Effect of dietary β-alanine supplementation on growth performance, meat quality, carnosine content, and gene expression of carnosine-related enzymes in broilers

Effect of dietary β-alanine supplementation on growth performance, meat quality, carnosine... Abstract The objective of the current study was to investigate the effect of dietary β-alanine supplementation on growth performance, meat quality, antioxidant ability, carnosine content, and gene expression of carnosine-related enzymes in broiler chicks. We randomly assigned 540 1-day-old Arbor Acres broilers to 5 dietary treatments supplemented with 0 (control group), 250, 500, 1,000, or 2,000 mg/kg of β-alanine (mg β-alanine per kg feed). Each treatment included 6 replicates of 18 birds. The feeding trial lasted for 42 d. Dietary β-alanine supplementation linearly and quadratically increased the average daily gain (ADG) during the starting period (d 1 to 21, P = 0.02 and P = 0.002). The feed conversion ratio (FCR) decreased quadratically in response to dietary β-alanine supplementation during the starting and entire periods (P < 0.001 and P = 0.003, respectively). For the entire period, the predicted best FCR would be achieved when β-alanine was fed at a level of 1,100 mg/kg from quadratic regression. The concentrations of carnosine and β-alanine in breast muscle increased quadratically with dietary β-alanine supplementation (d 42, P < 0.001 and P = 0.001, respectively). The predicted dietary β-alanine level for highest breast carnosine content was 1,196 mg/kg. Dietary supplementation with β-alanine reduced the taurine concentrations in plasma (d 42, linear and quadratic, P < 0.001). Breast muscle yield increased linearly and quadratically in response to dietary β-alanine addition (d 21, P = 0.017 and P = 0.007). Dietary supplementation with β-alanine quadratically reduced the shear force (P = 0.003), whereas a*45 min and a*24 h values increased quadratically in response to dietary β-alanine supplementation (d 42, P = 0.020 and P = 0.021, respectively). Dietary β-alanine addition quadratically enhanced the expression of carnosine synthase and taurine transporter mRNAs (P < 0.05). Overall, dietary β-alanine supplementation improved growth performance and carnosine content, ameliorated antioxidant capacity and meat quality, and upregulated the gene expression of carnosine synthesis–related enzymes in broiler chicks. INTRODUCTION Chicken meat is considered a desirable food by consumers because of its high protein, low fat and cholesterol, and abundance of functional peptides (Abe, 2000). Functional carnosine, which is abundant in skeletal muscle (Mannion et al., 1992), plays an important role in poultry tissues. Carnosine (β-alanyl-l-histidine) and its derivative anserine (β-alanyl-l-methyl-l-histidine) are well known for their antioxidants (Kohen et al., 1988), anti-fatigue (Nagai et al., 1996), and putative neurotransmitter properties (Tomonaga et al., 2005a). Carnosine is synthesized from 2 amino acids, β-alanine and l-histidine, by means of carnosine synthase. β-alanine, a non-essential amino acid, is the only β-amino acid that exists naturally. Moreover, it is the limiting amino acid for muscle carnosine synthesis (Everaert et al., 2013a). β-alanine can be synthesized in the liver (Matthews and Traut, 1987) or directly obtained from the diet (particularly white and red meat). Influences of dietary β-alanine addition have been studied in broilers (Tomonaga et al. 2005b; Won et al. 2013). Dietary supplementation of β-alanine enhances growth performance in broilers (Tomonaga et al., 2005b). Oral administration of 22 mmol/kg β-alanine to 2-day-old chicks for 5 d increases the carnosine concentration in the muscles of broilers (Tomonaga et al., 2012). Dietary supplementation of 1% β-alanine increased the carnosine levels in breast muscle of broilers from 756.15 μg/g to 911.01 μg/g (Kralik et al., 2014). Dietary β-alanine addition increased the redness value (Kralik et al., 2014) and lightness value and decreased the shear force (Zhang, 2008), while improving the meat quality. Dietary β-alanine supplementation increased the total antioxidant capacity during the post-supplementation session (Belviranli et al., 2015) and tended to decrease the malondialdehyde (MDA) content and improves the ability of antioxidant in breast muscle (Hu, 2009). Dietary supplementation with 1.8% β-alanine stimulated the gene expression of both taurine transporter (SLC6A6) and carnosine synthase (CARNS1) in mice (Everaert et al., 2013b). However, examination of dietary β-alanine levels and the mechanism of carnosine-synthesis gene expression has not yet been studied in broilers. Therefore, the aim of this study was to determine the optimal dosage of β-alanine on growth performance, meat quality, carnosine content, and gene expression of carnosine synthesis–related enzymes and transporters in broiler chicks. MATERIALS AND METHODS Diets and Design of Experiment The experimental procedures were approved by the Animal Care and Use Committee of the Feed Research Institute of the Chinese Academy of Agricultural Sciences. A total of 540 1-day-old male Arbor Acres broilers were randomly assigned into 5 dietary treatments supplemented with 0 (control group), 250, 500, 1,000, or 2,000 mg β-alanine per kg feed. Each treatment group included 6 replicates (cages) of 18 birds. The chicken house was kept 24-h constant-light each program and temperature was set to 33°C for the first 3 d, and then dropped by 2°C each successive wk until it reached 24°C. The composition and nutrient level of the basal diet is shown in Table 1. Birds were provided feed and water ad libitum during the feeding trial. All chickens were raised in line with the regulations of the Arbor Acres Broiler Commercial Management Guide (Aviagen, 2009). Table 1. Composition and nutrient levels of the basal diet (air-dry basis, %). Item  Starting (d 1–21)  Growing (d 21–42)  Ingredients, %      Corn  56.37  63.08  Soybean meal (43%)  36.56  29.24  Vegetable oil  3.00  3.50  Dicalcium phosphate  1.24  1.61  Limestone  1.61  1.18  Salt  0.35  0.35  dl-Methionine (98%)  0.27  0.3  l-Lysine-HCl (78%)  0.19  0.27  l-Threonine (98%)  0.09  0.15  Vitamin premix1  0.02  0.02  Mineral premix2  0.20  0.20  Choline chloride (50%)  0.10  0.10  Total  100  100  Calculated nutrient levels      AME, MJ/kg  12.55  12.97  Crude protein, %  21.00  19.00  Calcium, %  1.00  0.90  Total phosphorus, %  0.70  0.65  Available phosphorus, %  0.45  0.40  Lysine, %  1.15  1.05  Methionine, %  0.55  0.48  Methionine+cysteine, %  0.92  0.84  Threonine, %  0.82  0.69  Tryptophan, %  0.24  0.22  Value of β-alanine (mg/kg)  Theoretical value  Analytical value    0  <0.01    250  243    500  471    1,000  987    2,000  1934  Item  Starting (d 1–21)  Growing (d 21–42)  Ingredients, %      Corn  56.37  63.08  Soybean meal (43%)  36.56  29.24  Vegetable oil  3.00  3.50  Dicalcium phosphate  1.24  1.61  Limestone  1.61  1.18  Salt  0.35  0.35  dl-Methionine (98%)  0.27  0.3  l-Lysine-HCl (78%)  0.19  0.27  l-Threonine (98%)  0.09  0.15  Vitamin premix1  0.02  0.02  Mineral premix2  0.20  0.20  Choline chloride (50%)  0.10  0.10  Total  100  100  Calculated nutrient levels      AME, MJ/kg  12.55  12.97  Crude protein, %  21.00  19.00  Calcium, %  1.00  0.90  Total phosphorus, %  0.70  0.65  Available phosphorus, %  0.45  0.40  Lysine, %  1.15  1.05  Methionine, %  0.55  0.48  Methionine+cysteine, %  0.92  0.84  Threonine, %  0.82  0.69  Tryptophan, %  0.24  0.22  Value of β-alanine (mg/kg)  Theoretical value  Analytical value    0  <0.01    250  243    500  471    1,000  987    2,000  1934  1The vitamin premix supplied the following per kg of complete feed: vitamin A, 12,500 IU; vitamin D3, 2,500 IU; vitamin K3, 2.65 mg; vitamin B1, 2 mg; vitamin B2, 6 mg; vitamin B12, 0.025 mg; vitamin E, 30 IU; biotin, 0.0325 mg; folic acid, 1.25 mg; pantothenic acid, 12 mg; niacin, 50 mg. 2The mineral premix supplied the following per kg of complete feed: Cu, 8 mg; Zn, 75 mg; Fe, 80 mg; Mn, 100 mg; Se, 0.15 mg; I, 0.35 mg. View Large Growth Performance All cages were checked for sick and dead birds on a daily basis. Identification number, cage, age, and condition were recorded on a cage record sheet. General health status, weight, mortality, cause of death, and filling grade as well as morphologic alterations/symptoms of the dead birds were also recorded. Birds were weighed using a cage as a unit. Feed intake was recorded on a cage basis. Subsequently, average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR; feed: gain, g: g) were calculated. Feed conversion was calculated and corrected for mortality. Slaughtering and Sampling One bird around the average weight was selected from each replicate group for blood sampling and carcass measurements after starving for 10 h at the age of 21 and 42 d, respectively. Blood samples were obtained from the left jugular vein immediately after the birds were sacrificed, and then were centrifuged at 1,800 × g for 15 min at 4°C after storage for a while at room temperature. The plasma samples were kept at –20°C until analysis. After blood sampling, birds were hanged for few minutes to death and then eviscerated to measure carcass weight (without head, paws, or giblets) as a yield of total weight. The abdominal fat and the breast and thigh muscles were collected and weighed. The abdominal fat was referred to the adipose tissue from the proventriculus surrounding the gizzard down to the cloaca. The right side of breast muscle was then taken to determine meat color and muscle pH. At the same time, approximately 30.0 g of left breast muscle was taken to measure dripping loss, cooking loss, and shear value. All samples were stored at 4°C until analysis. Assay of Peptide and Free Amino Acids in Tissues and Plasma The contents of carnosine, anserine, taurine, and β-alanine were determined by an A300 automatic amino acid analyzer (Membra Pure, Bodenheim, Germany). Samples were combined with 200 μL sulfosalicylic acid (10%) to precipitate proteins kept at 4°C for 1 h, and then centrifuged at 14,500 × g for 15 min. After appropriate dilution, the supernatant was filtered through a 0.45-μm pore size filter membrane (Millipore Co., Bedford, MA) and then directly injected into the analyzer for free amino acid determination. The trimethylbenzene substrate was ninhydrin, which had a 0.09 mL/min flow rate, and the injection volume was fixed at 20 μL. Detection was performed by UV absorbance at wavelengths of 570/440 nm. Meat Quality Assay Muscle pH was determined using an electronic pH meter (CyberScan pH 310, Eutech Instruments Pte. Ltd., Singapore) at 45 min (pH45 min) and 24 h (pH24 h) postmortem. Each sample was measured 3 times, and the average value was taken as the final result. The value of pH decline within 24 h postmortem (ΔpH) was calculated as ΔpH = pH24 h − pH45 min. At 24 h after slaughter, meat color was measured in duplicate using a Chroma Meter (Chroma Meter WSC-S, Shanghai Precision and Scientific Instrument Co., Shanghai, China). Color was reported in the CIELab trichromatic system as lightness (L*), redness (a*), and yellowness (b*) values. Drip loss was measured as described by Zhang et al. (2009). Briefly, approximately 30 g (wet weight, W1) of regular-shaped muscle from the right pectoralis major muscle was placed in a zip-sealed plastic bag, and then the bag was filled with nitrogen to avoid oxidation, evaporation, and mutual extrusion. All bags were stored at 4°C for 24 h, and then surface moisture of the fillets was absorbed with filter paper and the muscle samples were reweighed (W2). Drip loss was calculated as (%) = (W1− W2)/W1 × 100%. After assessing drip loss, the meat samples were placed in new zip-sealed polyethylene bags and stored at 4°C until 72 h postmortem. At 72 h postmortem, the muscles were dried and weighed (W1), and then heated in a water bath at 85°C for 20 min (end-point temperature of 80°C), cooled in running water to ambient temperature, and then dried and reweighed (W2). Cooking loss was evaluated as (%) = (W1 − W2)/W1 × 100% (Xu et al., 2011). At 96 h postmortem, about 30 g (wet weight) of muscle was heated for 20 min in zip-sealed plastic bags in a water bath at 