Effect of dietary fructooligosaccharide supplementation on internal organs Salmonella colonization, immune response, ileal morphology, and ileal immunohistochemistry in laying hens challenged with Salmonella Enteritidis

Effect of dietary fructooligosaccharide supplementation on internal organs Salmonella... ABSTRACT A study was conducted to evaluate the efficacy of fructooligosaccharides (FOS) in controlling the infection of Salmonella Enteritidis (SE) in White Leghorns. A total of 30 laying hens (white leghorns W-36) were challenged both orally and cloacally with approximately 108 colony-forming units of nalidxic acid resistant SE (SENAR) and divided into 3 treatments: 1) SENAR challenged + 0.0% FOS, 2) SENAR challenged + 0.5% FOS (Nutraflora), and 3) SENAR challenged + 1.0% FOS. SENAR recovery via fecal shedding was measured at 3- and 6-d post-infection (dpi), whereas in the ceca and internal organs, SENAR recovery was measured at 7-d post-infection. In the first experiment, there was a 1.0 log10 and a 1.3 log10 reduction in cecal SENAR by supplementation of FOS at 0.5 and 1.0%, respectively. In the second experiment, there was a 0.6 log10 and a 0.8 log10 reduction in cecal SENAR by supplementation of FOS at 0.5 and 1.0%, respectively. Fecal shedding was significantly lower in 1.0% FOS supplemented groups compared to SENAR challenge 0.0% FOS. There was no significant difference among the 3 treatments on SENAR recovery in liver with gall bladder and ovaries. However, the frequency of positive SENAR in the ovaries (10 to 40%) in SENAR challenge 0.0% FOS was significantly lower than liver with gall bladder (60 to 80%) in both experiments. There was a significant upregulation of toll-like receptor-4 in 1.0% FOS and interferon gamma in both 0.5 and 1.0% FOS. Histologic measurements of ileal villi height and crypt depth were similar across all treatments. Immunohistochemistry analyses of ileal samples showed that immunoglobulin A positive cells increased as FOS concentration increased reaching significance at 1.0% as well as altered cytokine gene expression in the ileum. Further, FOS supplementation also reduced cecal SENAR and feces SENAR levels. Collectively, the results suggest that dietary supplementation with FOS may impair SE pathogenesis while modulating humoral immunity within the gut-associated lymphoid tissue. INTRODUCTION Foodborne diseases continue to be important health and economic issues in the United States with higher incidence observed for Salmonella (CDC, 2014). Salmonella enterica serovar Enteritidis (SE) is a facultative intracellular foodborne pathogen that causes illness in chickens and humans (Babu et al., 2012). The major sources of human Salmonella infections are the contaminated meat and eggs from Salmonella carrier chickens (Mughini-Gras et al., 2014). The misuse of antibiotics leading to the resistance in bacteria, such as Salmonella, has created demands for novel antimicrobial or inhibitory replacements (Cheng et al., 2014). Dietary interventions involving plant by-products including wheat-middling and alfalfa with fructoligosaccharides (FOS) to reduce the Salmonella colonization in molting hens have been evaluated in the past (Seo et al., 2001; Dunkley et al., 2007). Salmonella Enteritidis challenge with prebiotics, probiotics, and symbiotic supplementation in Salmonella-free 1-day-old broilers as well as laying hen pullets have been already reported (Murate et al., 2015). Other studies in broilers reported that dietary FOS administration yielded better gain and feed conversion (Bailey et al., 1991; Xu et al., 2003). Further, dietary FOS supplementation has the potential to elevate the anti-Salmonella activity, which is mainly due to the shift of intestinal microbiota and the production of short-chain fatty acids (Van Immerseel et al., 2009). Dietary supplementation with FOS revealed a 4-fold reduction of Salmonella in chicken ceca (Bailey et al., 1991) and had indirect benefits toward the immune system of chickens by promoting the growth of lactic acid-producing bacteria (Xu et al., 2003). Currently, no study has evaluated the bacteriological as well as immunological consequences of FOS supplementation in mature laying hens challenged with SE. We hypothesize that FOS supplementation reduces SE in the ceca and internal organs as well as stimulates select immunological parameters. To test this hypothesis, this study investigated the role of FOS supplementation on anti-Salmonella activity in feces, ceca, liver with gall bladder (L/GB) and ovary as well as intestinal morphology and select gut-associated lymphoid tissue immune parameters in White Leghorn hens. MATERIALS AND METHODS Salmonella, Diluent, and Inoculum Preparation Salmonella Enteritidis resistant to nalidixic acid (SENAR) bacteria were used in this study at the USDA-Agricultural Research Service facility (Athens, GA). Tryptic soy broth (Acumedia, Neogen Corp., Lansing, MI) with 15% glycerol (Sigma-Aldrich, St Louis, MO) was employed for long-term preservation of SENAR. SENAR were grown on brilliant green agar with sulphapyridine (BGS; Acumedia, East Lansing, MI) containing 200 ppm of Nal (BGS-Nal; Sigma-Aldrich, St. Louis, MO) and incubated for 24 h at 37°C. Isolated SENAR colonies were transferred to 9 ml of 0.85% sterile saline solution. The absorbance value was adjusted to an optical density of 0.20 ± 0.01 at 540 nm with a spectrophotometer (Spect-20, Milton-Roy, Thermo Spectronics, Madison, WI), which yields approximately 108 cfu/ml. Cultures were serially diluted in sterile saline for enumeration. Hens were individually gavaged orally with a 1 mL tuberculin syringe (Becton, Dickinson and Co., Franklin Lakes, NJ) and an animal feeding needle (Popper & Sons, Inc., New Hyde Park, NY), whereas intracloacal inoculation was performed using only a 1 mL tuberculin syringe. Hens were challenged with the inoculum doses of 2.4 × 108 and 1.7 × 108 cfu/ml of SENAR for experiments 1 and 2, respectively. Hens, Husbandry, and Dietary Treatments Two experiments were conducted with 30 (per experiment) Single Combs White Leghorn hens (n = 30 birds per experiment 60 and 65 wk old at the beginning of the first and second experiments, respectively). Hens were housed individually in wire-laying cages and fed a corn-soy layer mash diet (Table 1). The diet was formulated to provide 2600 kg/kcal ME, 16% CP, 4.4% Ca, and 0.5% available P (NRC, 1994). All hens were allowed to acclimate to the basal diet for 1 wk after which they were randomly allocated to the respective treatment diets. After 1-week adaptation to the treatment diets, hens were individually challenged with SENAR (0-d post-infection, dpi). On 7 dpi, hens were individually euthanized and samples were collected. Total experimental days were 21. Hens were housed under a controlled environment (27 ± 2°C) and a 16 h light:8 h dark regimen. Feed was withdrawn for 10 h before SENAR challenge, and feeders were replaced immediately post-challenge. Hens were grouped to give 10 replicates per treatment. The treatments were as follows: 1) SENAR challenged control, 2) SENAR challenged + 0.5% FOS (Nutraflora) (GTC Nutrition, Bridgewater, NJ), and 3) SENAR challenged + 1.0% FOS. All experiment protocols were approved by the Institutional Animal Care and Use Committee of University of Georgia (AUP number = A2014 07-016). Table 1. Diet formulation and calculated composition of diet1 (experiment 1 and 2).     % FOS in diet    Item  0.0  0.5  1.0  Ingredient (% of the diet)  Corn, grain  59.53  59.53  59.53  Soybean meal –48%  23.13  23.13  23.13  Limestone  9.62  9.62  9.62  Soybean oil  3.00  3.00  3.00  Defluorinated phosphorus  2.13  2.13  2.13  Vitamin premix2  0.50  0.50  0.50  DL-methionine  0.34  0.34  0.34  Common salt  0.30  0.30  0.30  L-Lysine HCl  0.30  0.30  0.30  Mineral premix3  0.15  0.15  0.15  FOS4  0.00  0.50  1.00  Sand  1.00  0.50  0.00  Calculated composition  ME (kcal/kg)  2.85  2.85  2.85  CP (%)  16  16  16  Ca (%)  4.4  4.4  4.4  Available P (%)  0.5  0.5  0.5      % FOS in diet    Item  0.0  0.5  1.0  Ingredient (% of the diet)  Corn, grain  59.53  59.53  59.53  Soybean meal –48%  23.13  23.13  23.13  Limestone  9.62  9.62  9.62  Soybean oil  3.00  3.00  3.00  Defluorinated phosphorus  2.13  2.13  2.13  Vitamin premix2  0.50  0.50  0.50  DL-methionine  0.34  0.34  0.34  Common salt  0.30  0.30  0.30  L-Lysine HCl  0.30  0.30  0.30  Mineral premix3  0.15  0.15  0.15  FOS4  0.00  0.50  1.00  Sand  1.00  0.50  0.00  Calculated composition  ME (kcal/kg)  2.85  2.85  2.85  CP (%)  16  16  16  Ca (%)  4.4  4.4  4.4  Available P (%)  0.5  0.5  0.5  1Diets are in as-fed basis. 2Supplemeted per kg of diet: thiamin mononitrate, 2.4 mg; nicotinic acid, 44 mg; riboflavin, 4.4 mg; D-Ca pantothenate, 12 mg; vitamin B12 (cobalamin), 12.0 g; pyridoxine HCl, 4.7 mg; D-biotin, 0.11 mg; folic acid, 5.5 mg; menadione sodium bisulfite complex, 3.34 mg; choline chloride, 220 mg; cholecalciferol, 27.5 g; transretinyl acetate, 1892 g; α tocopheryl acetate, 11 mg; ethoxyquin, 125 mg. 3Supplemented as per kg of diet: manganese (MnSO4.H2O), 60 mg; iron (FeSO4.7H2O), 30 mg; zinc (ZnO), 50 mg; copper (CuSO4.5H2O), 5 mg; iodine (ethylene diamine dihydroiodide), 0.15 mg; selenium (NaSe03), 0.3 mg. 4Fructoligosachharides: NutraFlora (GTC Nutrition, Bridgewater, NJ). View Large Table 1. Diet formulation and calculated composition of diet1 (experiment 1 and 2).     % FOS in diet    Item  0.0  0.5  1.0  Ingredient (% of the diet)  Corn, grain  59.53  59.53  59.53  Soybean meal –48%  23.13  23.13  23.13  Limestone  9.62  9.62  9.62  Soybean oil  3.00  3.00  3.00  Defluorinated phosphorus  2.13  2.13  2.13  Vitamin premix2  0.50  0.50  0.50  DL-methionine  0.34  0.34  0.34  Common salt  0.30  0.30  0.30  L-Lysine HCl  0.30  0.30  0.30  Mineral premix3  0.15  0.15  0.15  FOS4  0.00  0.50  1.00  Sand  1.00  0.50  0.00  Calculated composition  ME (kcal/kg)  2.85  2.85  2.85  CP (%)  16  16  16  Ca (%)  4.4  4.4  4.4  Available P (%)  0.5  0.5  0.5      % FOS in diet    Item  0.0  0.5  1.0  Ingredient (% of the diet)  Corn, grain  59.53  59.53  59.53  Soybean meal –48%  23.13  23.13  23.13  Limestone  9.62  9.62  9.62  Soybean oil  3.00  3.00  3.00  Defluorinated phosphorus  2.13  2.13  2.13  Vitamin premix2  0.50  0.50  0.50  DL-methionine  0.34  0.34  0.34  Common salt  0.30  0.30  0.30  L-Lysine HCl  0.30  0.30  0.30  Mineral premix3  0.15  0.15  0.15  FOS4  0.00  0.50  1.00  Sand  1.00  0.50  0.00  Calculated composition  ME (kcal/kg)  2.85  2.85  2.85  CP (%)  16  16  16  Ca (%)  4.4  4.4  4.4  Available P (%)  0.5  0.5  0.5  1Diets are in as-fed basis. 2Supplemeted per kg of diet: thiamin mononitrate, 2.4 mg; nicotinic acid, 44 mg; riboflavin, 4.4 mg; D-Ca pantothenate, 12 mg; vitamin B12 (cobalamin), 12.0 g; pyridoxine HCl, 4.7 mg; D-biotin, 0.11 mg; folic acid, 5.5 mg; menadione sodium bisulfite complex, 3.34 mg; choline chloride, 220 mg; cholecalciferol, 27.5 g; transretinyl acetate, 1892 g; α tocopheryl acetate, 11 mg; ethoxyquin, 125 mg. 3Supplemented as per kg of diet: manganese (MnSO4.H2O), 60 mg; iron (FeSO4.7H2O), 30 mg; zinc (ZnO), 50 mg; copper (CuSO4.5H2O), 5 mg; iodine (ethylene diamine dihydroiodide), 0.15 mg; selenium (NaSe03), 0.3 mg. 4Fructoligosachharides: NutraFlora (GTC Nutrition, Bridgewater, NJ). View Large Sampling Protocol and Processing Fecal Shedding (Bacteriological) Hens were monitored for fecal shedding on 3 and 6 dpi. Aluminum foil sheets were placed in the bottom of the cages overnight, and feces were collected the next morning in to sterile 50 mL conical centrifuge tubes and transported in an ice chest for bacteriological analyses. Briefly, feces from each bird were weighed, then diluted with buffered peptone water (BPW) 3 times volume to the sample weight and vortexed. A 10 μl portion of each sample was streaked for isolation onto BGS-Nal plates. Plates and sample tubes were incubated for 24 h at 37°C. Plates that were negative by direct plating were confirmed by a repeated streak into BGS-Nal plates from the overnight pre-enriched samples. The plates were read as negative or positive based on the Salmonella colonies they produced. Ceca, L/GB, and Ovaries (Bacteriological) All hens were humanely euthanized by electrocution on 7 dpi. Samples including ceca, ovaries, and L/GB were collected aseptically for bacteriological analyses. All the samples were macerated by a sterile rubber mallet. Samples were individually weighed and diluted in BPW at 3× their weight. The sample bags were stomached (Techmar Company, Cincinnati, Ohio) for 60 s and pre-enriched for 24 h at 37°C. Pre-enriched samples for ovaries and L/GB were streaked for isolation onto BGS-Nal plates and incubated for 24 h at 37°C. The growth of SENAR was observed and recorded. Cecal samples were analyzed using the modified Blanchfield method (Blanchfield et al., 1984). In brief, after stomaching for 60 s, two cotton-tipped swabs were dipped and rotated in the cecal material for approximately 5 s. One BGS-Nal plate was surface-swabbed (plate A). The second swab was transferred into a sterile 9.9 mL BPW dilution tube. The tube was vortexed for approximately 10 s, and a third swab was used to surface swab a second BGS-Nal plate (plate B). The contents of each dilution tube were returned to the stomacher bag and incubated with the plates at 37°C overnight. All plates together with the cecal samples were incubated overnight at 37°C. Samples that were negative after the overnight pre-enrichments were re-streaked onto a fresh BGS-Nal plate (plate C) and incubated overnight at 37°C. Counts were approximated and converted to log10 cfu SENR/g of cecal contents. Ileum Immune Genes Expression RNA Isolation, cDNA Synthesis, and Quantitative Real-time Polymerase Chain Reaction Sections of the ileum were aseptically excised, immediately frozen in liquid nitrogen, and preserved at –80°C for analysis of immune genes by quantitative real-time polymerase chain reaction (qRT-PCR). Total RNA was extracted from about 100 mg of tissues using QiAzol lysis reagents (Qiazen, Valencia, CA) according to the manufacturer's instruction. The samples were homogenized in a homogenizer (Biospec Products, Fisher Scientific, MA) for 3 min. The RNAse-free water (Ambion, Applied BioSystems, Life Technologies, CA) was used to dissolve the final pellet. The total RNA concentrations were determined at an optical density of 260 nm using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, MA). All RNA samples were normalized to a concentration of 2 μg/μl, and the purity of RNA was verified by evaluating the optical density ratio of 260 to 280 nm. The normalized RNA was reverse-transcribed using High Capacity cDNA synthesis kits (Applied BioSystems, Life Technologies, CA). Individual transcripts were normalized to glyceraldehyde 3-phosphate dehydrogenase as a housekeeping gene. Primers for select chicken immune marker genes toll-like receptor (TLR-4), interleukins (IL-1ß, IL-6, and IL-10), and interferon (IFNY) were designed according to National Center for Biotechnology Information presented in Table 2. qRT-PCR was performed using a Step One thermo-cycler (Applied Biosystem, Foster City, CA). Table 2. Chicken cytokines and toll-like receptor primer sequences. Gene1  Primer sequence (5″-3″)  Gene bank accession no.  