 2015). Furthermore, Sobayo (2013) found that the lengths of the jejunum and ileum of broilers fed diets containing ethanol-treated castor oil seed meal increased significantly. In this study, we found that XOS could improve the morphological development of the intestine. The fermentation of XOS in the gut could explain the results, with an increase in the absorption of nutrients. Previous studies revealed that butyrate and some probiotics can improve intestinal morphology (Abdelqader and Al-Fataftah, 2016). Hu and Guo (2007) also reported that dietary sodium butyrate increased linearly the VH: CD ratio in jejunum. More recently, Sikandar et al. (2017) observed significant increases in jejunal and duodenal villus height in broilers fed sodium butyrate. In this experiment, XOS in the chicken diet significantly increased butyric acid content and intestinal Bifidobacteria. So it can be assumed that the improvements in intestinal morphology and structure in the present study are related to the beneficial effects of XOS on the intestinal microflora population and bacterial metabolites (especially butyric acid), which influence the differentiation and proliferation of enterocytes. The balance of intestinal microflora is well known to play an important role in the health, growth, and productivity of poultry. XOS, like other functional oligosaccharides, are not hydrolyzed by digestive enzymes; therefore, they reach the distal parts of the intestinal intact and are assimilated by the gastrointestinal microbiota, particularly probiotic bacteria, which produce short-chain fatty acids (Patel and Goyal, 2011). In this study, dietary XOS increased linearly the cecal number of Bifidobacteria and concentrations of butyric acid, and reduced linearly Escherichia coli enumeration. Consistent with these findings, previous studies also showed that supplementation with 2 g/kg XOS in the diet increased the proportion of the genus Lactobacillus in the cecum and cecal concentrations of acetate and propionate (Pourabedin et al., 2015). Additionally, in the research of Maesschalck et al. (2015), dietary XOS significantly increased the butyric acid content in broilers and also Clostridium cluster XIVa bacteria in the ceca and lactic acid bacteria in the colon of birds. Baurhoo et al. (2007) reported that supplemental MOS increased populations of Lactobacillus and Bifidobacteria in the cecal contents of broiler chicks and decreased populations of cecal Escherichia coli. Supplemental MOS at 1 g/kg decreased (P < 0.05) ileal counts of Escherichia coli and total bacteria in aged laying hens (Ghasemian and Jahanian, 2016). By contrast, Suo et al. (2015) found that supplemental XOS had no effect (P > 0.38) on the populations of Escherichia coli, Salmonella, Lactobacilli, or Bifidobacterium in the cecum. The number of Bifidobacteria was significantly increased in this experiment; this can be attributed to the ability of Bifidobacteria to metabolize XOS, depending on the efficiency of their xylanolytic enzyme systems, as Zeng et al. (2007) reported, and a few arabinosidases have been purified and characterized from bifidobacteria (Van Laere et al., 1997; Laere et al., 1999; Shin et al., 2003). Furthermore, there are 2 main reasons for the reduction of the number of cecal Escherichia coli by XOS. For one thing, the increase in the number of beneficial bacteria such as Bifidobacteria in the cecum makes them dominant bacteria, and thereby these beneficial bacteria can competitively inhibit the growth of harmful bacteria such as Escherichia coli; for another, the colonization of bacteria on mucosal tissues is an important and prerequisite step for infection, and to colonize the mucosal surface, bacteria must first bind to the epithelial cells (Jahanian and Ashnagar, 2015), so XOS may be similar to the receptor