85°C. After cooling to ambient temperature, shear force value was measured in triplicate as described by Froning and Uijttenboogaart (1988). Assay of Plasma and Tissue Indices Plasma total superoxide dismutase (T-SOD) activity, total antioxidant capacity (T-AOC), and MDA content were analyzed using commercially available kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), and all parameters were evaluated according to the instructions (Wang et al., 2015). Total RNA Extraction and cDNA Synthesis Tissue dissected from the breast muscle was homogenized in Trizol Reagent (Invitrogen, Carlsbad, CA), and total RNA was extracted according to the manufacturer's instructions. The RNA samples were purified using the SV Total RNA Isolation System (Promega Corporation, Madison, WI) and quantified using a NanoDrop ND 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). Total RNA (1 mg) from each sample was used for first-strand cDNA synthesis with the TIANGEN Quantscript RT kit following the manufacturer's instructions (TIANGEN Biotech Co. Ltd, Beijing, China). Procedures for RNA preparation conformed to the Minimum Information for Publication of Quantitative Real-Time PCR Experiments guidelines. Real-Time Quantitative Polymerase Chain Reaction The gene expression of carnosine synthase (CARNS1), carnosinase (CNDP1, CNDP2), and β-alanine transporters (SLC6A6, SLC36A1, SLC6A14) were performed with a real-time polymerase chain reaction (PCR) kit following the manufacturer's protocol (Real MasterMix-SYBR Green; TIANGEN). Reactions of real-time quantitative PCR were carried out with an iCycler iQ5 multicolor real-time PCR detection system (Bio-Rad, Hercules, CA), and the protocol used was as follows: 95°C for 5 min; 40 cycles of 95°C for 10 s, 60°C for 30 s, 72°C for 30 s; and final extension at 72°C for 5 min. The melting curve was recorded at 60°C. The primers used are listed in Table 2. The amplification efficiency of each gene was validated by constructing a standard curve through 4 serial dilutions of cDNA. For analyses, relative quantification was applied with β-actin used as the housekeeping gene. A bird sample from non-β-alanine conditions was used as the calibrator sample. All experiments were done in triplicate. The relative mRNA expression levels of carnosine synthase (CARNS1), carnosinase (CNDP1, CNDP2), β-alanine transporters (SLC6A6, SLC36A1, SLC6A14) were calculated using the “normalized relative quantification” method followed by Primers for Real-Time PCR analysis. Table 2. Primers used in qPCR analysis in chicken. Gene  Forward primer (5΄-3΄)  Reserve primer (3΄-5΄)  Tm (°C)  Gene ID  CARNS1  CTGCCCTGGAAGAATTTGTG  GACAGCAACCAGCGAGAGAG  62  100,359,387  CNDP1  ATTCTCCATTCGCCAAGTTC  GCATCTGCATCACCAATAGG  59  421,012  CNDP2  AAACCTTGGGTGTCAGAC-TT  ACATTCTTGCCTGTTGCTTC  58  421,013  SLC6A6  GGGAAATCTTCATCGCTAT  CCATAAACCCAGGCTACAG  56  416,041  SLC36A1  CACGGCAGTTCCCTCTGAT  AGCAGTTGGGCAGGTTGAG  60  770,250  SLC6A14  AAACACGCCTCGTAAATGA  CACGATGTTGCCAGTCTCA  56  100,857,521  β-actin  ATCCGGACCCTCCATTGTC  AGCCATGCCAATCTCGTCTT  60  396,526  Gene  Forward primer (5΄-3΄)  Reserve primer (3΄-5΄)  Tm (°C)  Gene ID  CARNS1  CTGCCCTGGAAGAATTTGTG  GACAGCAACCAGCGAGAGAG  62  100,359,387  CNDP1  ATTCTCCATTCGCCAAGTTC  GCATCTGCATCACCAATAGG  59  421,012  CNDP2  AAACCTTGGGTGTCAGAC-TT  ACATTCTTGCCTGTTGCTTC  58  421,013  SLC6A6  GGGAAATCTTCATCGCTAT  CCATAAACCCAGGCTACAG  56  416,041  SLC36A1  CACGGCAGTTCCCTCTGAT  AGCAGTTGGGCAGGTTGAG  60  770,250  SLC6A14  AAACACGCCTCGTAAATGA  CACGATGTTGCCAGTCTCA  56  100,857,521  β-actin  ATCCGGACCCTCCATTGTC  AGCCATGCCAATCTCGTCTT  60  396,526  CARNS1, carnosine synthase; CNDP1, carnosinase-1; CNDP2, carnosinase-2; SLC6A6, taurine transporter; SLC36A1, Proton coupling amino acid transporter; SLC6A14, solute carrier family 6 member 14. View Large Statistical Analysis All data were analyzed by one-way analysis of variance (ANOVA) procedure of the SPSS 16.0 software package for Windows (SPSS, Chicago, IL). The model included the treatment effect, and the cage represented the experimental unit for growth performance, whereas the individual bird was the experimental unit for others parameters. Orthogonal polynomial contrasts were employed to test the linear and quadratic effects of dietary β-alanine supplementation. Regression analysis was used to estimate β-alanine optimization whenever a significant quadratic response (P ≤ 0.05) was observed. The treatment effects were considered significant at P ≤ 0.05, whereas a trend for a treatment effect was noted for P ≤ 0.10. RESULTS Growth Performance Effect of dietary β-alanine addition on growth performance is listed in Table 3. During the starting period (d 1 to 21), dietary β-alanine supplementation linearly and quadratically increased ADG (P = 0.012 and P = 0.002, respectively) and decreased FCR (P = 0.010 and P < 0.001, respectively). During the entire periods of the trial (d 1 to 42), dietary β-alanine quadratically reduced the FCR (P = 0.013) and tended to quadratically increase the ADG (P = 0.094). However, no significant difference was observed in ADFI in response to β-alanine supplementation in the diets (P > 0.05). Table 3. Effect of dietary β-alanine supplementation on growth performance in broiler chicks.1 Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  d 1–21   ADG, g/d  42.5  47.2  48.8  46.3  48.3  0.47  <0.001  0.012  0.002   ADFI, g/d  61.0  63.5  64.5  61.6  64.7  0.61  0.11  0.28  0.47   FCR (feed: gain g:g)  1.44  1.34  1.32  1.33  1.34  0.011  0.001  0.010  <0.001   BW d 21  936  1040  1054  1047  1014  10.9  0.016  0.25  0.33  d 21–42   ADG, g/d  76.6  75.7  80.3  75.5  76.8  0.58  0.15  0.86  0.79   ADFI, g/d  154  148  149  148  149.  3.84  0.41  0.37  0.42   FCR (feed: gain g:g)  2.01  1.96  1.87  1.96  1.95  0.017  0.064  0.43  0.12   BW d 42  2551  2709  2772  2630  2723  24.1  0.77  0.36  0.45  d 1–42   ADG, g/d  59.9  61.4  64.9  60.3  61.5  0.66  0.036  0.92  0.094   ADFI, g/d  105  102  107  101  104.  0.67  0.20  0.37  0.60   FCR (feed: gain g:g)  1.75  1.67  1.63  1.67  1.69  0.014  0.049  0.63  0.013  Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  d 1–21   ADG, g/d  42.5  47.2  48.8  46.3  48.3  0.47  <0.001  0.012  0.002   ADFI, g/d  61.0  63.5  64.5  61.6  64.7  0.61  0.11  0.28  0.47   FCR (feed: gain g:g)  1.44  1.34  1.32  1.33  1.34  0.011  0.001  0.010  <0.001   BW d 21  936  1040  1054  1047  1014  10.9  0.016  0.25  0.33  d 21–42   ADG, g/d  76.6  75.7  80.3  75.5  76.8  0.58  0.15  0.86  0.79   ADFI, g/d  154  148  149  148  149.  3.84  0.41  0.37  0.42   FCR (feed: gain g:g)  2.01  1.96  1.87  1.96  1.95  0.017  0.064  0.43  0.12   BW d 42  2551  2709  2772  2630  2723  24.1  0.77  0.36  0.45  d 1–42   ADG, g/d  59.9  61.4  64.9  60.3  61.5  0.66  0.036  0.92  0.094   ADFI, g/d  105  102  107  101  104.  0.67  0.20  0.37  0.60   FCR (feed: gain g:g)  1.75  1.67  1.63  1.67  1.69  0.014  0.049  0.63  0.013  1n = 6 replicates per treatment. ADG, average daily gain; ADFI, average daily feed intake; FCR (feed: gain = g: g), feed conversion ratio; BW, body weight. View Large Amino Acids and Dipeptide Levels in Breast Muscle and Plasma Table 4 shows the effect of dietary β-alanine addition on taurine, carnosine, anserine, and β-alanine levels in breast muscle and plasma of broilers at d 42. Beta-alanine-supplemented groups decreased taurine levels in plasma (linear and quadratic, P < 0.05). However, there were no differences in plasma levels of β-alanine, carnosine, or anserine content among all treatments (P > 0.05). Dietary β-alanine supplementation quadratically increased the concentrations of β-alanine and carnosine (P < 0.001 and P = 0.001, respectively), and tended to linearly and quadratically decrease taurine content in the breast muscle of broilers at d 42 (P = 0.085 and P = 0.077, respectively). Table 4. Effect of dietary β-alanine supplementation on amino acid and dipeptide levels in broiler chicks at d 42.1 Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  Breast, μg/g                     TAU  190  145  147  156  142  6.27  0.079  0.085  0.077   β-ALA  40.3  70.3  98.3  106  131  6.04  <0.001  <0.001  <0.001   CARN  2693  3155  3903  3494  3417  13  0.003  0.041  0.001   ANSER  8193  8290  8898  8357  7918  31  0.83  0.33  0.26  Plasma, μmol/L   TAU  703  480  422  518  308  4.07  0.001  0.002  0.005   β-ALA  21.7  23.7  25.0  26.5  32.5  2.16  0.61  0.12  0.28   CARN  35.0  36.7  63.3  48.3  31.7  4.24  0.10  0.98  0.062   ANSER  31.7  33.3  46.0  39.2  31.7  4.03  0.73  0.92  0.48  Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  Breast, μg/g                     TAU  190  145  147  156  142  6.27  0.079  0.085  0.077   β-ALA  40.3  70.3  98.3  106  131  6.04  <0.001  <0.001  <0.001   CARN  2693  3155  3903  3494  3417  13  0.003  0.041  0.001   ANSER  8193  8290  8898  8357  7918  31  0.83  0.33  0.26  Plasma, μmol/L   TAU  703  480  422  518  308  4.07  0.001  0.002  0.005   β-ALA  21.7  23.7  25.0  26.5  32.5  2.16  0.61  0.12  0.28   CARN  35.0  36.7  63.3  48.3  31.7  4.24  0.10  0.98  0.062   ANSER  31.7  33.3  46.0  39.2  31.7  4.03  0.73  0.92  0.48  1n = 6 replicates per treatment. TAU, taurine; β-ALA, β-alanine; CARN, carnosine; ANSER, anserine. View Large Slaughtering Performance and Meat Quality Effect of dietary β-alanine addition on carcass performance at d 21 and 42 is listed in Table 5. The broiler breast muscle yield quadratically increased in response to dietary β-alanine supplementation at the age of d 21 (P < 0.05). No notable differences in dressing yield or abdominal fat yield were found among all dietary treatments (P > 0.05). Table 5. Effect of dietary β-alanine supplementation on carcass yield of broiler chicks.1 Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  d 21   Dressing yield, %  63.3  63.4  63.4  63.6  63.3  0.20  0.99  0.84  0.90   Breast muscle yield, %  19.4  21.8  22.4  22.1  22.5  0.35  0.023  0.017  0.007   Leg muscle yield, %  19.4  19.9  19.6  19.9  20.1  0.33  0.97  0.58  0.86   Abdominal fat yield, %  1.57  1.56  1.56  1.46  1.65  0.06  0.90  0.94  0.86  d 42   Dressing yield, %  70.1  70.6  72.6  71.6  70.9  0.31  0.10  0.39  0.053   Breast muscle yield, %  31.6  32.1  33.3  30.4  31.9  0.45  0.38  0.55  0.70   Leg muscle yield, %  22.9  22.7  24.1  22.7  23.7  0.19  0.071  0.47  0.71   Abdominal fat yield, %  2.33  1.94  2.08  1.89  1.90  0.07  0.23  0.10  0.14  Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  d 21   Dressing yield, %  63.3  63.4  63.4  63.6  63.3  0.20  0.99  0.84  0.90   Breast muscle yield, %  19.4  21.8  22.4  22.1  22.5  0.35  0.023  0.017  0.007   Leg muscle yield, %  19.4  19.9  19.6  19.9  20.1  0.33  0.97  0.58  0.86   Abdominal fat yield, %  1.57  1.56  1.56  1.46  1.65  0.06  0.90  0.94  0.86  d 42   Dressing yield, %  70.1  70.6  72.6  71.6  70.9  0.31  0.10  0.39  0.053   Breast muscle yield, %  31.6  32.1  33.3  30.4  31.9  0.45  0.38  0.55  0.70   Leg muscle yield, %  22.9  22.7  24.1  22.7  23.7  0.19  0.071  0.47  0.71   Abdominal fat yield, %  2.33  1.94  2.08  1.89  1.90  0.07  0.23  0.10  0.14  1n = 6 replicates per treatment. View Large Dietary β-alanine supplementation quadratically reduced the shear force at the age of d 42 (P = 0.033, Table 6). There were no significant changes in L* value, b* value, or pH value of breast muscle at either 45 min or 24 h postmortem, and ΔpH was not significantly different in response to dietary β-alanine supplementation (P > 0.05). Dietary β-alanine addition quadratically increased a* value of breast muscle at both 45 min (P = 0.020) and 24 h (P = 0.021) postmortem. Table 6. Effect of dietary β-alanine supplementation on meat quality of broiler chicks at d 42.1 Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  Shear force, N  17.7  16.6  16.7  16.0  17.0  0.17  0.033  0.43  0.003  Dripping loss, %  3.03  3.01  2.99  2.81  3.29  0.06  0.31  0.62  0.094  Cooking loss, %  12.8  13.5  12.9  13.0  12.1  0.43  0.92  0.51  0.69  pH45 min  6.21  6.26  6.32  6.39  6.27  0.02  0.078  0.10  0.033  pH24 h  5.65  5.64  5.68  5.66  5.69  0.02  0.98  0.67  0.91  ΔpH  0.55  0.61  0.64  0.72  0.59  0.03  0.38  0.37  0.23  L*45 min  45.0  44.0  45.5  45.3  46.1  0.42  0.60  0.23  0.46  a*45 min  2.50  2.76  2.97  2.92  