Fragment size, bp  Annealing temperature,°C  Glyceraldehyde 3-phosphate dehydrogenase  F: GCTAAGGCTGTGGGGAAAGT  K01458  116  56    R: TCAGCAGCAGCCTTCACTAC        TLR4  F: AGTCTGAAATTGCTGAGCTCAAAT  AY064697  190  56    R: GCGACGTTAAGCCATGGAAG        IL6  F: CAGGACGAGATGTGCAAGAA  AJ309540  233  59    R: TAGCACAGAGACTCGACGTT        IL10  F: AGCAGATCAAGGAGACGTTC  NM001004414  103  56    R: ATCAGCAGGTACTCCTCGAT        IL-1β  F: CACAGAGATGGCGTTCGTTC  NM204524  118  56    R: GCAGATTGTGAGCATTGGGC        IFN- γ  F: CTGAAGAACTGGACAGAGAG  NM205149  159  58    R: CACCAGCTTCTGTAAGATGC        Gene1  Primer sequence (5″-3″)  Gene bank accession no.  Fragment size, bp  Annealing temperature,°C  Glyceraldehyde 3-phosphate dehydrogenase  F: GCTAAGGCTGTGGGGAAAGT  K01458  116  56    R: TCAGCAGCAGCCTTCACTAC        TLR4  F: AGTCTGAAATTGCTGAGCTCAAAT  AY064697  190  56    R: GCGACGTTAAGCCATGGAAG        IL6  F: CAGGACGAGATGTGCAAGAA  AJ309540  233  59    R: TAGCACAGAGACTCGACGTT        IL10  F: AGCAGATCAAGGAGACGTTC  NM001004414  103  56    R: ATCAGCAGGTACTCCTCGAT        IL-1β  F: CACAGAGATGGCGTTCGTTC  NM204524  118  56    R: GCAGATTGTGAGCATTGGGC        IFN- γ  F: CTGAAGAACTGGACAGAGAG  NM205149  159  58    R: CACCAGCTTCTGTAAGATGC        1IL, interleukin; IFN, interferon; TLR, toll-like receptor. View Large Table 2. Chicken cytokines and toll-like receptor primer sequences. Gene1  Primer sequence (5″-3″)  Gene bank accession no.  Fragment size, bp  Annealing temperature,°C  Glyceraldehyde 3-phosphate dehydrogenase  F: GCTAAGGCTGTGGGGAAAGT  K01458  116  56    R: TCAGCAGCAGCCTTCACTAC        TLR4  F: AGTCTGAAATTGCTGAGCTCAAAT  AY064697  190  56    R: GCGACGTTAAGCCATGGAAG        IL6  F: CAGGACGAGATGTGCAAGAA  AJ309540  233  59    R: TAGCACAGAGACTCGACGTT        IL10  F: AGCAGATCAAGGAGACGTTC  NM001004414  103  56    R: ATCAGCAGGTACTCCTCGAT        IL-1β  F: CACAGAGATGGCGTTCGTTC  NM204524  118  56    R: GCAGATTGTGAGCATTGGGC        IFN- γ  F: CTGAAGAACTGGACAGAGAG  NM205149  159  58    R: CACCAGCTTCTGTAAGATGC        Gene1  Primer sequence (5″-3″)  Gene bank accession no.  Fragment size, bp  Annealing temperature,°C  Glyceraldehyde 3-phosphate dehydrogenase  F: GCTAAGGCTGTGGGGAAAGT  K01458  116  56    R: TCAGCAGCAGCCTTCACTAC        TLR4  F: AGTCTGAAATTGCTGAGCTCAAAT  AY064697  190  56    R: GCGACGTTAAGCCATGGAAG        IL6  F: CAGGACGAGATGTGCAAGAA  AJ309540  233  59    R: TAGCACAGAGACTCGACGTT        IL10  F: AGCAGATCAAGGAGACGTTC  NM001004414  103  56    R: ATCAGCAGGTACTCCTCGAT        IL-1β  F: CACAGAGATGGCGTTCGTTC  NM204524  118  56    R: GCAGATTGTGAGCATTGGGC        IFN- γ  F: CTGAAGAACTGGACAGAGAG  NM205149  159  58    R: CACCAGCTTCTGTAAGATGC        1IL, interleukin; IFN, interferon; TLR, toll-like receptor. View Large Ileum Histomorphology Approximately 2 cm sections of the ileum were selected and fixed in 10% phosphate-buffered formalin (Sigma-Aldrich, St. Louis, MO) for 24 h. Briefly, tissues were routinely processed, and samples were embedded in paraffin and cut into 4.0 μm sections and stained with standard hematoxylin-eosin solution. Additional unstained sections were mounted onto positively charged slides for further immunohistochemistry (IHC) analysis. Each slide was evaluated for villi height (VH) and crypt depth (CD) at 100× magnification using a light microscope coupled with a camera (Leica DC500 camera, Leica Microsystems Inc., Buffalo Groove, IL). A minimum of 3 readings per slide were made for both VH and CD and averaged into a single value for each sample. VH was measured as entire villus length from the tip to base. CD was measured from the villus-crypt axis to the base of the specific crypt. Villus height to CD ratio and total mucosal thickness were also calculated for each ileum. Image J software was used to analyze and measure the length of the captured images. Ileum IHC Immunoglobulin A (IgA)-positive cells in the ileum were identified and quantitated by an IHC technique. Paraffin-embedded ileal sections mounted on slides were deparaffinized in xylene and hydrated in descending grades of alcohol. Antigen retrieval was executed in citrate buffer at pH 6.0 for 45 min with the use of a steamer. Blocking of peroxidase activity was performed with Bloxall (Vector Laboratories, Burlingame, CA) following manufacturer's instructions and the samples were washed. After the washing steps, the slides were incubated with a Protein Block solution (Dako, Carpinteria, CA) for 10 min to block non-specific binding. Mouse monoclonal antichicken IgA (Southern Biotech, Birmingham, AL) was diluted at 1:500 concentrations and used as a primary antibody. The slides were incubated with the primary antibody at 23°C for 1 h. Slides incubated with phosphate-buffered saline served as negative controls. The slides were then washed. The slides were incubated with MACH 3 mouse probe and horse radish peroxide—polymer (Biocare Medical, Concord, CA) following manufacturer's recommendations. After washing steps, the slides were incubated with 3, 3' diaminobenzidine tetrahydrochlorine (Vector Laboratories, Burlingame, CA) for 10 min at 23°C and counterstained with hematoxylin. The slides were examined by a bright field microscope. An Olympus DP25 camera was used to take photographs of 3 100× fields of view per section. Counting of immunostained cells was performed with CellSens Standard software (Olympus, Center Valley, PA). Statistical Analysis SENAR recovery from feces and internal organs was analyzed with Fisher's exact test for any Salmonella prevalence. The relative quantification analysis of qRT-PCR data was performed using the ΔΔCt method (Livak and Schmittgen, 2001). The means of Log10 viable SENAR counts from the ceca, ileum immune gene expression, histomorpholgy, and IHC data were subjected to one-way analysis of variance using the GLM procedure of SAS (SAS, 2009). Significant differences between the means of different treatments were determined by Duncan's multiple-range test, and significant differences were assessed at P < 0.05. RESULTS Prevalence of SENAR in Fecal Samples At 3 dpi, all of the fecal samples analyzed were positive for SENAR (Table 3). By day 6 dpi, the percentage of positive fecal samples for SENAR in the 0.0% FOS group had declined to ∼85% (average of 2 experiments). However, in the 6 dpi FOS-supplemented birds, this percentage decreased reaching significance in the 1.0% FOS-treated group in both experiments compared to SENAR challenge 0.0% FOS group. Table 3. Presence of Salmonella Enteritidis (SE) in fecal shedding analyzed at 3 and 6-d post-infection (dpi) from laying hens fed rations with 0.0, 0.5, or 1.0% fructoligosaccharides (FOS) (experiment 1 and 2).     Treatments (% FOS)  Experiments  dpi  0.0  0.5  1.0  1  3  10/101 (100%)  10/10 (100%)  10/10 (100%)    6  9/10a (90%)  7/10a (70%)  6/10b (60%)  2  3  10/10 (100%)  10/10 (100%)  10/10 (100%)    6  8/10a (80%)  7/10a (70%)  6/10b (60%)      Treatments (% FOS)  Experiments  dpi  0.0  0.5  1.0  1  3  10/101 (100%)  10/10 (100%)  10/10 (100%)    6  9/10a (90%)  7/10a (70%)  6/10b (60%)  2  3  10/10 (100%)  10/10 (100%)  10/10 (100%)    6  8/10a (80%)  7/10a (70%)  6/10b (60%)  1Pos/Tot: number of SE-positive hens out of a total of 10 observations. a,bMeans within a row with no common superscripts differ significantly (P < 0.05). View Large Table 3. Presence of Salmonella Enteritidis (SE) in fecal shedding analyzed at 3 and 6-d post-infection (dpi) from laying hens fed rations with 0.0, 0.5, or 1.0% fructoligosaccharides (FOS) (experiment 1 and 2).     Treatments (% FOS)  Experiments  dpi  0.0  0.5  1.0  1  3  10/101 (100%)  10/10 (100%)  10/10 (100%)    6  9/10a (90%)  7/10a (70%)  6/10b (60%)  2  3  10/10 (100%)  10/10 (100%)  10/10 (100%)    6  8/10a (80%)  7/10a (70%)  6/10b (60%)      Treatments (% FOS)  Experiments  dpi  0.0  0.5  1.0  1  3  10/101 (100%)  10/10 (100%)  10/10 (100%)    6  9/10a (90%)  7/10a (70%)  6/10b (60%)  2  3  10/10 (100%)  10/10 (100%)  10/10 (100%)    6  8/10a (80%)  7/10a (70%)  6/10b (60%)  1Pos/Tot: number of SE-positive hens out of a total of 10 observations. a,bMeans within a row with no common superscripts differ significantly (P < 0.05). View Large Cecal Count of SENAR Supplementation of FOS at 1.0% significantly reduced (P < 0.05) the cecal SENAR compared to SE challenged control diet but 1.0% FOS was not different from 0.5% FOS in both experiments (Table 4). In experiment 1, the mean log10 value of SENAR colonization was 4.2 in the 0.0% FOS that was reduced to log 3.2 in 0.5% FOS and to log 2.8 in 1.0% FOS. In experiment 2, the mean log10 value of SENAR colonization was log 3.7, 3.3, and 2.9 in the 0.0, 0.5, and 1.0% FOS, respectively. In experiment 1, there was 1.0 log10 and 1.4 log10 reduction in cecal SENAR by supplementation of FOS at 0.5 and 1.0%, respectively. In experiment 2, there was 0.5 log10 and 0.8 log10 reduction in cecal SENAR by supplementation of FOS at 0.5 and 1.0%, respectively. Table 4. The viable number (log10) of Salmonella Enteritidis (SE) in the cecal contents analyzed at 7-d post-infection fed rations with 0.0, 0.5, or 1.0% fructoligosaccharides (FOS) (experiment 1 and 2).1     Treatments (% FOS)  Experiment  Count  0.0  0.5  1.0  1  Log10 cfu/g  4.2 ± 1.67a  3.2 ± 1.46a,b  2.8 ± 1.08b  2  Log10 cfu/g  3.7 ± 1.78a  3.3 ± 1.63a,b  2.9 ± 1.28b      Treatments (% FOS)  Experiment  Count  0.0  0.5  1.0  1  Log10 cfu/g  4.2 ± 1.67a  3.2 ± 1.46a,b  2.8 ± 1.08b  2  Log10 cfu/g  3.7 ± 1.78a  3.3 ± 1.63a,b  2.9 ± 1.28b  1The mean ± SEM count per gram from 10 hens/treatment. a,bMeans within a row with no common superscripts differ significantly (P < 0.05). Values in the parenthesis represent the range of viable log10 counts of SENAR. View Large Table 4. The viable number (log10) of Salmonella Enteritidis (SE) in the cecal contents analyzed at 7-d post-infection fed rations with 0.0, 0.5, or 1.0% fructoligosaccharides (FOS) (experiment 1 and 2).1     Treatments (% FOS)  Experiment  Count  0.0  0.5  1.0  1  Log10 cfu/g  4.2 ± 1.67a  3.2 ± 1.46a,b  2.8 ± 1.08b  2  Log10 cfu/g  3.7 ± 1.78a  3.3 ± 1.63a,b  2.9 ± 1.28b      Treatments (% FOS)  Experiment  Count  0.0  0.5  1.0  1  Log10 cfu/g  4.2 ± 1.67a  3.2 ± 1.46a,b  2.8 ± 1.08b  2  Log10 cfu/g  3.7 ± 1.78a  3.3 ± 1.63a,b  2.9 ± 1.28b  1The mean ± SEM count per gram from 10 hens/treatment. a,bMeans within a row with no common superscripts differ significantly (P < 0.05). Values in the parenthesis represent the range of viable log10 counts of SENAR. View Large Prevalence of SENAR in Ovary and L/GB Salmonella Enteritidis recovery in the ovary was significantly lower (P < 0.05) compared to the L/GB (Table 5). The ovary was 40% positive in SE challenged 0.0% FOS, whereas for 0.5 and 1.0% FOS, it was 20 and 30% positive, respectively (experiment 1). In experiment 2, ovary was 20% positive in the 0.0% FOS, whereas it was 20 and 10% positive for 0.5 and 1.0% FOS. In L/GB, FOS supplementation at any level did not significantly reduce SE recovery. Table 5. Effects of fructoligosaccharides (FOS) on Salmonella Enteritidis colonization on the liver gall bladder (L/GB) and ovaries on 7-d post-infection (experiment 1 and 2).     