structures of Gram-negative pathogens on the intestinal surface, whereby XOS can serve as the attachment sites for Gram-negative pathogens and prevent attachment of bacteria onto the enterocytes. In the current experiment, we found that the addition of XOS in the diet of laying hens significantly increased the concentration of 1,25(OH)2D3 in plasma but had no effect on concentrations of CT or PTH. As a metabolite of vitamin D, 1, 25-dihydroxyvitamin D3 is the most active form of vitamin D in an animal body and promotes the absorption of calcium in intestinal epithelial cells (DeLuca et al., 1979). In a previous study, we found that dietary XOS increased the absorption of calcium (Li et al., 2017). It might be a good explanation for the increase in calcium absorption observed in the previous study. Vitamin D3, the main dietary source of vitamin D, is converted by sequential hydroxylations to 25 hydroxycholecalciferol in the liver and then to 1,25(OH)2D3 in the kidney before functioning (Światkiewicz et al., 2017). 25-hydroxylase and 1alpha-hydroxylase are key enzymes in this process; thus, the increase in plasma 1,25(OH)2D3 may be due to the influence of XOS on the activity of these enzymes. Little research has been conducted in this area, which deserves further study. Immunoglobulins are produced by lymphocytes in response to the intrusion of foreign, harmful substances into a living body. Immunoglobulin binds to the foreign antigen, which is then swallowed and digested by macrophages (Ohashi et al., 2014). Lymphocytes initially produce IgM immunoglobulin with a short lag phase before other immunoglobulin is produced (Rezaei et al., 2015). Interleukin-2 is a lymphokine that has an immunomodulatory effect and is secreted by T lymphocytes after stimulation by an antigen. Tumor necrosis factor-α is a proinflammatory cytokine produced primarily by macrophages and monocytes and is involved in general inflammation and immune response. In the present experiment, XOS supplementation significantly increased the concentration of IgM, IgA, IL-2, and TNF-α in plasma. Gómez-verduzco et al. (2009) found that dietary supplementation with 0.05% MOS increased local mucosal IgA secretions and humoral and cell-mediated immune responses. Our findings are similar to those of Deng et al. (2008), which showed that birds receiving 100 mg/kg chitooligosaccharide had higher serum concentrations of IL-1β, IL-6, and IgM than birds in the control treatment. Rezaei et al. (2015) reported that blood IgA concentration increased significantly when birds were fed 1% oligosaccharide extract from palm kernel expeller in the diet compared with the control treatment. This increase may be due to an increase in the number of beneficial intestinal microorganisms produced by the fermentation of XOS. Studies have shown that the addition of live microorganisms to the diet can stimulate the immune system (Koenen et al., 2004) and strengthen nonspecific immunity (Placha et al., 2010). CONCLUSIONS In conclusion, this study demonstrated that dietary supplementation of XOS to layer diets increased villus height, VH: CD ratio, and relative length of the jejunum; additionally, a beneficial effect was detected for Escherichia Coli and Bifidobacterium levels and concentration of butyric acid. Furthermore, XOS supplementation improved immunity by increasing plasma IgA, IgM, IL-2, and TNF-α of laying hens. ACKNOWLEDGEMENTS The authors are grateful for the funding and research support from the program of main livestock standardized breeding technology research and demonstration (2016NYZ0052) and the National Scientific and Technical Supporting Program (2014BAD13B04). REFERENCES Aachary A. A., Prapulla S. G.. 2011. Xylooligosaccharides (XOS) as an emerging prebiotic: Microbial synthesis, utilization, structural characterization, bioactive