2.63  0.15  <0.001  0.077  0.020  b*45 min  9.17  9.41  8.50  9.42  9.43  0.22  0.67  0.65  0.66  L*24 h  58.1  57.1  57.3  58.0  58.2  0.36  0.82  0.58  0.55  a*24 h  4.98  5.25  5.97  5.32  5.25  0.08  0.022  0.63  0.021  b*24 h  15.2  15.6  15.5  16.5  16.0  0.29  0.85  0.40  0.70  Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  Shear force, N  17.7  16.6  16.7  16.0  17.0  0.17  0.033  0.43  0.003  Dripping loss, %  3.03  3.01  2.99  2.81  3.29  0.06  0.31  0.62  0.094  Cooking loss, %  12.8  13.5  12.9  13.0  12.1  0.43  0.92  0.51  0.69  pH45 min  6.21  6.26  6.32  6.39  6.27  0.02  0.078  0.10  0.033  pH24 h  5.65  5.64  5.68  5.66  5.69  0.02  0.98  0.67  0.91  ΔpH  0.55  0.61  0.64  0.72  0.59  0.03  0.38  0.37  0.23  L*45 min  45.0  44.0  45.5  45.3  46.1  0.42  0.60  0.23  0.46  a*45 min  2.50  2.76  2.97  2.92  2.63  0.15  <0.001  0.077  0.020  b*45 min  9.17  9.41  8.50  9.42  9.43  0.22  0.67  0.65  0.66  L*24 h  58.1  57.1  57.3  58.0  58.2  0.36  0.82  0.58  0.55  a*24 h  4.98  5.25  5.97  5.32  5.25  0.08  0.022  0.63  0.021  b*24 h  15.2  15.6  15.5  16.5  16.0  0.29  0.85  0.40  0.70  1n = 6 replicates per treatment. L* = lightness; a* = redness; b* = yellowness; ΔpH = pH45 min−pH24 h. View Large Antioxidant Index Dietary addition of β-alanine quadratically decreased the levels of MDA in the breast muscle and plasma of broilers at d 42 (P < 0.002 and P < 0.001, respectively, Table 7). There were no distinct differences in the T-AOC or SOD content in either plasma or breast muscle of birds in all dietary treatments at d 42 (P > 0.05). However, dietary β-alanine tended to quadratically increase T-AOC level in plasma at d 42 (P = 0.080). Table 7. Effect of dietary β-alanine supplementation on antioxidant indices in breast muscle and plasma of broiler chicks at d 42.1 Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  Breast  MDA, nmol/L  2.55  1.74  1.40  1.41  1.39  0.13  0.012  0.006  0.002  SOD, U/mL  48.7  47.4  48.8  50.0  46.1  1.02  0.82  0.77  0.81  T-AOC, U/mL  0.23  0.26  0.27  0.28  0.29  0.01  0.45  0.09  0.18  Plasma  MDA, nmol/L  4.45  2.79  1.39  1.83  2.46  0.25  <0.001  0.002  <0.001  SOD, U/mL  102  115  141  144  122  8.98  0.51  0.32  0.26  T-AOC, U/mL  3.47  4.98  5.81  4.82  4.59  0.32  0.29  0.50  0.08  Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  Breast  MDA, nmol/L  2.55  1.74  1.40  1.41  1.39  0.13  0.012  0.006  0.002  SOD, U/mL  48.7  47.4  48.8  50.0  46.1  1.02  0.82  0.77  0.81  T-AOC, U/mL  0.23  0.26  0.27  0.28  0.29  0.01  0.45  0.09  0.18  Plasma  MDA, nmol/L  4.45  2.79  1.39  1.83  2.46  0.25  <0.001  0.002  <0.001  SOD, U/mL  102  115  141  144  122  8.98  0.51  0.32  0.26  T-AOC, U/mL  3.47  4.98  5.81  4.82  4.59  0.32  0.29  0.50  0.08  1n = 6 replicates per treatment. SOD, superoxide dismutase; T-AOC, total antioxidant capacity; MDA, malondialdehyde. View Large Gene Expression of Carnosine-Related Enzymes in Breast Muscle Table 8 shows the mRNA expression of CARNS1, CNDP1, CNDP2, SLC6A6, SLC36A1, SLC6A14 in pectoral muscle. Of all the 6 genes, only CNDP1 and SLC6A14 could not be detected in the breast muscle of birds. Dietary β-alanine supplementation quadratically increased the expression CARNS1 in breast muscle at d 42 (P < 0.05). Furthermore, Dietary addition of β-alanine quadratically increased the expression of SLC6A6 (β-alanine transporter) (P < 0.05). There were no distinct differences in the expression of SLC36A1 in response to β-alanine supplementation in the diets (P > 0.05). Table 8. Effect of dietary β-alanine supplementation on expression of carnosine-related enzyme mRNAs in the breast muscle of broiler chicks.1 Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  CARNS1  4.95  6.35  8.47  7.20  6.85  0.34  0.011  0.050  0.004  CNDP2  0.94  0.95  1.02  0.76  0.82  0.04  0.209  0.119  0.232  SLC6A6  5.17  6.90  8.91  7.10  7.28  0.33  0.005  0.060  0.004  SLC36A1  2.54  2.40  2.60  2.79  2.62  0.14  0.94  0.58  0.86  Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  CARNS1  4.95  6.35  8.47  7.20  6.85  0.34  0.011  0.050  0.004  CNDP2  0.94  0.95  1.02  0.76  0.82  0.04  0.209  0.119  0.232  SLC6A6  5.17  6.90  8.91  7.10  7.28  0.33  0.005  0.060  0.004  SLC36A1  2.54  2.40  2.60  2.79  2.62  0.14  0.94  0.58  0.86  1n = 6 replicates per treatment. CARNS1, carnosine synthase; CNDP2, carnosinase-2; SLC6A6, taurine transporter; SLC36A1, proton coupling amino acid transporter. View Large Prediction of Optimal β-alanine Supplementation in Broilers’ Diet Prediction of optimal β-alanine levels from growth, amino acid and dipeptide, carcass yield, MDA content, meat quality and gene expression of carnosine-related enzymes data is presented in Table 9. Results show that broilers had the optimal feed efficiency in starting and entire periods when β-alanine was supplemented at 1,221 mg/kg or 1,100 mg/kg. The highest β-alanine, carnosine content in breast muscle and lowest MDA content in breast muscle and plasma at d 42 would be generated by dietary supplementation of β-alanine at the level of 1,178 to 1,760 mg/kg, and the best meat color and tenderness would be achieved when the diet containing 1,041 to 1,110 β-alanine mg/kg diet. Expression of carnosine-related enzymes including CARNS1 and SLC6A6 in the breast muscle would be highest by dietary supplementation of β-alanine at the level of 1,164 to 1,187 mg/kg. Table 9. Prediction of dietary optimum β-alanine (mg/kg) supplementation based on significantly parameters. Parameter  R2  Equation  Optimal dose1  ADG (d 1–21)  0.464  Y = −2.333 × 2 + 6.521x + 44.21  1.398 g/kg  FCR (d 1–21)  0.704  Y = 0.076 × 2 − 0.187x + 1.413  1.221 g/kg  FCR (d 1–42)  0.586  Y = 0.073 × 2 − 0.1615x + 1.725  1.100 g/kg  β-ALA (breast muscle)  0.951  Y = −27.53 × 2 + 96.9x + 45.76  1.760 g/kg  CARN (breast muscle)  0.641  Y = −695.8 × 2 + 1664x + 2824  1.196 g/kg  MDA (breast muscle)  0.836  Y = 0.709 × 2 − 1.8799x + 2.354  1.325 g/kg  TAU (plasma)  0.638  Y = 52.67 × 2 − 251.92x + 619.2  2.392 g/kg  MDA (plasma)  0.803  Y = 2.104 × 2 − 4.9585x + 4.067  1.178 g/kg  Breast yield  0.720  Y = −1.604 × 2 + 4.3482x + 20.08  1.355 g/kg  SFV (breast muscle)  0.880  Y = 1.263 × 2 − 2.804x + 17.56  1.110 g/kg  a* 45 min (breast muscle)  0.885  Y = −0.416 × 2 + 0.8662x + 2.549  1.041 g/kg  a* 24 h (breast muscle)  0.349  Y = −0.489 × 2 + 1.0248x + 5.105  1.048 g/kg  CARNS1  0.620  Y = −2.0615 × 2 + 4.7977x+5.3560  1.164 g/kg  SLC6A6  0.457  Y = −1.7927 × 2 + 4.2229x+5.8085  1.178 g/kg  Parameter  R2  Equation  Optimal dose1  ADG (d 1–21)  0.464  Y = −2.333 × 2 + 6.521x + 44.21  1.398 g/kg  FCR (d 1–21)  0.704  Y = 0.076 × 2 − 0.187x + 1.413  1.221 g/kg  FCR (d 1–42)  0.586  Y = 0.073 × 2 − 0.1615x + 1.725  1.100 g/kg  β-ALA (breast muscle)  0.951  Y = −27.53 × 2 + 96.9x + 45.76  1.760 g/kg  CARN (breast muscle)  0.641  Y = −695.8 × 2 + 1664x + 2824  1.196 g/kg  MDA (breast muscle)  0.836  Y = 0.709 × 2 − 1.8799x + 2.354  1.325 g/kg  TAU (plasma)  0.638  Y = 52.67 × 2 − 251.92x + 619.2  2.392 g/kg  MDA (plasma)  0.803  Y = 2.104 × 2 − 4.9585x + 4.067  1.178 g/kg  Breast yield  0.720  Y = −1.604 × 2 + 4.3482x + 20.08  1.355 g/kg  SFV (breast muscle)  0.880  Y = 1.263 × 2 − 2.804x + 17.56  1.110 g/kg  a* 45 min (breast muscle)  0.885  Y = −0.416 × 2 + 0.8662x + 2.549  1.041 g/kg  a* 24 h (breast muscle)  0.349  Y = −0.489 × 2 + 1.0248x + 5.105  1.048 g/kg  CARNS1  0.620  Y = −2.0615 × 2 + 4.7977x+5.3560  1.164 g/kg  SLC6A6  0.457  Y = −1.7927 × 2 + 4.2229x+5.8085  1.178 g/kg  1β-alanine levels calculated from the vertex of the corresponding curve. ADG, average daily gain; FCR (feed: gain = g: g), feed conversion ratio; β-ALA, β-alanine; CARN, carnosine; MDA, malondialdehyde; TAU, taurine; SFV, shear force value. CARNS1, carnosine synthase; SLC6A6, taurine transporter. View Large DISCUSSION Growth Performance Dietary supplementation with β-alanine improved the growth performance of broilers throughout the entire experimental period. These results are consistent with a previous study (Tomonaga et al., 2005b). In the current study, chickens fed diets containing 250 to 2,000 mg/kg β-alanine had quadratically enhanced ADG (from 8.89% to 14.77%) and markedly decreased FCR in the starting period. The addition of β-alanine tended to decrease FCR during the overall period. A diet containing 2.5% β-alanine increases the feed efficiency in broilers (Jacob et al., 1991). The dosage of β-alanine in our current study was lower than that of previous studies (Jacob et al., 1991; Tomonaga et al., 2005b). However, some research reported that supplementation with excessive β-alanine inhibited feed intake in broilers (Zhang, 2008). Therefore, the suitable β-alanine level in broiler diets is of great importance for the industry. A prior study showed that dietary β-alanine supplementation increases the feed efficacy by markedly reducing feed consumption (Jacob et al., 1991). In the present study, diets supplemented with β-alanine increased the feed conversion via enhancing ADG, possibly because β-alanine could act as a neurotransmitter (Tiedje et al., 2010) to adjust the secretion of hormones related to growth performance. Another explanation is that oral administration of β-alanine may improve the feed efficiency through alleviating stress (Tomonaga et al., 2004). Different forms of β-alanine administration, i.e., drinking water or feed, may have different effects on growth performance in broilers (Tomonaga et al., 2005b; Tomonaga et al., 2006). Carnosine Content and mRNA Expression of Carnosine Synthesis–Related Enzymes The present study revealed that dietary β-alanine addition quadratically increased β-alanine and carnosine content in breast muscle of broilers. Dietary addition of β-alanine may enhance the carnosine content of the muscle because carnosine is a product of β-alanine and l-histidine synthesized by carnosine synthase (Stenesh and Winnick, 1960). This is similar to the results of previous studies (Dunnett and Harris, 1999; Tomonaga et al., 2012). The dosage of β-alanine was different from that in other studies (Zhang, 2008; Hu, 2009), this awaits further study. It was reported that SLC6A6, SLC36A1, and SLC6A14 could promote the transportation of β-alanine, of these transporters, only SLC6A14 gene expression was not investigated in the skeletal muscle (Drummond et al., 2010; Pierno et al., 2012). In the present study, we have evaluated the expression of carnosine-related transporters. It shows that dietary β-alanine supplementation quadratically upregulated the expression of SLC6A6 gene (Table 8). As we know, SLC6A6 transporter can transport both taurine and β-alanine (Pasantes-Morales et al., 1983). Hu et al. (2000) showed competitive inhibition between taurine and β-alanine for SLC6A6 transporter. Some studies indicated that taurine depletion might induce physiological dysfunction, such as growth retardation (Hu et al., 2000). In our current study, no markedly negative effects were observed in growth parameters, such as FCR. Moreover, taurine is depleted because β-alanine competes with taurine for uptake (Hu et al., 2000). Carcass Characteristics and Meat Quality Dietary addition of 0.5% β-alanine has no effect on breast muscle weight, whereas 1 or 2% β-alanine diets significantly reduced the breast muscle weight because higher concentrations of β-alanine may induce growth retardation or physiological dysfunction (Tomonaga et al. 2006). In the present study, dietary supplementation with β-alanine increased the breast muscle yield during the starting period, which indicated that a lower dosage of β-alanine, to some extent, increased the breast yield. With regard to meat quality, dietary supplementation with β-alanine quadratically increased the a*45 min or a*24 h values in breast muscle at d 42. The shear force decreased in response to dietary β-alanine addition. The reduction of the shear force with dietary β-alanine addition was possibly due to the increase of carnosine content, which may activate muscle calpain II in broilers under certain concentrations of calcium ions (Johnson and Hammer, 1989). Kralik et al. (2014) found that dietary supplementation with 0.5% β-alanine markedly increased the a* value of breast muscle tissue. This result is consistent with our