Treatments (% FOS)  Experiment  Organs  0.0  0.5  1.0  1  L/GB  8/10 (80%)a  8/10 (80%)a  8/10 (80%)a    Ovaries  4/10 (40%)b  2/10 (20%)b  3/10 (30%)b  2  L/GB  6/10 (60%)a  6/10 (60%)a  6/10 (60%)a    Ovaries  2/10 (20%)b  2/10 (20%)b  1/10 (10%)b      Treatments (% FOS)  Experiment  Organs  0.0  0.5  1.0  1  L/GB  8/10 (80%)a  8/10 (80%)a  8/10 (80%)a    Ovaries  4/10 (40%)b  2/10 (20%)b  3/10 (30%)b  2  L/GB  6/10 (60%)a  6/10 (60%)a  6/10 (60%)a    Ovaries  2/10 (20%)b  2/10 (20%)b  1/10 (10%)b  a,bMeans within a column with no common superscripts differ significantly (P < 0.05). View Large Table 5. Effects of fructoligosaccharides (FOS) on Salmonella Enteritidis colonization on the liver gall bladder (L/GB) and ovaries on 7-d post-infection (experiment 1 and 2).     Treatments (% FOS)  Experiment  Organs  0.0  0.5  1.0  1  L/GB  8/10 (80%)a  8/10 (80%)a  8/10 (80%)a    Ovaries  4/10 (40%)b  2/10 (20%)b  3/10 (30%)b  2  L/GB  6/10 (60%)a  6/10 (60%)a  6/10 (60%)a    Ovaries  2/10 (20%)b  2/10 (20%)b  1/10 (10%)b      Treatments (% FOS)  Experiment  Organs  0.0  0.5  1.0  1  L/GB  8/10 (80%)a  8/10 (80%)a  8/10 (80%)a    Ovaries  4/10 (40%)b  2/10 (20%)b  3/10 (30%)b  2  L/GB  6/10 (60%)a  6/10 (60%)a  6/10 (60%)a    Ovaries  2/10 (20%)b  2/10 (20%)b  1/10 (10%)b  a,bMeans within a column with no common superscripts differ significantly (P < 0.05). View Large Cytokine Gene Expression in the Ileum The FOS supplementation altered the expression of 2 of the ileal cytokine genes of the 5 examined (Figure 1). Supplementation of 1.0% FOS significantly upregulated the TLR-4 mRNA (P = 0.0005) expression compared to both the 0.0 and 0.5% FOS (Figure 1b). Supplementation of 0.5 and 1.0% FOS significantly upregulated the IFN- γ mRNA expression (P = 0.003) compared to the SE challenged 0.0% FOS group (Figure 1d). Figure 1. View largeDownload slide Ileal gene expressions of a) Interleukin (IL)-1ß, b) toll-like receptor (TLR)-4, c) IL-6, d) interferon (IFN)-γ, and e) IL-10, under Salmonella Enteritidis challenge condition (N = 10/treatment). Gene expressions were calculated relative to housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase. Error bars represent standard errors. Bars with ‘*’ symbol differ from the control. Figure 1. View largeDownload slide Ileal gene expressions of a) Interleukin (IL)-1ß, b) toll-like receptor (TLR)-4, c) IL-6, d) interferon (IFN)-γ, and e) IL-10, under Salmonella Enteritidis challenge condition (N = 10/treatment). Gene expressions were calculated relative to housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase. Error bars represent standard errors. Bars with ‘*’ symbol differ from the control. Intestinal Morphology and IgA Count in the Ileum In both experiments, VH, CD, and their ratio were not statistically different across treatments (Table 6). However, the number of IgA+-stained cells in the lamina propria of ileum was affected by FOS supplementation (Figure 2). IgA-positive cells were detected in intestinal mucosa in all 3 treatment groups (Figure 3). There was an increase in IgA+ cells in the ileum for the 1.0% FOS treatment that was significant to both the 0.0 and 0.5% FOS treatment groups. Figure 2. View largeDownload slide Representative immunohistochemical staining of immunoglobulin A+ (IgA+) cells in the ileum of White Leghorns. A) Negative control, B) IgA-positive cells (arrow) in Salmonella challenged 0.0% FOS, C) IgA-positive cells in 0.5% FOS, and D) IgA-positive cells in 1.0% FOS. The image was taken at magnification of 20×. Figure 2. View largeDownload slide Representative immunohistochemical staining of immunoglobulin A+ (IgA+) cells in the ileum of White Leghorns. A) Negative control, B) IgA-positive cells (arrow) in Salmonella challenged 0.0% FOS, C) IgA-positive cells in 0.5% FOS, and D) IgA-positive cells in 1.0% FOS. The image was taken at magnification of 20×. Figure 3. View largeDownload slide Immunoglobulin A (IgA)-positive cells in the lamina propria of ileum section of hens fed either 0.0% FOS with SE challenge, 0.5% FOS with SE challenge, and 1.0% FOS with SE challenge. The number of host cells showing positive staining on 3 randomly selected microscopic areas of each hen was counted. N = 3/treatment. Bars with ‘*’ symbol differ from the 0.0 to 0.5% FOS. Figure 3. View largeDownload slide Immunoglobulin A (IgA)-positive cells in the lamina propria of ileum section of hens fed either 0.0% FOS with SE challenge, 0.5% FOS with SE challenge, and 1.0% FOS with SE challenge. The number of host cells showing positive staining on 3 randomly selected microscopic areas of each hen was counted. N = 3/treatment. Bars with ‘*’ symbol differ from the 0.0 to 0.5% FOS. Table 6. Effect of fructooligosaccharide (FOS) on the ileal morphology of laying hens.1     Treatments (% FOS)2      Experiment   Site  0.0  0.5  1.0  SEM  P-value  1  VH (μm)  615.9  615.4  595.4  41.68  0.924    CD (μm)  101.1  75.6  95.6  9.88  0.181    VH:CD  6.6  8.5  6.9  0.89  0.297    Total mucosa thickness3 (μm)  1027.7  992.8  1085.6  56.48  0.512  2  VH (μm)  750.6  742.7  669.7  40.52  0.343    CD (μm)  75.5  90.5  88.9  84.90  0.318    VH:CD  8.8  8.2  7.2  0.69  0.143    Total mucosa thickness (μm)  1179.9  1148.5  1110.5  46.52  0.422      Treatments (% FOS)2      Experiment   Site  0.0  0.5  1.0  SEM  P-value  1  VH (μm)  615.9  615.4  595.4  41.68  0.924    CD (μm)  101.1  75.6  95.6  9.88  0.181    VH:CD  6.6  8.5  6.9  0.89  0.297    Total mucosa thickness3 (μm)  1027.7  992.8  1085.6  56.48  0.512  2  VH (μm)  750.6  742.7  669.7  40.52  0.343    CD (μm)  75.5  90.5  88.9  84.90  0.318    VH:CD  8.8  8.2  7.2  0.69  0.143    Total mucosa thickness (μm)  1179.9  1148.5  1110.5  46.52  0.422  1Means of the 3 measurements of each villus height, crypt depth, and total mucosa thickness of a hen, 10 hens per treatment. 20.0% FOS with SE challenge, 0.5% FOS with SE challenge, and 1.0% FOS with SE challenge. 3Total thickness of villus, crypt, and muscularis mucosa. N = 3/treatment. CD, crypt depth; VH, villi height View Large Table 6. Effect of fructooligosaccharide (FOS) on the ileal morphology of laying hens.1     Treatments (% FOS)2      Experiment   Site  0.0  0.5  1.0  SEM  P-value  1  VH (μm)  615.9  615.4  595.4  41.68  0.924    CD (μm)  101.1  75.6  95.6  9.88  0.181    VH:CD  6.6  8.5  6.9  0.89  0.297    Total mucosa thickness3 (μm)  1027.7  992.8  1085.6  56.48  0.512  2  VH (μm)  750.6  742.7  669.7  40.52  0.343    CD (μm)  75.5  90.5  88.9  84.90  0.318    VH:CD  8.8  8.2  7.2  0.69  0.143    Total mucosa thickness (μm)  1179.9  1148.5  1110.5  46.52  0.422      Treatments (% FOS)2      Experiment   Site  0.0  0.5  1.0  SEM  P-value  1  VH (μm)  615.9  615.4  595.4  41.68  0.924    CD (μm)  101.1  75.6  95.6  9.88  0.181    VH:CD  6.6  8.5  6.9  0.89  0.297    Total mucosa thickness3 (μm)  1027.7  992.8  1085.6  56.48  0.512  2  VH (μm)  750.6  742.7  669.7  40.52  0.343    CD (μm)  75.5  90.5  88.9  84.90  0.318    VH:CD  8.8  8.2  7.2  0.69  0.143    Total mucosa thickness (μm)  1179.9  1148.5  1110.5  46.52  0.422  1Means of the 3 measurements of each villus height, crypt depth, and total mucosa thickness of a hen, 10 hens per treatment. 20.0% FOS with SE challenge, 0.5% FOS with SE challenge, and 1.0% FOS with SE challenge. 3Total thickness of villus, crypt, and muscularis mucosa. N = 3/treatment. CD, crypt depth; VH, villi height View Large DISCUSSION Salmonella in Feces, Ceca, L/GB, and Ovary The FOS used in our study has shown to be effective in reducing SENAR fecal shedding at 6 dpi. Because there is a high chance of egg contamination after the egg-laying process, knowledge of SE fecal shedding pattern could help to evaluate future intervention approaches to reduce Salmonella contamination in eggs. A previous study reported that supplementation of 0.75% FOS reduced Salmonella prevalence to 12% and resulted in 0.75 log10 cfu reduction in Salmonella numbers when compared with SE challenged control birds (Bailey et al., 1991). Studies have shown that FOS alone or in combination with competitive exclusion cultures decreased organ colonization and recovery of SE from cecal contents of White Leghorn as well as broiler chicks (Bailey et al., 1991; Fukata et al., 1999). Invasion beyond intestine to internal organs like liver and spleen occurs within few hours of exposure to Salmonella infection (He et al., 2010). Hens-fed diets containing both alfalfa and FOS had significantly reduced fecal shedding as well as organs (liver and ovary) colonization of SE (Donalson et al., 2008). However, the above study was conducted with the complete feed withdrawal for 7 d unlike the present study, which removed feed for ∼12 to 14 h. Feed withdrawal in laying hens is one of the major stressors, and thus the incidence of SE is higher in such withdrawal periods. In our study, FOS was supplemented in feed and not in water because it was previously reported that in-feed supplementation of FOS was more effective in reducing Salmonella numbers than via drinking water (Bailey et al., 1991). Immune Gene Expression by Salmonella and FOS Salmonella infection has been shown to upregulate inflammatory cytokines gene expression such as IL-1ß, IL-18, and IFN- γ (Yasuda et al., 2002; Chappell et al., 2009; Babu et al., 2012). Interleukin-1ß is a pro-inflammatory cytokine mainly secreted from monocytes and macrophages (Corwin, 2000). In our study, there was no difference between treatments in the expression of IL-1ß gene at the level of the ileum. A study reported that IL-1ß was neither upregulated nor downregulated when chicks were challenged with Salmonella and supplemented with FOS (Janardhana et al., 2009). However, in another study, pro-inflammatory cytokines including IL-1ß were reduced by supplementing FOS-inulin diet in SE-infected cells (Babu et al., 2012). Still, it is worth noting that in the present study, cytokine gene expression was only evaluated in the ileal tissue. It is possible that this expression may have been different had avian lymphoid tissue been evaluated. TLR can recognize the conserved pathogen-associated molecular patterns of the lipopolysaccharides (LPS) of gram-negative bacteria, and are involved in a chain reaction that stimulates the innate immune response (Aderem and Ulevitch 2000). The increase in TLR-4 expression which became significant with a 1.0% FOS diet suggests that dietary FOS may enhance innate cell activation in the wake of SE infection. Orally administered prebiotics are non-inflammatory in basal conditions but are beneficial in experimental intestinal inflammatory conditions (Daddaoua et al., 2006). In a previous study, avian monocytes were activated by FOS and inulin possibly via TLR-4 ligation that resulted in enhanced cytokines secretion (Daddaoua et al., 2006). Another study reported an increased expression of TLR-4 mRNA in the ileum of chickens challenged with Clostridium perfringes and fed mannanoligosaccharides (Yitbarek et al., 2012). Such intestinal immune response may provide knowledge about the small intestine being a main site for pathogen control of gut-associated infections (Shang et al., 2015). In chickens, the TLR-4 is shown to be linked to resistance to Salmonella infection (Leveque et al., 2003). Thus, the impact of increased expression of TLR-4 in the ileum due to FOS feeding needs to be investigated further at the level of the innate cell. IL-6 serves as both pro- and anti-inflammatory cytokines and is also produced in monocytes and macrophages (Waititu et al., 2014). Increased chemokines and cytokine gene expression (IL-1ß, IL-6, IL-8, IL-18, and CCLi2) in heterophils, monocyte-derived macrophages, ceca and cecal tonsil are believed to be associated with Salmonella resistance (Ferro et al., 2004; Setta et al., 2012). Higher expression of IL-6 may be associated with strong pro-inflammatory immune response. The current study did not show any difference in the IL-6 expression between the treatments. This result agrees with other studies where no effects of FOS or prebiotics in IL-6 expression in the cecal tonsil, ileum, and spleen of broilers were not observed (Janardhana et al., 2009; Yitbarek et al., 2015). Similarly, no significant difference was observed in expression of IL-6 in the mannanoligosaccharides-treated group and Clostridium perfringens challenged chickens (Yitbarek et al., 2012). Interferon-γ is a pro-inflammatory cytokine that is responsible for increasing the expression of major histocompatibility complex antigens and provides host defense against intracellular pathogens such as Salmonella (Benbernou and Nauciel, 1994). Similarly, supplementing FOS also upregulated ileal gene expression of IL-1ß, -2, -10, -18, TLR-4, IFN-γ and splenic IL-18, IL-1ß (Shang et al., 2015). Similarly, a study that used dietary yeast cells found higher expression of IFN-γ in broilers (Shanmugasundaram et al., 2015). Interleukin-10 is a major anti-inflammatory cytokine, which can directly regulate both innate and adaptive T cell responses as well as suppresses inflammatory responses in tissues (Couper et al., 2008). The current study did not show any difference in IL-10 expression between treatments, and our findings are similar to a previous study where FOS did not show any effects on IL-10 expression in the cecal tonsil (Janardhana et al., 2009). However, our results contrast with another study that found upregulation of IL-10 in cecal tonsil by supplementing a blend of yeast-derived carbohydrates and probiotics (Yitbarek et al., 2015). Similar to the comment above regarding IL-1β, the gene expression results were restricted to ileal tissue, it is possible had the analysis been expanded to evaluate specific avian lymphoid tissue in the gut-associated lymphoid tissue