properties, and applications. Compr. Pev. Food Sci. F.  10: 2– 16. Google Scholar CrossRef Search ADS   Abdelqader A., Al-Fataftah A. R.. 2016. Effect of dietary butyric acid on performance, intestinal morphology, microflora composition and intestinal recovery of heat-stressed broilers. Livest. Sci.  183: 78– 83. Google Scholar CrossRef Search ADS   Abdullahi A. Y., Zuo J. J., Tan H. Z., Xia M. H., Guan W. T., Feng D. Y., Li G. Q.. 2015. Effects of xylanase, Lactobacillus and xylo-oligosaccharide on intestinal organs and tissue development of broiler chickens. Proceeding of the, Academic Conference of Chinese Feed Safety and Biotechnology and the Conference of Feed Enzyme about Academy and Technology , Guangzhou China. November 6–8. PP66. Baurhoo B., Phillip L., Ruizferia C. A.. 2007. Effects of purified lignin and mannan oligosaccharides on intestinal integrity and microbial populations in the ceca and litter of broiler chickens. Poult. Sci.  86: 1070– 1078. Google Scholar CrossRef Search ADS PubMed  Carvalho A. F. A., Oliva Neto P. D., Silva D. F. D., Pastore G. M.. 2013. Xylo-oligosaccharides from lignocellulosic materials: chemical structure, health benefits and production by chemical and enzymatic hydrolysis. Food Res. Int.  51: 75– 85. Google Scholar CrossRef Search ADS   Chung C. H., Day D. F.. 2004. Efficacy of Leuconostoc mesenteroides isomaltooligosaccharides as a poultry prebiotic. Poult. Sci.  83: 1302– 1306. Google Scholar CrossRef Search ADS PubMed  DeLuca H. F., Paaren H. E., Schnoes H. K.. 1979. Vitamin D and calcium metabolism. Top. Curr. Chem.  83: 1– 65. Google Scholar CrossRef Search ADS PubMed  Deng X., Li X., Liu P., Yuan S., Zang J., Li S., Xiangshu P.. 2008. Effect of chito-oligosaccharide supplementation on immunity in broiler chickens. Asian-Aust. j. Anim. Sci.  21: 81– 88. Google Scholar CrossRef Search ADS   Er B., Onurdag F. K., Demirhan B., Ö. Ozgacar S., Oktem A. B., Abbasoglu U.. 2013. Screening of quinolone antibiotic residues in chicken meat and beef sold in the markets of Ankara, Turkey. Poult. Sci . 92: 2212– 2215. Google Scholar CrossRef Search ADS PubMed  Ghasemian M., Jahanian R.. 2016. Dietary mannan-oligosaccharides supplementation could affect performance, immunocompetence, serum lipid metabolites, intestinal bacterial populations, and ileal nutrient digestibility in aged laying hens. Anim. Feed Sci. Technol.  213: 81– 89. Google Scholar CrossRef Search ADS   Gómez-Verduzco G., Cortes-Cuevas A., López-Coello C., Ávila-González E., Nava G. M.. 2009. Dietary supplementation of mannan-oligosaccharide enhances neonatal immune responses in chickens during natural exposure to Eimeria spp. Acta Vet. Scand.  51: 1– 7. Google Scholar CrossRef Search ADS PubMed  Grimoud J., Durand H., Courtin C., Monsan P., Ouarné F., Theodorou V., Roques C.. 2010. In vitro screening of probiotic lactic acid bacteria and prebiotic glucooligosaccharides to select effective synbiotics. Anaerobe . 16: 493– 500. Google Scholar CrossRef Search ADS PubMed  Hu Z., Guo Y.. 2007. Effects of dietary sodium butyrate supplementation on the intestinal morphological structure, absorptive function and gut flora in chickens. Anim. Feed Sci. Technol . 132: 240– 249. Google Scholar CrossRef Search ADS   Jahanian R., Ashnagar M.. 2015. Effect of dietary supplementation of mannan-oligosaccharides on performance, blood metabolites, ileal nutrient digestibility, and gut microflora in escherichia coli-challenged laying hens. Poult. Sci.  94: 2165– 2172. Google Scholar CrossRef Search ADS PubMed  Kaya A., Kaya H., MaciT M., ÇElebi S., EsenbuğA N., Yörük M. A., KaraoĞlu M.. 2013. Effects of dietary inclusion of plant extract mixture and copper into layer diets on egg yield and quality, yolk cholesterol and fatty acid composition. Kafkas Univ Vet. Fak. Derg.  19: 673– 679. Koenen M. E., Kramer J., v. d. Hulst R., Heres L., Jeurissen S. H. M., Boersma W. J. A.. 2004. Immunomodulation by probiotic Lactobacilli in layer- and meat-type chickens. Br. Poult. Sci.  45: 355– 366. Google Scholar CrossRef Search ADS PubMed  Laere K. M. J. V., Voragen C. H. L., Kroef T., Broek L. A. M. V. D., Beldman G., Voragen A. G. J.. 1999. Purification and mode of action of two different arabinoxylan arabinofuranohydrolases from Bifidobacterium adolescentis DSM 20083. Appl. Microbiol. Biotechnol . 