present study, but the dosage of β-alanine was lower in present study. Stress before slaughter may lead to pale, soft, exudative meat (Mckee and Sams, 1997); dietary β-alanine increases a* value and may alleviate stress responses in chickens (Tomonaga et al., 2004). In these studies, meat color was determined by muscle pigment content; β-alanine may influence the pigment content of muscle, which was not detected in the current study. Thus, this hypothesis needs to be clarified. Antioxidant Parameters In the present study, the MDA content in plasma quadratically decreased with dietary β-alanine addition (P < 0.05). Breast muscle of broilers supplemented with 0.5% β-alanine and kept for 60 d at −20°C exhibits lower thiobarbituric acid reactive substances (mg MDA/kg of tissue) value than the group without added β-alanine (Kralik et al., 2014). Belviranli et al. (2015) found that supplemental β-alanine has no effect on oxidative stability of breast muscle. In our current study, dietary addition of β-alanine decreased the MDA of breast muscle; this was possibly due to increasing the concentration of carnosine, which has a strong antioxidant ability (Boldyrev et al., 2004). Hu (2009) found that dietary supplementation with 0.5% carnosine greatly decreased the MDA content (P < 0.05), yet it increased the T-AOC content of breast muscle in broilers at d 42. In addition, Schnuck et al. (2016) found that dietary supplementation with β-alanine in mice improved the oxygen consumption as well as the expression of several cellular proteins associated with improved oxidative metabolism, and indicates that it may provide additional metabolic benefits that promote the muscle antioxidants. Prediction of Dietary Optimum β-alanine Supplementation In current study, dietary β-alanine at level of 500 and 1,000 mg/kg positively affected growth performance, increased β-alanine and carnosine contents in breast, decreased MDA content and impoved meat quality. Quadratic responses of β-alanine were observed on these parameters. Based on the polynomial regression, broilers had the optimal feed efficiency in starting and entire periods when fed diet supplemented with 1,221 or 1,100 mg/kg β-alanine. The highest muscular β-alanine, carnosine contents and lowest MDA contents at d 42 in plasma and breast muscle would be generated at the level of 1,178 to 1,760 mg/kg, and the best meat color and tenderness would be achieved when the diet had β-alanine ranging from 1,041 to 1,110 mg/kg. In addition, mRNA expression of carnosine-related enzymes (CARNS1 and SLC6A6) in the breast muscle would be highest by supplementation of β-alanine at the level of 1,164 to 1,178 mg/kg. Different from early studies that enhancement of muscular carnosine content responded at high dosage of β-alanine (Tomonaga et al., 2012; Kralik et al., 2014), our results demonstrated that lower dosage of β-alanine may effectively increased carnosine content in breast muscle. Furthermore, the low dosage of β-alanine may favorably affect the growth performance and meat quality. Therefore, the optimal β-alanine level added to diet for broilers is recommended to be 1,041 to 1,760 mg/kg based on the current experimental condition. CONCLUSIONS The present study showed that dietary supplementation of β-alanine can improve feed efficiency, muscular carnosine content and meat quality in broiler chicks. The improvement of meat quality may be attributed to the increased concentration of carnosine and up-regulation of mRNA expression of genes encoding carnosine-related enzymes. Quadratic responses were observed on growth performance, carnosine content, meat quality and expression of carnosine-related enzymes. Acknowledgements This study was financed by China Agriculture Research System-Beijing Team for Poultry Industry, and the National Key Technology Research and Development Program (2011BAD26B04, Beijing, China), and the Agricultural Science and Technology Innovation Program (ASTIP). REFERENCES Abe H. 2000. Role of histidine-related compounds as intracellular proton buffering constituents in vertebrate muscle. Biochemistry (Mosc.).  65: 757– 765. Google Scholar PubMed  Aviagen. 2009. Arbor Acres Broiler Management Guide . Aviagen Inc., Huntsville, AL. Boldyrev A., Bulygina E., Leinsoo T., Petrushanko I., Tsubone S., Abe H.. 2004. Protection of neuronal cells against reactive oxygen species by carnosine and related compounds. Comp. Biochem. Physiol. B. Biochem. Mol. Biol.  137: 81– 88. Google Scholar CrossRef Search ADS PubMed  Belviranli M., Okudan N., Revan S., Balci S., Gokbel H.. 2015. Repeated supramaximal exercise-induced oxidative stress: effect of β-alanine plus creatine supplementation. Asian J. Sports Med.  7: e26843. Dunnett M., Harris R. C.. 1999. Influence of oral β-alanine and L-histidine supplementation on the carnosine content of the gluteus medius. Equine Vet. J.  31: 499– 504. Google Scholar CrossRef Search ADS   Drummond M. J., Glynn E. L., Fry C. S., Timmerman K. L., Volpi E., Rasmussen B. B.. 2010. An increase in essential amino acid availability upregulates amino acid transporter expression inhuman skeletal muscle. Am. J. Physiol. Endocrinol. Metab.  298: 1011– 1018. Google Scholar CrossRef Search ADS   Everaert I., Stegen S., Vanheel B., Taes Y., Derave W.. 2013a. Effect of beta-alanine and carnosine supplementation on muscle contractility in mice. Med. Sci. Sport. Exer.  45: 43– 51. Google Scholar CrossRef Search ADS   Everaert I., Naeyer H. D., Taes Y., Derave W.. 2013b. Gene expression of carnosine-related enzymes and transporters in skeletal muscle. Eur. J. Appl. Physiol.  113: 1169– 1179. Google Scholar CrossRef Search ADS   Froning G. W., Uijttenboogaart T. G.. 1988. Effect of postmortem electrical stimulation on color, texture, pH, and cooking losses of hot and cold deboned chicken broiler carcasses. Poult. Sci.  67: 1536– 1544. Google Scholar CrossRef Search ADS   Hu J. M., Rho J. Y., Suzuki M., Nishihara M., Takahashi M.. 2000. Effect of taurine in rat milk on the growth of offspring. J. Vet. Med. Sci.  62: 693– 698. Google Scholar CrossRef Search ADS PubMed  Hu X. X. 2009. Nutritional regulation of dietary carnosine, β-alanine and astragalus polysaccharide on meat quality in broilers . Ph.D. Thesis, China Agricultural University. Beijing, China. (in Chinese). Jacob J. P., Blair R., Hart L. E., Gardiner E. E.. 1991. The effect of taurine transport antagonists on cardiac taurine concentration and the incidence of sudden death syndrome in male broiler chickens. Poult. Sci.  70: 561– 567. Google Scholar CrossRef Search ADS PubMed  Johnson P., Hammer J. L.. 1989. Effects of L-1-methyl-histidine and the muscle dipeptides carnosine and anserine on the activities of muscle calpains. Comp. Biochem. Physiol. B. Biochem. Mol. Biol.  94: 45– 48. Google Scholar CrossRef Search ADS   Kohen R., Yamamoto Y., Cundy K. C., Ames B. N.. 1988. Antioxidant activity of carnosine, homocarnosine, and anserine present in muscle and brain. Proc. Natl. Acad. Sci. U.S.A.  85: 3175– 3179. Google Scholar CrossRef Search ADS PubMed  Kralik G., Sak-Bosnar M., Kralik Z., Galović O.. 2014. Effects of β-alanine dietary supplementation on concentration of carnosine and quality of broiler muscle tissue. J. Poult. Sci.  51: 151– 156. Matthews M. M., Traut T. W.. 1987. Regulation of N-carbamoyl-beta-alanine amid hydrolase, the terminal enzyme in pyrimidine catabolism, by ligand-induced change in polymerization. J. Biol. Chem.  262: 7232– 7237. Google Scholar PubMed  Mannion A. F., Jakeman P. M., Dunnett M., Harris R. C., Willan P. L., 1992. Carnosine and anserine concentrations in the quadriceps femoris muscle of healthy humans. Eur. J. Appl. Physiol. Occup. Physiol.  64: 47– 50. Google Scholar CrossRef Search ADS PubMed  McKee S. R., Sams A. R.. 1997. The effect of seasonal heat stress on rigor development and the incidence of pale, exudative turkey meat. Poult. Sci.  76: 1616– 1620. Google Scholar CrossRef Search ADS PubMed  Nagai H., Harada M., Nakagawa M., Tanaka T., Gunadi B., Setiabudi M. L., Jocab L. A., Miyata Y.. 1996. Effects of chicken extract on the recovery from fatigue caused by mental workload. Appl. Human Sci.  15: 281– 286. Google Scholar CrossRef Search ADS PubMed  Pasantes-Morales H., Quesada O., Cárabez A., Huxtable R. J.. 1983. Effect of taurine transport antagonist, guanidinoethane sulfonate and β-alanine on the morphology of rat retina. J. Neurosci. Res.  9: 135– 143. Google Scholar CrossRef Search ADS PubMed  Pierno S., Liantonio A., Cannone G. M., Bellis M. D., Cannone M., Gramegna G., Scaramuzzi A., Simonetti S., Nicchia G. P., Basco D., Svelto M., Jean-Francois D.. 2012. Potential benefits of taurine in the prevention of skeletal muscle impairment induced by disuse in the hindlimb-unloaded rat. Amino Acids . 43: 431– 445. Google Scholar CrossRef Search ADS PubMed  Schnuck J. K., Sunderland K. L., Kuennen M. R., Vaughan R. A.. 2016. Characterization of the metabolic effect of β-alanine on markers of oxidative metabolism and mitochondrial biogenesis in skeletal muscle. J. Exerc. Nutr. Biochem.  20: 34– 41. Google Scholar CrossRef Search ADS   Stenesh J. J., Winnick T.. 1960. Carnosine-anserine synthetase of muscle. 4. Partial purification of the enzyme and further studies of β-alanyl peptide synthesis. Biochem. J.  77: 575– 581. Google Scholar CrossRef Search ADS PubMed  Tiedje K. E., Stevens K., Barnes S., Weaver D. F.. 2010. β-alanine as a small molecule neurotransmitter. Neurochem. Int.  57: 177– 188. Google Scholar CrossRef Search ADS PubMed  Tomonaga S., Tachibana T., Takagi T., Saito E. S., Zhang R., Denbow M., Furuse M.. 2004. Effect of central administration of carnosine and its constituents on behaviors in chicks. Brain Res. Bull.  63: 75– 82. Google Scholar CrossRef Search ADS PubMed  Tomonaga S., Tachibana T., Takahashi H., Sato M., Denbow D. M., Furuse M.. 2005a. Nitric oxide involves in carnosine-induced hyperactivity in chicks. Eur. J. Pharmacol.  524: 84– 88. Google Scholar CrossRef Search ADS   Tomonaga S., Kaji Y., Tachibana T., Denbow D. M., Furuse M.. 2005b. Oral administration of β-alanine modifies carnosine concentrations in the muscles and brains of chickens. J. Anim. Sci.  76: 249– 254. Google Scholar CrossRef Search ADS   Tomonaga S., Kaneko K., Kaji Y., Kido Y., Denbow D. M., Furuse M.. 2006. Dietary β-alanine enhances brain, but not muscle, carnosine and anserine concentrations in broilers. J. Anim. Sci.  77: 79– 86. Google Scholar CrossRef Search ADS   Tomonaga S., Matsumoto M., Furuse M.. 2012. β-alanine enhances brain and muscle carnosine levels in broiler chicks. J. Poult. Sci.  49: 308– 312. Google Scholar CrossRef Search ADS   Wang J., Zhang H. J., Samuel K. G., Long C., Wu S. G., Yue H. Y., Sun L. L., Qi G. H.. ( 2015). Effects of dietary pyrroloquinoline quinone disodium on growth, carcass characteristics, redox status, and mitochondria metabolism in broilers. Poult. Sci.  94: 215– 225. Google Scholar CrossRef Search ADS PubMed  Won P. S., Ho K. C., Namgung N., Yun J. B., Kee P. I., Kil D.. 2013. Effects of dietary supplementation of histidine, β-Alanine, magnesium oxide, ad blood meal on carnosine and anserine concentrations of broiler breast meat. J. Poult. Sci.  50: 251– 256. Google Scholar CrossRef Search ADS   Xu L., Zhang L., Yue H. Y., Wu S. G., Zhang H. J., Ji F., Qi G. H.. 2011. Effect of electrical stunning current and frequency on meat quality, plasma parameters, and glycolytic potential in broilers. Poult. Sci.  90: 1823– 1830. Google Scholar CrossRef Search ADS PubMed  Zhang G. Q. 2008. Nutritional regulation of dietary inosinic acid, β-alanine and histidine on meat quality in broilers . Ph.D. Thesis, China Agricultural University. Beijing, China. (in Chinese). Zhang L., Yue H. Y., Zhang H. J., Xu L., Wu S. G., Yan H. J., Gong Y. S., Qi G. H.. 2009. Transport stress in broilers: I. Blood metabolism, glycolytic potential, and meat quality. Poult. Sci.  88: 2033– 2041. Google Scholar CrossRef Search ADS PubMed  © 2018 Poultry Science Association Inc. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Effect of dietary β-alanine supplementation on growth performance, meat quality, carnosine content, and gene expression of carnosine-related enzymes in broilers

Loading next page...