and possibly the spleen, the results may have been different. Future FOS dietary-SE challenge studies will need to be performed to investigate this issue. Ileal Morphology and IgA Expression Analysis of the structure of the intestinal mucosa can provide useful information regarding the health of the digestive tract (Bogusławska-Tryk, 2012). Stress factors in the digesta can lead to shortening of villi and deepening of crypts (Bogusławska-Tryk, 2012). Increasing the VH suggests an increased surface area capable of greater absorption of available nutrients (Caspary, 1992). The increase in CD or crypt to VH ratio indicates the greater need of cell proliferation to maintain the gut barrier function (Awad et al., 2009). A possible explanation as to why the ileal morphology was unaffected in the hens used in this study might be due to the age and maturity of laying hens. Given that these birds were initially between 60 and 65 wk old, their gut integrity, microbiome, and immune capacity were well established. Similarly, Xu et al. (2003) accessed the effects of 3 levels of dietary FOS in a broiler basal diet at 2.0, 4.0, and 8.0 g/kg mixture and found no dietary effect detected for villi and microvilli or CD in the duodenum of unchallenged chicks. IgA is the major isotype of immunoglobulin secreted on the mucosal surface and protects the intestinal mucosal surfaces from invasion and colonization from pathogens by inhibiting attachment to the gut epithelium (Macpherson et al., 2008). The intestinal immune system, in general, is considered to have the largest accumulation of antibodies in the body (Burkey et al., 2009). The IgA is predominant in intestinal secretions and is synthesized by plasma cells in the lamina propria (Bos et al., 2001). The intestinal immune response plays an important defensive role for pathogens, particularly for those transmitted by fecal shedding (Bianco et al., 2014). There was an increase in IgA+ cells in all Salmonella-infected groups, and this was similar to a previous study that reported increased IgA-positive cells after Salmonella infection (Bobikova et al., 2015). CONCLUSION FOS reduced fecal shedding and ceca SENAR numbers in mature hens by 6 dpi. Further, FOS supplementation in the wake of SENAR challenge appears to alter select immune parameters in laying hens including increased gene expression of TLR-4 and IFN γ, as well as an increase in IgA+ cells in the ileal lamina propria. However, there was no effect observed for either VH or CD. The study shows that FOS can be used as one of the dietary interventions to reduce Salmonella infection in chickens thus helping the poultry industry. ACKNOWLEDGMENTS The authors are grateful to Jeromey Jackson and Lisa Stabler for the excellent technical assistance, and Roshan Adhikari and Chongxiao Chen for helping with animal sampling. Authors also thank Richard Gast for providing the Salmonella Enteritidis used in our study. REFERENCES Aderem A., Ulevitch R. J.. 2000. Toll-like receptors in the induction of the innate immune response. Nature . 406: 782– 787. Google Scholar CrossRef Search ADS PubMed  Awad W. A., Ghareeb K., Abdel-Raheem S., Bohm J.. 2009. Effects of dietary inclusion of probiotic and synbiotic on growth performance, organ weights, and intestinal histomorphology of broiler chickens. Poult. Sci . 88: 49– 56. Google Scholar CrossRef Search ADS PubMed  Babu U. S., Sommers K., Harrison L. M., Balan K. V.. 2012. Effects of fructooligosaccharide-inulin on Salmonella-killing and inflammatory gene expression in chicken macrophages. Vet. Immunol. Immunopathol . 149: 92– 96. Google Scholar CrossRef Search ADS PubMed  Bailey J. S., Blankenship L. C., Cox N. A.. 1991. Effect of fructooligosaccharide on Salmonella colonization of the chicken intestine. Poult. Sci . 70: 2433– 2438. Google Scholar CrossRef Search ADS PubMed  Benbernou N., Nauciel C.. 1994. Influence of mouse genotype and bacterial virulence in the generation of interferon-gamma-producing cells during the early phase of Salmonella typhimurium infection. Immunol . 83: 245– 249. Bianco C., Felice V., Panarese S., Marrocco R., Ostanello F., Brunetti B., Muscatello L. V., Leotti G., Vila T., Joisel F., Sarli G.. 2014. Quantitative immunohistochemical assessment of IgA, IgM, IgG and antigen-specific immunoglobulin secreting plasma cells in pig small intestinal lamina propria. Vet. Immunol. Immunopathol.  160: 281– 287. Google Scholar CrossRef Search ADS PubMed  Blanchfield B., Stavric S., Gleeson T., Pivnick H.. 1984. Minimum intestinal inoculum for Nurmi cultures and a new method for determining competitive exclusion of Salmonella from chicks. J. Food Prot . 47: 542– 545. Google Scholar CrossRef Search ADS   Bobikova K., Revajova V., Karaffova V., Levkutova M., Levkut M.. 2015. IgA gene expression and quantification of cecal IgA+, IgM+, and CD4+ cells in chickens treated with EFAL41 and infected with Salmonella Enteritidis. Acta Histochem . 117: 629– 634. Google Scholar CrossRef Search ADS PubMed  Bogusławska-Tryk M., Piotrowska A., Burlikowska K. 2012. Dietary fructans and their potential beneficial influence on health and performance parametrs in broiler chickens. J. Cent. Euro. Agri . 13: 272– 291. Bos N., Jiang H., Cebra J.. 2001. T cell control of the gut IgA response against commensal bacteria. Gut.  48: 762– 764. Google Scholar CrossRef Search ADS PubMed  Burkey T. E., Skjolaas K. A., Minton J. E.. 2009. BOARD-INVITED REVIEW: Porcine mucosal immunity of the gastrointestinal tract. J. Anim. Sci . 87: 1493– 1501. Google Scholar CrossRef Search ADS PubMed  Caspary W. F. 1992. Physiology and pathophysiology of intestinal absorption. Am. J. Clin. Nutr . 55: 299S– 308S. Google Scholar CrossRef Search ADS PubMed  CDC. 2014. Incidence and trends of infection with pathogens transmitted commonly through food — foodborne diseases active surveillance network, 10 U.S. sites, 2006–2013. Morb. Mortal. Wkly. Rep . 63: 328– 332. Chappell L., Kaiser P., Barrow P., Jones M. A., Johnston C., Wigley P.. 2009. The immunobiology of avian systemic salmonellosis. Vet. Immunol. Immunopathol . 128: 53– 59. Google Scholar CrossRef Search ADS PubMed  Cheng G., Hao H., Xie S., Wang X., Dai M., Huang L., Yuan Z.. 2014. Antibiotic alternatives: the substitution of antibiotics in animal husbandry? Front. Microbiol . 5: 217. Google Scholar CrossRef Search ADS PubMed  Corwin E. J. 2000. Understanding cytokines Part I: physiology and mechanism of action. Biol. Res. Nurs . 2: 30– 40. Google Scholar CrossRef Search ADS PubMed  Couper K. N., Blount D. G., Riley E. M.. 2008. IL-10: The master regulator of immunity to infection. J. Immunol . 180: 5771– 5777. Google Scholar CrossRef Search ADS PubMed  Daddaoua A., Puerta V., Requena P., Martinez-Ferez A., Guadix E., de Medina F. S., Zarzuelo A., Suarez M. D., Boza J. J., Martinez-Augustin O. 2006. Goat milk oligosaccharides are anti-inflammatory in rats with hapten-induced colitis. J. Nutr.  136: 672– 676. Google Scholar CrossRef Search ADS PubMed  Donalson L. M., McReynolds J. L., Kim W. K., Chalova V. I., Woodward C. L., Kubena L. F., Nisbet D. J., Ricke S. C.. 2008. The influence of a fructooligosaccharide prebiotic combined with alfalfa molt diets on the gastrointestinal tract fermentation, Salmonella enteritidis infection, and intestinal shedding in laying hens. Poult. Sci . 87: 1253– 1262. Google Scholar CrossRef Search ADS PubMed  Dunkley K. D., McReynolds J. L., Hume M. E., Dunkley C. S., Callaway T. R., Kubena L. F., Nisbet D. J., Ricke S. C.. 2007. Molting in Salmonella enteritidis-challenged laying hens fed alfalfa crumbles. I. Salmonella enteritidis colonization and virulence gene hilA response. Poult. Sci . 86: 1633– 1639. Google Scholar CrossRef Search ADS PubMed  Ferro P. J., Swaggerty C. L., Kaiser P., Pevzner I. Y., Kogut M. H.. 2004. Heterophils isolated from chickens resistant to extra-intestinal Salmonella Enteritidis infection express higher levels of pro-inflammatory cytokine mRNA following infection than heterophils from susceptible chickens. Epidemiol. Infect . 132: 1029– 1037. Google Scholar CrossRef Search ADS PubMed  Fukata T., Sasai K., Miyamoto T., Baba E.. 1999. Inhibitory effects of competitive exclusion and fructooligosaccharide, singly and in combination, on Salmonella colonization of chicks. J. Food Prot . 62: 229– 233. Google Scholar CrossRef Search ADS PubMed  He G. Z., Tian W. Y., Qian N., Cheng A. C., Deng S. X.. 2010. Quantitative studies of the distribution pattern for Salmonella Enteritidis in the internal organs of chicken after oral challenge by a real-time PCR. Vet. Res. Commun . 34: 669– 676. Google Scholar CrossRef Search ADS PubMed  Janardhana V., Broadway M. M., Bruce M. P., Lowenthal J. W., Geier M. S., Hughes R. J., Bean A. G. D.. 2009. Prebiotics modulate immune responses in the gut-associated lymphoid tissue of chickens. J. Nutr . 139: 1404– 1409. Google Scholar CrossRef Search ADS PubMed  Leveque G., Forgetta V., Morroll S., Smith A. L., Bumstead N., Barrow P., Loredo-Osti J. C., Morgan K., Malo D.. 2003. Allelic variation in TLR4 is linked to susceptibility to Salmonella enterica serovar Typhimurium infection in chickens. Infect. Immun . 71: 1116– 1124. Google Scholar CrossRef Search ADS PubMed  Livak K. J., Schmittgen T. D.. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods.  25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Macpherson A. J., McCoy K. D., Johansen F. E., Brandtzaeg P.. 2008. The immune geography of IgA induction and function. Mucosal. Immunol . 1: 11– 22. Google Scholar CrossRef Search ADS PubMed  Mughini-Gras L., Enserink R., Friesema I., Heck M., Duynhoven Y. V., Pelt W. V.. 2014. Risk factors for human Salmonellosis originating from pigs, cattle, broiler chickens and egg laying hens : a combined case-control and source attribution analysis. Plos One . 9: e87933. Google Scholar CrossRef Search ADS PubMed  Murate L. S., Paião F. G., Almeida A. M. d., Berchieri A. Jr, Shimokomaki M.. 2015. Efficacy of prebiotics, probiotics, and synbiotics on laying hens and broilers challenged with Salmonella Enteritidis. Jpn. Poult. Sci . 52: 52– 56. Google Scholar CrossRef Search ADS   NRC. 1994. Nutrient Requirements of Poultry . 9th rev. ed. Natl. Acad. Press, Washington, DC. SAS. 2009. Statistical Analysis Systems Users Guide.  9th ed. SAS Institute Inc., Cary, NC. Seo K. H., Holt P. S., Gast R. K.. 2001. Comparison of Salmonella Enteritidis infection in hens molted via long-term feed withdrawal versus full-fed wheat middling. J. Food Prot . 64: 1917– 1921. Google Scholar CrossRef Search ADS PubMed  Setta A. M., Barrow P. A., Kaiser P., Jones M. A.. 2012. Early immune dynamics following infection with Salmonella enterica serovars Enteritidis, Infantis, Pullorum and Gallinarum: cytokine and chemokine gene expression profile and cellular changes of chicken cecal tonsils. Comp. Immunol. Microbiol. Infect. Dis.  35: 397– 410. Google Scholar CrossRef Search ADS PubMed  Shang Y., Regassa A., Kim J. H., Kim W. K.. 2015. The effect of dietary fructooligosaccharide supplementation on growth performance, intestinal morphology, and immune responses in broiler chickens challenged with Salmonella Enteritidis lipopolysaccharides. Poult. Sci . 94: 2887– 2897. Google Scholar CrossRef Search ADS PubMed  Shanmugasundaram R., Kogut M. H., Arsenault R. J., Swaggerty C. L., Cole K., Reddish J. M., Selvaraj R. K.. 2015. Effect of Salmonella infection on cecal tonsil regulatory T cell properties in chickens. Poult. Sci . 94: 1828– 1835. Google Scholar CrossRef Search ADS PubMed  Van Immerseel F., De Zutter L., Houf K., Pasmans F., Haesebrouck F., Ducatelle R.. 2009. Strategies to control Salmonella in the broiler production chain. World's Poult. Sci. J.  65: 367– 392. Google Scholar CrossRef Search ADS   Waititu S. M., Yitbarek A., Matini E., Echeverry H., Kiarie E., Rodriguez-Lecompte J. C., Nyachoti C. M.. 2014. Effect of supplementing direct-fed microbials on broiler performance, nutrient digestibilities, and immune responses1. Poult. Sci . 93: 625– 635. Google Scholar CrossRef Search ADS PubMed  Xu Z. R., Hu C. H., Xia M. S., X. A., Zhan, Wang M. Q.. 2003. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci . 82: 1030– 1036. Google Scholar CrossRef Search ADS PubMed  Yasuda M., Tanaka S., Arakawa H., Taura Y., Yokomizo Y., Ekino S.. 2002. A comparative study of gut-associated lymphoid tissue in calf and chicken. Anat. Rec . 266: 207– 217. Google Scholar CrossRef Search ADS PubMed  Yitbarek A., Echeverry H., Brady J., Hernandez-Doria J., Camelo-Jaimes G., Sharif S., Guenter W., House J. D., Rodriguez-Lecompte J. C.. 2012. Innate immune response to yeast-derived carbohydrates in broiler chickens fed organic diets and challenged with Clostridium perfringens. Poult. Sci.  91: 1105– 1112. Google Scholar CrossRef Search ADS PubMed  Yitbarek A., Echeverry H., Munyaka P., Rodriguez-Lecompte J. C.. 2015. Innate immune response of pullets fed diets supplemented with prebiotics and synbiotics. Poult. Sci.  94: 1802– 1811. Google Scholar CrossRef Search ADS PubMed  © 2018 Poultry Science Association Inc. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Effect of dietary fructooligosaccharide supplementation on internal organs Salmonella colonization, immune response, ileal morphology, and ileal immunohistochemistry in laying hens challenged with Salmonella Enteritidis

Loading next page...