51: 606– 613. Google Scholar CrossRef Search ADS   Laika M., Jahanian R.. 2017. Increase in dietary arginine level could ameliorate detrimental impacts of coccidial infection in broiler chickens. Livest. Sci.  195: 38– 44. Google Scholar CrossRef Search ADS   Li D. D., Ding X. M., Zhang K. Y., Bai S. P., Wang J. P., Zeng Q. F., Su Z. W., Kang L.. 2017. Effects of dietary xylooligosaccharides on the performance, egg quality, nutrient digestibility and plasma parameters of laying hens. Anim. Feed Sci. Technol.  225: 20– 26. Google Scholar CrossRef Search ADS   Lopez H. W., Coudray C., M. A., Levratverny, Feilletcoudray C., Demigné C., Rémésy C. 2000. Fructooligosaccharides enhance mineral apparent absorption and counteract the deleterious effects of phytic acid on mineral homeostasis. J. Nutr. Biochem.  11: 500– 508. Google Scholar CrossRef Search ADS PubMed  Maesschalck C. D., Eeckhaut V., Maertens L., Lange L. D., Marchal L., Nezer C., De Baere S., Croubels S., Daube G., Dewulf J., Haesebrouck F., Ducatelle R., Taminau B., Van Immerseel F.. 2015. Effects of xylo-oligosaccharides on broiler chicken performance and microbiota. Appl. Environ. Microb.  81: 5880– 5888. Google Scholar CrossRef Search ADS   Ministry of Agriculture of the People's Republic of China, 2004. Chicken feeding standard (NY/T33-2004) . Moura P., Barata R., Carvalheiro F., Gírio F., Loureirodias M. C., Esteves M. P.. 2007. In vitro fermentation of xylo-oligosaccharides from corn cobs autohydrolysis by Bifidobacterium and Lactobacillus strains. LWT-Food Sci Technol . 40: 963– 972. Google Scholar CrossRef Search ADS   Ohashi Y., Hiraguchi M., Ushida K.. 2014. The composition of intestinal bacteria affects the level of luminal IgA. Biosci. Biotechnol. Biochem . 70: 3031– 3035. Google Scholar CrossRef Search ADS   Patel S., Goyal A.. 2011. Functional oligosaccharides: Production, properties and applications. World J. Microbiol. Biotechnol.  27: 1119– 1128. Google Scholar CrossRef Search ADS   Placha I., Simonova M. P., Cobanova K., Laukova A., Faix S.. 2010. Effect of Enterococcus faecium AL41 and Thymus vulgaris essential oil on small intestine integrity and antioxidative status of laying hens. Res. Vet. Sci.  89: 257– 261. Google Scholar CrossRef Search ADS PubMed  Pourabedin M., Guan L., Zhao X.. 2015. Xylo-oligosaccharides and virginiamycin differentially modulate gut microbial composition in chickens. Microbiome . 3: 1– 12. Google Scholar CrossRef Search ADS PubMed  Pourabedin M., Xu Z., Baurhoo B., Chevaux E., Zhao X.. 2014. Effects of mannan oligosaccharide and virginiamycin on the cecal microbial community and intestinal morphology of chickens raised under suboptimal conditions. Can. J. Microbiol.  60: 255– 266. Google Scholar CrossRef Search ADS PubMed  Rezaei S., Faseleh J. M., Liang J. B., Zulkifli I., Farjam A. S., Laudadio V., Tufarelli V.. 2015. Effect of oligosaccharides extract from palm kernel expeller on growth performance, gut microbiota and immune response in broiler chickens. Poult. Sci.  94: 2414. Google Scholar CrossRef Search ADS PubMed  Rycroft C. E., Jones M. R., Gibson G. R., Rastall R. A.. 2001. A comparative in vitro evaluation of the fermentation properties of prebiotic oligosaccharides. J. Appl. Microbiol.  