 
/lp/ou_press/effect-of-dietary-alanine-supplementation-on-growth-performance-meat-YbcPq03huj
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pex410
Publisher site
See Article on Publisher Site

Abstract

Abstract The objective of the current study was to investigate the effect of dietary β-alanine supplementation on growth performance, meat quality, antioxidant ability, carnosine content, and gene expression of carnosine-related enzymes in broiler chicks. We randomly assigned 540 1-day-old Arbor Acres broilers to 5 dietary treatments supplemented with 0 (control group), 250, 500, 1,000, or 2,000 mg/kg of β-alanine (mg β-alanine per kg feed). Each treatment included 6 replicates of 18 birds. The feeding trial lasted for 42 d. Dietary β-alanine supplementation linearly and quadratically increased the average daily gain (ADG) during the starting period (d 1 to 21, P = 0.02 and P = 0.002). The feed conversion ratio (FCR) decreased quadratically in response to dietary β-alanine supplementation during the starting and entire periods (P < 0.001 and P = 0.003, respectively). For the entire period, the predicted best FCR would be achieved when β-alanine was fed at a level of 1,100 mg/kg from quadratic regression. The concentrations of carnosine and β-alanine in breast muscle increased quadratically with dietary β-alanine supplementation (d 42, P < 0.001 and P = 0.001, respectively). The predicted dietary β-alanine level for highest breast carnosine content was 1,196 mg/kg. Dietary supplementation with β-alanine reduced the taurine concentrations in plasma (d 42, linear and quadratic, P < 0.001). Breast muscle yield increased linearly and quadratically in response to dietary β-alanine addition (d 21, P = 0.017 and P = 0.007). Dietary supplementation with β-alanine quadratically reduced the shear force (P = 0.003), whereas a*45 min and a*24 h values increased quadratically in response to dietary β-alanine supplementation (d 42, P = 0.020 and P = 0.021, respectively). Dietary β-alanine addition quadratically enhanced the expression of carnosine synthase and taurine transporter mRNAs (P < 0.05). Overall, dietary β-alanine supplementation improved growth performance and carnosine content, ameliorated antioxidant capacity and meat quality, and upregulated the gene expression of carnosine synthesis–related enzymes in broiler chicks. INTRODUCTION Chicken meat is considered a desirable food by consumers because of its high protein, low fat and cholesterol, and abundance of functional peptides (Abe, 2000). Functional carnosine, which is abundant in skeletal muscle (Mannion et al., 1992), plays an important role in poultry tissues. Carnosine (β-alanyl-l-histidine) and its derivative anserine (β-alanyl-l-methyl-l-histidine) are well known for their antioxidants (Kohen et al., 1988), anti-fatigue (Nagai et al., 1996), and putative neurotransmitter properties (Tomonaga et al., 2005a). Carnosine is synthesized from 2 amino acids, β-alanine and l-histidine, by means of carnosine synthase. β-alanine, a non-essential amino acid, is the only β-amino acid that exists naturally. Moreover, it is the limiting amino acid for muscle carnosine synthesis (Everaert et al., 2013a). β-alanine can be synthesized in the liver (Matthews and Traut, 1987) or directly obtained from the diet (particularly white and red meat). Influences of dietary β-alanine addition have been studied in broilers (Tomonaga et al. 2005b; Won et al. 2013). Dietary supplementation of β-alanine enhances growth performance in broilers (Tomonaga et al., 2005b). Oral administration of 22 mmol/kg β-alanine to 2-day-old chicks for 5 d increases the carnosine concentration in the muscles of broilers (Tomonaga et al., 2012). Dietary supplementation of 1% β-alanine increased the carnosine levels in breast muscle of broilers from 756.15 μg/g to 911.01 μg/g (Kralik et al., 2014). Dietary β-alanine addition increased the redness value (Kralik et al., 2014) and lightness value and decreased the shear force (Zhang, 2008), while improving the meat quality. Dietary β-alanine supplementation increased the total antioxidant capacity during the post-supplementation session (Belviranli et al., 2015) and tended to decrease the malondialdehyde (MDA) content and improves the ability of antioxidant in breast muscle (Hu, 2009). Dietary supplementation with 1.8% β-alanine stimulated the gene expression of both taurine transporter (SLC6A6) and carnosine synthase (CARNS1) in mice (Everaert et al., 2013b). However, examination of dietary β-alanine levels and the mechanism of carnosine-synthesis gene expression has not yet been studied in broilers. Therefore, the aim of this study was to determine the optimal dosage of β-alanine on growth performance, meat quality, carnosine content, and gene expression of carnosine synthesis–related enzymes and transporters in broiler chicks. MATERIALS AND METHODS Diets and Design of Experiment The experimental procedures were approved by the Animal Care and Use Committee of the Feed Research Institute of the Chinese Academy of Agricultural Sciences. A total of 540 1-day-old male Arbor Acres broilers were randomly assigned into 5 dietary treatments supplemented with 0 (control group), 250, 500, 1,000, or 2,000 mg β-alanine per kg feed. Each treatment group included 6 replicates (cages) of 18 birds. The chicken house was kept 24-h constant-light each program and temperature was set to 33°C for the first 3 d, and then dropped by 2°C each successive wk until it reached 24°C. The composition and nutrient level of the basal diet is shown in Table 1. Birds were provided feed and water ad libitum during the feeding trial. All chickens were raised in line with the regulations of the Arbor Acres Broiler Commercial Management Guide (Aviagen, 2009). Table 1. Composition and nutrient levels of the basal diet (air-dry basis, %). Item  Starting (d 1–21)  Growing (d 21–42)  Ingredients, %      Corn  56.37  63.08  Soybean meal (43%)  36.56  29.24  Vegetable oil  3.00  3.50  Dicalcium phosphate  1.24  1.61  Limestone  1.61  1.18  Salt  0.35  0.35  dl-Methionine (98%)  0.27  0.3  l-Lysine-HCl (78%)  0.19  0.27  l-Threonine (98%)  0.09  0.15  Vitamin premix1  0.02  0.02  Mineral premix2  0.20  0.20  Choline chloride (50%)  0.10  0.10  Total  100  100  Calculated nutrient levels      AME, MJ/kg  12.55  12.97  Crude protein, %  21.00  19.00  Calcium, %  1.00  0.90  Total phosphorus, %  0.70  0.65  Available phosphorus, %  0.45  0.40  Lysine, %  1.15  1.05  Methionine, %  0.55  0.48  Methionine+cysteine, %  0.92  0.84  Threonine, %  0.82  0.69  Tryptophan, %  0.24  0.22  Value of β-alanine (mg/kg)  Theoretical value  Analytical value    0  <0.01    250  243    500  471    1,000  987    2,000  1934  Item  Starting (d 1–21)  Growing (d 21–42)  Ingredients, %      Corn  56.37  63.08  Soybean meal (43%)  36.56  29.24  Vegetable oil  3.00  3.50  Dicalcium phosphate  1.24  1.61  Limestone  1.61  1.18  Salt  0.35  0.35  dl-Methionine (98%)  0.27  0.3  l-Lysine-HCl (78%)  0.19  0.27  l-Threonine (98%)  0.09  0.15  Vitamin premix1  0.02  0.02  Mineral premix2  0.20  0.20  Choline chloride (50%)  0.10  0.10  Total  100  100  Calculated nutrient levels      AME, MJ/kg  12.55  12.97  Crude protein, %  21.00  19.00  Calcium, %  1.00  0.90  Total phosphorus, %  0.70  0.65  Available phosphorus, %  0.45  0.40  Lysine, %  1.15  1.05  Methionine, %  0.55  0.48  Methionine+cysteine, %  0.92  0.84  Threonine, %  0.82  0.69  Tryptophan, %  0.24  0.22  Value of β-alanine (mg/kg)  Theoretical value  Analytical value    0  <0.01    250  243    500  471    1,000  987    2,000  1934  1The vitamin premix supplied the following per kg of complete feed: vitamin A, 12,500 IU; vitamin D3, 2,500 IU; vitamin K3, 2.65 mg; vitamin B1, 2 mg; vitamin B2, 6 mg; vitamin B12, 0.025 mg; vitamin E, 30 IU; biotin, 0.0325 mg; folic acid, 1.25 mg; pantothenic acid, 12 mg; niacin, 50 mg. 2The mineral premix supplied the following per kg of complete feed: Cu, 8 mg; Zn, 75 mg; Fe, 80 mg; Mn, 100 mg; Se, 0.15 mg; I, 0.35 mg. View Large Growth Performance All cages were checked for sick and dead birds on a daily basis. Identification number, cage, age, and condition were recorded on a cage record sheet. General health status, weight, mortality, cause of death, and filling grade as well as morphologic alterations/symptoms of the dead birds were also recorded. Birds were weighed using a cage as a unit. Feed intake was recorded on a cage basis. Subsequently, average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR; feed: gain, g: g) were calculated. Feed conversion was calculated and corrected for mortality. Slaughtering and Sampling One bird around the average weight was selected from each replicate group for blood sampling and carcass measurements after starving for 10 h at the age of 21 and 42 d, respectively. Blood samples were obtained from the left jugular vein immediately after the birds were sacrificed, and then were centrifuged at 1,800 × g for 15 min at 4°C after storage for a while at room temperature. The plasma samples were kept at –20°C until analysis. After blood sampling, birds were hanged for few minutes to death and then eviscerated to measure carcass weight (without head, paws, or giblets) as a yield of total weight. The abdominal fat and the breast and thigh muscles were collected and weighed. The abdominal fat was referred to the adipose tissue from the proventriculus surrounding the gizzard down to the cloaca. The right side of breast muscle was then taken to determine meat color and muscle pH. At the same time, approximately 30.0 g of left breast muscle was taken to measure dripping loss, cooking loss, and shear value. All samples were stored at 4°C until analysis. Assay of Peptide and Free Amino Acids in Tissues and Plasma The contents of carnosine, anserine, taurine, and β-alanine were determined by an A300 automatic amino acid analyzer (Membra Pure, Bodenheim, Germany). Samples were combined with 200 μL sulfosalicylic acid (10%) to precipitate proteins kept at 4°C for 1 h, and then centrifuged at 14,500 × g for 15 min. After appropriate dilution, the supernatant was filtered through a 0.45-μm pore size filter membrane (Millipore Co., Bedford, MA) and then directly injected into the analyzer for free amino acid determination. The trimethylbenzene substrate was ninhydrin, which had a 0.09 mL/min flow rate, and the injection volume was fixed at 20 μL. Detection was performed by UV absorbance at wavelengths of 570/440 nm. Meat Quality Assay Muscle pH was determined using an electronic pH meter (CyberScan pH 310, Eutech Instruments Pte. Ltd., Singapore) at 45 min (pH45 min) and 24 h (pH24 h) postmortem. Each sample was measured 3 times, and the average value was taken as the final result. The value of pH decline within 24 h postmortem (ΔpH) was calculated as ΔpH = pH24 h − pH45 min. At 24 h after slaughter, meat color was measured in duplicate using a Chroma Meter (Chroma Meter WSC-S, Shanghai Precision and Scientific Instrument Co., Shanghai, China). Color was reported in the CIELab trichromatic system as lightness (L*), redness (a*), and yellowness (b*) values. Drip loss was measured as described by Zhang et al. (2009). Briefly, approximately 30 g (wet weight, W1) of regular-shaped muscle from the right pectoralis major muscle was placed in a zip-sealed plastic bag, and then the bag was filled with nitrogen to avoid oxidation, evaporation, and mutual extrusion. All bags were stored at 4°C for 24 h, and then surface moisture of the fillets was absorbed with filter paper and the muscle samples were reweighed (W2). Drip loss was calculated as (%) = (W1− W2)/W1 × 100%. After assessing drip loss, the meat samples were placed in new zip-sealed polyethylene bags and stored at 4°C until 72 h postmortem. At 72 h postmortem, the muscles were dried and weighed (W1), and then heated in a water bath at 85°C for 20 min (end-point temperature of 80°C), cooled in running water to ambient temperature, and then dried and reweighed (W2). Cooking loss was evaluated as (%) = (W1 − W2)/W1 × 100% (Xu et al., 2011). At 96 h postmortem, about 30 g (wet weight) of muscle was heated for 20 min in zip-sealed plastic bags in a water bath at 85°C. After cooling to ambient