 
/lp/ou_press/effect-of-dietary-fructooligosaccharide-supplementation-on-internal-uXbtw6RmeQ
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pey101
Publisher site
See Article on Publisher Site

Abstract

ABSTRACT A study was conducted to evaluate the efficacy of fructooligosaccharides (FOS) in controlling the infection of Salmonella Enteritidis (SE) in White Leghorns. A total of 30 laying hens (white leghorns W-36) were challenged both orally and cloacally with approximately 108 colony-forming units of nalidxic acid resistant SE (SENAR) and divided into 3 treatments: 1) SENAR challenged + 0.0% FOS, 2) SENAR challenged + 0.5% FOS (Nutraflora), and 3) SENAR challenged + 1.0% FOS. SENAR recovery via fecal shedding was measured at 3- and 6-d post-infection (dpi), whereas in the ceca and internal organs, SENAR recovery was measured at 7-d post-infection. In the first experiment, there was a 1.0 log10 and a 1.3 log10 reduction in cecal SENAR by supplementation of FOS at 0.5 and 1.0%, respectively. In the second experiment, there was a 0.6 log10 and a 0.8 log10 reduction in cecal SENAR by supplementation of FOS at 0.5 and 1.0%, respectively. Fecal shedding was significantly lower in 1.0% FOS supplemented groups compared to SENAR challenge 0.0% FOS. There was no significant difference among the 3 treatments on SENAR recovery in liver with gall bladder and ovaries. However, the frequency of positive SENAR in the ovaries (10 to 40%) in SENAR challenge 0.0% FOS was significantly lower than liver with gall bladder (60 to 80%) in both experiments. There was a significant upregulation of toll-like receptor-4 in 1.0% FOS and interferon gamma in both 0.5 and 1.0% FOS. Histologic measurements of ileal villi height and crypt depth were similar across all treatments. Immunohistochemistry analyses of ileal samples showed that immunoglobulin A positive cells increased as FOS concentration increased reaching significance at 1.0% as well as altered cytokine gene expression in the ileum. Further, FOS supplementation also reduced cecal SENAR and feces SENAR levels. Collectively, the results suggest that dietary supplementation with FOS may impair SE pathogenesis while modulating humoral immunity within the gut-associated lymphoid tissue. INTRODUCTION Foodborne diseases continue to be important health and economic issues in the United States with higher incidence observed for Salmonella (CDC, 2014). Salmonella enterica serovar Enteritidis (SE) is a facultative intracellular foodborne pathogen that causes illness in chickens and humans (Babu et al., 2012). The major sources of human Salmonella infections are the contaminated meat and eggs from Salmonella carrier chickens (Mughini-Gras et al., 2014). The misuse of antibiotics leading to the resistance in bacteria, such as Salmonella, has created demands for novel antimicrobial or inhibitory replacements (Cheng et al., 2014). Dietary interventions involving plant by-products including wheat-middling and alfalfa with fructoligosaccharides (FOS) to reduce the Salmonella colonization in molting hens have been evaluated in the past (Seo et al., 2001; Dunkley et al., 2007). Salmonella Enteritidis challenge with prebiotics, probiotics, and symbiotic supplementation in Salmonella-free 1-day-old broilers as well as laying hen pullets have been already reported (Murate et al., 2015). Other studies in broilers reported that dietary FOS administration yielded better gain and feed conversion (Bailey et al., 1991; Xu et al., 2003). Further, dietary FOS supplementation has the potential to elevate the anti-Salmonella activity, which is mainly due to the shift of intestinal microbiota and the production of short-chain fatty acids (Van Immerseel et al., 2009). Dietary supplementation with FOS revealed a 4-fold reduction of Salmonella in chicken ceca (Bailey et al., 1991) and had indirect benefits toward the immune system of chickens by promoting the growth of lactic acid-producing bacteria (Xu et al., 2003). Currently, no study has evaluated the bacteriological as well as immunological consequences of FOS supplementation in mature laying hens challenged with SE. We hypothesize that FOS supplementation reduces SE in the ceca and internal organs as well as stimulates select immunological parameters. To test this hypothesis, this study investigated the role of FOS supplementation on anti-Salmonella activity in feces, ceca, liver with gall bladder (L/GB) and ovary as well as intestinal morphology and select gut-associated lymphoid tissue immune parameters in White Leghorn hens. MATERIALS AND METHODS Salmonella, Diluent, and Inoculum Preparation Salmonella Enteritidis resistant to nalidixic acid (SENAR) bacteria were used in this study at the USDA-Agricultural Research Service facility (Athens, GA). Tryptic soy broth (Acumedia, Neogen Corp., Lansing, MI) with 15% glycerol (Sigma-Aldrich, St Louis, MO) was employed for long-term preservation of SENAR. SENAR were grown on brilliant green agar with sulphapyridine (BGS; Acumedia, East Lansing, MI) containing 200 ppm of Nal (BGS-Nal; Sigma-Aldrich, St. Louis, MO) and incubated for 24 h at 37°C. Isolated SENAR colonies were transferred to 9 ml of 0.85% sterile saline solution. The absorbance value was adjusted to an optical density of 0.20 ± 0.01 at 540 nm with a spectrophotometer (Spect-20, Milton-Roy, Thermo Spectronics, Madison, WI), which yields approximately 108 cfu/ml. Cultures were serially diluted in sterile saline for enumeration. Hens were individually gavaged orally with a 1 mL tuberculin syringe (Becton, Dickinson and Co., Franklin Lakes, NJ) and an animal feeding needle (Popper & Sons, Inc., New Hyde Park, NY), whereas intracloacal inoculation was performed using only a 1 mL tuberculin syringe. Hens were challenged with the inoculum doses of 2.4 × 108 and 1.7 × 108 cfu/ml of SENAR for experiments 1 and 2, respectively. Hens, Husbandry, and Dietary Treatments Two experiments were conducted with 30 (per experiment) Single Combs White Leghorn hens (n = 30 birds per experiment 60 and 65 wk old at the beginning of the first and second experiments, respectively). Hens were housed individually in wire-laying cages and fed a corn-soy layer mash diet (Table 1). The diet was formulated to provide 2600 kg/kcal ME, 16% CP, 4.4% Ca, and 0.5% available P (NRC, 1994). All hens were allowed to acclimate to the basal diet for 1 wk after which they were randomly allocated to the respective treatment diets. After 1-week adaptation to the treatment diets, hens were individually challenged with SENAR (0-d post-infection, dpi). On 7 dpi, hens were individually euthanized and samples were collected. Total experimental days were 21. Hens were housed under a controlled environment (27 ± 2°C) and a 16 h light:8 h dark regimen. Feed was withdrawn for 10 h before SENAR challenge, and feeders were replaced immediately post-challenge. Hens were grouped to give 10 replicates per treatment. The treatments were as follows: 1) SENAR challenged control, 2) SENAR challenged + 0.5% FOS (Nutraflora) (GTC Nutrition, Bridgewater, NJ), and 3) SENAR challenged + 1.0% FOS. All experiment protocols were approved by the Institutional Animal Care and Use Committee of University of Georgia (AUP number = A2014 07-016). Table 1. Diet formulation and calculated composition of diet1 (experiment 1 and 2).     % FOS in diet    Item  0.0  0.5  1.0  Ingredient (% of the diet)  Corn, grain  59.53  59.53  59.53  Soybean meal –48%  23.13  23.13  23.13  Limestone  9.62  9.62  9.62  Soybean oil  3.00  3.00  3.00  Defluorinated phosphorus  2.13  2.13  2.13  Vitamin premix2  0.50  0.50  0.50  DL-methionine  0.34  0.34  0.34  Common salt  0.30  0.30  0.30  L-Lysine HCl  0.30  0.30  0.30  Mineral premix3  0.15  0.15  0.15  FOS4  0.00  0.50  1.00  Sand  1.00  0.50  0.00  Calculated composition  ME (kcal/kg)  2.85  2.85  2.85  CP (%)  16  16  16  Ca (%)  4.4  4.4  4.4  Available P (%)  0.5  0.5  0.5      % FOS in diet    Item  0.0  0.5  1.0  Ingredient (% of the diet)  Corn, grain  59.53  59.53  59.53  Soybean meal –48%  23.13  23.13  23.13  Limestone  9.62  9.62  9.62  Soybean oil  3.00  3.00  3.00  Defluorinated phosphorus  2.13  2.13  2.13  Vitamin premix2  0.50  0.50  0.50  DL-methionine  0.34  0.34  0.34  Common salt  0.30  0.30  0.30  L-Lysine HCl  0.30  0.30  0.30  Mineral premix3  0.15  0.15  0.15  FOS4  0.00  0.50  1.00  Sand  1.00  0.50  0.00  Calculated composition  ME (kcal/kg)  2.85  2.85  2.85  CP (%)  16  16  16  Ca (%)  4.4  4.4  4.4  Available P (%)  0.5  0.5  0.5  1Diets are in as-fed basis. 2Supplemeted per kg of diet: thiamin mononitrate, 2.4 mg; nicotinic acid, 44 mg; riboflavin, 4.4 mg; D-Ca pantothenate, 12 mg; vitamin B12 (cobalamin), 12.0 g; pyridoxine HCl, 4.7 mg; D-biotin, 0.11 mg; folic acid, 5.5 mg; menadione sodium bisulfite complex, 3.34 mg; choline chloride, 220 mg; cholecalciferol, 27.5 g; transretinyl acetate, 1892 g; α tocopheryl acetate, 11 mg; ethoxyquin, 125 mg. 3Supplemented as per kg of diet: manganese (MnSO4.H2O), 60 mg; iron (FeSO4.7H2O), 30 mg; zinc (ZnO), 50 mg; copper (CuSO4.5H2O), 5 mg; iodine (ethylene diamine dihydroiodide), 0.15 mg; selenium (NaSe03), 0.3 mg. 4Fructoligosachharides: NutraFlora (GTC Nutrition, Bridgewater, NJ). View Large Table 1. Diet formulation and calculated composition of diet1 (experiment 1 and 2).     % FOS in diet    Item  0.0  0.5  1.0  Ingredient (% of the diet)  Corn, grain  59.53  59.53  59.53  Soybean meal –48%  23.13  23.13  23.13  Limestone  9.62  9.62  9.62  Soybean oil  3.00  3.00  3.00  Defluorinated phosphorus  2.13  2.13  2.13  Vitamin premix2  0.50  0.50  0.50  DL-methionine  0.34  0.34  0.34  Common salt  0.30  0.30  0.30  L-Lysine HCl  0.30  0.30  0.30  Mineral premix3  0.15  0.15  0.15  FOS4  0.00  0.50  1.00  Sand  1.00  0.50  0.00  Calculated composition  ME (kcal/kg)  2.85  2.85  2.85  CP (%)  16  16  16  Ca (%)  4.4  4.4  4.4  Available P (%)  0.5  0.5  0.5      % FOS in diet    Item  0.0  0.5  1.0  Ingredient (% of the diet)  Corn, grain  59.53  59.53  59.53  Soybean meal –48%  23.13  23.13  23.13  Limestone  9.62  9.62  9.62  Soybean oil  3.00  3.00  3.00  Defluorinated phosphorus  2.13  2.13  2.13  Vitamin premix2  0.50  0.50  0.50  DL-methionine  0.34  0.34  0.34  Common salt  0.30  0.30  0.30  L-Lysine HCl  0.30  0.30  0.30  Mineral premix3  0.15  0.15  0.15  FOS4  0.00  0.50  1.00  Sand  1.00  0.50  0.00  Calculated composition  ME (kcal/kg)  2.85  2.85  2.85  CP (%)  16  16  16  Ca (%)  4.4  4.4  4.4  Available P (%)  0.5  0.5  0.5  1Diets are in as-fed basis. 2Supplemeted per kg of diet: thiamin mononitrate, 2.4 mg; nicotinic acid, 44 mg; riboflavin, 4.4 mg; D-Ca pantothenate, 12 mg; vitamin B12 (cobalamin), 12.0 g; pyridoxine HCl, 4.7 mg; D-biotin, 0.11 mg; folic acid, 5.5 mg; menadione sodium bisulfite complex, 3.34 mg; choline chloride, 220 mg; cholecalciferol, 27.5 g; transretinyl acetate, 1892 g; α tocopheryl acetate, 11 mg; ethoxyquin, 125 mg. 3Supplemented as per kg of diet: manganese (MnSO4.H2O), 60 mg; iron (FeSO4.7H2O), 30 mg; zinc (ZnO), 50 mg; copper (CuSO4.5H2O), 5 mg; iodine (ethylene diamine dihydroiodide), 0.15 mg; selenium (NaSe03), 0.3 mg. 4Fructoligosachharides: NutraFlora (GTC Nutrition, Bridgewater, NJ). View Large Sampling Protocol and Processing Fecal Shedding (Bacteriological) Hens were monitored for fecal shedding on 3 and 6 dpi. Aluminum foil sheets were placed in the bottom of the cages overnight, and feces were collected the next morning in to sterile 50 mL conical centrifuge tubes and transported in an ice chest for bacteriological analyses. Briefly, feces from each bird were weighed, then diluted with buffered peptone water (BPW) 3 times volume to the sample weight and vortexed. A 10 μl portion of each sample was streaked for isolation onto BGS-Nal plates. Plates and sample tubes were incubated for 24 h at 37°C. Plates that were negative by direct plating were confirmed by a repeated streak into BGS-Nal plates from the overnight pre-enriched samples. The plates were read as negative or positive based on the Salmonella colonies they produced. Ceca, L/GB, and Ovaries (Bacteriological) All hens were humanely euthanized by electrocution on 7 dpi. Samples including ceca, ovaries, and L/GB were collected aseptically for bacteriological analyses. All the samples were macerated by a sterile rubber mallet. Samples were individually weighed and diluted in BPW at 3× their weight. The sample bags were stomached (Techmar Company, Cincinnati, Ohio) for 60 s and pre-enriched for 24 h at 37°C. Pre-enriched samples for ovaries and L/GB were streaked for isolation onto BGS-Nal plates and incubated for 24 h at 37°C. The growth of SENAR was observed and recorded. Cecal samples were analyzed using the modified Blanchfield method (Blanchfield et al., 1984). In brief, after stomaching for 60 s, two cotton-tipped swabs were dipped and rotated in the cecal material for approximately 5 s. One BGS-Nal plate was surface-swabbed (plate A). The second swab was transferred into a sterile 9.9 mL BPW dilution tube. The tube was vortexed for approximately 10 s, and a third swab was used to surface swab a second BGS-Nal plate (plate B). The contents of each dilution tube were returned to the stomacher bag and incubated with the plates at 37°C overnight. All plates together with the cecal samples were incubated overnight at 37°C. Samples that were negative after the overnight pre-enrichments were re-streaked onto a fresh BGS-Nal plate (plate C) and incubated overnight at 37°C. Counts were approximated and converted to log10 cfu SENR/g of cecal contents. Ileum Immune Genes Expression RNA Isolation, cDNA Synthesis, and Quantitative Real-time Polymerase Chain Reaction Sections of the ileum were aseptically excised, immediately frozen in liquid nitrogen, and preserved at –80°C for analysis of immune genes by quantitative real-time polymerase chain reaction (qRT-PCR). Total RNA was extracted from about 100 mg of tissues using QiAzol lysis reagents (Qiazen, Valencia, CA) according to the manufacturer's instruction. The samples were homogenized in a homogenizer (Biospec Products, Fisher Scientific, MA) for 3 min. The RNAse-free water (Ambion, Applied BioSystems, Life Technologies, CA) was used to dissolve the final pellet. The total RNA concentrations were determined at an optical density of 260 nm using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, MA). All RNA samples were normalized to a concentration of 2 μg/μl, and the purity of RNA was verified by evaluating the optical density ratio of 260 to 280 nm. The normalized RNA was reverse-transcribed using High Capacity cDNA synthesis kits (Applied BioSystems, Life Technologies, CA). Individual transcripts were normalized to glyceraldehyde 3-phosphate dehydrogenase as a housekeeping gene. Primers for select chicken immune marker genes toll-like receptor (TLR-4), interleukins (IL-1ß, IL-6, and IL-10), and interferon (IFNY) were designed according to National Center for Biotechnology Information presented in Table 2. qRT-PCR was performed using a Step One thermo-cycler (Applied Biosystem, Foster City, CA). Table 2. Chicken cytokines and toll-like receptor primer sequences. Gene1  Primer sequence (5″-3″)  Gene bank accession no.  