91: 878– 887. Google Scholar CrossRef Search ADS PubMed  Sánchez O., Guio F., Garcia D., Silva E., Caicedo L.. 2008. Fructooligosaccharides production by Aspergillus sp. N74 in a mechanically agitated airlift reactor. Food Bioprod. Process.  86: 109– 115. Google Scholar CrossRef Search ADS   Shin H. Y., Park S. Y., Sung J. H., Kim D. H.. 2003. Purification and characterization of alpha-L-arabinopyranosidase and alpha-L- arabinofuranosidase from Bifidobacterium breve K-110, a human intestinal anaerobic bacterium metabolizing ginsenoside Rb2 and Rc. Appl. Environ. Microbiol . 69: 7116– 7123. Google Scholar CrossRef Search ADS PubMed  Sikandar A., Zaneb H., Younus M., Khattak F., Masood S., Aslam A., Khattak F., Ashraf S., Yousaf M. S., Rehman H.. 2017. Effect of sodium butyrate on performance, immune status, microarchitecture of small intestinal mucosa and lymphoid organs in broiler chickens. Asian-Aust. j. Anim. Sci.  30: 690– 699. Google Scholar CrossRef Search ADS   Sobayo R. A. 2013. Changes in growth, digestibility and gut anatomy by broilers fed diets containing ethanol-treated castor oil seed (Ricinus communis L.) meal. Rev. Cient. Agr.  12: 660– 667. Song J., Jiao L. F., Xiao K., Luan Z. S., Hu C. H., Shi B., Zhan X. A.. 2013. Cello-oligosaccharide ameliorates heat stress-induced impairment of intestinal microflora, morphology and barrier integrity in broilers. Anim. Feed Sci. Technol.  185: 175– 181. Google Scholar CrossRef Search ADS   Suo H. Q., Lin L. U., Guo-Hui X. U., Lin X., Chen X. G., Xia R. R., Zhang L. Y., Luo X. G.. 2015. Effectiveness of dietary xylo-oligosaccharides for broilers fed a conventional corn-soybean meal diet. J. Integr. Agr.  14: 2050– 2057. Google Scholar CrossRef Search ADS   Światkiewicz S., Arczewska-Wlosek A., Bederska-Lojewska D., JÓzefiak D.. 2017. Efficacy of dietary vitamin d and its metabolites in poultry - Review and implications of the recent studies. World's Poult. Sci. J.  73: 57– 68. Google Scholar CrossRef Search ADS   Światkiewicz S., Koreleski J., Arczewska A.. 2010. Effect of organic acids and prebiotics on bone quality in laying hens fed diets with two levels of calcium and phosphorus. Acta. Vet. Brno.  79: 185– 193. Google Scholar CrossRef Search ADS   Teillant A., Brower C. H., Laxminarayan R.. 2015. Economics of antibiotic growth promoters in livestock. Annu. Rev. Resour. Econ . 17: 1– 26. Van Laere K. M., Beldman G., Voragen A. G.. 1997. A new arabinofuranohydrolase from Bifidobacterium adolescentis able to remove arabinosyl residues from double-substituted xylose units in arabinoxylan. Appl. Microbiol. Biotechnol.  47: 231– 235. Google Scholar CrossRef Search ADS PubMed  Xu Z. R., Hu C. H., Xia M. S., Zhan X. A., Wang M. Q.. 2003. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of growing pigs. Poult. Sci.  82: 1030– 1036. Google Scholar CrossRef Search ADS PubMed  Yue S., Regassa A., Ji H. K., Kim W. K.. 2015. The effect of dietary fructooligosaccharide supplementation on growth performance, intestinal morphology, and immune responses in broiler chickens challenged with Salmonella Enteritidis lipopolysaccharides. Poult. Sci.  94: 77– 89. Zeng H., Xue Y., Peng T., Shao W.. 2007. Properties of xylanolytic enzyme system in bifidobacteria and their effects on the utilization of xylooligosaccharides. Food Chem . 101: 1172– 1177. Google Scholar CrossRef Search ADS   Zhenping S., Wenting L., Ruikui Y., Jia L., Honghong L., Wei S., Zhongmie W., Jingpan L., Zhe S., Yuling Q.. 2013. Effect of a straw-derived xylooligosaccharide on broiler growth performance, endocrine metabolism, and immune response. Can. J. Vet. Res.  77: 105– 109. Google Scholar PubMed  Zhou E., Pan X. L., Tian X. Z.. 2009. Application study of xylo-oligosaccharide in layer production. Mod. Appl. Sci.  3: 103– 107. © 2017 Poultry Science Association Inc.

Journal

Poultry ScienceOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off