temperature, shear force value was measured in triplicate as described by Froning and Uijttenboogaart (1988). Assay of Plasma and Tissue Indices Plasma total superoxide dismutase (T-SOD) activity, total antioxidant capacity (T-AOC), and MDA content were analyzed using commercially available kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), and all parameters were evaluated according to the instructions (Wang et al., 2015). Total RNA Extraction and cDNA Synthesis Tissue dissected from the breast muscle was homogenized in Trizol Reagent (Invitrogen, Carlsbad, CA), and total RNA was extracted according to the manufacturer's instructions. The RNA samples were purified using the SV Total RNA Isolation System (Promega Corporation, Madison, WI) and quantified using a NanoDrop ND 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). Total RNA (1 mg) from each sample was used for first-strand cDNA synthesis with the TIANGEN Quantscript RT kit following the manufacturer's instructions (TIANGEN Biotech Co. Ltd, Beijing, China). Procedures for RNA preparation conformed to the Minimum Information for Publication of Quantitative Real-Time PCR Experiments guidelines. Real-Time Quantitative Polymerase Chain Reaction The gene expression of carnosine synthase (CARNS1), carnosinase (CNDP1, CNDP2), and β-alanine transporters (SLC6A6, SLC36A1, SLC6A14) were performed with a real-time polymerase chain reaction (PCR) kit following the manufacturer's protocol (Real MasterMix-SYBR Green; TIANGEN). Reactions of real-time quantitative PCR were carried out with an iCycler iQ5 multicolor real-time PCR detection system (Bio-Rad, Hercules, CA), and the protocol used was as follows: 95°C for 5 min; 40 cycles of 95°C for 10 s, 60°C for 30 s, 72°C for 30 s; and final extension at 72°C for 5 min. The melting curve was recorded at 60°C. The primers used are listed in Table 2. The amplification efficiency of each gene was validated by constructing a standard curve through 4 serial dilutions of cDNA. For analyses, relative quantification was applied with β-actin used as the housekeeping gene. A bird sample from non-β-alanine conditions was used as the calibrator sample. All experiments were done in triplicate. The relative mRNA expression levels of carnosine synthase (CARNS1), carnosinase (CNDP1, CNDP2), β-alanine transporters (SLC6A6, SLC36A1, SLC6A14) were calculated using the “normalized relative quantification” method followed by Primers for Real-Time PCR analysis. Table 2. Primers used in qPCR analysis in chicken. Gene  Forward primer (5΄-3΄)  Reserve primer (3΄-5΄)  Tm (°C)  Gene ID  CARNS1  CTGCCCTGGAAGAATTTGTG  GACAGCAACCAGCGAGAGAG  62  100,359,387  CNDP1  ATTCTCCATTCGCCAAGTTC  GCATCTGCATCACCAATAGG  59  421,012  CNDP2  AAACCTTGGGTGTCAGAC-TT  ACATTCTTGCCTGTTGCTTC  58  421,013  SLC6A6  GGGAAATCTTCATCGCTAT  CCATAAACCCAGGCTACAG  56  416,041  SLC36A1  CACGGCAGTTCCCTCTGAT  AGCAGTTGGGCAGGTTGAG  60  770,250  SLC6A14  AAACACGCCTCGTAAATGA  CACGATGTTGCCAGTCTCA  56  100,857,521  β-actin  ATCCGGACCCTCCATTGTC  AGCCATGCCAATCTCGTCTT  60  396,526  Gene  Forward primer (5΄-3΄)  Reserve primer (3΄-5΄)  Tm (°C)  Gene ID  CARNS1  CTGCCCTGGAAGAATTTGTG  GACAGCAACCAGCGAGAGAG  62  100,359,387  CNDP1  ATTCTCCATTCGCCAAGTTC  GCATCTGCATCACCAATAGG  59  421,012  CNDP2  AAACCTTGGGTGTCAGAC-TT  ACATTCTTGCCTGTTGCTTC  58  421,013  SLC6A6  GGGAAATCTTCATCGCTAT  CCATAAACCCAGGCTACAG  56  416,041  SLC36A1  CACGGCAGTTCCCTCTGAT  AGCAGTTGGGCAGGTTGAG  60  770,250  SLC6A14  AAACACGCCTCGTAAATGA  CACGATGTTGCCAGTCTCA  56  100,857,521  β-actin  ATCCGGACCCTCCATTGTC  AGCCATGCCAATCTCGTCTT  60  396,526  CARNS1, carnosine synthase; CNDP1, carnosinase-1; CNDP2, carnosinase-2; SLC6A6, taurine transporter; SLC36A1, Proton coupling amino acid transporter; SLC6A14, solute carrier family 6 member 14. View Large Statistical Analysis All data were analyzed by one-way analysis of variance (ANOVA) procedure of the SPSS 16.0 software package for Windows (SPSS, Chicago, IL). The model included the treatment effect, and the cage represented the experimental unit for growth performance, whereas the individual bird was the experimental unit for others parameters. Orthogonal polynomial contrasts were employed to test the linear and quadratic effects of dietary β-alanine supplementation. Regression analysis was used to estimate β-alanine optimization whenever a significant quadratic response (P ≤ 0.05) was observed. The treatment effects were considered significant at P ≤ 0.05, whereas a trend for a treatment effect was noted for P ≤ 0.10. RESULTS Growth Performance Effect of dietary β-alanine addition on growth performance is listed in Table 3. During the starting period (d 1 to 21), dietary β-alanine supplementation linearly and quadratically increased ADG (P = 0.012 and P = 0.002, respectively) and decreased FCR (P = 0.010 and P < 0.001, respectively). During the entire periods of the trial (d 1 to 42), dietary β-alanine quadratically reduced the FCR (P = 0.013) and tended to quadratically increase the ADG (P = 0.094). However, no significant difference was observed in ADFI in response to β-alanine supplementation in the diets (P > 0.05). Table 3. Effect of dietary β-alanine supplementation on growth performance in broiler chicks.1 Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  d 1–21   ADG, g/d  42.5  47.2  48.8  46.3  48.3  0.47  <0.001  0.012  0.002   ADFI, g/d  61.0  63.5  64.5  61.6  64.7  0.61  0.11  0.28  0.47   FCR (feed: gain g:g)  1.44  1.34  1.32  1.33  1.34  0.011  0.001  0.010  <0.001   BW d 21  936  1040  1054  1047  1014  10.9  0.016  0.25  0.33  d 21–42   ADG, g/d  76.6  75.7  80.3  75.5  76.8  0.58  0.15  0.86  0.79   ADFI, g/d  154  148  149  148  149.  3.84  0.41  0.37  0.42   FCR (feed: gain g:g)  2.01  1.96  1.87  1.96  1.95  0.017  0.064  0.43  0.12   BW d 42  2551  2709  2772  2630  2723  24.1  0.77  0.36  0.45  d 1–42   ADG, g/d  59.9  61.4  64.9  60.3  61.5  0.66  0.036  0.92  0.094   ADFI, g/d  105  102  107  101  104.  0.67  0.20  0.37  0.60   FCR (feed: gain g:g)  1.75  1.67  1.63  1.67  1.69  0.014  0.049  0.63  0.013  Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  d 1–21   ADG, g/d  42.5  47.2  48.8  46.3  48.3  0.47  <0.001  0.012  0.002   ADFI, g/d  61.0  63.5  64.5  61.6  64.7  0.61  0.11  0.28  0.47   FCR (feed: gain g:g)  1.44  1.34  1.32  1.33  1.34  0.011  0.001  0.010  <0.001   BW d 21  936  1040  1054  1047  1014  10.9  0.016  0.25  0.33  d 21–42   ADG, g/d  76.6  75.7  80.3  75.5  76.8  0.58  0.15  0.86  0.79   ADFI, g/d  154  148  149  148  149.  3.84  0.41  0.37  0.42   FCR (feed: gain g:g)  2.01  1.96  1.87  1.96  1.95  0.017  0.064  0.43  0.12   BW d 42  2551  2709  2772  2630  2723  24.1  0.77  0.36  0.45  d 1–42   ADG, g/d  59.9  61.4  64.9  60.3  61.5  0.66  0.036  0.92  0.094   ADFI, g/d  105  102  107  101  104.  0.67  0.20  0.37  0.60   FCR (feed: gain g:g)  1.75  1.67  1.63  1.67  1.69  0.014  0.049  0.63  0.013  1n = 6 replicates per treatment. ADG, average daily gain; ADFI, average daily feed intake; FCR (feed: gain = g: g), feed conversion ratio; BW, body weight. View Large Amino Acids and Dipeptide Levels in Breast Muscle and Plasma Table 4 shows the effect of dietary β-alanine addition on taurine, carnosine, anserine, and β-alanine levels in breast muscle and plasma of broilers at d 42. Beta-alanine-supplemented groups decreased taurine levels in plasma (linear and quadratic, P < 0.05). However, there were no differences in plasma levels of β-alanine, carnosine, or anserine content among all treatments (P > 0.05). Dietary β-alanine supplementation quadratically increased the concentrations of β-alanine and carnosine (P < 0.001 and P = 0.001, respectively), and tended to linearly and quadratically decrease taurine content in the breast muscle of broilers at d 42 (P = 0.085 and P = 0.077, respectively). Table 4. Effect of dietary β-alanine supplementation on amino acid and dipeptide levels in broiler chicks at d 42.1 Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  Breast, μg/g                     TAU  190  145  147  156  142  6.27  0.079  0.085  0.077   β-ALA  40.3  70.3  98.3  106  131  6.04  <0.001  <0.001  <0.001   CARN  2693  3155  3903  3494  3417  13  0.003  0.041  0.001   ANSER  8193  8290  8898  8357  7918  31  0.83  0.33  0.26  Plasma, μmol/L   TAU  703  480  422  518  308  4.07  0.001  0.002  0.005   β-ALA  21.7  23.7  25.0  26.5  32.5  2.16  0.61  0.12  0.28   CARN  35.0  36.7  63.3  48.3  31.7  4.24  0.10  0.98  0.062   ANSER  31.7  33.3  46.0  39.2  31.7  4.03  0.73  0.92  0.48  Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  Breast, μg/g                     TAU  190  145  147  156  142  6.27  0.079  0.085  0.077   β-ALA  40.3  70.3  98.3  106  131  6.04  <0.001  <0.001  <0.001   CARN  2693  3155  3903  3494  3417  13  0.003  0.041  0.001   ANSER  8193  8290  8898  8357  7918  31  0.83  0.33  0.26  Plasma, μmol/L   TAU  703  480  422  518  308  4.07  0.001  0.002  0.005   β-ALA  21.7  23.7  25.0  26.5  32.5  2.16  0.61  0.12  0.28   CARN  35.0  36.7  63.3  48.3  31.7  4.24  0.10  0.98  0.062   ANSER  31.7  33.3  46.0  39.2  31.7  4.03  0.73  0.92  0.48  1n = 6 replicates per treatment. TAU, taurine; β-ALA, β-alanine; CARN, carnosine; ANSER, anserine. View Large Slaughtering Performance and Meat Quality Effect of dietary β-alanine addition on carcass performance at d 21 and 42 is listed in Table 5. The broiler breast muscle yield quadratically increased in response to dietary β-alanine supplementation at the age of d 21 (P < 0.05). No notable differences in dressing yield or abdominal fat yield were found among all dietary treatments (P > 0.05). Table 5. Effect of dietary β-alanine supplementation on carcass yield of broiler chicks.1 Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  d 21   Dressing yield, %  63.3  63.4  63.4  63.6  63.3  0.20  0.99  0.84  0.90   Breast muscle yield, %  19.4  21.8  22.4  22.1  22.5  0.35  0.023  0.017  0.007   Leg muscle yield, %  19.4  19.9  19.6  19.9  20.1  0.33  0.97  0.58  0.86   Abdominal fat yield, %  1.57  1.56  1.56  1.46  1.65  0.06  0.90  0.94  0.86  d 42   Dressing yield, %  70.1  70.6  72.6  71.6  70.9  0.31  0.10  0.39  0.053   Breast muscle yield, %  31.6  32.1  33.3  30.4  31.9  0.45  0.38  0.55  0.70   Leg muscle yield, %  22.9  22.7  24.1  22.7  23.7  0.19  0.071  0.47  0.71   Abdominal fat yield, %  2.33  1.94  2.08  1.89  1.90  0.07  0.23  0.10  0.14  Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  d 21   Dressing yield, %  63.3  63.4  63.4  63.6  63.3  0.20  0.99  0.84  0.90   Breast muscle yield, %  19.4  21.8  22.4  22.1  22.5  0.35  0.023  0.017  0.007   Leg muscle yield, %  19.4  19.9  19.6  19.9  20.1  0.33  0.97  0.58  0.86   Abdominal fat yield, %  1.57  1.56  1.56  1.46  1.65  0.06  0.90  0.94  0.86  d 42   Dressing yield, %  70.1  70.6  72.6  71.6  70.9  0.31  0.10  0.39  0.053   Breast muscle yield, %  31.6  32.1  33.3  30.4  31.9  0.45  0.38  0.55  0.70   Leg muscle yield, %  22.9  22.7  24.1  22.7  23.7  0.19  0.071  0.47  0.71   Abdominal fat yield, %  2.33  1.94  2.08  1.89  1.90  0.07  0.23  0.10  0.14  1n = 6 replicates per treatment. View Large Dietary β-alanine supplementation quadratically reduced the shear force at the age of d 42 (P = 0.033, Table 6). There were no significant changes in L* value, b* value, or pH value of breast muscle at either 45 min or 24 h postmortem, and ΔpH was not significantly different in response to dietary β-alanine supplementation (P > 0.05). Dietary β-alanine addition quadratically increased a* value of breast muscle at both 45 min (P = 0.020) and 24 h (P = 0.021) postmortem. Table 6. Effect of dietary β-alanine supplementation on meat quality of broiler chicks at d 42.1 Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  Shear force, N  17.7  16.6  16.7  16.0  17.0  0.17  0.033  0.43  0.003  Dripping loss, %  3.03  3.01  2.99  2.81  3.29  0.06  0.31  0.62  0.094  Cooking loss, %  12.8  13.5  12.9  13.0  12.1  0.43  0.92  0.51  0.69  pH45 min  6.21  6.26  6.32  6.39  6.27  0.02  0.078  0.10  0.033  pH24 h  5.65  5.64  5.68  5.66  5.69  0.02  0.98  0.67  0.91  ΔpH  0.55  0.61  0.64  0.72  0.59  0.03  0.38  0.37  0.23  L*45 min  45.0  44.0  45.5  45.3  46.1  0.42  0.60  0.23  0.46  a*45 min  2.50  2.76  2.97  2.92  