Fragment size, bp  Annealing temperature,°C  Glyceraldehyde 3-phosphate dehydrogenase  F: GCTAAGGCTGTGGGGAAAGT  K01458  116  56    R: TCAGCAGCAGCCTTCACTAC        TLR4  F: AGTCTGAAATTGCTGAGCTCAAAT  AY064697  190  56    R: GCGACGTTAAGCCATGGAAG        IL6  F: CAGGACGAGATGTGCAAGAA  AJ309540  233  59    R: TAGCACAGAGACTCGACGTT        IL10  F: AGCAGATCAAGGAGACGTTC  NM001004414  103  56    R: ATCAGCAGGTACTCCTCGAT        IL-1β  F: CACAGAGATGGCGTTCGTTC  NM204524  118  56    R: GCAGATTGTGAGCATTGGGC        IFN- γ  F: CTGAAGAACTGGACAGAGAG  NM205149  159  58    R: CACCAGCTTCTGTAAGATGC        Gene1  Primer sequence (5″-3″)  Gene bank accession no.  Fragment size, bp  Annealing temperature,°C  Glyceraldehyde 3-phosphate dehydrogenase  F: GCTAAGGCTGTGGGGAAAGT  K01458  116  56    R: TCAGCAGCAGCCTTCACTAC        TLR4  F: AGTCTGAAATTGCTGAGCTCAAAT  AY064697  190  56    R: GCGACGTTAAGCCATGGAAG        IL6  F: CAGGACGAGATGTGCAAGAA  AJ309540  233  59    R: TAGCACAGAGACTCGACGTT        IL10  F: AGCAGATCAAGGAGACGTTC  NM001004414  103  56    R: ATCAGCAGGTACTCCTCGAT        IL-1β  F: CACAGAGATGGCGTTCGTTC  NM204524  118  56    R: GCAGATTGTGAGCATTGGGC        IFN- γ  F: CTGAAGAACTGGACAGAGAG  NM205149  159  58    R: CACCAGCTTCTGTAAGATGC        1IL, interleukin; IFN, interferon; TLR, toll-like receptor. View Large Table 2. Chicken cytokines and toll-like receptor primer sequences. Gene1  Primer sequence (5″-3″)  Gene bank accession no.  Fragment size, bp  Annealing temperature,°C  Glyceraldehyde 3-phosphate dehydrogenase  F: GCTAAGGCTGTGGGGAAAGT  K01458  116  56    R: TCAGCAGCAGCCTTCACTAC        TLR4  F: AGTCTGAAATTGCTGAGCTCAAAT  AY064697  190  56    R: GCGACGTTAAGCCATGGAAG        IL6  F: CAGGACGAGATGTGCAAGAA  AJ309540  233  59    R: TAGCACAGAGACTCGACGTT        IL10  F: AGCAGATCAAGGAGACGTTC  NM001004414  103  56    R: ATCAGCAGGTACTCCTCGAT        IL-1β  F: CACAGAGATGGCGTTCGTTC  NM204524  118  56    R: GCAGATTGTGAGCATTGGGC        IFN- γ  F: CTGAAGAACTGGACAGAGAG  NM205149  159  58    R: CACCAGCTTCTGTAAGATGC        Gene1  Primer sequence (5″-3″)  Gene bank accession no.  Fragment size, bp  Annealing temperature,°C  Glyceraldehyde 3-phosphate dehydrogenase  F: GCTAAGGCTGTGGGGAAAGT  K01458  116  56    R: TCAGCAGCAGCCTTCACTAC        TLR4  F: AGTCTGAAATTGCTGAGCTCAAAT  AY064697  190  56    R: GCGACGTTAAGCCATGGAAG        IL6  F: CAGGACGAGATGTGCAAGAA  AJ309540  233  59    R: TAGCACAGAGACTCGACGTT        IL10  F: AGCAGATCAAGGAGACGTTC  NM001004414  103  56    R: ATCAGCAGGTACTCCTCGAT        IL-1β  F: CACAGAGATGGCGTTCGTTC  NM204524  118  56    R: GCAGATTGTGAGCATTGGGC        IFN- γ  F: CTGAAGAACTGGACAGAGAG  NM205149  159  58    R: CACCAGCTTCTGTAAGATGC        1IL, interleukin; IFN, interferon; TLR, toll-like receptor. View Large Ileum Histomorphology Approximately 2 cm sections of the ileum were selected and fixed in 10% phosphate-buffered formalin (Sigma-Aldrich, St. Louis, MO) for 24 h. Briefly, tissues were routinely processed, and samples were embedded in paraffin and cut into 4.0 μm sections and stained with standard hematoxylin-eosin solution. Additional unstained sections were mounted onto positively charged slides for further immunohistochemistry (IHC) analysis. Each slide was evaluated for villi height (VH) and crypt depth (CD) at 100× magnification using a light microscope coupled with a camera (Leica DC500 camera, Leica Microsystems Inc., Buffalo Groove, IL). A minimum of 3 readings per slide were made for both VH and CD and averaged into a single value for each sample. VH was measured as entire villus length from the tip to base. CD was measured from the villus-crypt axis to the base of the specific crypt. Villus height to CD ratio and total mucosal thickness were also calculated for each ileum. Image J software was used to analyze and measure the length of the captured images. Ileum IHC Immunoglobulin A (IgA)-positive cells in the ileum were identified and quantitated by an IHC technique. Paraffin-embedded ileal sections mounted on slides were deparaffinized in xylene and hydrated in descending grades of alcohol. Antigen retrieval was executed in citrate buffer at pH 6.0 for 45 min with the use of a steamer. Blocking of peroxidase activity was performed with Bloxall (Vector Laboratories, Burlingame, CA) following manufacturer's instructions and the samples were washed. After the washing steps, the slides were incubated with a Protein Block solution (Dako, Carpinteria, CA) for 10 min to block non-specific binding. Mouse monoclonal antichicken IgA (Southern Biotech, Birmingham, AL) was diluted at 1:500 concentrations and used as a primary antibody. The slides were incubated with the primary antibody at 23°C for 1 h. Slides incubated with phosphate-buffered saline served as negative controls. The slides were then washed. The slides were incubated with MACH 3 mouse probe and horse radish peroxide—polymer (Biocare Medical, Concord, CA) following manufacturer's recommendations. After washing steps, the slides were incubated with 3, 3' diaminobenzidine tetrahydrochlorine (Vector Laboratories, Burlingame, CA) for 10 min at 23°C and counterstained with hematoxylin. The slides were examined by a bright field microscope. An Olympus DP25 camera was used to take photographs of 3 100× fields of view per section. Counting of immunostained cells was performed with CellSens Standard software (Olympus, Center Valley, PA). Statistical Analysis SENAR recovery from feces and internal organs was analyzed with Fisher's exact test for any Salmonella prevalence. The relative quantification analysis of qRT-PCR data was performed using the ΔΔCt method (Livak and Schmittgen, 2001). The means of Log10 viable SENAR counts from the ceca, ileum immune gene expression, histomorpholgy, and IHC data were subjected to one-way analysis of variance using the GLM procedure of SAS (SAS, 2009). Significant differences between the means of different treatments were determined by Duncan's multiple-range test, and significant differences were assessed at P < 0.05. RESULTS Prevalence of SENAR in Fecal Samples At 3 dpi, all of the fecal samples analyzed were positive for SENAR (Table 3). By day 6 dpi, the percentage of positive fecal samples for SENAR in the 0.0% FOS group had declined to ∼85% (average of 2 experiments). However, in the 6 dpi FOS-supplemented birds, this percentage decreased reaching significance in the 1.0% FOS-treated group in both experiments compared to SENAR challenge 0.0% FOS group. Table 3. Presence of Salmonella Enteritidis (SE) in fecal shedding analyzed at 3 and 6-d post-infection (dpi) from laying hens fed rations with 0.0, 0.5, or 1.0% fructoligosaccharides (FOS) (experiment 1 and 2).     Treatments (% FOS)  Experiments  dpi  0.0  0.5  1.0  1  3  10/101 (100%)  10/10 (100%)  10/10 (100%)    6  9/10a (90%)  7/10a (70%)  6/10b (60%)  2  3  10/10 (100%)  10/10 (100%)  10/10 (100%)    6  8/10a (80%)  7/10a (70%)  6/10b (60%)      Treatments (% FOS)  Experiments  dpi  0.0  0.5  1.0  1  3  10/101 (100%)  10/10 (100%)  10/10 (100%)    6  9/10a (90%)  7/10a (70%)  6/10b (60%)  2  3  10/10 (100%)  10/10 (100%)  10/10 (100%)    6  8/10a (80%)  7/10a (70%)  6/10b (60%)  1Pos/Tot: number of SE-positive hens out of a total of 10 observations. a,bMeans within a row with no common superscripts differ significantly (P < 0.05). View Large Table 3. Presence of Salmonella Enteritidis (SE) in fecal shedding analyzed at 3 and 6-d post-infection (dpi) from laying hens fed rations with 0.0, 0.5, or 1.0% fructoligosaccharides (FOS) (experiment 1 and 2).     Treatments (% FOS)  Experiments  dpi  0.0  0.5  1.0  1  3  10/101 (100%)  10/10 (100%)  10/10 (100%)    6  9/10a (90%)  7/10a (70%)  6/10b (60%)  2  3  10/10 (100%)  10/10 (100%)  10/10 (100%)    6  8/10a (80%)  7/10a (70%)  6/10b (60%)      Treatments (% FOS)  Experiments  dpi  0.0  0.5  1.0  1  3  10/101 (100%)  10/10 (100%)  10/10 (100%)    6  9/10a (90%)  7/10a (70%)  6/10b (60%)  2  3  10/10 (100%)  10/10 (100%)  10/10 (100%)    6  8/10a (80%)  7/10a (70%)  6/10b (60%)  1Pos/Tot: number of SE-positive hens out of a total of 10 observations. a,bMeans within a row with no common superscripts differ significantly (P < 0.05). View Large Cecal Count of SENAR Supplementation of FOS at 1.0% significantly reduced (P < 0.05) the cecal SENAR compared to SE challenged control diet but 1.0% FOS was not different from 0.5% FOS in both experiments (Table 4). In experiment 1, the mean log10 value of SENAR colonization was 4.2 in the 0.0% FOS that was reduced to log 3.2 in 0.5% FOS and to log 2.8 in 1.0% FOS. In experiment 2, the mean log10 value of SENAR colonization was log 3.7, 3.3, and 2.9 in the 0.0, 0.5, and 1.0% FOS, respectively. In experiment 1, there was 1.0 log10 and 1.4 log10 reduction in cecal SENAR by supplementation of FOS at 0.5 and 1.0%, respectively. In experiment 2, there was 0.5 log10 and 0.8 log10 reduction in cecal SENAR by supplementation of FOS at 0.5 and 1.0%, respectively. Table 4. The viable number (log10) of Salmonella Enteritidis (SE) in the cecal contents analyzed at 7-d post-infection fed rations with 0.0, 0.5, or 1.0% fructoligosaccharides (FOS) (experiment 1 and 2).1     Treatments (% FOS)  Experiment  Count  0.0  0.5  1.0  1  Log10 cfu/g  4.2 ± 1.67a  3.2 ± 1.46a,b  2.8 ± 1.08b  2  Log10 cfu/g  3.7 ± 1.78a  3.3 ± 1.63a,b  2.9 ± 1.28b      Treatments (% FOS)  Experiment  Count  0.0  0.5  1.0  1  Log10 cfu/g  4.2 ± 1.67a  3.2 ± 1.46a,b  2.8 ± 1.08b  2  Log10 cfu/g  3.7 ± 1.78a  3.3 ± 1.63a,b  2.9 ± 1.28b  1The mean ± SEM count per gram from 10 hens/treatment. a,bMeans within a row with no common superscripts differ significantly (P < 0.05). Values in the parenthesis represent the range of viable log10 counts of SENAR. View Large Table 4. The viable number (log10) of Salmonella Enteritidis (SE) in the cecal contents analyzed at 7-d post-infection fed rations with 0.0, 0.5, or 1.0% fructoligosaccharides (FOS) (experiment 1 and 2).1     Treatments (% FOS)  Experiment  Count  0.0  0.5  1.0  1  Log10 cfu/g  4.2 ± 1.67a  3.2 ± 1.46a,b  2.8 ± 1.08b  2  Log10 cfu/g  3.7 ± 1.78a  3.3 ± 1.63a,b  2.9 ± 1.28b      Treatments (% FOS)  Experiment  Count  0.0  0.5  1.0  1  Log10 cfu/g  4.2 ± 1.67a  3.2 ± 1.46a,b  2.8 ± 1.08b  2  Log10 cfu/g  3.7 ± 1.78a  3.3 ± 1.63a,b  2.9 ± 1.28b  1The mean ± SEM count per gram from 10 hens/treatment. a,bMeans within a row with no common superscripts differ significantly (P < 0.05). Values in the parenthesis represent the range of viable log10 counts of SENAR. View Large Prevalence of SENAR in Ovary and L/GB Salmonella Enteritidis recovery in the ovary was significantly lower (P < 0.05) compared to the L/GB (Table 5). The ovary was 40% positive in SE challenged 0.0% FOS, whereas for 0.5 and 1.0% FOS, it was 20 and 30% positive, respectively (experiment 1). In experiment 2, ovary was 20% positive in the 0.0% FOS, whereas it was 20 and 10% positive for 0.5 and 1.0% FOS. In L/GB, FOS supplementation at any level did not significantly reduce SE recovery. Table 5. Effects of fructoligosaccharides (FOS) on Salmonella Enteritidis colonization on the liver gall bladder (L/GB) and ovaries on 7-d post-infection (experiment 1 and 2).     