Effect of cysteamine hydrochloride supplementation on the growth performance, enterotoxic status, and glutathione turnover of broilers fed aflatoxin B1 contaminated diets

Effect of cysteamine hydrochloride supplementation on the growth performance, enterotoxic status,... ABSTRACT This study aimed to investigate the effect of cysteamine hydrochloride (CSH) supplementation on the growth performance, opportunistic bacteria and enterotoxic markers, visceral lesions, glutathione turnover, and inflammatory factors of broilers fed diets contaminated with aflatoxin B1 (AFB1). One-day-old Arbor Acres broilers (n = 480) were randomly allocated to 4 treatments with 6 replicates of 20 chicks each for a 2 × 2 design with CSH (0 or 200 mg/kg) and AFB1 (0 or 40 μg/kg). The trial lasted for 42 d. Results showed that AFB1 negatively affected (P < 0.05) growth performance, opportunistic bacteria and enterotoxic markers, intestinal lesions, glutathione turnover, and inflammatory factors. The CSH increased (P < 0.05) feed intake and body weight gain. The enterotoxic status was relieved in the CSH treatments by reducing (P < 0.05) the populations of gut Escherichia coli, Gram-negative bacteria, serum diamine oxidase, and intestinal lesions. The CSH also increased (P < 0.05) serum reduced glutathione, glutathione s-transferases, and glutathione reductase, and decreased (P < 0.05) the mRNA levels of tumor necrosis factor-α, interleukin-6, and interleukin-1β. Significant interactions (P < 0.05) were found on Gram-negative bacteria, diamine oxidase, and glutathione s-transferases. The results suggest that the CSH can improve glutathione turnover and reduce the risk of enterotoxic disease induced by AFB1 in broilers. INTRODUCTION Sulfhydryl group in glutathione has a pivotal role in counteracting oxidative stress and inflammatory occurrence, and this group based products have recently started to use in animal feeds (Hu et al., 2008; Wang et al., 2015; Bai et al., 2017). As a commercial additive, cysteamine hydrochloride (CSH) is the simplest and the most stable among aminothiol compounds (Reid, 1958). Studies showed that supplemental CSH or its derivatives improved animal growth by reducing oxidative stress, enhancing immunity and intestinal integrity (Morrison et al., 2005; Wang et al., 2015; Zhou et al., 2017). The oxidative stress of animals is related to enterotoxic status or toxins that are derived from contaminated feeds or imbalanced gut opportunistic bacteria, such as aflatoxin B1 (AFB1), Gram-negative bacteria (Gram–), Clostridium perfringens, and Escherichia coli. These consequently result in intestinal hyperpermeability, inflammatory responses, and even the occurrence of enteric diseases (Immerseel et al., 2004; Yarru et al., 2009; Hafez, 2011; Liu et al., 2018). So it is interesting whether CSH can influence the toxicity of dietary toxins and populations of opportunistic bacteria in the intestine of farm animals. But literature about this is unavailable. The CSH or derivatives act through sulfhydryl-disulfide exchange reactions in glutathione redox cycle, so the providing of sulfhydryl group can theoretically facilitate the synthesis and turnover of glutathione (Courtney-Martin and Pencharz, 2016). Meanwhile, the AFB1 contamination in feedstuffs is becoming a considerable threat to the gut health of growing animals. However, information about the effect of CSH on glutathione turnover in AFB1 contaminated animals is very limited. Therefore, the present study aimed to investigate the effect of dietary CSH on growth performance, opportunistic bacteria and endotoxins, visceral lesions, glutathione turnover, and inflammatory factors of broilers fed diets contaminated with AFB1. MATERIAL AND METHODS Diets, CSH, and AFB1 The experiment was a 2 × 2 factorial design without or with CSH (200 mg/kg) or AFB1 (40 μg/kg). The CSH was coated, provided by Hangzhou King Techina Technology Co., Ltd (Hangzhou, China). The AFB1 was produced using Aspergillus flavus from the China General Microbiological Culture Collection Center as described by Liu et al. (2018). The AFB1 concentrations in the moldy corn meal were detected at 3764 μg/kg. Uncontaminated control corn was replaced by the moldy corn to yield a concentration of 40 μg AFB1 per kg diet. The nutritive values of basal diet were recommended by Arbor Acres Broiler Management Handbook in China, and diets were stored in a cool, dry, dark, and well-ventilated place and fed as mash on air-dry basis. No antibiotics were offered to broilers via either feed or water throughout the trial. The formulation of the basal diet was listed in Table 1. Table 1. Ingredients and nutrient levels of basal diet1 (air-dry basis). Contents (%) Items 1 to 21 d of age 22 to 42 d of age Ingredients Corn 60.00 57.57 Soybean meal 25.00 25.45 Corn gluten meal 8.70 4.50 Full-fat soybean 0 3.50 Soybean oil 1.35 5.00 Limestone 1.20 1.00 L-Lysine 0.53 0.13 DL-Methionine 0.12 0.10 Salt 0.30 0.40 Dicalcium phosphate 2.15 1.70 Choline chloride 0.15 0.15 Premix2 0.50 0.50 Nutrients3 Crude protein 21.90 20.00 ME (MJ/kg) 12.61 13.38 Ca 1.02 0.86 Non-phytate P 0.50 0.42 Methionine 0.50 0.43 Lysine 1.43 1.07 Contents (%) Items 1 to 21 d of age 22 to 42 d of age Ingredients Corn 60.00 57.57 Soybean meal 25.00 25.45 Corn gluten meal 8.70 4.50 Full-fat soybean 0 3.50 Soybean oil 1.35 5.00 Limestone 1.20 1.00 L-Lysine 0.53 0.13 DL-Methionine 0.12 0.10 Salt 0.30 0.40 Dicalcium phosphate 2.15 1.70 Choline chloride 0.15 0.15 Premix2 0.50 0.50 Nutrients3 Crude protein 21.90 20.00 ME (MJ/kg) 12.61 13.38 Ca 1.02 0.86 Non-phytate P 0.50 0.42 Methionine 0.50 0.43 Lysine 1.43 1.07 1Aflatoxin B1 is not detectable (< 2 μg/kg) in the basal diet. 2Provided per kg diet: vitamin A (retinyl acetate), 8,000 IU; cholecalciferol, 1,000 IU; vitamin E (DL-tocopheryl acetate), 20 IU; vitamin K, 0.5 mg; thiamin, 2.0 mg; riboflavin, 8.0 mg; d-pantothenic acid, 10 mg; niacin, 35 mg; pyridoxine, 3.5 mg; biotin, 0.18 mg; folic acid, 0.55 mg; vitamin B12, 0.010 mg; manganese, 120 mg; iodine, 0.70 mg; iron, 100 mg; copper, 8 mg; zinc, 100 mg; and selenium, 0.30 mg. 3Calculated chemical composition by Chinese Feed Database (Xiong et al., 2014). View Large Table 1. Ingredients and nutrient levels of basal diet1 (air-dry basis). Contents (%) Items 1 to 21 d of age 22 to 42 d of age Ingredients Corn 60.00 57.57 Soybean meal 25.00 25.45 Corn gluten meal 8.70 4.50 Full-fat soybean 0 3.50 Soybean oil 1.35 5.00 Limestone 1.20 1.00 L-Lysine 0.53 0.13 DL-Methionine 0.12 0.10 Salt 0.30 0.40 Dicalcium phosphate 2.15 1.70 Choline chloride 0.15 0.15 Premix2 0.50 0.50 Nutrients3 Crude protein 21.90 20.00 ME (MJ/kg) 12.61 13.38 Ca 1.02 0.86 Non-phytate P 0.50 0.42 Methionine 0.50 0.43 Lysine 1.43 1.07 Contents (%) Items 1 to 21 d of age 22 to 42 d of age Ingredients Corn 60.00 57.57 Soybean meal 25.00 25.45 Corn gluten meal 8.70 4.50 Full-fat soybean 0 3.50 Soybean oil 1.35 5.00 Limestone 1.20 1.00 L-Lysine 0.53 0.13 DL-Methionine 0.12 0.10 Salt 0.30 0.40 Dicalcium phosphate 2.15 1.70 Choline chloride 0.15 0.15 Premix2 0.50 0.50 Nutrients3 Crude protein 21.90 20.00 ME (MJ/kg) 12.61 13.38 Ca 1.02 0.86 Non-phytate P 0.50 0.42 Methionine 0.50 0.43 Lysine 1.43 1.07 1Aflatoxin B1 is not detectable (< 2 μg/kg) in the basal diet. 2Provided per kg diet: vitamin A (retinyl acetate), 8,000 IU; cholecalciferol, 1,000 IU; vitamin E (DL-tocopheryl acetate), 20 IU; vitamin K, 0.5 mg; thiamin, 2.0 mg; riboflavin, 8.0 mg; d-pantothenic acid, 10 mg; niacin, 35 mg; pyridoxine, 3.5 mg; biotin, 0.18 mg; folic acid, 0.55 mg; vitamin B12, 0.010 mg; manganese, 120 mg; iodine, 0.70 mg; iron, 100 mg; copper, 8 mg; zinc, 100 mg; and selenium, 0.30 mg. 3Calculated chemical composition by Chinese Feed Database (Xiong et al., 2014). View Large Animals and Samples All the experimental procedures were approved by the Animal Ethics Committee of the Henan University of Science and Technology (Luoyang, China). A total of 480 1-day-old Arbor Acres broilers (male) were randomly allocated into 4 groups with 6 replicates of 20 chicks each. All chicks were reared in 3-layered cages and given ad libitum access to diets and water throughout the study. The temperature, ventilation, and light regime of chicken house were managed according to Arbor Acres broiler management handbook. Birds and feeds in each cage were weighed at 21 and 42 d old, average daily feed intake (ADFI), average daily body weight gain (ADG), and feed conversion ratio (FCR) were immediately adjusted when mortality occurred. All the birds were monitored for general health at least twice a day. At day 42 of the trial, 6 birds per replicate were randomly selected, weighed, euthanized by CO2, and then dissected. Blood was immediately drawn from the heart with a syringe and aliquoted into sterile vials for serum preparation as described by Liu et al. (2008). Liver, duodenum, jejunum, and ileum were collected and scored for lesions on a scale of 0 to 3 (Gholamiandehkordi et al., 2007). Approximately 1 cm segment in the middle part of duodenum was dissected and stored in an RNA stabilization solution at −20°C for gene expression analysis (Liu et al., 2008). Approximately 2 g ileal digesta was collected and stored at −40°C for gut microflora analysis. Chemical and Biochemical Analysis The concentrations of AFB1 in the moldy corn and feed were detected according to the Standard of China (GB/T 5009.22–2003) with an enzyme-linked immunosorbent assay kit (detection limit 2 μg/kg, Longke Fangzhou Biotech, Beijing, China). The concentrations of serum endotoxin were measured using a limulus amoebocyte lysate-based kit (Lonza, Walkersville, MD). Briefly, samples and standards were incubated for 10 min at 37°C with limulus amoebocyte lysate and then for another 6 min with colorimetric substrate. Internal control for recovery calculation was included in the assessment. The reaction was stopped with 25% acetic acid and then the absorbance was read at 405 nm. The activity of diamine oxidase (DAO) in serum (1 mL) was