2.63  0.15  <0.001  0.077  0.020  b*45 min  9.17  9.41  8.50  9.42  9.43  0.22  0.67  0.65  0.66  L*24 h  58.1  57.1  57.3  58.0  58.2  0.36  0.82  0.58  0.55  a*24 h  4.98  5.25  5.97  5.32  5.25  0.08  0.022  0.63  0.021  b*24 h  15.2  15.6  15.5  16.5  16.0  0.29  0.85  0.40  0.70  Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  Shear force, N  17.7  16.6  16.7  16.0  17.0  0.17  0.033  0.43  0.003  Dripping loss, %  3.03  3.01  2.99  2.81  3.29  0.06  0.31  0.62  0.094  Cooking loss, %  12.8  13.5  12.9  13.0  12.1  0.43  0.92  0.51  0.69  pH45 min  6.21  6.26  6.32  6.39  6.27  0.02  0.078  0.10  0.033  pH24 h  5.65  5.64  5.68  5.66  5.69  0.02  0.98  0.67  0.91  ΔpH  0.55  0.61  0.64  0.72  0.59  0.03  0.38  0.37  0.23  L*45 min  45.0  44.0  45.5  45.3  46.1  0.42  0.60  0.23  0.46  a*45 min  2.50  2.76  2.97  2.92  2.63  0.15  <0.001  0.077  0.020  b*45 min  9.17  9.41  8.50  9.42  9.43  0.22  0.67  0.65  0.66  L*24 h  58.1  57.1  57.3  58.0  58.2  0.36  0.82  0.58  0.55  a*24 h  4.98  5.25  5.97  5.32  5.25  0.08  0.022  0.63  0.021  b*24 h  15.2  15.6  15.5  16.5  16.0  0.29  0.85  0.40  0.70  1n = 6 replicates per treatment. L* = lightness; a* = redness; b* = yellowness; ΔpH = pH45 min−pH24 h. View Large Antioxidant Index Dietary addition of β-alanine quadratically decreased the levels of MDA in the breast muscle and plasma of broilers at d 42 (P < 0.002 and P < 0.001, respectively, Table 7). There were no distinct differences in the T-AOC or SOD content in either plasma or breast muscle of birds in all dietary treatments at d 42 (P > 0.05). However, dietary β-alanine tended to quadratically increase T-AOC level in plasma at d 42 (P = 0.080). Table 7. Effect of dietary β-alanine supplementation on antioxidant indices in breast muscle and plasma of broiler chicks at d 42.1 Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  Breast  MDA, nmol/L  2.55  1.74  1.40  1.41  1.39  0.13  0.012  0.006  0.002  SOD, U/mL  48.7  47.4  48.8  50.0  46.1  1.02  0.82  0.77  0.81  T-AOC, U/mL  0.23  0.26  0.27  0.28  0.29  0.01  0.45  0.09  0.18  Plasma  MDA, nmol/L  4.45  2.79  1.39  1.83  2.46  0.25  <0.001  0.002  <0.001  SOD, U/mL  102  115  141  144  122  8.98  0.51  0.32  0.26  T-AOC, U/mL  3.47  4.98  5.81  4.82  4.59  0.32  0.29  0.50  0.08  Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  Breast  MDA, nmol/L  2.55  1.74  1.40  1.41  1.39  0.13  0.012  0.006  0.002  SOD, U/mL  48.7  47.4  48.8  50.0  46.1  1.02  0.82  0.77  0.81  T-AOC, U/mL  0.23  0.26  0.27  0.28  0.29  0.01  0.45  0.09  0.18  Plasma  MDA, nmol/L  4.45  2.79  1.39  1.83  2.46  0.25  <0.001  0.002  <0.001  SOD, U/mL  102  115  141  144  122  8.98  0.51  0.32  0.26  T-AOC, U/mL  3.47  4.98  5.81  4.82  4.59  0.32  0.29  0.50  0.08  1n = 6 replicates per treatment. SOD, superoxide dismutase; T-AOC, total antioxidant capacity; MDA, malondialdehyde. View Large Gene Expression of Carnosine-Related Enzymes in Breast Muscle Table 8 shows the mRNA expression of CARNS1, CNDP1, CNDP2, SLC6A6, SLC36A1, SLC6A14 in pectoral muscle. Of all the 6 genes, only CNDP1 and SLC6A14 could not be detected in the breast muscle of birds. Dietary β-alanine supplementation quadratically increased the expression CARNS1 in breast muscle at d 42 (P < 0.05). Furthermore, Dietary addition of β-alanine quadratically increased the expression of SLC6A6 (β-alanine transporter) (P < 0.05). There were no distinct differences in the expression of SLC36A1 in response to β-alanine supplementation in the diets (P > 0.05). Table 8. Effect of dietary β-alanine supplementation on expression of carnosine-related enzyme mRNAs in the breast muscle of broiler chicks.1 Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  CARNS1  4.95  6.35  8.47  7.20  6.85  0.34  0.011  0.050  0.004  CNDP2  0.94  0.95  1.02  0.76  0.82  0.04  0.209  0.119  0.232  SLC6A6  5.17  6.90  8.91  7.10  7.28  0.33  0.005  0.060  0.004  SLC36A1  2.54  2.40  2.60  2.79  2.62  0.14  0.94  0.58  0.86  Parameter  Supplemental β-alanine level (mg/kg feed)    P-value    0  250  500  1,000  2,000  SEM  ANOVA  Linear  Quadratic  CARNS1  4.95  6.35  8.47  7.20  6.85  0.34  0.011  0.050  0.004  CNDP2  0.94  0.95  1.02  0.76  0.82  0.04  0.209  0.119  0.232  SLC6A6  5.17  6.90  8.91  7.10  7.28  0.33  0.005  0.060  0.004  SLC36A1  2.54  2.40  2.60  2.79  2.62  0.14  0.94  0.58  0.86  1n = 6 replicates per treatment. CARNS1, carnosine synthase; CNDP2, carnosinase-2; SLC6A6, taurine transporter; SLC36A1, proton coupling amino acid transporter. View Large Prediction of Optimal β-alanine Supplementation in Broilers’ Diet Prediction of optimal β-alanine levels from growth, amino acid and dipeptide, carcass yield, MDA content, meat quality and gene expression of carnosine-related enzymes data is presented in Table 9. Results show that broilers had the optimal feed efficiency in starting and entire periods when β-alanine was supplemented at 1,221 mg/kg or 1,100 mg/kg. The highest β-alanine, carnosine content in breast muscle and lowest MDA content in breast muscle and plasma at d 42 would be generated by dietary supplementation of β-alanine at the level of 1,178 to 1,760 mg/kg, and the best meat color and tenderness would be achieved when the diet containing 1,041 to 1,110 β-alanine mg/kg diet. Expression of carnosine-related enzymes including CARNS1 and SLC6A6 in the breast muscle would be highest by dietary supplementation of β-alanine at the level of 1,164 to 1,187 mg/kg. Table 9. Prediction of dietary optimum β-alanine (mg/kg) supplementation based on significantly parameters. Parameter  R2  Equation  Optimal dose1  ADG (d 1–21)  0.464  Y = −2.333 × 2 + 6.521x + 44.21  1.398 g/kg  FCR (d 1–21)  0.704  Y = 0.076 × 2 − 0.187x + 1.413  1.221 g/kg  FCR (d 1–42)  0.586  Y = 0.073 × 2 − 0.1615x + 1.725  1.100 g/kg  β-ALA (breast muscle)  0.951  Y = −27.53 × 2 + 96.9x + 45.76  1.760 g/kg  CARN (breast muscle)  0.641  Y = −695.8 × 2 + 1664x + 2824  1.196 g/kg  MDA (breast muscle)  0.836  Y = 0.709 × 2 − 1.8799x + 2.354  1.325 g/kg  TAU (plasma)  0.638  Y = 52.67 × 2 − 251.92x + 619.2  2.392 g/kg  MDA (plasma)  0.803  Y = 2.104 × 2 − 4.9585x + 4.067  1.178 g/kg  Breast yield  0.720  Y = −1.604 × 2 + 4.3482x + 20.08  1.355 g/kg  SFV (breast muscle)  0.880  Y = 1.263 × 2 − 2.804x + 17.56  1.110 g/kg  a* 45 min (breast muscle)  0.885  Y = −0.416 × 2 + 0.8662x + 2.549  1.041 g/kg  a* 24 h (breast muscle)  0.349  Y = −0.489 × 2 + 1.0248x + 5.105  1.048 g/kg  CARNS1  0.620  Y = −2.0615 × 2 + 4.7977x+5.3560  1.164 g/kg  SLC6A6  0.457  Y = −1.7927 × 2 + 4.2229x+5.8085  1.178 g/kg  Parameter  R2  Equation  Optimal dose1  ADG (d 1–21)  0.464  Y = −2.333 × 2 + 6.521x + 44.21  1.398 g/kg  FCR (d 1–21)  0.704  Y = 0.076 × 2 − 0.187x + 1.413  1.221 g/kg  FCR (d 1–42)  0.586  Y = 0.073 × 2 − 0.1615x + 1.725  1.100 g/kg  β-ALA (breast muscle)  0.951  Y = −27.53 × 2 + 96.9x + 45.76  1.760 g/kg  CARN (breast muscle)  0.641  Y = −695.8 × 2 + 1664x + 2824  1.196 g/kg  MDA (breast muscle)  0.836  Y = 0.709 × 2 − 1.8799x + 2.354  1.325 g/kg  TAU (plasma)  0.638  Y = 52.67 × 2 − 251.92x + 619.2  2.392 g/kg  MDA (plasma)  0.803  Y = 2.104 × 2 − 4.9585x + 4.067  1.178 g/kg  Breast yield  0.720  Y = −1.604 × 2 + 4.3482x + 20.08  1.355 g/kg  SFV (breast muscle)  0.880  Y = 1.263 × 2 − 2.804x + 17.56  1.110 g/kg  a* 45 min (breast muscle)  0.885  Y = −0.416 × 2 + 0.8662x + 2.549  1.041 g/kg  a* 24 h (breast muscle)  0.349  Y = −0.489 × 2 + 1.0248x + 5.105  1.048 g/kg  CARNS1  0.620  Y = −2.0615 × 2 + 4.7977x+5.3560  1.164 g/kg  SLC6A6  0.457  Y = −1.7927 × 2 + 4.2229x+5.8085  1.178 g/kg  1β-alanine levels calculated from the vertex of the corresponding curve. ADG, average daily gain; FCR (feed: gain = g: g), feed conversion ratio; β-ALA, β-alanine; CARN, carnosine; MDA, malondialdehyde; TAU, taurine; SFV, shear force value. CARNS1, carnosine synthase; SLC6A6, taurine transporter. View Large DISCUSSION Growth Performance Dietary supplementation with β-alanine improved the growth performance of broilers throughout the entire experimental period. These results are consistent with a previous study (Tomonaga et al., 2005b). In the current study, chickens fed diets containing 250 to 2,000 mg/kg β-alanine had quadratically enhanced ADG (from 8.89% to 14.77%) and markedly decreased FCR in the starting period. The addition of β-alanine tended to decrease FCR during the overall period. A diet containing 2.5% β-alanine increases the feed efficiency in broilers (Jacob et al., 1991). The dosage of β-alanine in our current study was lower than that of previous studies (Jacob et al., 1991; Tomonaga et al., 2005b). However, some research reported that supplementation with excessive β-alanine inhibited feed intake in broilers (Zhang, 2008). Therefore, the suitable β-alanine level in broiler diets is of great importance for the industry. A prior study showed that dietary β-alanine supplementation increases the feed efficacy by markedly reducing feed consumption (Jacob et al., 1991). In the present study, diets supplemented with β-alanine increased the feed conversion via enhancing ADG, possibly because β-alanine could act as a neurotransmitter (Tiedje et al., 2010) to adjust the secretion of hormones related to growth performance. Another explanation is that oral administration of β-alanine may improve the feed efficiency through alleviating stress (Tomonaga et al., 2004). Different forms of β-alanine administration, i.e., drinking water or feed, may have different effects on growth performance in broilers (Tomonaga et al., 2005b; Tomonaga et al., 2006). Carnosine Content and mRNA Expression of Carnosine Synthesis–Related Enzymes The present study revealed that dietary β-alanine addition quadratically increased β-alanine and carnosine content in breast muscle of broilers. Dietary addition of β-alanine may enhance the carnosine content of the muscle because carnosine is a product of β-alanine and l-histidine synthesized by carnosine synthase (Stenesh and Winnick, 1960). This is similar to the results of previous studies (Dunnett and Harris, 1999; Tomonaga et al., 2012). The dosage of β-alanine was different from that in other studies (Zhang, 2008; Hu, 2009), this awaits further study. It was reported that SLC6A6, SLC36A1, and SLC6A14 could promote the transportation of β-alanine, of these transporters, only SLC6A14 gene expression was not investigated in the skeletal muscle (Drummond et al., 2010; Pierno et al., 2012). In the present study, we have evaluated the expression of carnosine-related transporters. It shows that dietary β-alanine supplementation quadratically upregulated the expression of SLC6A6 gene (Table 8). As we know, SLC6A6 transporter can transport both taurine and β-alanine (Pasantes-Morales et al., 1983). Hu et al. (2000) showed competitive inhibition between taurine and β-alanine for SLC6A6 transporter. Some studies indicated that taurine depletion might induce physiological dysfunction, such as growth retardation (Hu et al., 2000). In our current study, no markedly negative effects were observed in growth parameters, such as FCR. Moreover, taurine is depleted because β-alanine competes with taurine for uptake (Hu et al., 2000). Carcass Characteristics and Meat Quality Dietary addition of 0.5% β-alanine has no effect on breast muscle weight, whereas 1 or 2% β-alanine diets significantly reduced the breast muscle weight because higher concentrations of β-alanine may induce growth retardation or physiological dysfunction (Tomonaga et al. 2006). In the present study, dietary supplementation with β-alanine increased the breast muscle yield during the starting period, which indicated that a lower dosage of β-alanine, to some extent, increased the breast yield. With regard to meat quality, dietary supplementation with β-alanine quadratically increased the a*45 min or a*24 h values in breast muscle at d 42. The shear force decreased in response to dietary β-alanine addition. The reduction of the shear force with dietary β-alanine addition was possibly due to the increase of carnosine content, which may activate muscle calpain II in broilers under certain concentrations of calcium ions (Johnson and Hammer, 1989). Kralik et al. (2014) found that dietary supplementation with 0.5% β-alanine