Treatments (% FOS)  Experiment  Organs  0.0  0.5  1.0  1  L/GB  8/10 (80%)a  8/10 (80%)a  8/10 (80%)a    Ovaries  4/10 (40%)b  2/10 (20%)b  3/10 (30%)b  2  L/GB  6/10 (60%)a  6/10 (60%)a  6/10 (60%)a    Ovaries  2/10 (20%)b  2/10 (20%)b  1/10 (10%)b      Treatments (% FOS)  Experiment  Organs  0.0  0.5  1.0  1  L/GB  8/10 (80%)a  8/10 (80%)a  8/10 (80%)a    Ovaries  4/10 (40%)b  2/10 (20%)b  3/10 (30%)b  2  L/GB  6/10 (60%)a  6/10 (60%)a  6/10 (60%)a    Ovaries  2/10 (20%)b  2/10 (20%)b  1/10 (10%)b  a,bMeans within a column with no common superscripts differ significantly (P < 0.05). View Large Table 5. Effects of fructoligosaccharides (FOS) on Salmonella Enteritidis colonization on the liver gall bladder (L/GB) and ovaries on 7-d post-infection (experiment 1 and 2).     Treatments (% FOS)  Experiment  Organs  0.0  0.5  1.0  1  L/GB  8/10 (80%)a  8/10 (80%)a  8/10 (80%)a    Ovaries  4/10 (40%)b  2/10 (20%)b  3/10 (30%)b  2  L/GB  6/10 (60%)a  6/10 (60%)a  6/10 (60%)a    Ovaries  2/10 (20%)b  2/10 (20%)b  1/10 (10%)b      Treatments (% FOS)  Experiment  Organs  0.0  0.5  1.0  1  L/GB  8/10 (80%)a  8/10 (80%)a  8/10 (80%)a    Ovaries  4/10 (40%)b  2/10 (20%)b  3/10 (30%)b  2  L/GB  6/10 (60%)a  6/10 (60%)a  6/10 (60%)a    Ovaries  2/10 (20%)b  2/10 (20%)b  1/10 (10%)b  a,bMeans within a column with no common superscripts differ significantly (P < 0.05). View Large Cytokine Gene Expression in the Ileum The FOS supplementation altered the expression of 2 of the ileal cytokine genes of the 5 examined (Figure 1). Supplementation of 1.0% FOS significantly upregulated the TLR-4 mRNA (P = 0.0005) expression compared to both the 0.0 and 0.5% FOS (Figure 1b). Supplementation of 0.5 and 1.0% FOS significantly upregulated the IFN- γ mRNA expression (P = 0.003) compared to the SE challenged 0.0% FOS group (Figure 1d). Figure 1. View largeDownload slide Ileal gene expressions of a) Interleukin (IL)-1ß, b) toll-like receptor (TLR)-4, c) IL-6, d) interferon (IFN)-γ, and e) IL-10, under Salmonella Enteritidis challenge condition (N = 10/treatment). Gene expressions were calculated relative to housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase. Error bars represent standard errors. Bars with ‘*’ symbol differ from the control. Figure 1. View largeDownload slide Ileal gene expressions of a) Interleukin (IL)-1ß, b) toll-like receptor (TLR)-4, c) IL-6, d) interferon (IFN)-γ, and e) IL-10, under Salmonella Enteritidis challenge condition (N = 10/treatment). Gene expressions were calculated relative to housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase. Error bars represent standard errors. Bars with ‘*’ symbol differ from the control. Intestinal Morphology and IgA Count in the Ileum In both experiments, VH, CD, and their ratio were not statistically different across treatments (Table 6). However, the number of IgA+-stained cells in the lamina propria of ileum was affected by FOS supplementation (Figure 2). IgA-positive cells were detected in intestinal mucosa in all 3 treatment groups (Figure 3). There was an increase in IgA+ cells in the ileum for the 1.0% FOS treatment that was significant to both the 0.0 and 0.5% FOS treatment groups. Figure 2. View largeDownload slide Representative immunohistochemical staining of immunoglobulin A+ (IgA+) cells in the ileum of White Leghorns. A) Negative control, B) IgA-positive cells (arrow) in Salmonella challenged 0.0% FOS, C) IgA-positive cells in 0.5% FOS, and D) IgA-positive cells in 1.0% FOS. The image was taken at magnification of 20×. Figure 2. View largeDownload slide Representative immunohistochemical staining of immunoglobulin A+ (IgA+) cells in the ileum of White Leghorns. A) Negative control, B) IgA-positive cells (arrow) in Salmonella challenged 0.0% FOS, C) IgA-positive cells in 0.5% FOS, and D) IgA-positive cells in 1.0% FOS. The image was taken at magnification of 20×. Figure 3. View largeDownload slide Immunoglobulin A (IgA)-positive cells in the lamina propria of ileum section of hens fed either 0.0% FOS with SE challenge, 0.5% FOS with SE challenge, and 1.0% FOS with SE challenge. The number of host cells showing positive staining on 3 randomly selected microscopic areas of each hen was counted. N = 3/treatment. Bars with ‘*’ symbol differ from the 0.0 to 0.5% FOS. Figure 3. View largeDownload slide Immunoglobulin A (IgA)-positive cells in the lamina propria of ileum section of hens fed either 0.0% FOS with SE challenge, 0.5% FOS with SE challenge, and 1.0% FOS with SE challenge. The number of host cells showing positive staining on 3 randomly selected microscopic areas of each hen was counted. N = 3/treatment. Bars with ‘*’ symbol differ from the 0.0 to 0.5% FOS. Table 6. Effect of fructooligosaccharide (FOS) on the ileal morphology of laying hens.1     Treatments (% FOS)2      Experiment   Site  0.0  0.5  1.0  SEM  P-value  1  VH (μm)  615.9  615.4  595.4  41.68  0.924    CD (μm)  101.1  75.6  95.6  9.88  0.181    VH:CD  6.6  8.5  6.9  0.89  0.297    Total mucosa thickness3 (μm)  1027.7  992.8  1085.6  56.48  0.512  2  VH (μm)  750.6  742.7  669.7  40.52  0.343    CD (μm)  75.5  90.5  88.9  84.90  0.318    VH:CD  8.8  8.2  7.2  0.69  0.143    Total mucosa thickness (μm)  1179.9  1148.5  1110.5  46.52  0.422      Treatments (% FOS)2      Experiment   Site  0.0  0.5  1.0  SEM  P-value  1  VH (μm)  615.9  615.4  595.4  41.68  0.924    CD (μm)  101.1  75.6  95.6  9.88  0.181    VH:CD  6.6  8.5  6.9  0.89  0.297    Total mucosa thickness3 (μm)  1027.7  992.8  1085.6  56.48  0.512  2  VH (μm)  750.6  742.7  669.7  40.52  0.343    CD (μm)  75.5  90.5  88.9  84.90  0.318    VH:CD  8.8  8.2  7.2  0.69  0.143    Total mucosa thickness (μm)  1179.9  1148.5  1110.5  46.52  0.422  1Means of the 3 measurements of each villus height, crypt depth, and total mucosa thickness of a hen, 10 hens per treatment. 20.0% FOS with SE challenge, 0.5% FOS with SE challenge, and 1.0% FOS with SE challenge. 3Total thickness of villus, crypt, and muscularis mucosa. N = 3/treatment. CD, crypt depth; VH, villi height View Large Table 6. Effect of fructooligosaccharide (FOS) on the ileal morphology of laying hens.1     Treatments (% FOS)2      Experiment   Site  0.0  0.5  1.0  SEM  P-value  1  VH (μm)  615.9  615.4  595.4  41.68  0.924    CD (μm)  101.1  75.6  95.6  9.88  0.181    VH:CD  6.6  8.5  6.9  0.89  0.297    Total mucosa thickness3 (μm)  1027.7  992.8  1085.6  56.48  0.512  2  VH (μm)  750.6  742.7  669.7  40.52  0.343    CD (μm)  75.5  90.5  88.9  84.90  0.318    VH:CD  8.8  8.2  7.2  0.69  0.143    Total mucosa thickness (μm)  1179.9  1148.5  1110.5  46.52  0.422      Treatments (% FOS)2      Experiment   Site  0.0  0.5  1.0  SEM  P-value  1  VH (μm)  615.9  615.4  595.4  41.68  0.924    CD (μm)  101.1  75.6  95.6  9.88  0.181    VH:CD  6.6  8.5  6.9  0.89  0.297    Total mucosa thickness3 (μm)  1027.7  992.8  1085.6  56.48  0.512  2  VH (μm)  750.6  742.7  669.7  40.52  0.343    CD (μm)  75.5  90.5  88.9  84.90  0.318    VH:CD  8.8  8.2  7.2  0.69  0.143    Total mucosa thickness (μm)  1179.9  1148.5  1110.5  46.52  0.422  1Means of the 3 measurements of each villus height, crypt depth, and total mucosa thickness of a hen, 10 hens per treatment. 20.0% FOS with SE challenge, 0.5% FOS with SE challenge, and 1.0% FOS with SE challenge. 3Total thickness of villus, crypt, and muscularis mucosa. N = 3/treatment. CD, crypt depth; VH, villi height View Large DISCUSSION Salmonella in Feces, Ceca, L/GB, and Ovary The FOS used in our study has shown to be effective in reducing SENAR fecal shedding at 6 dpi. Because there is a high chance of egg contamination after the egg-laying process, knowledge of SE fecal shedding pattern could help to evaluate future intervention approaches to reduce Salmonella contamination in eggs. A previous study reported that supplementation of 0.75% FOS reduced Salmonella prevalence to 12% and resulted in 0.75 log10 cfu reduction in Salmonella numbers when compared with SE challenged control birds (Bailey et al., 1991). Studies have shown that FOS alone or in combination with competitive exclusion cultures decreased organ colonization and recovery of SE from cecal contents of White Leghorn as well as broiler chicks (Bailey et al., 1991; Fukata et al., 1999). Invasion beyond intestine to internal organs like liver and spleen occurs within few hours of exposure to Salmonella infection (He et al., 2010). Hens-fed diets containing both alfalfa and FOS had significantly reduced fecal shedding as well as organs (liver and ovary) colonization of SE (Donalson et al., 2008). However, the above study was conducted with the complete feed withdrawal for 7 d unlike the present study, which removed feed for ∼12 to 14 h. Feed withdrawal in laying hens is one of the major stressors, and thus the incidence of SE is higher in such withdrawal periods. In our study, FOS was supplemented in feed and not in water because it was previously reported that in-feed supplementation of FOS was more effective in reducing Salmonella numbers than via drinking water (Bailey et al., 1991). Immune Gene Expression by Salmonella and FOS Salmonella infection has been shown to upregulate inflammatory cytokines gene expression such as IL-1ß, IL-18, and IFN- γ (Yasuda et al., 2002; Chappell et al., 2009; Babu et al., 2012). Interleukin-1ß is a pro-inflammatory cytokine mainly secreted from monocytes and macrophages (Corwin, 2000). In our study, there was no difference between treatments in the expression of IL-1ß gene at the level of the ileum. A study reported that IL-1ß was neither upregulated nor downregulated when chicks were challenged with Salmonella and supplemented with FOS (Janardhana et al., 2009). However, in another study, pro-inflammatory cytokines including IL-1ß were reduced by supplementing FOS-inulin diet in SE-infected cells (Babu et al., 2012). Still, it is worth noting that in the present study, cytokine gene expression was only evaluated in the ileal tissue. It is possible that this expression may have been different had avian lymphoid tissue been evaluated. TLR can recognize the conserved pathogen-associated molecular patterns of the lipopolysaccharides (LPS) of gram-negative bacteria, and are involved in a chain reaction that stimulates the innate immune response (Aderem and Ulevitch 2000). The increase in TLR-4 expression which became significant with a 1.0% FOS diet suggests that dietary FOS may enhance innate cell activation in the wake of SE infection. Orally administered prebiotics are non-inflammatory in basal conditions but are beneficial in experimental intestinal inflammatory conditions (Daddaoua et al., 2006). In a previous study, avian monocytes were activated by FOS and inulin possibly via TLR-4 ligation that resulted in enhanced cytokines secretion (Daddaoua et al., 2006). Another study reported an increased expression of TLR-4 mRNA in the ileum of chickens challenged with Clostridium perfringes and fed mannanoligosaccharides (Yitbarek et al., 2012). Such intestinal immune response may provide knowledge about the small intestine being a main site for pathogen control of gut-associated infections (Shang et al., 2015). In chickens, the TLR-4 is shown to be linked to resistance to Salmonella infection (Leveque et al., 2003). Thus, the impact of increased expression of TLR-4 in the ileum due to FOS feeding needs to be investigated further at the level of the innate cell. IL-6 serves as both pro- and anti-inflammatory cytokines and is also produced in monocytes and macrophages (Waititu et al., 2014). Increased chemokines and cytokine gene expression (IL-1ß, IL-6, IL-8, IL-18, and CCLi2) in heterophils, monocyte-derived macrophages, ceca and cecal tonsil are believed to be associated with Salmonella resistance (Ferro et al., 2004; Setta et al., 2012). Higher expression of IL-6 may be associated with strong pro-inflammatory immune response. The current study did not show any difference in the IL-6 expression between the treatments. This result agrees with other studies where no effects of FOS or prebiotics in IL-6 expression in the cecal tonsil, ileum, and spleen of broilers were not observed (Janardhana et al., 2009; Yitbarek et al., 2015). Similarly, no significant difference was observed in expression of IL-6 in the mannanoligosaccharides-treated group and Clostridium perfringens challenged chickens (Yitbarek et al., 2012). Interferon-γ is a pro-inflammatory cytokine that is responsible for increasing the expression of major histocompatibility complex antigens and provides host defense against intracellular pathogens such as Salmonella (Benbernou and Nauciel, 1994). Similarly, supplementing FOS also upregulated ileal gene expression of IL-1ß, -2, -10, -18, TLR-4, IFN-γ and splenic IL-18, IL-1ß (Shang et al., 2015). Similarly, a study that used dietary yeast cells found higher expression of IFN-γ in broilers (Shanmugasundaram et al., 2015). Interleukin-10 is a major anti-inflammatory cytokine, which can directly regulate both innate and adaptive T cell responses as well as suppresses inflammatory responses in tissues (Couper et al., 2008). The current study did not show any difference in IL-10 expression between treatments, and our findings are similar to a previous study where FOS did not show any effects on IL-10 expression in the cecal tonsil (Janardhana et al., 2009). However, our results contrast with another study that found upregulation of IL-10 in cecal tonsil by supplementing a blend of yeast-derived carbohydrates and probiotics (Yitbarek et al., 2015). Similar to the comment above regarding IL-1β, the gene expression results were restricted to ileal tissue, it is possible had the analysis been expanded to evaluate specific avian lymphoid tissue in the gut-associated lymphoid tissue and possibly the spleen, the results may have been different. Future FOS dietary-SE challenge studies will need to be performed to investigate this issue. Ileal Morphology and IgA Expression Analysis of the structure of the intestinal mucosa can provide useful information regarding the health of the digestive tract (Bogusławska-Tryk, 2012). Stress factors in the digesta can lead to shortening of villi and deepening of crypts (Bogusławska-Tryk, 2012). Increasing the VH suggests an increased surface area capable of greater absorption of available nutrients (Caspary, 1992). The increase in CD or crypt to VH ratio indicates the greater need of cell proliferation to maintain the gut barrier function (Awad et al., 2009). A possible explanation as to why the ileal morphology was unaffected in the hens used in this study might be due to the age and maturity of laying hens. Given that these birds were initially between 60 and 65 wk old, their gut integrity, microbiome, and immune capacity were well established. Similarly, Xu et al. (2003) accessed the effects of 3 levels of dietary FOS in a broiler basal diet at 2.0, 4.0, and 8.0 g/kg mixture and found no dietary effect detected for villi and microvilli or CD in the duodenum of unchallenged chicks. IgA is the major isotype of immunoglobulin secreted on the mucosal surface and protects the intestinal mucosal surfaces from invasion and colonization from pathogens by inhibiting attachment to the gut epithelium (Macpherson et al., 2008). The intestinal immune system, in general, is considered to have the largest accumulation of antibodies in the body (Burkey et al., 2009). The IgA is predominant in intestinal secretions and is synthesized by plasma cells in the lamina propria (Bos et al., 2001). The intestinal immune response plays an important defensive role for pathogens, particularly for those transmitted by fecal shedding (Bianco et al., 2014). There was an increase in IgA+ cells in all Salmonella-infected groups, and this was similar to a previous study that reported increased IgA-positive cells after Salmonella infection (Bobikova et al., 2015). CONCLUSION FOS reduced fecal shedding and ceca SENAR numbers in mature hens by 6 dpi. Further, FOS supplementation in the wake of SENAR challenge appears to alter select immune parameters in laying hens including increased gene expression of TLR-4 and IFN γ, as well as an increase in IgA+ cells in the ileal lamina propria. However, there was no effect observed for either VH or CD. The study shows that FOS can be used as one of the dietary interventions to reduce Salmonella infection in chickens thus helping the poultry industry. ACKNOWLEDGMENTS The authors are grateful to Jeromey Jackson and Lisa Stabler for the excellent technical assistance, and Roshan Adhikari and Chongxiao Chen for helping with animal sampling. Authors also thank Richard Gast for providing the Salmonella Enteritidis used in our study. REFERENCES Aderem A., Ulevitch R. J.. 2000. Toll-like receptors in the induction of the innate immune response. Nature . 406: 782– 787. Google Scholar CrossRef Search ADS PubMed  Awad W. A., Ghareeb K., Abdel-Raheem S., Bohm J.. 2009. Effects of dietary inclusion of probiotic and synbiotic on growth performance, organ weights, and intestinal histomorphology of broiler chickens. Poult. Sci . 88: 49– 56. Google Scholar CrossRef Search ADS PubMed  Babu U. S., Sommers K., Harrison L. M., Balan K. V.. 2012. Effects of fructooligosaccharide-inulin on Salmonella-killing and inflammatory gene expression in chicken macrophages. Vet. Immunol. Immunopathol . 149: 92– 96. Google Scholar CrossRef Search ADS PubMed  Bailey J. S., Blankenship L. C., Cox N. A.. 1991. Effect of fructooligosaccharide on Salmonella colonization of the chicken intestine. Poult. Sci . 70: 2433– 2438. Google Scholar CrossRef Search ADS PubMed  Benbernou N., Nauciel C.. 1994. Influence of mouse genotype and bacterial virulence in the generation of interferon-gamma-producing cells during the early phase of Salmonella typhimurium infection. Immunol . 83: 245– 249. Bianco C., Felice V., Panarese S., Marrocco R., Ostanello F., Brunetti B., Muscatello L. V., Leotti G., Vila T., Joisel F., Sarli G.. 2014. Quantitative immunohistochemical assessment of IgA, IgM, IgG and antigen-specific immunoglobulin secreting plasma cells in pig small intestinal lamina propria. Vet. Immunol. Immunopathol.  160: 281– 287. Google Scholar CrossRef Search ADS PubMed  Blanchfield B., Stavric S., Gleeson T., Pivnick H.. 1984. Minimum intestinal inoculum for Nurmi cultures and a new method for determining competitive exclusion of Salmonella from chicks. J. Food Prot . 47: 542– 545. Google Scholar CrossRef Search ADS   Bobikova K., Revajova V., Karaffova V., Levkutova M., Levkut M.. 2015. IgA gene expression and quantification of cecal IgA+, IgM+, and CD4+ cells in chickens treated with EFAL41 and infected with Salmonella Enteritidis. Acta Histochem . 117: 629– 634. Google Scholar CrossRef Search ADS PubMed  Bogusławska-Tryk M., Piotrowska A., Burlikowska K. 2012. Dietary fructans and their potential beneficial influence on health and performance parametrs in broiler chickens. J. Cent. Euro. Agri . 13: 272– 291. Bos N., Jiang H., Cebra J.. 2001. T cell control of the gut IgA response against commensal bacteria. Gut.  48: 762– 764. Google Scholar CrossRef Search ADS PubMed  Burkey T. E., Skjolaas K. A., Minton J. E.. 2009. BOARD-INVITED REVIEW: Porcine mucosal immunity of the gastrointestinal tract. J. Anim. Sci . 87: 1493– 1501. Google Scholar CrossRef Search ADS PubMed  Caspary W. F. 1992. Physiology and pathophysiology of intestinal absorption. Am. J. Clin. Nutr . 55: 299S– 308S. Google Scholar CrossRef Search ADS PubMed  CDC. 2014. Incidence and trends of infection with pathogens transmitted commonly through food — foodborne diseases active surveillance network, 10 U.S. sites, 2006–2013. Morb. Mortal. Wkly. Rep . 63: 328– 332. Chappell L., Kaiser P., Barrow P., Jones M. A., Johnston C., Wigley P.. 2009. The immunobiology of avian systemic salmonellosis. Vet. Immunol. Immunopathol . 128: 53– 59. Google Scholar CrossRef Search ADS PubMed  Cheng G., Hao H., Xie S., Wang X., Dai M., Huang L., Yuan Z.. 2014. Antibiotic alternatives: the substitution of antibiotics in animal husbandry? Front. Microbiol . 5: 217. Google Scholar CrossRef Search ADS PubMed  Corwin E. J. 2000. Understanding cytokines Part I: physiology and mechanism of action. Biol. Res. Nurs . 2: 30– 40. Google Scholar CrossRef Search ADS PubMed  Couper K. N., Blount D. G., Riley E. M.. 2008. IL-10: The master regulator of immunity to infection. J. Immunol . 180: 5771– 5777. Google Scholar CrossRef Search ADS PubMed  Daddaoua A., Puerta V., Requena P., Martinez-Ferez A., Guadix E., de Medina F. S., Zarzuelo A., Suarez M. D., Boza J. J., Martinez-Augustin O. 2006. Goat milk oligosaccharides are anti-inflammatory in rats with hapten-induced colitis. J. Nutr.  136: 672– 676. Google Scholar CrossRef Search ADS PubMed  Donalson L. M., McReynolds J. L., Kim W. K., Chalova V. I., Woodward C. L., Kubena L. F., Nisbet D. J., Ricke S. C.. 2008. The influence of a fructooligosaccharide prebiotic combined with alfalfa molt diets on the gastrointestinal tract fermentation, Salmonella enteritidis infection, and intestinal shedding in laying hens. Poult. Sci . 87: 1253– 1262. Google Scholar CrossRef Search ADS PubMed  Dunkley K. D., McReynolds J. L., Hume M. E., Dunkley C. S., Callaway T. R., Kubena L. F., Nisbet D. J., Ricke S. C.. 2007. Molting in Salmonella enteritidis-challenged laying hens fed alfalfa crumbles. I. Salmonella enteritidis colonization and virulence gene hilA response. Poult. Sci . 86: 1633– 1639. Google Scholar CrossRef Search ADS PubMed  Ferro P. J., Swaggerty C. L., Kaiser P., Pevzner I. Y., Kogut M. H.. 2004. Heterophils isolated from chickens resistant to extra-intestinal Salmonella Enteritidis infection express higher levels of pro-inflammatory cytokine mRNA following infection than heterophils from susceptible chickens. Epidemiol. Infect . 132: 1029– 1037. Google Scholar CrossRef Search ADS PubMed  Fukata T., Sasai K., Miyamoto T., Baba E.. 1999. Inhibitory effects of competitive exclusion and fructooligosaccharide, singly and in combination, on Salmonella colonization of chicks. J. Food Prot . 62: 229– 233. Google Scholar CrossRef Search ADS PubMed  He G. Z., Tian W. Y., Qian N., Cheng A. C., Deng S. X.. 2010. Quantitative studies of the distribution pattern for Salmonella Enteritidis in the internal organs of chicken after oral challenge by a real-time PCR. Vet. Res. Commun . 34: 669– 676. Google Scholar CrossRef Search ADS PubMed  Janardhana V., Broadway M. M., Bruce M. P., Lowenthal J. W., Geier M. S., Hughes R. J., Bean A. G. D.. 2009. Prebiotics modulate immune responses in the gut-associated lymphoid tissue of chickens. J. Nutr . 139: 1404– 1409. Google Scholar CrossRef Search ADS PubMed  Leveque G., Forgetta V., Morroll S., Smith A. L., Bumstead N., Barrow P., Loredo-Osti J. C., Morgan K., Malo D.. 2003. Allelic variation in TLR4 is linked to susceptibility to Salmonella enterica serovar Typhimurium infection in chickens. Infect. Immun . 71: 1116– 1124. Google Scholar CrossRef Search ADS PubMed  Livak K. J., Schmittgen T. D.. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods.  25: 402– 408. Google Scholar CrossRef Search ADS PubMed  Macpherson A. J., McCoy K. D., Johansen F. E., Brandtzaeg P.. 2008. The immune geography of IgA induction and function. Mucosal. Immunol . 1: 11– 22. Google Scholar CrossRef Search ADS PubMed  Mughini-Gras L., Enserink R., Friesema I., Heck M., Duynhoven Y. V., Pelt W. V.. 2014. Risk factors for human Salmonellosis originating from pigs, cattle, broiler chickens and egg laying hens : a combined case-control and source attribution analysis. Plos One . 9: e87933. Google Scholar CrossRef Search ADS PubMed  Murate L. S., Paião F. G., Almeida A. M. d., Berchieri A. Jr, Shimokomaki M.. 2015. Efficacy of prebiotics, probiotics, and synbiotics on laying hens and broilers challenged with Salmonella Enteritidis. Jpn. Poult. Sci . 52: 52– 56. Google Scholar CrossRef Search ADS   NRC. 1994. Nutrient Requirements of Poultry . 9th rev. ed. Natl. Acad. Press, Washington, DC. SAS. 2009. Statistical Analysis Systems Users Guide.  9th ed. SAS Institute Inc., Cary, NC. Seo K. H., Holt P. S., Gast R. K.. 2001. Comparison of Salmonella Enteritidis infection in hens molted via long-term feed withdrawal versus full-fed wheat middling. J. Food Prot . 64: 1917– 1921. Google Scholar CrossRef Search ADS PubMed  Setta A. M., Barrow P. A., Kaiser P., Jones M. A.. 2012. Early immune dynamics following infection with Salmonella enterica serovars Enteritidis, Infantis, Pullorum and Gallinarum: cytokine and chemokine gene expression profile and cellular changes of chicken cecal tonsils. Comp. Immunol. Microbiol. Infect. Dis.  35: 397– 410. Google Scholar CrossRef Search ADS PubMed  Shang Y., Regassa A., Kim J. H., Kim W. K.. 2015. The effect of dietary fructooligosaccharide supplementation on growth performance, intestinal morphology, and immune responses in broiler chickens challenged with Salmonella Enteritidis lipopolysaccharides. Poult. Sci . 94: 2887– 2897. Google Scholar CrossRef Search ADS PubMed  Shanmugasundaram R., Kogut M. H., Arsenault R. J., Swaggerty C. L., Cole K., Reddish J. M., Selvaraj R. K.. 2015. Effect of Salmonella infection on cecal tonsil regulatory T cell properties in chickens. Poult. Sci . 94: 1828– 1835. Google Scholar CrossRef Search ADS PubMed  Van Immerseel F., De Zutter L., Houf K., Pasmans F., Haesebrouck F., Ducatelle R.. 2009. Strategies to control Salmonella in the broiler production chain. World's Poult. Sci. J.  65: 367– 392. Google Scholar CrossRef Search ADS   Waititu S. M., Yitbarek A., Matini E., Echeverry H., Kiarie E., Rodriguez-Lecompte J. C., Nyachoti C. M.. 2014. Effect of supplementing direct-fed microbials on broiler performance, nutrient digestibilities, and immune responses1. Poult. Sci . 93: 625– 635. Google Scholar CrossRef Search ADS PubMed  Xu Z. R., Hu C. H., Xia M. S., X. A., Zhan, Wang M. Q.. 2003. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci . 82: 1030– 1036. Google Scholar CrossRef Search ADS PubMed  Yasuda M., Tanaka S., Arakawa H., Taura Y., Yokomizo Y., Ekino S.. 2002. A comparative study of gut-associated lymphoid tissue in calf and chicken. Anat. Rec . 266: 207– 217. Google Scholar CrossRef Search ADS PubMed  Yitbarek A., Echeverry H., Brady J., Hernandez-Doria J., Camelo-Jaimes G., Sharif S., Guenter W., House J. D., Rodriguez-Lecompte J. C.. 2012. Innate immune response to yeast-derived carbohydrates in broiler chickens fed organic diets and challenged with Clostridium perfringens. Poult. Sci.  91: 1105– 1112. Google Scholar CrossRef Search ADS PubMed  Yitbarek A., Echeverry H., Munyaka P., Rodriguez-Lecompte J. C.. 2015. Innate immune response of pullets fed diets supplemented with prebiotics and synbiotics. Poult. Sci.  94: 1802– 1811. Google Scholar CrossRef Search ADS PubMed  © 2018 Poultry Science Association Inc.

Journal

Poultry ScienceOxford University Press

Published: Apr 13, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off