examined by a spectrophotometric assay. The DAO standard (D7876–250) was purchased from a Sigma-Aldrich supplier in Beijing of China. Serum profiles of reduced glutathione (r-GSH), glutathione s-transferases (GSTs), and glutathione reductase (GR) were detected using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The units of r-GSH, GSTs, and GR were finally calculated and expressed as mg/g, μmol/min·g (U/g), and U/g, respectively, per gram protein in the supernatant of tissue samples to minimize the errors during sample preparation. Three parallel tests with aliquots of the same sample were performed for all samples and all chemical and biochemical analyses. Bacteria Enumeration and mRNA Expression The enumeration of ileal bacteria was carried out according to the method by Wu et al. (2014) with minor modification. Briefly, approximately 1 g of each ileal digesta was diluted with 9 mL of ice-cold sterile buffer peptone water (0.1%) and homogenized. The suspension of each sample was serially diluted between 10−1 and 10−7 dilutions, and 100 μL of each diluted sample was subsequently spread onto duplicate selective agar plates for bacterial counting. The number of cfu was expressed as a logarithmic (log10) transformation per gram of intestinal digesta. Commercial media (Qingdao Hopebio Co., Ltd., Shandong, China) was used for the cultivation and isolation of E. coli (HB7001), C. perfringens (HB0256), and Gram– (HB8643). Total mRNA isolation and cDNA synthesis were carried out according to the description by Liu et al. (2008), and the transcriptional profiles of target genes were expressed as the relative expression to beta-actin gene. Primer information for qPCR was listed in Table 2. Primers and qPCR reagents were provided by Dalian TaKaRa Co., Ltd. (Liaoning, China). The qPCR reactions were set at 10 μL with 5 μL of SYBR Green Master Mix, 1 μL of primer, 4 μL of 10 × diluted cDNA. All qPCRs were run in triplicates on the same thermal cycles (50°C 2 min, 95°C 10 min, 40 cycles of 95°C 15 s and 60°C 1 min) on the ABI Prism 7900HT Fast Real-Time PCR System. No amplification signal was detected in water or no-RT RNA samples. Table 2. Information of primers for quantitative real-time PCR. Primers (5′→3′) Length (bp) Names GenBank Forward Reverse TNF-α HQ739087.1 gagcagggctgacacggat cccaaacgctgcttccaaat 86 IL-1β XM_01,529,7469.1 gaaggtaaggatgggagggct actgtggtgtgctcagaatcc 117 IL-6 AB302327.1 gaaatccctcctcgccaatct ctcacggtcttctccataagc 105 β-actin NM_205,518 ttgtccaccgcaaatgcttc aagccatgccaatctcgtct 107 Primers (5′→3′) Length (bp) Names GenBank Forward Reverse TNF-α HQ739087.1 gagcagggctgacacggat cccaaacgctgcttccaaat 86 IL-1β XM_01,529,7469.1 gaaggtaaggatgggagggct actgtggtgtgctcagaatcc 117 IL-6 AB302327.1 gaaatccctcctcgccaatct ctcacggtcttctccataagc 105 β-actin NM_205,518 ttgtccaccgcaaatgcttc aagccatgccaatctcgtct 107 IL-1β, interleukin-1β; IL-6, interleukin-6; TNF-α, tumor necrosis factor-α. View Large Table 2. Information of primers for quantitative real-time PCR. Primers (5′→3′) Length (bp) Names GenBank Forward Reverse TNF-α HQ739087.1 gagcagggctgacacggat cccaaacgctgcttccaaat 86 IL-1β XM_01,529,7469.1 gaaggtaaggatgggagggct actgtggtgtgctcagaatcc 117 IL-6 AB302327.1 gaaatccctcctcgccaatct ctcacggtcttctccataagc 105 β-actin NM_205,518 ttgtccaccgcaaatgcttc aagccatgccaatctcgtct 107 Primers (5′→3′) Length (bp) Names GenBank Forward Reverse TNF-α HQ739087.1 gagcagggctgacacggat cccaaacgctgcttccaaat 86 IL-1β XM_01,529,7469.1 gaaggtaaggatgggagggct actgtggtgtgctcagaatcc 117 IL-6 AB302327.1 gaaatccctcctcgccaatct ctcacggtcttctccataagc 105 β-actin NM_205,518 ttgtccaccgcaaatgcttc aagccatgccaatctcgtct 107 IL-1β, interleukin-1β; IL-6, interleukin-6; TNF-α, tumor necrosis factor-α. View Large Statistics Data were analyzed using General Linear Model procedure of SAS (SAS Inst. Inc., Cary, NC). The model for the factorial design included the CSH, AFB1, and the CSH × AFB1 interaction. The differences among treatments were analyzed using ANOVA. Cage or pooled digesta per cage was the experimental unit for growth performance or gut bacterial counting. The mean of 6 birds per cage was the statistical unit for blood samples and gene expression. Lesions in the liver or intestine were compared using total lesion scores of 6 birds per cage. Differences of variables were separated using Tukey's Studentized Range test at P < 0.05 level of significance. RESULTS Growth Performance and Mortality In Table 3, at 1 to 21 d, there were significant effects (P < 0.001) of AFB1, CSH, and their interactions on ADFI and ADG. Compared with AFB1 treatment, the inclusion of CSH increased (P < 0.05) ADFI and ADG, and both reached to the levels of control treatment. Table 3. Effect of cysteamine hydrochloride on the growth performance and mortality of broilers fed aflatoxin B1 contaminated diets. Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 1 to 21 d of age ADFI (g/bird) 43.50a,b 43.97a 41.19c 43.22b 0.144 <0.001 <0.001 <0.001 ADG (g/bird) 29.10a,b 29.27a 26.95c 28.57b 0.154 <0.001 <0.001 <0.001 FCR 1.495 1.503 1.528 1.512 0.013 0.026 0.638 0.211 Mortality (%) 1.67 1.67 2.50 2.50 1.086 0.452 1.000 1.000 22 to 42 d of age ADFI (g/bird) 189.3b 192.2a 183.1d 186.6c 14.38 <0.001 <0.001 0.593 ADG (g/bird) 80.37a 80.83a 73.47c 76.10b 0.571 <0.001 0.014 0.071 FCR 2.356c 2.377b,c 2.494a 2.452a,b 0.029 <0.001 0.624 0.133 Mortality (%) 2.50 2.50 4.25 3.38 1.045 0.223 0.679 0.679 Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 1 to 21 d of age ADFI (g/bird) 43.50a,b 43.97a 41.19c 43.22b 0.144 <0.001 <0.001 <0.001 ADG (g/bird) 29.10a,b 29.27a 26.95c 28.57b 0.154 <0.001 <0.001 <0.001 FCR 1.495 1.503 1.528 1.512 0.013 0.026 0.638 0.211 Mortality (%) 1.67 1.67 2.50 2.50 1.086 0.452 1.000 1.000 22 to 42 d of age ADFI (g/bird) 189.3b 192.2a 183.1d 186.6c 14.38 <0.001 <0.001 0.593 ADG (g/bird) 80.37a 80.83a 73.47c 76.10b 0.571 <0.001 0.014 0.071 FCR 2.356c 2.377b,c 2.494a 2.452a,b 0.029 <0.001 0.624 0.133 Mortality (%) 2.50 2.50 4.25 3.38 1.045 0.223 0.679 0.679 a-dMeans within a row with no common superscripts are significantly different (P < 0.05). AFB1, aflatoxin B1; ADFI, average daily feed intake; ADG, average daily body weight gain; CSH, cysteamine hydrochloride; FCR, feed conversion ratio. –, not detectable (< 2 μg/kg). View Large Table 3. Effect of cysteamine hydrochloride on the growth performance and mortality of broilers fed aflatoxin B1 contaminated diets. Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 1 to 21 d of age ADFI (g/bird) 43.50a,b 43.97a 41.19c 43.22b 0.144 <0.001 <0.001 <0.001 ADG (g/bird) 29.10a,b 29.27a 26.95c 28.57b 0.154 <0.001 <0.001 <0.001 FCR 1.495 1.503 1.528 1.512 0.013 0.026 0.638 0.211 Mortality (%) 1.67 1.67 2.50 2.50 1.086 0.452 1.000 1.000 22 to 42 d of age ADFI (g/bird) 189.3b 192.2a 183.1d 186.6c 14.38 <0.001 <0.001 0.593 ADG (g/bird) 80.37a 80.83a 73.47c 76.10b 0.571 <0.001 0.014 0.071 FCR 2.356c 2.377b,c 2.494a 2.452a,b 0.029 <0.001 0.624 0.133 Mortality (%) 2.50 2.50 4.25 3.38 1.045 0.223 0.679 0.679 Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 1 to 21 d of age ADFI (g/bird) 43.50a,b 43.97a 41.19c 43.22b 0.144 <0.001 <0.001 <0.001 ADG (g/bird) 29.10a,b 29.27a 26.95c 28.57b 0.154 <0.001 <0.001 <0.001 FCR 1.495 1.503 1.528 1.512 0.013 0.026 0.638 0.211 Mortality (%) 1.67 1.67 2.50 2.50 1.086 0.452 1.000 1.000 22 to 42 d of age ADFI (g/bird) 189.3b 192.2a 183.1d 186.6c 14.38 <0.001 <0.001 0.593 ADG (g/bird) 80.37a 80.83a 73.47c 76.10b 0.571 <0.001 0.014 0.071 FCR 2.356c 2.377b,c 2.494a 2.452a,b 0.029 <0.001 0.624 0.133 Mortality (%) 2.50 2.50 4.25 3.38 1.045 0.223 0.679 0.679 a-dMeans within a row with no common superscripts are significantly different (P < 0.05). AFB1, aflatoxin B1; ADFI, average daily feed intake; ADG, average daily body weight gain; CSH, cysteamine hydrochloride; FCR, feed conversion ratio. –, not detectable (< 2 μg/kg). View Large At 22 to 42 d, the AFB1 affected (P < 0.001) ADFI, ADG, and FCR, whereas the CSH affected (P < 0.05) the ADFI and ADG. Compared with the AFB1 treatment, the diet with AFB1 contamination and CSH inclusion improved (P < 0.05) the ADFI and ADG, but did not reach the levels of control diet. During the 2 phases, the mortality was not affected by the CSH and AFB1. Enterotoxigenic Status and Visceral Lesions The ileal counts of E. coli and Gram– were increased (P < 0.05) by dietary AFB1 (Table 4), and the counts of E. coli, C. perfringens, and Gram– were decreased (P < 0.001) by CSH inclusion. Compared with AFB1 treatment, the Gram– was decreased (P < 0.05) by 7.2% in CSH treatment, which caused an interaction (P = 0.001). Table 4. Effect of cysteamine hydrochloride on the opportunistic bacteria, enterotoxic markers, and visceral lesions of broilers fed aflatoxin B1 contaminated diets. Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Opportunistic bacteria (Log10 cfu/g of ileal digesta) E. coli 6.44b,c 6.25c 7.01a 6.76a,b 0.091 <0.001 0.023 0.746 C. perfringens 2.74b 2.70b 3.22a 3.12a 0.069 <0.001 0.354 0.628 Gram– 6.56c 6.56c 7.57a 7.03b 0.072 <0.001 0.001 0.001 Serum enterotoxic markers Endotoxin (EU/mL) 0.23b 0.23b 0.31a 0.27a,b 0.022 <0.001 0.068 0.091 DAO (U/mL) 0.82b,c 0.79c 1.20a 0.97b 0.040 <0.001 0.004 0.024 Lesion scores Liver 0.67b 0.67b 1.67a 0.67b 0.247 0.057 0.057 0.057 Intestine 1.67b 1.33b 3.00a 1.83b 0.214 <0.001 0.002 0.066 Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Opportunistic bacteria (Log10 cfu/g of ileal digesta) E. coli 6.44b,c 6.25c 7.01a 6.76a,b 0.091 <0.001 0.023 0.746 C. perfringens 2.74b 2.70b 3.22a 3.12a 0.069 <0.001 0.354 0.628 Gram– 6.56c 6.56c 7.57a 7.03b 0.072 <0.001 0.001 0.001 Serum enterotoxic markers Endotoxin (EU/mL) 0.23b 0.23b 0.31a 0.27a,b 0.022 <0.001 0.068 0.091 DAO (U/mL) 0.82b,c 0.79c 1.20a 0.97b 0.040 <0.001 0.004 0.024 Lesion scores Liver 0.67b 0.67b 1.67a 0.67b 0.247 0.057 0.057 0.057 Intestine 1.67b 1.33b 3.00a 1.83b 0.214 <0.001 0.002 0.066 a-cMeans within a row with no common superscripts are significantly different (P < 0.05). AFB1, aflatoxin B1; C. perfringens, Clostridium perfringens; CSH, cysteamine hydrochloride; DAO, diamine oxidase; E. coli, Escherichia coli; Gram–, Gram-negative bacteria. –, not detectable (< 2 μg/kg). View Large Table 4. Effect of cysteamine hydrochloride on the opportunistic bacteria, enterotoxic markers, and visceral lesions of broilers fed aflatoxin B1 contaminated diets. Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Opportunistic bacteria (Log10 cfu/g of ileal digesta) E. coli 6.44b,c 6.25c 7.01a 6.76a,b 0.091 <0.001 0.023 0.746 C. perfringens 2.74b 2.70b 3.22a 3.12a 0.069 <0.001 0.354 0.628 Gram– 6.56c 6.56c 7.57a 7.03b 0.072 <0.001 0.001 0.001 Serum enterotoxic markers Endotoxin (EU/mL) 0.23b 0.23b 0.31a 0.27a,b 0.022 <0.001 0.068 0.091 DAO (U/mL) 0.82b,c 0.79c 1.20a 0.97b 0.040 <0.001 0.004 0.024 Lesion scores Liver 0.67b 0.67b 1.67a 0.67b 0.247 0.057 0.057 0.057 Intestine 1.67b 1.33b 3.00a 1.83b 0.214 <0.001 0.002 0.066 Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Opportunistic bacteria (Log10 cfu/g of ileal digesta) E. coli 6.44b,c 6.25c 7.01a 6.76a,b 0.091 <0.001 0.023 0.746 C. perfringens 2.74b 2.70b 3.22a 3.12a 0.069 <0.001 0.354 0.628 Gram– 6.56c 6.56c 7.57a 7.03b 0.072 <0.001 0.001 0.001 Serum enterotoxic markers Endotoxin (EU/mL) 0.23b 0.23b 0.31a 0.27a,b 0.022 <0.001 0.068 0.091 DAO (U/mL) 0.82b,c 0.79c 1.20a 0.97b 0.040 <0.001 0.004 0.024 Lesion scores Liver 0.67b 0.67b 1.67a 0.67b 0.247 0.057 0.057 0.057 Intestine 1.67b 1.33b 3.00a 1.83b 0.214 <0.001 0.002 0.066 a-cMeans within a row with no common superscripts are significantly different (P < 0.05). AFB1, aflatoxin B1; C. perfringens, Clostridium perfringens; CSH, cysteamine hydrochloride; DAO, diamine oxidase; E. coli, Escherichia coli; Gram–, Gram-negative bacteria. –, not detectable (< 2 μg/kg). View Large For serum enterotoxic markers, the AFB1 affected (P < 0.001) endotoxin and DAO, whereas CSH affected (P = 0.004) DAO, and an interaction (P = 0.024) was found on DAO. Compared with AFB1 treatment, the level of DAO in CSH treatment was decreased (P < 0.05) by 19.2%. The intestinal lesion scores were affected by AFB1 (P < 0.001) and CSH (P = 0.002). The liver lesion scores were not affected by the 2 dietary factors, and there were no interactions. Compared with the AFB1 treatment, the liver and intestinal lesion scores in the CSH supplemental treatment were decreased (P < 0.05) by 59.9 and 39.0%, respectively. Glutathione Turnover and Inflammatory Factors There were significant effects (P < 0.001) of AFB1 and CSH on the profiles of r-GSH, GSTs, and GR (Table 5). The increasing effect of CSH on GSTs was more pronounced (P < 0.05) in diets without AFB1 contamination, which caused an interaction (P < 0.01). Compared with the control, r-GSH, GSTs, and GR in the CSH treatment were increased (P < 0.05) by 18.4, 72.1, and 31.8%, respectively. Compared with the AFB1 treatment, the GR in CSH treatment was increased (P < 0.05) by 48.9%. Table 5. Effect of cysteamine hydrochloride on the glutathione turnover and inflammatory factors in the serum of broilers fed aflatoxin B1 contaminated diets. Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Glutathione turnover r-GSH (mg/g) 28.26b 33.45a 19.19b 24.55b 1.202 <0.001 <0.001 0.955 GSTs (U/g) 354.0b 609.2a 194.3c 270.6c 19.62 <0.001 <0.001 <0.001 GR (U/g) 26.55b 35.00a 17.04c 25.38b 1.706 <0.001 <0.001 0.975 Inflammatory factors (mRNA expression, 2−ΔΔCt) TNF-α 2.20b 1.79c 3.11a 3.05a 0.090 <0.001 0.016 0.062 IL-6 5.62b 4.49b 7.25a 5.04b 0.370 0.008 <0.001 0.163 IL-1β 4.59a,b 3.59b 4.98a 3.82b 0.269 0.268 0.001 0.772 Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Glutathione turnover r-GSH (mg/g) 28.26b 33.45a 19.19b 24.55b 1.202 <0.001 <0.001 0.955 GSTs (U/g) 354.0b 609.2a 194.3c 270.6c 19.62 <0.001 <0.001 <0.001 GR (U/g) 26.55b 35.00a 17.04c 25.38b 1.706 <0.001 <0.001 0.975 Inflammatory factors (mRNA expression, 2−ΔΔCt) TNF-α 2.20b 1.79c 3.11a 3.05a 0.090 <0.001 0.016 0.062 IL-6 5.62b 4.49b 7.25a 5.04b 0.370 0.008 <0.001 0.163 IL-1β 4.59a,b 3.59b 4.98a 3.82b 0.269 0.268 0.001 0.772 a–cMeans within a row with no common superscripts are significantly different (P < 0.05). AFB1, aflatoxin B1; CSH, cysteamine hydrochloride; GR, glutathione reductase; GSTs, glutathione s-transferases; IL-1β, interleukin-1β; IL-6, interleukin-6; r-GSH, reduced glutathione; TNF-α, tumor necrosis factor-α. –, not detectable (< 2 μg/kg). View Large Table 5. Effect of cysteamine hydrochloride on the glutathione turnover and inflammatory factors in the serum of broilers fed aflatoxin B1 contaminated diets. Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Glutathione turnover r-GSH (mg/g) 28.26b 33.45a 19.19b 24.55b 1.202 <0.001 <0.001 0.955 GSTs (U/g) 354.0b 609.2a 194.3c 270.6c 19.62 <0.001 <0.001 <0.001 GR (U/g) 26.55b 35.00a 17.04c 25.38b 1.706 <0.001 <0.001 0.975 Inflammatory factors (mRNA expression, 2−ΔΔCt) TNF-α 2.20b 1.79c 3.11a 3.05a 0.090 <0.001 0.016 0.062 IL-6 5.62b 4.49b 7.25a 5.04b 0.370 0.008 <0.001 0.163 IL-1β 4.59a,b 3.59b 4.98a 3.82b 0.269 0.268 0.001 0.772 Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Glutathione turnover r-GSH (mg/g) 28.26b 33.45a 19.19b 24.55b 1.202 <0.001 <0.001 0.955 GSTs (U/g) 354.0b 609.2a 194.3c 270.6c 19.62 <0.001 <0.001 <0.001 GR (U/g) 26.55b 35.00a 17.04c 25.38b 1.706 <0.001 <0.001 0.975 Inflammatory factors (mRNA expression, 2−ΔΔCt) TNF-α 2.20b 1.79c 3.11a 3.05a 0.090 <0.001 0.016 0.062 IL-6 5.62b 4.49b 7.25a 5.04b 0.370 0.008 <0.001 0.163 IL-1β 4.59a,b 3.59b 4.98a 3.82b 0.269 0.268 0.001 0.772 a–cMeans within a row with no common superscripts are significantly different (P < 0.05). AFB1, aflatoxin B1; CSH, cysteamine hydrochloride; GR, glutathione reductase; GSTs, glutathione s-transferases; IL-1β, interleukin-1β; IL-6, interleukin-6; r-GSH, reduced glutathione; TNF-α, tumor necrosis factor-α. –, not detectable (< 2 μg/kg). View Large There were significant effects (P < 0.01) of AFB1 on the mRNA profiles of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6), whereas the CSH affected TNF-α, IL-6, and interleukin-1β (IL-1β). Compared with the control, the TNF-α in the CSH treatment was lower (P < 0.05) by 18.6%. Compared with the AFB1 treatment, IL-6 and IL-1β in CSH treatment were decreased (P < 0.05) by 30.5 and 23.3%, respectively. DISCUSSION In the present study, supplemental CSH improved the ADFI and ADG of broilers, with responses being more pronounced at the presence of AFB1, indicating that CSH relieved the toxicity of AFB1. Dunshea (2007) reported that dietary CSH increased daily gain, carcass weight, and gain: feed in finisher gilts. Nunes et al. (2012) found that the diet supplemented with cysteamine improved feed conversion. However, based on AFB1 contaminated diets, the information about CSH on growth performance is unavailable in farm animals. In the present study, with the concurrence of AFB1, the CSH effect was more pronounced, and they were interactive in ADFI and ADG at 1 to 21 d, and how the CSH interacts with growth axis of animals with exposure to AFB1 needs further study. Besides the growth-promoting effect, the CSH or derivatives are important antioxidants for detoxification in the liver or gut. The oxidative stress is mainly caused by enterotoxins from toxigenic microbiota when their balance is disturbed (Mani et al., 2012; Tremaroli and Bäckhed, 2012). Furthermore, with the occurrence of moldy feedstuffs, a lower level of AFB1 in the diet is a major predisposing factor for gut flora disruption and enterocyte oxidation (Yarru et al., 2009). Liu et al. (2018) reported that dietary AFB1 increased the count of C. perfringens in the ileal digsta of broilers. Similarly, in the present study the counts of E. coli, C. perfringens, and Gram– were increased by the AFB1, whereas E. coli and Gram– were decreased by the CSH, and an interaction was found on Gram–. Also, serum levels of endotoxins and DAO were increased by the AFB1, and the level of DAO was decreased by the CSH. The result indicates that the CSH can depress gut opportunistic bacteria and their toxicity. The literature about the effect of non-protein sulfhydryl groups on gut flora is unavailable, but the effect on serum toxic markers of CSH in the present study was supported by the findings that cysteamine had beneficial effect on tissue damage induced by endotoxin, ischemia-reperfusion, and hemorrhagic shock in rodent animals (Glantzounis et al., 2006; Mota et al., 2007) or in pigs (Zhou et al., 2017). Necrotic lesions are caused by factors external to the cell or tissue, such as contamination, toxins, or trauma which result in the unregulated digestion of cell components. The increased lesion scores of liver and intestine in the present study further demonstrated the toxicity of AFB1. With the occurrence of moldy feedstuffs, AFB1, the most toxic, is becoming a major predisposing factor of necrotic lesions of visceral organs of broilers (Kumar and Balachandran, 2009). The information about the effect of CSH or its analogs on the visceral lesions is scarce. In the present study, regardless of AFB1, the CSH decreased lesion scores in the liver and intestine, indicating that the CSH can protect cell or tissue and decrease lesions. Anyway, the CSH or its derivatives as feed additives, the relationship of them with necrotic lesions needs further study. In the present study, the AFB1 decreased the r-GSH, GSTs, and GR, whereas the CSH increased r-GSH, GSTs, and GR. The CSH or derivatives act through sulfhydryl-disulfide exchange reactions in glutathione redox cycle, so the providing of sulfhydryl group can facilitate the synthesis and turnover of glutathione (Courtney-Martin and Pencharz, 2016). Based on AFB1 contaminated diets, there are no reports on the effect of CSH or derivatives on glutathione turnover. Yarru et al. (2009) found that AFB1 increased the expression of superoxide dismutase and GSTs in the liver of broilers. Zhou et al. (2017) reported that increased glutathione content and glutathione peroxidase activity and decreased malondialdehyde content were observed in pigs receiving cysteamine. Bai et al. (2017) demonstrated that CSH improved antioxidant status and delayed pig meat discoloration by improving glutathione levels and antioxidase activity after longer chill storage, and promoted the stability of pork color by reducing oxidation. For the relationship between AFB1 and glutathione status, Valdivia et al. (2001) found that broilers treated with AFB1 plus N-acetylcysteine were shown to be partially protected against deleterious effects on plasma alanine aminotransferase, and liver GSTs and glutathione. Thiol-containing compounds also influence inflammation and immunity by intracellular glutathione and cysteine levels (Ruan et al., 2017). In the present study, the mRNA profiles of TNF-α and IL-6 were increased by AFB1, and TNF-α, IL-6, and IL-1β were decreased by CSH, but the levels of TNF-α and IL-6 were greater than the control, indicating that the CSH can relieve the inflammation caused by AFB1, but for TNF-α, the effect does not reach the level of control. It is well documented that AFB1 can cause immunotoxicity and inflammatory responses in rats (Hinton et al., 2003) or broilers (Li et al., 2014; Ma et al., 2015) and cysteamine, as a US FDA-approved drug, has antioxidant, antibacterial, anti-inflammatory, and mucolytic properties (Kopp et al., 2017; Vij, 2017). In farm animals, cysteamine supplementation increased the concentrations of secretory IgA, IgM, and IgG in the jejunal mucosa of pigs (Zhou et al., 2017), and induced proliferation and differentiation of IgA-positive cells and intraepithelial lymphocytes in the intestinal mucosa of chickens by reducing the number of somatostatin-positive cells (Yang et al., 2007). CONCLUSIONS Diets contaminated with AFB1 depressed growth performance and glutathione turnover, and exacerbated enterotoxic status. The CSH supplementation increased ADFI, ADG, and glutathione turnover, but decreased ileal E. coli and Gram–, the mRNA levels of TNF-α, IL-1β, and IL-6, serum DAO, and intestinal lesions. There were interactions of CSH and AFB1 on Gram–, DAO, and GSTs. The results suggest that the CSH supplementation can decrease gut opportunistic bacterial populations and inflammatory factors by facilitating glutathione turnover in broilers fed AFB1 contaminated diets. ACKNOWLEDGMENTS This research was supported by the National Natural Science Foundation of China (31272466). REFERENCES Bai M. , Liu H. , Xu K. , Zou B. , Yu R. , Liu Y. , Xing W. , Du H. , Li Y. , Yin Y. . 2018 . Effects of dietary coated cysteamine hydrochloride on pork color in finishing pigs . J. Sci. Food Agric. 98 : 1743 – 1750 . Google Scholar CrossRef Search ADS PubMed Courtney-Martin G. , Pencharz P. B. . 2016 . Sulfur Amino Acids Metabolism from Protein Synthesis to Glutathione in the Molecular Nutrition of Amino Acids and Proteins . Pages: 265 – 286 . Academic Press , Rochester, NY . Google Scholar CrossRef Search ADS Dunshea F. R. 2007 . Porcine somatotropin and cysteamine hydrochloride improve growth performance and reduce back fat in finisher gilts . Aust. J. Exp. Agric. 47 : 796 – 800 . Google Scholar CrossRef Search ADS Gholamiandehkordi A. R. , Timbermont L. , Lanckriet A. , Broeck W. V. D. , Pedersen K. , Dewulf J. , Pasmans F. , Haesebrouck F. , Ducatelle R. , Immerseel F. V. . 2007 . Quantification of gut lesions in a subclinical necrotic enteritis model . Avian Pathol. 36 : 375 – 382 . Google Scholar CrossRef Search ADS PubMed Glantzounis G. K. , Yang W. , Koti R. S. , Mikhailidis D. P. , Seifalian A. M. , Davidson B. R. . 2006 . The role of thiols in liver ischemia-reperfusion injury . Curr. Pharm. Des. 12 : 2891 – 2901 . Google Scholar CrossRef Search ADS PubMed Hafez H. M. 2011 . Enteric diseases of poultry with special attention to Clostridium perfringens . Pak. Vet. J. 31 : 175 – 184 . Hinton D. M. , Myers M. J. , Raybourne R. A. , Francke-Carroll S. , Sotomayor R. E. , Shaddock J. , Warbritton A. , Chou M. W. . 2003 . Immunotoxicity of aflatoxin B1 in rats: effects on lymphocytes and the inflammatory response in a chronic intermittent dosing study . Toxicol. Sci. 73 : 362 – 377 . Google Scholar CrossRef Search ADS PubMed Hu Y. , Ni Y. , Ren L. , Dai J. , Zhao R. . 2008 . Leptin is involved in the effects of cysteamine on egg laying of hens, characteristics of eggs, and posthatch growth of broiler offspring . Poult. Sci. 87 : 1810 – 1817 . Google Scholar CrossRef Search ADS PubMed Immerseel F. V. , Buck J. D. , Pasmans F. , Huyghebaert G. , Haesebrouck F. , Ducatelle R. . 2004 . Clostridium perfringens in poultry: an emerging threat for animal and public health . Avian Pathol. 33 : 537 – 549 . Google Scholar CrossRef Search ADS PubMed Kopp B. T. , Shrestha C. , Assani K. , Schlesinger L. S. . 2017 . Cysteamine-mediated clearance of multi-drug resistant pathogens from cystic fibrosis macrophages . Am. J. Respir. Crit. Care Med. 195 : A4850 . Kumar R. , Balachandran C. . 2009 . Histopathological changes in broiler chickens fed aflatoxin and cyclopiazonic acid . Vet. Arch. 79 : 31 – 40 . Li Y. , Ma Q. G. , Zhao L. H. , Wei H. , Duan G. X. , Zhang J. Y. , Ji C. . 2014 . Effects of lipoic acid on immune function, the antioxidant defense system, and inflammation-related genes expression of broiler chickens fed aflatoxin contaminated diets . Int. J. Mol. Sci. 15 : 5649 – 5662 . Google Scholar CrossRef Search ADS PubMed Liu N. , Ru Y. J. , Li F. D. , Cowieson A. J. . 2008 . Effect of diet containing phytate and phytase on the activity and messenger ribonucleic acid expression of carbohydrase and transporter in chickens . J. Anim. Sci. 86 : 3432 – 3439 . Google Scholar CrossRef Search ADS PubMed Liu N. , Wang J. Q. , Chao J. S. , Chen Y. K. , Wang J. P. . 2018 . Effect of yeast cell wall on the growth performance and gut health of broilers challenged with aflatoxin B1 and necrotic enteritis . Poult. Sci. 97 : 477 – 484 . Google Scholar CrossRef Search ADS PubMed Ma Q. , Li Y. , Fan Y. , Zhao L. , Wei H. , Ji C. , Zhang J. . 2015 . Molecular mechanisms of lipoic acid protection against aflatoxin B1-induced liver oxidative damage and inflammatory responses in broilers . Toxins 7 : 5435 – 5447 . Google Scholar CrossRef Search ADS PubMed Mani V. , Weber T. E. , Baumgard L. H. , Gabler N. K. . 2012 . Growth and development symposium: endotoxin, inflammation, and intestinal function in livestock . J. Anim. Sci. 90 : 1452 – 1465 . Google Scholar CrossRef Search ADS PubMed Morrison J. P. , Coleman M. C. , Aunan E. S. , Walsh S. A. , Spitz D. R. , Kregel K. C. . 2005 . Thiol supplementation in aged animals alters antioxidant enzyme activity after heat stress . J. Appl. Physiol. 99 : 2271 – 2277 . Google Scholar CrossRef Search ADS PubMed Mota J. M. S. , Soares P. M. , Menezes A. A. , Lemos H. P. , Cunha F. Q. , Brito G. A. C. , Ribeiro R. A. , de Souza M. H. . 2007 . Amifostine (Wr-2721) prevents indomethacin-induced gastric damage in rats: role of non-protein sulfhydryl groups and leukocyte adherence . Dig. Dis. Sci. 52 : 119 – 125 . Google Scholar CrossRef Search ADS PubMed Nunes J. O. , Bertechini A. G. , Á. G. D. Brito J. , Makiyama L. , Mesquita F. R. , Nishio C. M. . 2012 . Evaluation of cysteamine associated with different energy patterns in diets for broiler chickens. Czech . J. Anim. Sci. 41 : 1956 – 1960 . Reid E. E. 1958 . Organic Chemistry of Bivalent Sulfur . Pages: 398 – 399 . Chemical Publishing Co. , Los Angeles, CA . Ruan T. , Li L. , Peng X. , Wu B. . 2017 . Effects of methionine on the immune function in animals . Health (N. Y) 9 : 857 – 869 . Tremaroli V. , Bäckhed F. . 2012 . Functional interactions between the gut microbiota and host metabolism . Nature 489 : 242 – 249 . Google Scholar CrossRef Search ADS PubMed Valdivia A. G. , Martinez A. , Damian F. J. , Quezada T. , Ortiz R. , Martinez C. , Llamas J. , Rodriguez M. L. , Yamamoto L. , Jaramillo F. , Loarca-Pina M. G. . 2001 . Efficacy of N-acetylcysteine to reduce the effects of aflatoxin B1 intoxication in broiler chickens . Poult. Sci. 80 : 727 – 734 . Google Scholar CrossRef Search ADS PubMed Vij N. 2017 . Nano-based rescue of dysfunctional autophagy in chronic obstructive lung diseases . Expert Opin. Drug Deliv. 14 : 483 – 489 . Google Scholar CrossRef Search ADS PubMed Wang C. , Dong C. J. , Wang Z. Q. , Yang F. , Mao H. L. , Wu Z. , Zhou Q. , Wang H. F. . 2015 . Effect of cysteamine hydrochloride supplementation on the milk performance of dairy cow . Livestock Sci. 178 : 94 – 99 . Google Scholar CrossRef Search ADS Wu S. , Stanley D. , Rodgers N. , Swick R. A. , Moore R. J. . 2014 . Two necrotic enteritis predisposing factors, dietary fishmeal and Eimeria infection, induce large changes in the caecal microbiota of broiler chickens . Vet. Microbiol. 169 : 188 – 197 . Google Scholar CrossRef Search ADS PubMed Xiong B. , Pang Z. , Zhao F. , Luo Q. . 2014 . Tables of Feed Composition and Nutritive Values In China , 25th ed . China Feed Database , Beijing, China . Yang Q. , Lian G. , Gong X. . 2007 . Enhancement of mucosal immune responses in chickens by oral administration of cysteamine . Poult. Sci. 86 : 1323 – 1328 . Google Scholar CrossRef Search ADS PubMed Yarru L. P. , Settivari R. S. , Gowda N. K. S. , Antoniou E. , Ledoux D. R. , Rottinghaus G. E. . 2009 . Effects of turmeric (Curcuma longa) on the expression of hepatic genes associated with biotransformation, antioxidant, and immune systems in broiler chicks fed aflatoxin . Poult. Sci. 88 : 2620 – 2627 . Google Scholar CrossRef Search ADS PubMed Zhou P. , Luo Y. , Zhang L. , Li J. , Zhang B. , Xing S. , Zhu Y. , Gao F. , Zhou G. . 2017 . Effects of cysteamine supplementation on the intestinal expression of amino acid and peptide transporters and intestinal health in finishing pigs . Anim Sci. J. 88 : 314 – 321 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Effect of cysteamine hydrochloride supplementation on the growth performance, enterotoxic status, and glutathione turnover of broilers fed aflatoxin B1 contaminated diets

Loading next page...
 
/lp/ou_press/effect-of-cysteamine-hydrochloride-supplementation-on-the-growth-s5413S1eqV
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pey206
Publisher site
See Article on Publisher Site

Abstract

ABSTRACT This study aimed to investigate the effect of cysteamine hydrochloride (CSH) supplementation on the growth performance, opportunistic bacteria and enterotoxic markers, visceral lesions, glutathione turnover, and inflammatory factors of broilers fed diets contaminated with aflatoxin B1 (AFB1). One-day-old Arbor Acres broilers (n = 480) were randomly allocated to 4 treatments with 6 replicates of 20 chicks each for a 2 × 2 design with CSH (0 or 200 mg/kg) and AFB1 (0 or 40 μg/kg). The trial lasted for 42 d. Results showed that AFB1 negatively affected (P < 0.05) growth performance, opportunistic bacteria and enterotoxic markers, intestinal lesions, glutathione turnover, and inflammatory factors. The CSH increased (P < 0.05) feed intake and body weight gain. The enterotoxic status was relieved in the CSH treatments by reducing (P < 0.05) the populations of gut Escherichia coli, Gram-negative bacteria, serum diamine oxidase, and intestinal lesions. The CSH also increased (P < 0.05) serum reduced glutathione, glutathione s-transferases, and glutathione reductase, and decreased (P < 0.05) the mRNA levels of tumor necrosis factor-α, interleukin-6, and interleukin-1β. Significant interactions (P < 0.05) were found on Gram-negative bacteria, diamine oxidase, and glutathione s-transferases. The results suggest that the CSH can improve glutathione turnover and reduce the risk of enterotoxic disease induced by AFB1 in broilers. INTRODUCTION Sulfhydryl group in glutathione has a pivotal role in counteracting oxidative stress and inflammatory occurrence, and this group based products have recently started to use in animal feeds (Hu et al., 2008; Wang et al., 2015; Bai et al., 2017). As a commercial additive, cysteamine hydrochloride (CSH) is the simplest and the most stable among aminothiol compounds (Reid, 1958). Studies showed that supplemental CSH or its derivatives improved animal growth by reducing oxidative stress, enhancing immunity and intestinal integrity (Morrison et al., 2005; Wang et al., 2015; Zhou et al., 2017). The oxidative stress of animals is related to enterotoxic status or toxins that are derived from contaminated feeds or imbalanced gut opportunistic bacteria, such as aflatoxin B1 (AFB1), Gram-negative bacteria (Gram–), Clostridium perfringens, and Escherichia coli. These consequently result in intestinal hyperpermeability, inflammatory responses, and even the occurrence of enteric diseases (Immerseel et al., 2004; Yarru et al., 2009; Hafez, 2011; Liu et al., 2018). So it is interesting whether CSH can influence the toxicity of dietary toxins and populations of opportunistic bacteria in the intestine of farm animals. But literature about this is unavailable. The CSH or derivatives act through sulfhydryl-disulfide exchange reactions in glutathione redox cycle, so the providing of sulfhydryl group can theoretically facilitate the synthesis and turnover of glutathione (Courtney-Martin and Pencharz, 2016). Meanwhile, the AFB1 contamination in feedstuffs is becoming a considerable threat to the gut health of growing animals. However, information about the effect of CSH on glutathione turnover in AFB1 contaminated animals is very limited. Therefore, the present study aimed to investigate the effect of dietary CSH on growth performance, opportunistic bacteria and endotoxins, visceral lesions, glutathione turnover, and inflammatory factors of broilers fed diets contaminated with AFB1. MATERIAL AND METHODS Diets, CSH, and AFB1 The experiment was a 2 × 2 factorial design without or with CSH (200 mg/kg) or AFB1 (40 μg/kg). The CSH was coated, provided by Hangzhou King Techina Technology Co., Ltd (Hangzhou, China). The AFB1 was produced using Aspergillus flavus from the China General Microbiological Culture Collection Center as described by Liu et al. (2018). The AFB1 concentrations in the moldy corn meal were detected at 3764 μg/kg. Uncontaminated control corn was replaced by the moldy corn to yield a concentration of 40 μg AFB1 per kg diet. The nutritive values of basal diet were recommended by Arbor Acres Broiler Management Handbook in China, and diets were stored in a cool, dry, dark, and well-ventilated place and fed as mash on air-dry basis. No antibiotics were offered to broilers via either feed or water throughout the trial. The formulation of the basal diet was listed in Table 1. Table 1. Ingredients and nutrient levels of basal diet1 (air-dry basis). Contents (%) Items 1 to 21 d of age 22 to 42 d of age Ingredients Corn 60.00 57.57 Soybean meal 25.00 25.45 Corn gluten meal 8.70 4.50 Full-fat soybean 0 3.50 Soybean oil 1.35 5.00 Limestone 1.20 1.00 L-Lysine 0.53 0.13 DL-Methionine 0.12 0.10 Salt 0.30 0.40 Dicalcium phosphate 2.15 1.70 Choline chloride 0.15 0.15 Premix2 0.50 0.50 Nutrients3 Crude protein 21.90 20.00 ME (MJ/kg) 12.61 13.38 Ca 1.02 0.86 Non-phytate P 0.50 0.42 Methionine 0.50 0.43 Lysine 1.43 1.07 Contents (%) Items 1 to 21 d of age 22 to 42 d of age Ingredients Corn 60.00 57.57 Soybean meal 25.00 25.45 Corn gluten meal 8.70 4.50 Full-fat soybean 0 3.50 Soybean oil 1.35 5.00 Limestone 1.20 1.00 L-Lysine 0.53 0.13 DL-Methionine 0.12 0.10 Salt 0.30 0.40 Dicalcium phosphate 2.15 1.70 Choline chloride 0.15 0.15 Premix2 0.50 0.50 Nutrients3 Crude protein 21.90 20.00 ME (MJ/kg) 12.61 13.38 Ca 1.02 0.86 Non-phytate P 0.50 0.42 Methionine 0.50 0.43 Lysine 1.43 1.07 1Aflatoxin B1 is not detectable (< 2 μg/kg) in the basal diet. 2Provided per kg diet: vitamin A (retinyl acetate), 8,000 IU; cholecalciferol, 1,000 IU; vitamin E (DL-tocopheryl acetate), 20 IU; vitamin K, 0.5 mg; thiamin, 2.0 mg; riboflavin, 8.0 mg; d-pantothenic acid, 10 mg; niacin, 35 mg; pyridoxine, 3.5 mg; biotin, 0.18 mg; folic acid, 0.55 mg; vitamin B12, 0.010 mg; manganese, 120 mg; iodine, 0.70 mg; iron, 100 mg; copper, 8 mg; zinc, 100 mg; and selenium, 0.30 mg. 3Calculated chemical composition by Chinese Feed Database (Xiong et al., 2014). View Large Table 1. Ingredients and nutrient levels of basal diet1 (air-dry basis). Contents (%) Items 1 to 21 d of age 22 to 42 d of age Ingredients Corn 60.00 57.57 Soybean meal 25.00 25.45 Corn gluten meal 8.70 4.50 Full-fat soybean 0 3.50 Soybean oil 1.35 5.00 Limestone 1.20 1.00 L-Lysine 0.53 0.13 DL-Methionine 0.12 0.10 Salt 0.30 0.40 Dicalcium phosphate 2.15 1.70 Choline chloride 0.15 0.15 Premix2 0.50 0.50 Nutrients3 Crude protein 21.90 20.00 ME (MJ/kg) 12.61 13.38 Ca 1.02 0.86 Non-phytate P 0.50 0.42 Methionine 0.50 0.43 Lysine 1.43 1.07 Contents (%) Items 1 to 21 d of age 22 to 42 d of age Ingredients Corn 60.00 57.57 Soybean meal 25.00 25.45 Corn gluten meal 8.70 4.50 Full-fat soybean 0 3.50 Soybean oil 1.35 5.00 Limestone 1.20 1.00 L-Lysine 0.53 0.13 DL-Methionine 0.12 0.10 Salt 0.30 0.40 Dicalcium phosphate 2.15 1.70 Choline chloride 0.15 0.15 Premix2 0.50 0.50 Nutrients3 Crude protein 21.90 20.00 ME (MJ/kg) 12.61 13.38 Ca 1.02 0.86 Non-phytate P 0.50 0.42 Methionine 0.50 0.43 Lysine 1.43 1.07 1Aflatoxin B1 is not detectable (< 2 μg/kg) in the basal diet. 2Provided per kg diet: vitamin A (retinyl acetate), 8,000 IU; cholecalciferol, 1,000 IU; vitamin E (DL-tocopheryl acetate), 20 IU; vitamin K, 0.5 mg; thiamin, 2.0 mg; riboflavin, 8.0 mg; d-pantothenic acid, 10 mg; niacin, 35 mg; pyridoxine, 3.5 mg; biotin, 0.18 mg; folic acid, 0.55 mg; vitamin B12, 0.010 mg; manganese, 120 mg; iodine, 0.70 mg; iron, 100 mg; copper, 8 mg; zinc, 100 mg; and selenium, 0.30 mg. 3Calculated chemical composition by Chinese Feed Database (Xiong et al., 2014). View Large Animals and Samples All the experimental procedures were approved by the Animal Ethics Committee of the Henan University of Science and Technology (Luoyang, China). A total of 480 1-day-old Arbor Acres broilers (male) were randomly allocated into 4 groups with 6 replicates of 20 chicks each. All chicks were reared in 3-layered cages and given ad libitum access to diets and water throughout the study. The temperature, ventilation, and light regime of chicken house were managed according to Arbor Acres broiler management handbook. Birds and feeds in each cage were weighed at 21 and 42 d old, average daily feed intake (ADFI), average daily body weight gain (ADG), and feed conversion ratio (FCR) were immediately adjusted when mortality occurred. All the birds were monitored for general health at least twice a day. At day 42 of the trial, 6 birds per replicate were randomly selected, weighed, euthanized by CO2, and then dissected. Blood was immediately drawn from the heart with a syringe and aliquoted into sterile vials for serum preparation as described by Liu et al. (2008). Liver, duodenum, jejunum, and ileum were collected and scored for lesions on a scale of 0 to 3 (Gholamiandehkordi et al., 2007). Approximately 1 cm segment in the middle part of duodenum was dissected and stored in an RNA stabilization solution at −20°C for gene expression analysis (Liu et al., 2008). Approximately 2 g ileal digesta was collected and stored at −40°C for gut microflora analysis. Chemical and Biochemical Analysis The concentrations of AFB1 in the moldy corn and feed were detected according to the Standard of China (GB/T 5009.22–2003) with an enzyme-linked immunosorbent assay kit (detection limit 2 μg/kg, Longke Fangzhou Biotech, Beijing, China). The concentrations of serum endotoxin were measured using a limulus amoebocyte lysate-based kit (Lonza, Walkersville, MD). Briefly, samples and standards were incubated for 10 min at 37°C with limulus amoebocyte lysate and then for another 6 min with colorimetric substrate. Internal control for recovery calculation was included in the assessment. The reaction was stopped with 25% acetic acid and then the absorbance was read at 405 nm. The activity of diamine oxidase (DAO) in serum (1 mL) was examined by a spectrophotometric assay. The DAO standard (D7876–250) was purchased from a Sigma-Aldrich supplier in Beijing of China. Serum profiles of reduced glutathione (r-GSH), glutathione s-transferases (GSTs), and glutathione reductase (GR) were detected using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The units of r-GSH, GSTs, and GR were finally calculated and expressed as mg/g, μmol/min·g (U/g), and U/g, respectively, per gram protein in the supernatant of tissue samples to minimize the errors during sample preparation. Three parallel tests with aliquots of the same sample were performed for all samples and all chemical and biochemical analyses. Bacteria Enumeration and mRNA Expression The enumeration of ileal bacteria was carried out according to the method by Wu et al. (2014) with minor modification. Briefly, approximately 1 g of each ileal digesta was diluted with 9 mL of ice-cold sterile buffer peptone water (0.1%) and homogenized. The suspension of each sample was serially diluted between 10−1 and 10−7 dilutions, and 100 μL of each diluted sample was subsequently spread onto duplicate selective agar plates for bacterial counting. The number of cfu was expressed as a logarithmic (log10) transformation per gram of intestinal digesta. Commercial media (Qingdao Hopebio Co., Ltd., Shandong, China) was used for the cultivation and isolation of E. coli (HB7001), C. perfringens (HB0256), and Gram– (HB8643). Total mRNA isolation and cDNA synthesis were carried out according to the description by Liu et al. (2008), and the transcriptional profiles of target genes were expressed as the relative expression to beta-actin gene. Primer information for qPCR was listed in Table 2. Primers and qPCR reagents were provided by Dalian TaKaRa Co., Ltd. (Liaoning, China). The qPCR reactions were set at 10 μL with 5 μL of SYBR Green Master Mix, 1 μL of primer, 4 μL of 10 × diluted cDNA. All qPCRs were run in triplicates on the same thermal cycles (50°C 2 min, 95°C 10 min, 40 cycles of 95°C 15 s and 60°C 1 min) on the ABI Prism 7900HT Fast Real-Time PCR System. No amplification signal was detected in water or no-RT RNA samples. Table 2. Information of primers for quantitative real-time PCR. Primers (5′→3′) Length (bp) Names GenBank Forward Reverse TNF-α HQ739087.1 gagcagggctgacacggat cccaaacgctgcttccaaat 86 IL-1β XM_01,529,7469.1 gaaggtaaggatgggagggct actgtggtgtgctcagaatcc 117 IL-6 AB302327.1 gaaatccctcctcgccaatct ctcacggtcttctccataagc 105 β-actin NM_205,518 ttgtccaccgcaaatgcttc aagccatgccaatctcgtct 107 Primers (5′→3′) Length (bp) Names GenBank Forward Reverse TNF-α HQ739087.1 gagcagggctgacacggat cccaaacgctgcttccaaat 86 IL-1β XM_01,529,7469.1 gaaggtaaggatgggagggct actgtggtgtgctcagaatcc 117 IL-6 AB302327.1 gaaatccctcctcgccaatct ctcacggtcttctccataagc 105 β-actin NM_205,518 ttgtccaccgcaaatgcttc aagccatgccaatctcgtct 107 IL-1β, interleukin-1β; IL-6, interleukin-6; TNF-α, tumor necrosis factor-α. View Large Table 2. Information of primers for quantitative real-time PCR. Primers (5′→3′) Length (bp) Names GenBank Forward Reverse TNF-α HQ739087.1 gagcagggctgacacggat cccaaacgctgcttccaaat 86 IL-1β XM_01,529,7469.1 gaaggtaaggatgggagggct actgtggtgtgctcagaatcc 117 IL-6 AB302327.1 gaaatccctcctcgccaatct ctcacggtcttctccataagc 105 β-actin NM_205,518 ttgtccaccgcaaatgcttc aagccatgccaatctcgtct 107 Primers (5′→3′) Length (bp) Names GenBank Forward Reverse TNF-α HQ739087.1 gagcagggctgacacggat cccaaacgctgcttccaaat 86 IL-1β XM_01,529,7469.1 gaaggtaaggatgggagggct actgtggtgtgctcagaatcc 117 IL-6 AB302327.1 gaaatccctcctcgccaatct ctcacggtcttctccataagc 105 β-actin NM_205,518 ttgtccaccgcaaatgcttc aagccatgccaatctcgtct 107 IL-1β, interleukin-1β; IL-6, interleukin-6; TNF-α, tumor necrosis factor-α. View Large Statistics Data were analyzed using General Linear Model procedure of SAS (SAS Inst. Inc., Cary, NC). The model for the factorial design included the CSH, AFB1, and the CSH × AFB1 interaction. The differences among treatments were analyzed using ANOVA. Cage or pooled digesta per cage was the experimental unit for growth performance or gut bacterial counting. The mean of 6 birds per cage was the statistical unit for blood samples and gene expression. Lesions in the liver or intestine were compared using total lesion scores of 6 birds per cage. Differences of variables were separated using Tukey's Studentized Range test at P < 0.05 level of significance. RESULTS Growth Performance and Mortality In Table 3, at 1 to 21 d, there were significant effects (P < 0.001) of AFB1, CSH, and their interactions on ADFI and ADG. Compared with AFB1 treatment, the inclusion of CSH increased (P < 0.05) ADFI and ADG, and both reached to the levels of control treatment. Table 3. Effect of cysteamine hydrochloride on the growth performance and mortality of broilers fed aflatoxin B1 contaminated diets. Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 1 to 21 d of age ADFI (g/bird) 43.50a,b 43.97a 41.19c 43.22b 0.144 <0.001 <0.001 <0.001 ADG (g/bird) 29.10a,b 29.27a 26.95c 28.57b 0.154 <0.001 <0.001 <0.001 FCR 1.495 1.503 1.528 1.512 0.013 0.026 0.638 0.211 Mortality (%) 1.67 1.67 2.50 2.50 1.086 0.452 1.000 1.000 22 to 42 d of age ADFI (g/bird) 189.3b 192.2a 183.1d 186.6c 14.38 <0.001 <0.001 0.593 ADG (g/bird) 80.37a 80.83a 73.47c 76.10b 0.571 <0.001 0.014 0.071 FCR 2.356c 2.377b,c 2.494a 2.452a,b 0.029 <0.001 0.624 0.133 Mortality (%) 2.50 2.50 4.25 3.38 1.045 0.223 0.679 0.679 Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 1 to 21 d of age ADFI (g/bird) 43.50a,b 43.97a 41.19c 43.22b 0.144 <0.001 <0.001 <0.001 ADG (g/bird) 29.10a,b 29.27a 26.95c 28.57b 0.154 <0.001 <0.001 <0.001 FCR 1.495 1.503 1.528 1.512 0.013 0.026 0.638 0.211 Mortality (%) 1.67 1.67 2.50 2.50 1.086 0.452 1.000 1.000 22 to 42 d of age ADFI (g/bird) 189.3b 192.2a 183.1d 186.6c 14.38 <0.001 <0.001 0.593 ADG (g/bird) 80.37a 80.83a 73.47c 76.10b 0.571 <0.001 0.014 0.071 FCR 2.356c 2.377b,c 2.494a 2.452a,b 0.029 <0.001 0.624 0.133 Mortality (%) 2.50 2.50 4.25 3.38 1.045 0.223 0.679 0.679 a-dMeans within a row with no common superscripts are significantly different (P < 0.05). AFB1, aflatoxin B1; ADFI, average daily feed intake; ADG, average daily body weight gain; CSH, cysteamine hydrochloride; FCR, feed conversion ratio. –, not detectable (< 2 μg/kg). View Large Table 3. Effect of cysteamine hydrochloride on the growth performance and mortality of broilers fed aflatoxin B1 contaminated diets. Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 1 to 21 d of age ADFI (g/bird) 43.50a,b 43.97a 41.19c 43.22b 0.144 <0.001 <0.001 <0.001 ADG (g/bird) 29.10a,b 29.27a 26.95c 28.57b 0.154 <0.001 <0.001 <0.001 FCR 1.495 1.503 1.528 1.512 0.013 0.026 0.638 0.211 Mortality (%) 1.67 1.67 2.50 2.50 1.086 0.452 1.000 1.000 22 to 42 d of age ADFI (g/bird) 189.3b 192.2a 183.1d 186.6c 14.38 <0.001 <0.001 0.593 ADG (g/bird) 80.37a 80.83a 73.47c 76.10b 0.571 <0.001 0.014 0.071 FCR 2.356c 2.377b,c 2.494a 2.452a,b 0.029 <0.001 0.624 0.133 Mortality (%) 2.50 2.50 4.25 3.38 1.045 0.223 0.679 0.679 Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 1 to 21 d of age ADFI (g/bird) 43.50a,b 43.97a 41.19c 43.22b 0.144 <0.001 <0.001 <0.001 ADG (g/bird) 29.10a,b 29.27a 26.95c 28.57b 0.154 <0.001 <0.001 <0.001 FCR 1.495 1.503 1.528 1.512 0.013 0.026 0.638 0.211 Mortality (%) 1.67 1.67 2.50 2.50 1.086 0.452 1.000 1.000 22 to 42 d of age ADFI (g/bird) 189.3b 192.2a 183.1d 186.6c 14.38 <0.001 <0.001 0.593 ADG (g/bird) 80.37a 80.83a 73.47c 76.10b 0.571 <0.001 0.014 0.071 FCR 2.356c 2.377b,c 2.494a 2.452a,b 0.029 <0.001 0.624 0.133 Mortality (%) 2.50 2.50 4.25 3.38 1.045 0.223 0.679 0.679 a-dMeans within a row with no common superscripts are significantly different (P < 0.05). AFB1, aflatoxin B1; ADFI, average daily feed intake; ADG, average daily body weight gain; CSH, cysteamine hydrochloride; FCR, feed conversion ratio. –, not detectable (< 2 μg/kg). View Large At 22 to 42 d, the AFB1 affected (P < 0.001) ADFI, ADG, and FCR, whereas the CSH affected (P < 0.05) the ADFI and ADG. Compared with the AFB1 treatment, the diet with AFB1 contamination and CSH inclusion improved (P < 0.05) the ADFI and ADG, but did not reach the levels of control diet. During the 2 phases, the mortality was not affected by the CSH and AFB1. Enterotoxigenic Status and Visceral Lesions The ileal counts of E. coli and Gram– were increased (P < 0.05) by dietary AFB1 (Table 4), and the counts of E. coli, C. perfringens, and Gram– were decreased (P < 0.001) by CSH inclusion. Compared with AFB1 treatment, the Gram– was decreased (P < 0.05) by 7.2% in CSH treatment, which caused an interaction (P = 0.001). Table 4. Effect of cysteamine hydrochloride on the opportunistic bacteria, enterotoxic markers, and visceral lesions of broilers fed aflatoxin B1 contaminated diets. Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Opportunistic bacteria (Log10 cfu/g of ileal digesta) E. coli 6.44b,c 6.25c 7.01a 6.76a,b 0.091 <0.001 0.023 0.746 C. perfringens 2.74b 2.70b 3.22a 3.12a 0.069 <0.001 0.354 0.628 Gram– 6.56c 6.56c 7.57a 7.03b 0.072 <0.001 0.001 0.001 Serum enterotoxic markers Endotoxin (EU/mL) 0.23b 0.23b 0.31a 0.27a,b 0.022 <0.001 0.068 0.091 DAO (U/mL) 0.82b,c 0.79c 1.20a 0.97b 0.040 <0.001 0.004 0.024 Lesion scores Liver 0.67b 0.67b 1.67a 0.67b 0.247 0.057 0.057 0.057 Intestine 1.67b 1.33b 3.00a 1.83b 0.214 <0.001 0.002 0.066 Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Opportunistic bacteria (Log10 cfu/g of ileal digesta) E. coli 6.44b,c 6.25c 7.01a 6.76a,b 0.091 <0.001 0.023 0.746 C. perfringens 2.74b 2.70b 3.22a 3.12a 0.069 <0.001 0.354 0.628 Gram– 6.56c 6.56c 7.57a 7.03b 0.072 <0.001 0.001 0.001 Serum enterotoxic markers Endotoxin (EU/mL) 0.23b 0.23b 0.31a 0.27a,b 0.022 <0.001 0.068 0.091 DAO (U/mL) 0.82b,c 0.79c 1.20a 0.97b 0.040 <0.001 0.004 0.024 Lesion scores Liver 0.67b 0.67b 1.67a 0.67b 0.247 0.057 0.057 0.057 Intestine 1.67b 1.33b 3.00a 1.83b 0.214 <0.001 0.002 0.066 a-cMeans within a row with no common superscripts are significantly different (P < 0.05). AFB1, aflatoxin B1; C. perfringens, Clostridium perfringens; CSH, cysteamine hydrochloride; DAO, diamine oxidase; E. coli, Escherichia coli; Gram–, Gram-negative bacteria. –, not detectable (< 2 μg/kg). View Large Table 4. Effect of cysteamine hydrochloride on the opportunistic bacteria, enterotoxic markers, and visceral lesions of broilers fed aflatoxin B1 contaminated diets. Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Opportunistic bacteria (Log10 cfu/g of ileal digesta) E. coli 6.44b,c 6.25c 7.01a 6.76a,b 0.091 <0.001 0.023 0.746 C. perfringens 2.74b 2.70b 3.22a 3.12a 0.069 <0.001 0.354 0.628 Gram– 6.56c 6.56c 7.57a 7.03b 0.072 <0.001 0.001 0.001 Serum enterotoxic markers Endotoxin (EU/mL) 0.23b 0.23b 0.31a 0.27a,b 0.022 <0.001 0.068 0.091 DAO (U/mL) 0.82b,c 0.79c 1.20a 0.97b 0.040 <0.001 0.004 0.024 Lesion scores Liver 0.67b 0.67b 1.67a 0.67b 0.247 0.057 0.057 0.057 Intestine 1.67b 1.33b 3.00a 1.83b 0.214 <0.001 0.002 0.066 Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Opportunistic bacteria (Log10 cfu/g of ileal digesta) E. coli 6.44b,c 6.25c 7.01a 6.76a,b 0.091 <0.001 0.023 0.746 C. perfringens 2.74b 2.70b 3.22a 3.12a 0.069 <0.001 0.354 0.628 Gram– 6.56c 6.56c 7.57a 7.03b 0.072 <0.001 0.001 0.001 Serum enterotoxic markers Endotoxin (EU/mL) 0.23b 0.23b 0.31a 0.27a,b 0.022 <0.001 0.068 0.091 DAO (U/mL) 0.82b,c 0.79c 1.20a 0.97b 0.040 <0.001 0.004 0.024 Lesion scores Liver 0.67b 0.67b 1.67a 0.67b 0.247 0.057 0.057 0.057 Intestine 1.67b 1.33b 3.00a 1.83b 0.214 <0.001 0.002 0.066 a-cMeans within a row with no common superscripts are significantly different (P < 0.05). AFB1, aflatoxin B1; C. perfringens, Clostridium perfringens; CSH, cysteamine hydrochloride; DAO, diamine oxidase; E. coli, Escherichia coli; Gram–, Gram-negative bacteria. –, not detectable (< 2 μg/kg). View Large For serum enterotoxic markers, the AFB1 affected (P < 0.001) endotoxin and DAO, whereas CSH affected (P = 0.004) DAO, and an interaction (P = 0.024) was found on DAO. Compared with AFB1 treatment, the level of DAO in CSH treatment was decreased (P < 0.05) by 19.2%. The intestinal lesion scores were affected by AFB1 (P < 0.001) and CSH (P = 0.002). The liver lesion scores were not affected by the 2 dietary factors, and there were no interactions. Compared with the AFB1 treatment, the liver and intestinal lesion scores in the CSH supplemental treatment were decreased (P < 0.05) by 59.9 and 39.0%, respectively. Glutathione Turnover and Inflammatory Factors There were significant effects (P < 0.001) of AFB1 and CSH on the profiles of r-GSH, GSTs, and GR (Table 5). The increasing effect of CSH on GSTs was more pronounced (P < 0.05) in diets without AFB1 contamination, which caused an interaction (P < 0.01). Compared with the control, r-GSH, GSTs, and GR in the CSH treatment were increased (P < 0.05) by 18.4, 72.1, and 31.8%, respectively. Compared with the AFB1 treatment, the GR in CSH treatment was increased (P < 0.05) by 48.9%. Table 5. Effect of cysteamine hydrochloride on the glutathione turnover and inflammatory factors in the serum of broilers fed aflatoxin B1 contaminated diets. Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Glutathione turnover r-GSH (mg/g) 28.26b 33.45a 19.19b 24.55b 1.202 <0.001 <0.001 0.955 GSTs (U/g) 354.0b 609.2a 194.3c 270.6c 19.62 <0.001 <0.001 <0.001 GR (U/g) 26.55b 35.00a 17.04c 25.38b 1.706 <0.001 <0.001 0.975 Inflammatory factors (mRNA expression, 2−ΔΔCt) TNF-α 2.20b 1.79c 3.11a 3.05a 0.090 <0.001 0.016 0.062 IL-6 5.62b 4.49b 7.25a 5.04b 0.370 0.008 <0.001 0.163 IL-1β 4.59a,b 3.59b 4.98a 3.82b 0.269 0.268 0.001 0.772 Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Glutathione turnover r-GSH (mg/g) 28.26b 33.45a 19.19b 24.55b 1.202 <0.001 <0.001 0.955 GSTs (U/g) 354.0b 609.2a 194.3c 270.6c 19.62 <0.001 <0.001 <0.001 GR (U/g) 26.55b 35.00a 17.04c 25.38b 1.706 <0.001 <0.001 0.975 Inflammatory factors (mRNA expression, 2−ΔΔCt) TNF-α 2.20b 1.79c 3.11a 3.05a 0.090 <0.001 0.016 0.062 IL-6 5.62b 4.49b 7.25a 5.04b 0.370 0.008 <0.001 0.163 IL-1β 4.59a,b 3.59b 4.98a 3.82b 0.269 0.268 0.001 0.772 a–cMeans within a row with no common superscripts are significantly different (P < 0.05). AFB1, aflatoxin B1; CSH, cysteamine hydrochloride; GR, glutathione reductase; GSTs, glutathione s-transferases; IL-1β, interleukin-1β; IL-6, interleukin-6; r-GSH, reduced glutathione; TNF-α, tumor necrosis factor-α. –, not detectable (< 2 μg/kg). View Large Table 5. Effect of cysteamine hydrochloride on the glutathione turnover and inflammatory factors in the serum of broilers fed aflatoxin B1 contaminated diets. Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Glutathione turnover r-GSH (mg/g) 28.26b 33.45a 19.19b 24.55b 1.202 <0.001 <0.001 0.955 GSTs (U/g) 354.0b 609.2a 194.3c 270.6c 19.62 <0.001 <0.001 <0.001 GR (U/g) 26.55b 35.00a 17.04c 25.38b 1.706 <0.001 <0.001 0.975 Inflammatory factors (mRNA expression, 2−ΔΔCt) TNF-α 2.20b 1.79c 3.11a 3.05a 0.090 <0.001 0.016 0.062 IL-6 5.62b 4.49b 7.25a 5.04b 0.370 0.008 <0.001 0.163 IL-1β 4.59a,b 3.59b 4.98a 3.82b 0.269 0.268 0.001 0.772 Treatments P-values Items Control CSH AFB1 AFB1+CSH SEM AFB1 CSH AFB1 × CSH Dietary factors AFB1 (μg/kg) – – 40 40 CSH (mg/kg) 0 200 0 200 Glutathione turnover r-GSH (mg/g) 28.26b 33.45a 19.19b 24.55b 1.202 <0.001 <0.001 0.955 GSTs (U/g) 354.0b 609.2a 194.3c 270.6c 19.62 <0.001 <0.001 <0.001 GR (U/g) 26.55b 35.00a 17.04c 25.38b 1.706 <0.001 <0.001 0.975 Inflammatory factors (mRNA expression, 2−ΔΔCt) TNF-α 2.20b 1.79c 3.11a 3.05a 0.090 <0.001 0.016 0.062 IL-6 5.62b 4.49b 7.25a 5.04b 0.370 0.008 <0.001 0.163 IL-1β 4.59a,b 3.59b 4.98a 3.82b 0.269 0.268 0.001 0.772 a–cMeans within a row with no common superscripts are significantly different (P < 0.05). AFB1, aflatoxin B1; CSH, cysteamine hydrochloride; GR, glutathione reductase; GSTs, glutathione s-transferases; IL-1β, interleukin-1β; IL-6, interleukin-6; r-GSH, reduced glutathione; TNF-α, tumor necrosis factor-α. –, not detectable (< 2 μg/kg). View Large There were significant effects (P < 0.01) of AFB1 on the mRNA profiles of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6), whereas the CSH affected TNF-α, IL-6, and interleukin-1β (IL-1β). Compared with the control, the TNF-α in the CSH treatment was lower (P < 0.05) by 18.6%. Compared with the AFB1 treatment, IL-6 and IL-1β in CSH treatment were decreased (P < 0.05) by 30.5 and 23.3%, respectively. DISCUSSION In the present study, supplemental CSH improved the ADFI and ADG of broilers, with responses being more pronounced at the presence of AFB1, indicating that CSH relieved the toxicity of AFB1. Dunshea (2007) reported that dietary CSH increased daily gain, carcass weight, and gain: feed in finisher gilts. Nunes et al. (2012) found that the diet supplemented with cysteamine improved feed conversion. However, based on AFB1 contaminated diets, the information about CSH on growth performance is unavailable in farm animals. In the present study, with the concurrence of AFB1, the CSH effect was more pronounced, and they were interactive in ADFI and ADG at 1 to 21 d, and how the CSH interacts with growth axis of animals with exposure to AFB1 needs further study. Besides the growth-promoting effect, the CSH or derivatives are important antioxidants for detoxification in the liver or gut. The oxidative stress is mainly caused by enterotoxins from toxigenic microbiota when their balance is disturbed (Mani et al., 2012; Tremaroli and Bäckhed, 2012). Furthermore, with the occurrence of moldy feedstuffs, a lower level of AFB1 in the diet is a major predisposing factor for gut flora disruption and enterocyte oxidation (Yarru et al., 2009). Liu et al. (2018) reported that dietary AFB1 increased the count of C. perfringens in the ileal digsta of broilers. Similarly, in the present study the counts of E. coli, C. perfringens, and Gram– were increased by the AFB1, whereas E. coli and Gram– were decreased by the CSH, and an interaction was found on Gram–. Also, serum levels of endotoxins and DAO were increased by the AFB1, and the level of DAO was decreased by the CSH. The result indicates that the CSH can depress gut opportunistic bacteria and their toxicity. The literature about the effect of non-protein sulfhydryl groups on gut flora is unavailable, but the effect on serum toxic markers of CSH in the present study was supported by the findings that cysteamine had beneficial effect on tissue damage induced by endotoxin, ischemia-reperfusion, and hemorrhagic shock in rodent animals (Glantzounis et al., 2006; Mota et al., 2007) or in pigs (Zhou et al., 2017). Necrotic lesions are caused by factors external to the cell or tissue, such as contamination, toxins, or trauma which result in the unregulated digestion of cell components. The increased lesion scores of liver and intestine in the present study further demonstrated the toxicity of AFB1. With the occurrence of moldy feedstuffs, AFB1, the most toxic, is becoming a major predisposing factor of necrotic lesions of visceral organs of broilers (Kumar and Balachandran, 2009). The information about the effect of CSH or its analogs on the visceral lesions is scarce. In the present study, regardless of AFB1, the CSH decreased lesion scores in the liver and intestine, indicating that the CSH can protect cell or tissue and decrease lesions. Anyway, the CSH or its derivatives as feed additives, the relationship of them with necrotic lesions needs further study. In the present study, the AFB1 decreased the r-GSH, GSTs, and GR, whereas the CSH increased r-GSH, GSTs, and GR. The CSH or derivatives act through sulfhydryl-disulfide exchange reactions in glutathione redox cycle, so the providing of sulfhydryl group can facilitate the synthesis and turnover of glutathione (Courtney-Martin and Pencharz, 2016). Based on AFB1 contaminated diets, there are no reports on the effect of CSH or derivatives on glutathione turnover. Yarru et al. (2009) found that AFB1 increased the expression of superoxide dismutase and GSTs in the liver of broilers. Zhou et al. (2017) reported that increased glutathione content and glutathione peroxidase activity and decreased malondialdehyde content were observed in pigs receiving cysteamine. Bai et al. (2017) demonstrated that CSH improved antioxidant status and delayed pig meat discoloration by improving glutathione levels and antioxidase activity after longer chill storage, and promoted the stability of pork color by reducing oxidation. For the relationship between AFB1 and glutathione status, Valdivia et al. (2001) found that broilers treated with AFB1 plus N-acetylcysteine were shown to be partially protected against deleterious effects on plasma alanine aminotransferase, and liver GSTs and glutathione. Thiol-containing compounds also influence inflammation and immunity by intracellular glutathione and cysteine levels (Ruan et al., 2017). In the present study, the mRNA profiles of TNF-α and IL-6 were increased by AFB1, and TNF-α, IL-6, and IL-1β were decreased by CSH, but the levels of TNF-α and IL-6 were greater than the control, indicating that the CSH can relieve the inflammation caused by AFB1, but for TNF-α, the effect does not reach the level of control. It is well documented that AFB1 can cause immunotoxicity and inflammatory responses in rats (Hinton et al., 2003) or broilers (Li et al., 2014; Ma et al., 2015) and cysteamine, as a US FDA-approved drug, has antioxidant, antibacterial, anti-inflammatory, and mucolytic properties (Kopp et al., 2017; Vij, 2017). In farm animals, cysteamine supplementation increased the concentrations of secretory IgA, IgM, and IgG in the jejunal mucosa of pigs (Zhou et al., 2017), and induced proliferation and differentiation of IgA-positive cells and intraepithelial lymphocytes in the intestinal mucosa of chickens by reducing the number of somatostatin-positive cells (Yang et al., 2007). CONCLUSIONS Diets contaminated with AFB1 depressed growth performance and glutathione turnover, and exacerbated enterotoxic status. The CSH supplementation increased ADFI, ADG, and glutathione turnover, but decreased ileal E. coli and Gram–, the mRNA levels of TNF-α, IL-1β, and IL-6, serum DAO, and intestinal lesions. There were interactions of CSH and AFB1 on Gram–, DAO, and GSTs. The results suggest that the CSH supplementation can decrease gut opportunistic bacterial populations and inflammatory factors by facilitating glutathione turnover in broilers fed AFB1 contaminated diets. ACKNOWLEDGMENTS This research was supported by the National Natural Science Foundation of China (31272466). REFERENCES Bai M. , Liu H. , Xu K. , Zou B. , Yu R. , Liu Y. , Xing W. , Du H. , Li Y. , Yin Y. . 2018 . Effects of dietary coated cysteamine hydrochloride on pork color in finishing pigs . J. Sci. Food Agric. 98 : 1743 – 1750 . Google Scholar CrossRef Search ADS PubMed Courtney-Martin G. , Pencharz P. B. . 2016 . Sulfur Amino Acids Metabolism from Protein Synthesis to Glutathione in the Molecular Nutrition of Amino Acids and Proteins . Pages: 265 – 286 . Academic Press , Rochester, NY . Google Scholar CrossRef Search ADS Dunshea F. R. 2007 . Porcine somatotropin and cysteamine hydrochloride improve growth performance and reduce back fat in finisher gilts . Aust. J. Exp. Agric. 47 : 796 – 800 . Google Scholar CrossRef Search ADS Gholamiandehkordi A. R. , Timbermont L. , Lanckriet A. , Broeck W. V. D. , Pedersen K. , Dewulf J. , Pasmans F. , Haesebrouck F. , Ducatelle R. , Immerseel F. V. . 2007 . Quantification of gut lesions in a subclinical necrotic enteritis model . Avian Pathol. 36 : 375 – 382 . Google Scholar CrossRef Search ADS PubMed Glantzounis G. K. , Yang W. , Koti R. S. , Mikhailidis D. P. , Seifalian A. M. , Davidson B. R. . 2006 . The role of thiols in liver ischemia-reperfusion injury . Curr. Pharm. Des. 12 : 2891 – 2901 . Google Scholar CrossRef Search ADS PubMed Hafez H. M. 2011 . Enteric diseases of poultry with special attention to Clostridium perfringens . Pak. Vet. J. 31 : 175 – 184 . Hinton D. M. , Myers M. J. , Raybourne R. A. , Francke-Carroll S. , Sotomayor R. E. , Shaddock J. , Warbritton A. , Chou M. W. . 2003 . Immunotoxicity of aflatoxin B1 in rats: effects on lymphocytes and the inflammatory response in a chronic intermittent dosing study . Toxicol. Sci. 73 : 362 – 377 . Google Scholar CrossRef Search ADS PubMed Hu Y. , Ni Y. , Ren L. , Dai J. , Zhao R. . 2008 . Leptin is involved in the effects of cysteamine on egg laying of hens, characteristics of eggs, and posthatch growth of broiler offspring . Poult. Sci. 87 : 1810 – 1817 . Google Scholar CrossRef Search ADS PubMed Immerseel F. V. , Buck J. D. , Pasmans F. , Huyghebaert G. , Haesebrouck F. , Ducatelle R. . 2004 . Clostridium perfringens in poultry: an emerging threat for animal and public health . Avian Pathol. 33 : 537 – 549 . Google Scholar CrossRef Search ADS PubMed Kopp B. T. , Shrestha C. , Assani K. , Schlesinger L. S. . 2017 . Cysteamine-mediated clearance of multi-drug resistant pathogens from cystic fibrosis macrophages . Am. J. Respir. Crit. Care Med. 195 : A4850 . Kumar R. , Balachandran C. . 2009 . Histopathological changes in broiler chickens fed aflatoxin and cyclopiazonic acid . Vet. Arch. 79 : 31 – 40 . Li Y. , Ma Q. G. , Zhao L. H. , Wei H. , Duan G. X. , Zhang J. Y. , Ji C. . 2014 . Effects of lipoic acid on immune function, the antioxidant defense system, and inflammation-related genes expression of broiler chickens fed aflatoxin contaminated diets . Int. J. Mol. Sci. 15 : 5649 – 5662 . Google Scholar CrossRef Search ADS PubMed Liu N. , Ru Y. J. , Li F. D. , Cowieson A. J. . 2008 . Effect of diet containing phytate and phytase on the activity and messenger ribonucleic acid expression of carbohydrase and transporter in chickens . J. Anim. Sci. 86 : 3432 – 3439 . Google Scholar CrossRef Search ADS PubMed Liu N. , Wang J. Q. , Chao J. S. , Chen Y. K. , Wang J. P. . 2018 . Effect of yeast cell wall on the growth performance and gut health of broilers challenged with aflatoxin B1 and necrotic enteritis . Poult. Sci. 97 : 477 – 484 . Google Scholar CrossRef Search ADS PubMed Ma Q. , Li Y. , Fan Y. , Zhao L. , Wei H. , Ji C. , Zhang J. . 2015 . Molecular mechanisms of lipoic acid protection against aflatoxin B1-induced liver oxidative damage and inflammatory responses in broilers . Toxins 7 : 5435 – 5447 . Google Scholar CrossRef Search ADS PubMed Mani V. , Weber T. E. , Baumgard L. H. , Gabler N. K. . 2012 . Growth and development symposium: endotoxin, inflammation, and intestinal function in livestock . J. Anim. Sci. 90 : 1452 – 1465 . Google Scholar CrossRef Search ADS PubMed Morrison J. P. , Coleman M. C. , Aunan E. S. , Walsh S. A. , Spitz D. R. , Kregel K. C. . 2005 . Thiol supplementation in aged animals alters antioxidant enzyme activity after heat stress . J. Appl. Physiol. 99 : 2271 – 2277 . Google Scholar CrossRef Search ADS PubMed Mota J. M. S. , Soares P. M. , Menezes A. A. , Lemos H. P. , Cunha F. Q. , Brito G. A. C. , Ribeiro R. A. , de Souza M. H. . 2007 . Amifostine (Wr-2721) prevents indomethacin-induced gastric damage in rats: role of non-protein sulfhydryl groups and leukocyte adherence . Dig. Dis. Sci. 52 : 119 – 125 . Google Scholar CrossRef Search ADS PubMed Nunes J. O. , Bertechini A. G. , Á. G. D. Brito J. , Makiyama L. , Mesquita F. R. , Nishio C. M. . 2012 . Evaluation of cysteamine associated with different energy patterns in diets for broiler chickens. Czech . J. Anim. Sci. 41 : 1956 – 1960 . Reid E. E. 1958 . Organic Chemistry of Bivalent Sulfur . Pages: 398 – 399 . Chemical Publishing Co. , Los Angeles, CA . Ruan T. , Li L. , Peng X. , Wu B. . 2017 . Effects of methionine on the immune function in animals . Health (N. Y) 9 : 857 – 869 . Tremaroli V. , Bäckhed F. . 2012 . Functional interactions between the gut microbiota and host metabolism . Nature 489 : 242 – 249 . Google Scholar CrossRef Search ADS PubMed Valdivia A. G. , Martinez A. , Damian F. J. , Quezada T. , Ortiz R. , Martinez C. , Llamas J. , Rodriguez M. L. , Yamamoto L. , Jaramillo F. , Loarca-Pina M. G. . 2001 . Efficacy of N-acetylcysteine to reduce the effects of aflatoxin B1 intoxication in broiler chickens . Poult. Sci. 80 : 727 – 734 . Google Scholar CrossRef Search ADS PubMed Vij N. 2017 . Nano-based rescue of dysfunctional autophagy in chronic obstructive lung diseases . Expert Opin. Drug Deliv. 14 : 483 – 489 . Google Scholar CrossRef Search ADS PubMed Wang C. , Dong C. J. , Wang Z. Q. , Yang F. , Mao H. L. , Wu Z. , Zhou Q. , Wang H. F. . 2015 . Effect of cysteamine hydrochloride supplementation on the milk performance of dairy cow . Livestock Sci. 178 : 94 – 99 . Google Scholar CrossRef Search ADS Wu S. , Stanley D. , Rodgers N. , Swick R. A. , Moore R. J. . 2014 . Two necrotic enteritis predisposing factors, dietary fishmeal and Eimeria infection, induce large changes in the caecal microbiota of broiler chickens . Vet. Microbiol. 169 : 188 – 197 . Google Scholar CrossRef Search ADS PubMed Xiong B. , Pang Z. , Zhao F. , Luo Q. . 2014 . Tables of Feed Composition and Nutritive Values In China , 25th ed . China Feed Database , Beijing, China . Yang Q. , Lian G. , Gong X. . 2007 . Enhancement of mucosal immune responses in chickens by oral administration of cysteamine . Poult. Sci. 86 : 1323 – 1328 . Google Scholar CrossRef Search ADS PubMed Yarru L. P. , Settivari R. S. , Gowda N. K. S. , Antoniou E. , Ledoux D. R. , Rottinghaus G. E. . 2009 . Effects of turmeric (Curcuma longa) on the expression of hepatic genes associated with biotransformation, antioxidant, and immune systems in broiler chicks fed aflatoxin . Poult. Sci. 88 : 2620 – 2627 . Google Scholar CrossRef Search ADS PubMed Zhou P. , Luo Y. , Zhang L. , Li J. , Zhang B. , Xing S. , Zhu Y. , Gao F. , Zhou G. . 2017 . Effects of cysteamine supplementation on the intestinal expression of amino acid and peptide transporters and intestinal health in finishing pigs . Anim Sci. J. 88 : 314 – 321 . Google Scholar CrossRef Search ADS PubMed © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Poultry ScienceOxford University Press

Published: May 30, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off