markedly increased the a* value of breast muscle tissue. This result is consistent with our present study, but the dosage of β-alanine was lower in present study. Stress before slaughter may lead to pale, soft, exudative meat (Mckee and Sams, 1997); dietary β-alanine increases a* value and may alleviate stress responses in chickens (Tomonaga et al., 2004). In these studies, meat color was determined by muscle pigment content; β-alanine may influence the pigment content of muscle, which was not detected in the current study. Thus, this hypothesis needs to be clarified. Antioxidant Parameters In the present study, the MDA content in plasma quadratically decreased with dietary β-alanine addition (P < 0.05). Breast muscle of broilers supplemented with 0.5% β-alanine and kept for 60 d at −20°C exhibits lower thiobarbituric acid reactive substances (mg MDA/kg of tissue) value than the group without added β-alanine (Kralik et al., 2014). Belviranli et al. (2015) found that supplemental β-alanine has no effect on oxidative stability of breast muscle. In our current study, dietary addition of β-alanine decreased the MDA of breast muscle; this was possibly due to increasing the concentration of carnosine, which has a strong antioxidant ability (Boldyrev et al., 2004). Hu (2009) found that dietary supplementation with 0.5% carnosine greatly decreased the MDA content (P < 0.05), yet it increased the T-AOC content of breast muscle in broilers at d 42. In addition, Schnuck et al. (2016) found that dietary supplementation with β-alanine in mice improved the oxygen consumption as well as the expression of several cellular proteins associated with improved oxidative metabolism, and indicates that it may provide additional metabolic benefits that promote the muscle antioxidants. Prediction of Dietary Optimum β-alanine Supplementation In current study, dietary β-alanine at level of 500 and 1,000 mg/kg positively affected growth performance, increased β-alanine and carnosine contents in breast, decreased MDA content and impoved meat quality. Quadratic responses of β-alanine were observed on these parameters. Based on the polynomial regression, broilers had the optimal feed efficiency in starting and entire periods when fed diet supplemented with 1,221 or 1,100 mg/kg β-alanine. The highest muscular β-alanine, carnosine contents and lowest MDA contents at d 42 in plasma and breast muscle would be generated at the level of 1,178 to 1,760 mg/kg, and the best meat color and tenderness would be achieved when the diet had β-alanine ranging from 1,041 to 1,110 mg/kg. In addition, mRNA expression of carnosine-related enzymes (CARNS1 and SLC6A6) in the breast muscle would be highest by supplementation of β-alanine at the level of 1,164 to 1,178 mg/kg. Different from early studies that enhancement of muscular carnosine content responded at high dosage of β-alanine (Tomonaga et al., 2012; Kralik et al., 2014), our results demonstrated that lower dosage of β-alanine may effectively increased carnosine content in breast muscle. Furthermore, the low dosage of β-alanine may favorably affect the growth performance and meat quality. Therefore, the optimal β-alanine level added to diet for broilers is recommended to be 1,041 to 1,760 mg/kg based on the current experimental condition. CONCLUSIONS The present study showed that dietary supplementation of β-alanine can improve feed efficiency, muscular carnosine content and meat quality in broiler chicks. The improvement of meat quality may be attributed to the increased concentration of carnosine and up-regulation of mRNA expression of genes encoding carnosine-related enzymes. Quadratic responses were observed on growth performance, carnosine content, meat quality and expression of carnosine-related enzymes. Acknowledgements This study was financed by China Agriculture Research System-Beijing Team for Poultry Industry, and the National Key Technology Research and Development Program (2011BAD26B04, Beijing, China), and the Agricultural Science and Technology Innovation Program (ASTIP). REFERENCES Abe H. 2000. Role of histidine-related compounds as intracellular proton buffering constituents in vertebrate muscle. Biochemistry (Mosc.).  65: 757– 765. Google Scholar PubMed  Aviagen. 2009. Arbor Acres Broiler Management Guide . Aviagen Inc., Huntsville, AL. Boldyrev A., Bulygina E., Leinsoo T., Petrushanko I., Tsubone S., Abe H.. 2004. Protection of neuronal cells against reactive oxygen species by carnosine and related compounds. Comp. Biochem. Physiol. B. Biochem. Mol. Biol.  137: 81– 88. Google Scholar CrossRef Search ADS PubMed  Belviranli M., Okudan N., Revan S., Balci S., Gokbel H.. 2015. Repeated supramaximal exercise-induced oxidative stress: effect of β-alanine plus creatine supplementation. Asian J. Sports Med.  7: e26843. Dunnett M., Harris R. C.. 1999. Influence of oral β-alanine and L-histidine supplementation on the carnosine content of the gluteus medius. Equine Vet. J.  31: 499– 504. Google Scholar CrossRef Search ADS   Drummond M. J., Glynn E. L., Fry C. S., Timmerman K. L., Volpi E., Rasmussen B. B.. 2010. An increase in essential amino acid availability upregulates amino acid transporter expression inhuman skeletal muscle. Am. J. Physiol. Endocrinol. Metab.  298: 1011– 1018. Google Scholar CrossRef Search ADS   Everaert I., Stegen S., Vanheel B., Taes Y., Derave W.. 2013a. Effect of beta-alanine and carnosine supplementation on muscle contractility in mice. Med. Sci. Sport. Exer.  45: 43– 51. Google Scholar CrossRef Search ADS   Everaert I., Naeyer H. D., Taes Y., Derave W.. 2013b. Gene expression of carnosine-related enzymes and transporters in skeletal muscle. Eur. J. Appl. Physiol.  113: 1169– 1179. Google Scholar CrossRef Search ADS   Froning G. W., Uijttenboogaart T. G.. 1988. Effect of postmortem electrical stimulation on color, texture, pH, and cooking losses of hot and cold deboned chicken broiler carcasses. Poult. Sci.  67: 1536– 1544. Google Scholar CrossRef Search ADS   Hu J. M., Rho J. Y., Suzuki M., Nishihara M., Takahashi M.. 2000. Effect of taurine in rat milk on the growth of offspring. J. Vet. Med. Sci.  62: 693– 698. Google Scholar CrossRef Search ADS PubMed  Hu X. X. 2009. Nutritional regulation of dietary carnosine, β-alanine and astragalus polysaccharide on meat quality in broilers . Ph.D. Thesis, China Agricultural University. Beijing, China. (in Chinese). Jacob J. P., Blair R., Hart L. E., Gardiner E. E.. 1991. The effect of taurine transport antagonists on cardiac taurine concentration and the incidence of sudden death syndrome in male broiler chickens. Poult. Sci.  70: 561– 567. Google Scholar CrossRef Search ADS PubMed  Johnson P., Hammer J. L.. 1989. Effects of L-1-methyl-histidine and the muscle dipeptides carnosine and anserine on the activities of muscle calpains. Comp. Biochem. Physiol. B. Biochem. Mol. Biol.  94: 45– 48. Google Scholar CrossRef Search ADS   Kohen R., Yamamoto Y., Cundy K. C., Ames B. N.. 1988. Antioxidant activity of carnosine, homocarnosine, and anserine present in muscle and brain. Proc. Natl. Acad. Sci. U.S.A.  85: 3175– 3179. Google Scholar CrossRef Search ADS PubMed  Kralik G., Sak-Bosnar M., Kralik Z., Galović O.. 2014. Effects of β-alanine dietary supplementation on concentration of carnosine and quality of broiler muscle tissue. J. Poult. Sci.  51: 151– 156. Matthews M. M., Traut T. W.. 1987. Regulation of N-carbamoyl-beta-alanine amid hydrolase, the terminal enzyme in pyrimidine catabolism, by ligand-induced change in polymerization. J. Biol. Chem.  262: 7232– 7237. Google Scholar PubMed  Mannion A. F., Jakeman P. M., Dunnett M., Harris R. C., Willan P. L., 1992. Carnosine and anserine concentrations in the quadriceps femoris muscle of healthy humans. Eur. J. Appl. Physiol. Occup. Physiol.  64: 47– 50. Google Scholar CrossRef Search ADS PubMed  McKee S. R., Sams A. R.. 1997. The effect of seasonal heat stress on rigor development and the incidence of pale, exudative turkey meat. Poult. Sci.  76: 1616– 1620. Google Scholar CrossRef Search ADS PubMed  Nagai H., Harada M., Nakagawa M., Tanaka T., Gunadi B., Setiabudi M. L., Jocab L. A., Miyata Y.. 1996. Effects of chicken extract on the recovery from fatigue caused by mental workload. Appl. Human Sci.  15: 281– 286. Google Scholar CrossRef Search ADS PubMed  Pasantes-Morales H., Quesada O., Cárabez A., Huxtable R. J.. 1983. Effect of taurine transport antagonist, guanidinoethane sulfonate and β-alanine on the morphology of rat retina. J. Neurosci. Res.  9: 135– 143. Google Scholar CrossRef Search ADS PubMed  Pierno S., Liantonio A., Cannone G. M., Bellis M. D., Cannone M., Gramegna G., Scaramuzzi A., Simonetti S., Nicchia G. P., Basco D., Svelto M., Jean-Francois D.. 2012. Potential benefits of taurine in the prevention of skeletal muscle impairment induced by disuse in the hindlimb-unloaded rat. Amino Acids . 43: 431– 445. Google Scholar CrossRef Search ADS PubMed  Schnuck J. K., Sunderland K. L., Kuennen M. R., Vaughan R. A.. 2016. Characterization of the metabolic effect of β-alanine on markers of oxidative metabolism and mitochondrial biogenesis in skeletal muscle. J. Exerc. Nutr. Biochem.  20: 34– 41. Google Scholar CrossRef Search ADS   Stenesh J. J., Winnick T.. 1960. Carnosine-anserine synthetase of muscle. 4. Partial purification of the enzyme and further studies of β-alanyl peptide synthesis. Biochem. J.  77: 575– 581. Google Scholar CrossRef Search ADS PubMed  Tiedje K. E., Stevens K., Barnes S., Weaver D. F.. 2010. β-alanine as a small molecule neurotransmitter. Neurochem. Int.  57: 177– 188. Google Scholar CrossRef Search ADS PubMed  Tomonaga S., Tachibana T., Takagi T., Saito E. S., Zhang R., Denbow M., Furuse M.. 2004. Effect of central administration of carnosine and its constituents on behaviors in chicks. Brain Res. Bull.  63: 75– 82. Google Scholar CrossRef Search ADS PubMed  Tomonaga S., Tachibana T., Takahashi H., Sato M., Denbow D. M., Furuse M.. 2005a. Nitric oxide involves in carnosine-induced hyperactivity in chicks. Eur. J. Pharmacol.  524: 84– 88. Google Scholar CrossRef Search ADS   Tomonaga S., Kaji Y., Tachibana T., Denbow D. M., Furuse M.. 2005b. Oral administration of β-alanine modifies carnosine concentrations in the muscles and brains of chickens. J. Anim. Sci.  76: 249– 254. Google Scholar CrossRef Search ADS   Tomonaga S., Kaneko K., Kaji Y., Kido Y., Denbow D. M., Furuse M.. 2006. Dietary β-alanine enhances brain, but not muscle, carnosine and anserine concentrations in broilers. J. Anim. Sci.  77: 79– 86. Google Scholar CrossRef Search ADS   Tomonaga S., Matsumoto M., Furuse M.. 2012. β-alanine enhances brain and muscle carnosine levels in broiler chicks. J. Poult. Sci.  49: 308– 312. Google Scholar CrossRef Search ADS   Wang J., Zhang H. J., Samuel K. G., Long C., Wu S. G., Yue H. Y., Sun L. L., Qi G. H.. ( 2015). Effects of dietary pyrroloquinoline quinone disodium on growth, carcass characteristics, redox status, and mitochondria metabolism in broilers. Poult. Sci.  94: 215– 225. Google Scholar CrossRef Search ADS PubMed  Won P. S., Ho K. C., Namgung N., Yun J. B., Kee P. I., Kil D.. 2013. Effects of dietary supplementation of histidine, β-Alanine, magnesium oxide, ad blood meal on carnosine and anserine concentrations of broiler breast meat. J. Poult. Sci.  50: 251– 256. Google Scholar CrossRef Search ADS   Xu L., Zhang L., Yue H. Y., Wu S. G., Zhang H. J., Ji F., Qi G. H.. 2011. Effect of electrical stunning current and frequency on meat quality, plasma parameters, and glycolytic potential in broilers. Poult. Sci.  90: 1823– 1830. Google Scholar CrossRef Search ADS PubMed  Zhang G. Q. 2008. Nutritional regulation of dietary inosinic acid, β-alanine and histidine on meat quality in broilers . Ph.D. Thesis, China Agricultural University. Beijing, China. (in Chinese). Zhang L., Yue H. Y., Zhang H. J., Xu L., Wu S. G., Yan H. J., Gong Y. S., Qi G. H.. 2009. Transport stress in broilers: I. Blood metabolism, glycolytic potential, and meat quality. Poult. Sci.  88: 2033– 2041. Google Scholar CrossRef Search ADS PubMed  © 2018 Poultry Science Association Inc.

Journal

Poultry ScienceOxford University Press

Published: Apr 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial