Distinct features of C/N balance regulation in Prochlorococcus sp. strain MIT9313

Distinct features of C/N balance regulation in Prochlorococcus sp. strain MIT9313 Abstract The abundance and significant contribution to global primary production of the marine cyanobacterium Prochlorococcus have made it one of the main models in marine ecology. Several conditions known to cause strong effects on the regulation of N-related enzymes in other cyanobacteria lacked such effect in Prochlorococcus. Prochlorococcus sp. strain MIT9313 is one of the most early-branching strains among the members of this genus. In order to further understand the C/N control system in this cyanobacterium, we studied the effect of the absence of three key elements in the ocean, namely N, P and Fe, as well as the effect of inhibitors of the N assimilation or photosynthesis on the N metabolism of this strain. Furthermore, we focused our work in the effect of ageing, as the age of cultures has clear effects on the regulation of some enzymes in Prochlorococcus. To reach this goal, expression of the main three regulators involved in N assimilation in cyanobacteria, namely ntcA, glnB and pipX, as well as that of icd (encoding for isocitrate dehydrogenase) were analysed. Our results show that the control of the main proteins involved in the C/N balance in strain MIT9313 differs from other model Prochlorococcus strains. Prochlorococcus, nitrogen metabolism, C/N balance sensing, transcriptional regulation, starvation, adaptive mechanisms INTRODUCTION Prochlorococcus is the most abundant photosynthetic organism on Earth (Partensky, Blanchot and Vaulot 1999; Biller et al.2015); together with marine Synechococcus, it is responsible for a very significant part of the global primary production (Partensky, Hess and Vaulot 1999; Scanlan et al.2009). The ecological relevance of marine picocyanobacteria is even more significant in the light of global warming, since oceanic phytoplankton populations are an important carbon sink (Landschützer et al.2015), and recent studies suggest that the effects of climate change will increase their populations (Flombaum et al.2013). Furthermore, improving the understanding of the phytoplankton blooms has been considered the next frontier in order to get climate projections right (Tollefson 2016). Recent long-term studies addressed the factors controlling the appearance of cyanobacterial blooms in the ocean, pointing to temperature as one of the main elements (Hunter-Cervera et al.2016). However, and despite the large number of studies on marine picocyanobacteria, there are still many aspects insufficiently known. Among them, the metabolism of carbon and nitrogen and their regulation is one of the most important fields, since it links photosynthesis (allowing the incorporation of atmospheric CO2) to the utilisation of nitrogen. N is one of the main elements of life, since it constitutes an essential part of proteins and nucleic acids. Because N is scarcely available in the oligotrophic intertropical oceans inhabited by Prochlorococcus, there are large regions where N limitation imposes harsh conditions for this cyanobacterium to thrive (Graziano et al.1996). Our team has studied the regulation of several enzymes involved in the N and C metabolisms in Prochlorococcus, namely glutamine synthetase (El Alaoui et al.2001, 2003; Gómez-Baena et al.2001; Gómez-Baena et al.2006, 2015), isocitrate dehydrogenase (McDonagh et al.2012; Domínguez-Martín et al.2014) and glutamate dehydrogenase (Rangel et al.2009). Besides, we have carried out a gene expression study focused on genes encoding enzymes and regulatory proteins that control the C/N balance in the low-light Prochlorococcus strain SS120 (López-Lozano et al.2009). One of our main conclusions was that this control system seems to have been streamlined in Prochlorococcus, probably due to an evolutionary trend in order to save energy (García-Fernández and Diez 2004; García-Fernández, Tandeau de Marsac and Diez 2004). This fits with the results observed by other authors using different approaches, such as global transcriptomic (Tolonen et al.2006) or proteomic studies (Grzymski and Dussaq 2011; Read et al.2017). In order to further understand the C/N control system in Prochlorococcus, we present a study in Prochlorococcus sp. strain MIT9313, representative of the LLIV ecotype. This is one of the most early-branching strains among the cultured members of the Prochlorococcus genus (Biller et al.2015). In global transcriptomic studies addressing nitrogen availability in Prochlorococcus sp. strains MED4 and MIT9313, it was shown that both strains integrate N and C metabolism in profoundly different ways (Tolonen et al.2006). More recently, a comparative RNA-seq transcriptomics study between the same strains further illustrated those differences, particularly in the case of non-coding RNAs (Voigt et al.2014). The aim of this work is to further understand the differential features in the regulation of the C/N balance in Prochlorococcus sp. MIT9313. To this goal, we studied the expression of icd, the gene encoding the key enzyme isocitrate dehydrogenase, and main regulatory genes of C/N metabolism in cyanobacteria: the master nitrogen regulator ntcA (Luque, Flores and Herrero 1994), and the genes encoding proteins that interact with NtcA, pipX and glnB, encoding the coactivator of NtcA, PipX (Espinosa et al. 2006) and the regulatory PII protein (Forchhammer and Tandeau de Marsac 1994), respectively. We performed a series of experiments to determine gene expression by semiquantitative RT-PCR, under conditions representative of limitations of Prochlorococcus populations in nature; i.e. starvation for N, P and Fe; inhibition of the glutamine synthetase (GS) and glutamate synthase (GOGAT) enzymes; inhibition of the photosynthetic electron transport; and ageing of the cultures. In this work, we describe and discuss the results with respect to those observed in other cyanobacterial strains. MATERIALS AND METHODS Growth of cultures of Prochlorococcus Prochlorococcus marinus sp. strain MIT9313 (LL-adapted) was grown as previously described (El Alaoui et al.2001). Methionine sulfoximine (MSX), azaserine, 3-(3–4-dichlorophenyl)-1,1-dimethylurea (DCMU) and 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone (DBMIB) were dissolved and added to cultures as previously described (El Alaoui et al.2001). Cell collection Cell collection and the preparation of culture media devoid of key elements for experiments addressing nutrient starvation are described in López-Lozano et al. (2009). RNA isolation RNA was isolated from 500 mL culture samples, using the TRIsure RNA Isolation Reagent (Bioline) following the method described previously by our team (Domínguez-Martín, Díez and García-Fernández 2016). Real-time quantitative RT-PCR analysis of gene expression cDNA synthesis from RNA samples was carried out with the iScriptTM cDNA Synthesis kit from Quanta as recommended by the manufacturers (Domínguez-Martín et al.2014). Specific primers for icd, ntcA, glnB and pipX genes (encoding isocitrate dehydrogenase, NtcA, PII and PipX, respectively) were designed as previously described (Domínguez-Martín, Díez and García-Fernández 2016). Specificity of the qRT-PCR reactions was checked by agarose gel electrophoresis. The sequences of the primers used are listed in Table 1. Table 1. Primers used for quantitative real-time RT-PCR reactions. Primer  Sequence 5΄- 3΄  Gene  RT-FMI  CAACATGCTCTTCGGCTAAA  icd  RT-RMI  AGTTCATAGCCCCAGTCACG    RT-FP2M  CGACGACGACAAGGTGGA  glnB  RT-RP2M  CTTGCTGTCACGCTCGCC    RT-FTCA  GCGTGGGGTTACTTCTGC  ntcA  RT-RTCA  CGATGGACTGATGTGAGAGG    RT-FPXM  TTACGCCACGCTCTATGC  pipX  RT-RPXM  AACAACTGCTGCCAACTCTC    FRPM  CTATCTAGGACCGCCGTTAC  rnpB  RRPM  GAGAGTGCCACAGAAAAACA    Primer  Sequence 5΄- 3΄  Gene  RT-FMI  CAACATGCTCTTCGGCTAAA  icd  RT-RMI  AGTTCATAGCCCCAGTCACG    RT-FP2M  CGACGACGACAAGGTGGA  glnB  RT-RP2M  CTTGCTGTCACGCTCGCC    RT-FTCA  GCGTGGGGTTACTTCTGC  ntcA  RT-RTCA  CGATGGACTGATGTGAGAGG    RT-FPXM  TTACGCCACGCTCTATGC  pipX  RT-RPXM  AACAACTGCTGCCAACTCTC    FRPM  CTATCTAGGACCGCCGTTAC  rnpB  RRPM  GAGAGTGCCACAGAAAAACA    View Large qRT-PCR semiquantitative gene expression determinations were carried out as previously described (Domínguez-Martín et al.2014), according to the Pfaffl method (Pfaffl 2001), on an iCycler IQ multicolor real-time PCR detection system (Bio-Rad). The melting point of PCR products was used to confirm the absence of false amplifications. Triplicate determinations from at least three independent biological samples subjected to identical culture conditions were used for calculations. Results were endogenously normalised to rnpB expression (encoding RNase P), using the 2−ΔΔCt method (Pfaffl 2001), since this gene did not change under our experimental conditions. The results shown in all figures correspond to relative expression, so that each value represents the changes under a specific condition with respect to the same culture under control conditions. Prochlorococcus genomic sequences Genomic sequences were retrieved from the Joint Genome Institute (http://genome.jgi-psf.org) and Cyorf (http://cyano.genome.ad.jp/) databases. Statistical analysis Results were obtained by using at least three different samples, and error bars show the standard deviation. Statistical analysis was done using the Student's t-test, as previously described (Domínguez-Martín et al.2014). Assessment of data significance is indicated with asterisks: * indicates P ≤ 0.05; ** indicates P ≤ 0.01. RESULTS AND DISCUSSION Effect of key elements starvation In previous studies on the regulation of nitrogen-related enzymes, we observed that several conditions known to cause strong effects in other cyanobacteria lacked such effect in Prochlorococcus (El Alaoui et al.2001, 2003; Domínguez-Martín et al.2014); thus, we were interested to check whether this might be due to a general streamlining on regulatory networks or to some specific response of these N-related enzymes. We decided to study the effect of the absence of three key elements in the ocean, namely N, P and Fe, which are often in limiting concentration in oligotrophic areas, on the N metabolism of Prochlorococcus sp. MIT9313. Prochlorococcus MIT9313 cells were transferred to media without any added key element (either N, P or Fe), and were kept under such conditions for 5 days, sampling at 48 and 120 h, in order to test whether prolonged starvation effects were different with respect to those observed after 2 days starvation. Aliquots of the same cultures were kept under standard conditions. Nitrogen Figure 1 shows the relative expression changes observed for the ntcA, glnB, pipX and icd genes under N starvation, with respect to cells growing under standard conditions (standard PCR-S11 media, which includes 400 μM (NH4)2SO4). Figure 1. View largeDownload slide Effect of key elements starvation on gene expression in Prochlorococcus sp. strain MIT9313. Cells were subjected to nitrogen (blue), phosphorus (red) or iron (green) starvation for 5 days, keeping an aliquot growing under standard conditions as control. Samples were obtained at 48 and 120 h to determine gene expression by qRT-PCR. The expression levels represent the response of starved cells with respect to the control, for each sample. A, ntcA expression. B, glnB expression. C, pipX expression. D, icd expression. Error bars represent the standard deviation. Figure 1. View largeDownload slide Effect of key elements starvation on gene expression in Prochlorococcus sp. strain MIT9313. Cells were subjected to nitrogen (blue), phosphorus (red) or iron (green) starvation for 5 days, keeping an aliquot growing under standard conditions as control. Samples were obtained at 48 and 120 h to determine gene expression by qRT-PCR. The expression levels represent the response of starved cells with respect to the control, for each sample. A, ntcA expression. B, glnB expression. C, pipX expression. D, icd expression. Error bars represent the standard deviation. ntcA showed a strong increase (over 20-fold) at 48 h, which however disappeared almost completely at 120 h (P = 0.0026). pipX expression showed a similar pattern, although the induction at 48 h was less remarkable (ca. 12-fold). However, glnB and icd changed in the opposite way: their expression showed little change at 48 h, while it was strongly upregulated after 120 h (P = 0.0002 and P = 0.0001, respectively). This behaviour is consistent with previous reports in Prochlorococcus sp. MIT9313 (Tolonen et al.2006) that showed upregulation of ntcA under nitrogen starvation, while glnB was slightly downregulated after 48 h. Our results also fit with previous studies in freshwater cyanobacterial strains, where ntcA (Luque, Flores and Herrero 1994) and pipX (Valladares et al.2011) have been shown to increase upon nitrogen starvation. The study of the promoters of ntcA, glnB and pipX associated with reported transcriptional start sites (TSS) upstream of the coding sequence of these regulatory genes in Prochlorococcus sp. MIT9313 (Voigt et al.2014) showed the presence of a putative NtcA-binding site in all of them (Fig. S1, Supporting Information). Although the NtcA-binding sites of these genes presented some variations with respect to the consensus palindromic sequence GTAN8TAC described for cyanobacteria (Luque, Flores and Herrero 1994), they still conserved the most necessary nucleotides required for this binding (Picossi, Flores and Herrero 2014). NtcA-activated promoters also show a canonical sigma-70 Escherichia coli-like -10 box (TAN3T) that is found in either the ntcA or the pipX promoter, while that of glnB presents an incomplete version of this box in MIT9313 strain. Interestingly, these three regulatory genes also possess potential antisense RNA (aTSS) (Voigt et al.2014) associated with NtcA-binding sites with either activating or repressing function (Fig. S1, Supporting Information). NtcA acts as a repressor when the NtcA-binding site overlaps the RNA polymerase-binding site (García-Domínguez, Reyes and Florencio 2000); while ntcA, glnB and pipX show repressive NtcA-binding sites for all their reported aTSS, only glnB and pipX present additional activator sites linked to –10 non-canonical boxes that could lead the expression of these aTSS. Hence, the balance between the expression of gene coding RNA (gTSS) and aTSS in glnB and pipX, likely controlled by the differential affinity of both NtcA and RNA polymerase for their corresponding binding sites, would explain the differences observed in the expression of those regulatory genes with respect to that of ntcA under nitrogen starvation, despite being modulated by the same transcription factor. This would require further experimental confirmation by northern blot by using specific probes. A significant change was observed when we compared the gene expression results obtained with the Prochlorococcus sp. strain MIT9313 with those reported previously by our team on Prochlorococcus sp. strain SS120 (López-Lozano et al.2009): with that strain, we could see a decrease in glnB and ntcA expression under N starvation. At the same time (48 h), we observed a stronger decrease in glnB expression in MIT9313, followed by an increase of roughly 2-fold at 120 h (Fig. 1B). Besides, we observed an increase in ntcA expression in MIT9313 (Fig. 1A), in contrast to the decrease observed in SS120 (López-Lozano et al.2009). This suggests that, even comparing two low-light adapted strains as SS120 and MIT9313, there exists some differences regarding key regulator proteins as PII and NtcA. The distinct evolutive stories of these strains might help to explain the observed differences (see later). A possible reason for these differences might be that, unlike SS120, Prochlorococcus sp. strain MIT9313 seems to be capable of using glutamate, since it possesses the gdh gene, encoding glutamate dehydrogenase (Rangel et al.2009). The downregulation effect on gdh expression and its activity when MIT9313 cells were subjected to N starvation suggest that this enzyme in Prochlorococcus is involved in the assimilation of amino acids, and is not performing direct ammonium assimilation to produce glutamate (Rangel et al.2009). This might be useful to assimilate glutamate released to culture media in aged cultures (Rangel et al.2009), thus providing an alternate source of nitrogen to Prochlorococcus sp. strain MIT9313, which might be unavailable for the strain SS120. Phosphorus Unlike the results observed under N limitation, P starvation induced the long-term upregulation of all studied genes (ntcA, glnB, pipX and icd). However, the changes were much less remarkable compared to those observed under N starvation (Fig. 1). This suggests that those effects are not mediated by the same regulatory mechanisms as those provoked by N starvation. Interestingly, no clear effect was observed in samples obtained 48 h after the beginning of P starvation. Since ntcA/pipX showed opposite regulatory patterns to glnB under N starvation, the results observed under P starvation might suggest that they are caused by a general stress response, leading to the upregulation of a number of genes. This is in good agreement with global transcriptomic studies focused on the effects of P limitation in Prochlorococcus sp. MIT9313 (Martiny, Coleman and Chisholm 2006). However, no specific changes for the genes studied in our paper were reported by Martiny and coworkers. In transcriptomic studies addressing P limitation in Prochlorococcus sp. MED4, no specific changes for the genes here studied were reported either (Reistetter et al.2013). Iron Fe starvation induced a ca. 4-fold increase in the glnB and pipX expression, and slightly lower in the case of ntcA. Interestingly, this increase was roughly similar at both times of sampling (48 and 120 h), in contrast with the results obtained for both N and P starvation. There was a significant upregulation in icd expression after 120 h (P = 0.001). Our results might suggest that Prochlorococcus can quickly adapt to Fe starvation by increasing the expression of certain genes, keeping them upregulated as long as the starvation persists. This hypothesis, in turn, fits with previous studies suggesting that Prochlorococcus is an organism adapted to grow in environments with low iron concentrations, which has developed specific adaptation mechanisms (i.e. the utilisation of pcb genes as antenna, whose phylogeny is very related to isiA, a gene expressed under Fe starvation in other cyanobacteria; Bibby et al.2003). Effect of ageing Previous studies of our team showed that age of cultures had clear effects on the regulation of some enzymes in Prochlorococcus as glutamine synthetase (Gómez-Baena et al.2006) or glutamate dehydrogenase (Rangel et al.2009). Hence, we studied whether this effect might be due to changes in the expression of regulatory genes, and consequently the expression of other enzyme-coding genes. Figure 2 shows the expression of ntcA, glnB, pipX and icd over the course of 11 days. We observed a progressive increase in the expression of the three regulatory genes: ntcA and pipX, with the latter showing the strongest upregulation (more than 15-fold increase; P = 0.0022), followed by icd (ca. 12-fold; P = 0.0001) and ntcA (ca. 10-fold); glnB expression showed a less marked increase (ca. 3-fold). This suggests that the consumption of nitrogen by Prochlorococcus cells might lead to a reduced availability of this element in aged cultures, thus inducing the expression of the regulatory genes here studied. Those changes, in turn, would induce the icd upregulation (Fig. 2). Figure 2. View largeDownload slide Effect of ageing on gene expression in Prochlorococcus sp. strain MIT9313. Cells were grown under standard conditions for 12 days and samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of cells at the indicated times with respect to the values determined at the beginning of the experiment. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. Figure 2. View largeDownload slide Effect of ageing on gene expression in Prochlorococcus sp. strain MIT9313. Cells were grown under standard conditions for 12 days and samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of cells at the indicated times with respect to the values determined at the beginning of the experiment. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. These results are consistent with the evolution observed for gdhA expression in Prochlorococcus sp. strain MIT9313: it increased over 15-fold after 7 days of cell growth (Rangel et al.2009). Interestingly, the glutamate dehydrogenase enzyme concentration did not significantly change in that period, suggesting that the increase in gene expression was caused by a faster turnover of the protein. Furthermore, we demonstrated that isocitrate dehydrogenase is subjected to oxidative modification (Gómez-Baena et al.2006; McDonagh et al.2012), and this process has been shown to be age-dependent in the case of glutamine synthetase (Gómez-Baena et al.2006). We propose that ageing induces oxidative degradation in isocitrate dehydrogenase from Prochlorococcus MIT9313 cells, accelerating the turnover of this protein. This is compensated by an increased icd expression to overcome degradation of the enzyme under such conditions. Effect of inhibitors of N assimilation MSX and azaserine are specific inhibitors of GS and GOGAT, respectively (Pace and McDermott 1952; Oaks, Sivasankar and Goodfellow 1998), which have been used in physiological studies on the role of both enzymes and the regulatory system of nitrogen metabolism in cyanobacteria. Addition of 100 μM MSX induced a strong upregulation of ntcA (ca. 50-fold), detectable 24 h after its addition to Prochlorococcus sp. MIT9313 cultures (Fig. 3); pipX and icd were also upregulated, but with a less pronounced effect (ca. 9-fold and 7-fold increase in expression, respectively), although in both cases it was significant (P = 0.0001 for both conditions 24 h after addition of inhibitor). The pattern was different in glnB, whose expression decreased at 24 h, after a small increase at 6 h. Figure 3. View largeDownload slide Effect of MSX addition on gene expression in Prochlorococcus sp. strain MIT9313. MSX (100 μM) was added to cultures at 0 time, keeping an aliquot growing under standard conditions without addition. Samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of MSX-treated cells with respect to the control, for each sample. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. Figure 3. View largeDownload slide Effect of MSX addition on gene expression in Prochlorococcus sp. strain MIT9313. MSX (100 μM) was added to cultures at 0 time, keeping an aliquot growing under standard conditions without addition. Samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of MSX-treated cells with respect to the control, for each sample. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. Interestingly, the response in the case of ntcA in Prochlorococcus sp. MIT9313 is opposite to that observed in another low-light adapted Prochlorococcus strain: its expression decreased 0.5-fold 24 h after MSX addition in SS120 (López-Lozano et al.2009) vs ca. 50-fold increase in MIT9313 (Fig. 3). This fact is particularly striking, since ntcA encodes the master nitrogen regulator, and its function seems to have been conserved in the whole cyanobacterial radiation. That two Prochlorococcus strains adapted to grow at depth show such a strong difference in a basic regulatory mechanism is a good example of the diversification experimented by the Prochlorococcus genus. The response of icd after MSX addition was also different between both strains: it showed a comparable increase but with a very different timing, it increased very quickly in SS120 (6-fold after 1 h) but more slowly in MIT9313 (7-fold after 24 h; Fig. 3), despite the huge upregulation of ntcA in this strain. When we analysed the effects of 100 μM azaserine to Prochlorococcus sp. MIT9313 cultures (Fig. 4), we observed an increase in the expression of ntcA, glnB and pipX 5 h after addition of the inhibitor; however, this effect disappeared after 24 h for the three genes, showing a significant decrease in the case of glnB (P = 0.002). Interestingly, icd expression did increase after 24 h. These changes were similar to those observed for the same genes in Prochlorococcus SS120 (López-Lozano et al.2009). Figure 4. View largeDownload slide Effect of azaserine addition on gene expression in Prochlorococcus sp. strain MIT9313. Azaserine (100 μM) was added to cultures at 0 time, keeping an aliquot growing under standard conditions without addition. Samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of azaserine-treated cells with respect to the control, for each sample. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. Figure 4. View largeDownload slide Effect of azaserine addition on gene expression in Prochlorococcus sp. strain MIT9313. Azaserine (100 μM) was added to cultures at 0 time, keeping an aliquot growing under standard conditions without addition. Samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of azaserine-treated cells with respect to the control, for each sample. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. In summary, MSX addition provoked striking differences between MIT9313 and SS120, but the effect of azaserine was alike in both strains. Effects of inhibitors of the photosynthetic electron chain The addition of photosynthetic inhibitors (DCMU and DBMIB, blocking the photosynthetic electron flow before and after the plastoquinone pool, respectively) was studied in order to check whether the electron transport was involved in the control of the C/N balance in Prochlorococcus sp. MIT9313, and more specifically, whether the redox state of plastoquinone could be directly responsible for this control. Both inhibitors were added separately at the indicated concentrations, and samples from Prochlorococcus sp. MIT9313 cultures were taken after 1 and 24 h of the inhibitors’ addition. A control culture with no addition was used in all experiments. DCMU had little effect on the expression of the studied genes (Fig. 5A), with minor up- or downregulation depending on the gene, with the exception of icd, which was significantly upregulated after 24 h (P = 0.0019). However, addition of DBMIB induced an increase in all cases, going from 2-fold increase in the case of glnB to a remarkable ca. 100-fold increase in the case of icd (P = 0.0001). This suggests that electron flow is indeed involved in the control of the C/N balance; taking into account the striking effect of DBMIB, and the lack of effect of DCMU, it seems that reduction of the plastoquinone pool induces gene expression. Figure 5. View largeDownload slide Effect of DCMU and DBMIB addition on gene expression in Prochlorococcus sp. strain MIT9313. (A) DCMU (0.3 μM) and (B) DBMIB (0.06 μM) were added to cultures at 0 time, keeping an aliquot growing under standard conditions without addition. Samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of inhibitor-treated cells with respect to the control, for each sample. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. Figure 5. View largeDownload slide Effect of DCMU and DBMIB addition on gene expression in Prochlorococcus sp. strain MIT9313. (A) DCMU (0.3 μM) and (B) DBMIB (0.06 μM) were added to cultures at 0 time, keeping an aliquot growing under standard conditions without addition. Samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of inhibitor-treated cells with respect to the control, for each sample. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. Interestingly, we observed similar effects for both inhibitors on ntcA and glnB expression in Prochlorococcus sp. SS120 (López-Lozano et al.2009). However, DBMIB effect on icd expression clearly differs between both strains: icd levels strongly decreased in the SS120 strain, while they showed a huge increase in the MIT9313 strain (Fig. 5B). This points out to fundamental differences in the control of icd expression in Prochlorococcus depending on the studied strain, since isocitrate dehydrogenase is the enzyme linking the C and N metabolisms in cyanobacteria (Domínguez-Martín et al.2014). Remarkable differences in the integration of the C/N metabolisms were also observed in previous transcriptomic studies (Tolonen et al.2006). Our work corroborates these results and provides additional evidence to support a modulation of the C/N balance control systems in Prochlorococcus; early branching low-light strains as MIT9313 show a icd responsiveness to the redox state of the plastoquinone pool that seems to have been lost in more late-branching ecotypes as SS120. This idea fits nicely with the hypothesis of general streamlining in the C/N control systems in Prochlorococcus, previously proposed by our team (García-Fernández, Tandeau de Marsac and Diez 2004), as an adaptive mechanism to very oligotrophic oceans. Related processes have also been described by our team in the regulation of glutamine synthetase in the marine strain Synechococcus sp. WH7803 strain (Domínguez-Martín, Díez and García-Fernández 2016). Concluding remarks The results described in this work evidence clear differences in the expression of key genes in the regulation of C/N in Prochlorococcus sp. strain MIT9313, which are especially remarkable when compared to similar experiments in other low-light adapted strain as SS120: the expression of glnB under nitrogen starvation (Fig. 1B); the expression of ntcA after MSX addition (Fig. 3); and the expression of icd after DBMIB addition (Fig. 5B). All these responses are almost opposite to those found in Prochlorococcus sp. SS120, where glnB, ntcA and icd transcript levels decrease or remain unchanged when cells are subjected to the same conditions (López-Lozano et al.2009). This might be another example of a progressive process of simplification in the regulatory systems of Prochlorococcus, where regulatory proteins become less responsive to changes in the environment: i.e. the lack of phosphorylation of the PII protein (Palinska et al.2002) or the decreased responsiveness of NtcA to 2-oxoglutarate (Domínguez-Martín et al.2017). In this view, late-branching strains of the low-light Prochlorococcus ecotypes (as SS120) show regulatory patterns that are streamlined with respect to early-branching, low-light adapted strains as Prochlorococcus sp. strain MIT9313. SUPPLEMENTARY DATA Supplementary data are available at FEMSLE online. Acknowledgements We thank the Roscoff Culture Collection (Station Biologique, Roscoff, France) and the Massachusetts Institute of Technology Cyanobacterial Collection (Cambridge, USA) for providing Prochlorococcus sp. strain MIT9313. We acknowledge the kind collaboration of the Instituto Español de Oceanografía for supplying seawater. DNA sequencing was carried at the genomics service of the Servicio Centralizado de Apoyo a la Investigación (SCAI, Universidad de Córdoba, Spain). FUNDING This work was supported by grants BFU-2013–44767-P and BFU-2016–76227-P (Spanish Ministerio de Economía y Competitividad, cofunded by the European Social Fund from the European Union), P12-BIO-2141 (Proyectos de Excelencia, Junta de Andalucía, Spain) and Universidad de Córdoba (Programa Propio de Investigación). María Agustina Domínguez-Martín (MAD-M) and Oriol Alberto Rangel-Zúñiga (OAR-Z) received doctoral grants from projects BFU-2013–44767-P and BFU2006–1011/BMC, respectively. Antonio López-Lozano (AL-L) received a post-doctoral grant from project P12-BIO-2141 (Proyectos de Excelencia, Junta de Andalucía, Spain). Conflict of Interest. None declared. REFERENCES Bibby T , Mary I, Nield Jet al.   Low-light-adapted Prochlorococcus species possess specific antennae for each photosystem. Nature  2003; 424: 1051– 4. Google Scholar CrossRef Search ADS PubMed  Biller S , Berube P, Lindell Det al.   Prochlorococcus: the structure and function of collective diversity. Nat Rev Microbiol  2015; 13: 13– 27. Google Scholar CrossRef Search ADS PubMed  Domínguez-Martín M , Díez J, García-Fernández J. Physiological studies of glutamine synthetases I and III from Synechococcus sp. WH7803 reveal differential regulation. Front Microbiol  2016; 7: 969. Google Scholar CrossRef Search ADS PubMed  Domínguez-Martín MA , López-Lozano, A, Clavería-Gimeno, Ret al.   Differential NtcA responsiveness to 2-oxoglutarate underlies the diversity of C/N balance regulation in Prochlorococcus. Front Microbiol  2017; 8: 2641. Domínguez-Martín MA , López-Lozano A, Diez Jet al.   Physiological regulation of isocitrate dehydrogenase and the role of 2-oxoglutarate in Prochlorococcus sp. strain PCC 9511. PLOS One  2014; 9: e103380. Google Scholar CrossRef Search ADS PubMed  El Alaoui S , Diez J, Humanes Let al.   In vivo regulation of glutamine synthetase activity in the marine chlorophyll b-containing cyanobacterium Prochlorococcus sp. strain PCC 9511 (Oxyphotobacteria). Appl Environ Microb  2001; 67: 2202– 7. Google Scholar CrossRef Search ADS   El Alaoui S , Diez J, Toribio Fet al.   Glutamine synthetase from the marine cyanobacteria Prochlorococcus spp.: characterization, phylogeny and response to nutrient limitation. Environ Microbiol  2003; 5: 412– 23. Google Scholar CrossRef Search ADS PubMed  Espinosa J , Forchhammer K, Burillo Set al.   Interaction network in cyanobacterial nitrogen regulation: PipX, a protein that interacts in a 2-oxoglutarate dependent manner with PII and NtcA. Mol Microbiol  2006; 61: 457– 69. Google Scholar CrossRef Search ADS PubMed  Flombaum P , Gallegos JL, Gordillo RAet al.   Present and future global distributions of the marine cyanobacteria Prochlorococcus and Synechococcus. P Natl Acad Sci USA  2013; 110: 9824– 9. Google Scholar CrossRef Search ADS   Forchhammer K , Tandeau de Marsac N. The PII protein in the cyanobacterium Synechococcus sp. strain PCC 7942 is modified by serine phosphorylation and signals the cellular N-status. J Bacteriol  1994; 176: 84– 91. Google Scholar CrossRef Search ADS PubMed  García-Domínguez M , Reyes J, Florencio F. NtcA represses transcription of gifA and gifB, genes that encode inhibitors of glutamine synthetase type I from Synechocystis sp. PCC 6803. Mol Microbiol  2000; 35: 1192– 201. Google Scholar CrossRef Search ADS PubMed  García-Fernández J , Diez J. Adaptive mechanisms of the nitrogen and carbon assimilatory pathways in the marine cyanobacteria Prochlorococcus. Res Microbiol  2004; 155: 795– 802. Google Scholar CrossRef Search ADS PubMed  García-Fernández J , Tandeau de Marsac N, Diez J. Streamlined regulation and gene loss as adaptive mechanisms in Prochlorococcus for optimized nitrogen utilization in oligotrophic environments. Microbiol Mol Biol R  2004; 68: 630– 8. Google Scholar CrossRef Search ADS   Gómez-Baena G , Diez J, García-Fernández Jet al.   Regulation of glutamine synthetase by metal-catalyzed oxidative modification in the marine oxyphotobacterium Prochlorococcus. Biochim Biophys Acta  2001; 1568: 237– 44. Google Scholar CrossRef Search ADS PubMed  Gómez-Baena G , Domínguez-Martín M, Donaldson Ret al.   Nutrient starvation makes glutamine synthetase more sensitive to oxidative modification in Prochlorococcus marinus PCC 9511. PLOS One  2015;doi: 10.1371/journal.pone.0135322. Gómez-Baena G , García-Fernández J, Lopez-Lozano Aet al.   Glutamine synthetase degradation is controlled by oxidative proteolysis in the marine cyanobacterium Prochlorococcus marinus strain PCC 9511. Biochim Biophys Acta  2006; 1760: 930– 40. Google Scholar CrossRef Search ADS PubMed  Graziano L , Geider R, Li Wet al.   Nitrogen limitation of North Atlantic phytoplankton - Analysis of physiological condition in nutrient enrichment experiments. Aquat Microb Ecol  1996; 11: 53– 64. Google Scholar CrossRef Search ADS   Grzymski J , Dussaq A. The significance of nitrogen cost minimization in proteomes of marine microorganisms. ISME J  2011; 6: 71– 80. Google Scholar CrossRef Search ADS PubMed  Hunter-Cervera KR , Neubert MG, Olson RJet al.   Physiological and ecological drivers of early spring blooms of a coastal phytoplankter. Science  2016; 354: 326– 9. Google Scholar CrossRef Search ADS PubMed  Landschützer P , Gruber N, Haumann FAet al.   The reinvigoration of the Southern Ocean carbon sink. Science  2015; 349: 1221– 4. Google Scholar CrossRef Search ADS PubMed  López-Lozano A , Gómez-Baena G, Muñoz-Marín Met al.   Expression of genes involved in nitrogen assimilation and the C/N balance sensing in Prochlorococcus sp. strain SS120. Gene Expression  2009; 14: 279– 89. Google Scholar CrossRef Search ADS PubMed  Luque I , Flores E, Herrero A. Molecular mechanism for the operation of nitrogen control in cyanobacteria. EMBO J  1994; 13: 2862– 9. Google Scholar PubMed  McDonagh B , Domínguez-Martín MA, Gómez-Baena Get al.   Nitrogen starvation induces extensive changes in the redox proteome of Prochlorococcus sp. SS120. Environ Microbiol Rep  2012; 4: 257– 67. Google Scholar CrossRef Search ADS PubMed  Martiny A , Coleman M, Chisholm S. Phosphate acquisition genes in Prochlorococcus ecotypes: evidence for genome-wide adaptation. P Natl Acad Sci USA  2006; 103: 12552– 7. Google Scholar CrossRef Search ADS   Oaks A , Sivasankar S, Goodfellow V. The specificity of methionine sulfoximine and azaserine inhibition in plant tissues. Phytochemistry  1998; 49: 355– 7. Google Scholar CrossRef Search ADS   Pace J , McDermott E. Methionine sulphoximine and some enzyme systems involving glutamine. Nature  1952; 169: 415– 6. Google Scholar CrossRef Search ADS PubMed  Palinska KA , Laloui W, Bedu Set al.   The signal transducer PII and bicarbonate acquisition in Prochlorococcus marinus PCC 9511, a marine cyanobacterium naturally deficient in nitrate and nitrite assimilation. Microbiology  2002; 148: 2405– 12. Google Scholar CrossRef Search ADS PubMed  Partensky F , Blanchot J, Vaulot D. Differential distribution and ecology of Prochlorococcus and Synechococcus in oceanic waters: a review. In: Charpy L, Larkum A (eds). Marine Cyanobacteria , Vol. 19. Numéro Spécial, Monaco: Bulletin de l’Institut Océanographique, 1999, 457– 76. Partensky F , Hess W, Vaulot D. Prochlorococcus, a marine photosynthetic prokaryote of global significance. Microbiol Mol Biol R  1999; 63: 106– 27. Pfaffl M . A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res  2001; 29: e45. Google Scholar CrossRef Search ADS PubMed  Picossi S , Flores E, Herrero A. ChIP analysis unravels an exceptionally wide distribution of DNA binding sites for the NtcA transcription factor in a heterocyst-forming cyanobacterium. BMC Genomics  2014; 15: 22. Rangel O , Gómez-Baena G, López-Lozano Aet al.   Physiological role and regulation of glutamate dehydrogenase in Prochlorococcus MIT9313. Environ Microbiol Rep  2009; 1: 56– 64. Google Scholar CrossRef Search ADS PubMed  Read RW , Berube PM, Biller SJet al.   Nitrogen cost minimization is promoted by structural changes in the transcriptome of N-deprived Prochlorococcus cells. ISME J  2017; 11: 2267– 78. Google Scholar CrossRef Search ADS PubMed  Reistetter EN , Krumhardt K, Callnan Ket al.   Effects of phosphorus starvation versus limitation on the marine cyanobacterium Prochlorococcus MED4 II: gene expression. Environ Microbiol  2013; 15: 2129– 43. Google Scholar CrossRef Search ADS PubMed  Scanlan D , Ostrowski M, Mazard Set al.   Ecological genomics of marine picocyanobacteria. Microbiol Mol Biol R  2009; 73: 249– 99. Google Scholar CrossRef Search ADS   Tollefson J . The hostile ocean that slowed climate change. Science  2016; 349: 346– 8. Tolonen A , Aach J, Lindell Det al.   Global gene expression of Prochlorococcus ecotypes in response to changes in nitrogen availability. Mol Syst Biol  2006; 2: 53. Google Scholar CrossRef Search ADS PubMed  Valladares A , Rodríguez V, Camargo Set al.   Specific role of the cyanobacterial PipX factor in the heterocysts of Anabaena sp. strain PCC 7120. J Bacteriol  2011; 193: 1172– 82. Google Scholar CrossRef Search ADS PubMed  Voigt K , Sharma CM, Mitschke Jet al.   Comparative transcriptomics of two environmentally relevant cyanobacteria reveals unexpected transcriptome diversity. ISME J  2014; 8: 2056– 68. Google Scholar CrossRef Search ADS PubMed  © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png FEMS Microbiology Letters Oxford University Press

Distinct features of C/N balance regulation in Prochlorococcus sp. strain MIT9313

Loading next page...
 
/lp/ou_press/distinct-features-of-c-n-balance-regulation-in-prochlorococcus-sp-i0i9SeBfoH
Publisher
Blackwell
Copyright
© FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
0378-1097
eISSN
1574-6968
D.O.I.
10.1093/femsle/fnx278
Publisher site
See Article on Publisher Site

Abstract

Abstract The abundance and significant contribution to global primary production of the marine cyanobacterium Prochlorococcus have made it one of the main models in marine ecology. Several conditions known to cause strong effects on the regulation of N-related enzymes in other cyanobacteria lacked such effect in Prochlorococcus. Prochlorococcus sp. strain MIT9313 is one of the most early-branching strains among the members of this genus. In order to further understand the C/N control system in this cyanobacterium, we studied the effect of the absence of three key elements in the ocean, namely N, P and Fe, as well as the effect of inhibitors of the N assimilation or photosynthesis on the N metabolism of this strain. Furthermore, we focused our work in the effect of ageing, as the age of cultures has clear effects on the regulation of some enzymes in Prochlorococcus. To reach this goal, expression of the main three regulators involved in N assimilation in cyanobacteria, namely ntcA, glnB and pipX, as well as that of icd (encoding for isocitrate dehydrogenase) were analysed. Our results show that the control of the main proteins involved in the C/N balance in strain MIT9313 differs from other model Prochlorococcus strains. Prochlorococcus, nitrogen metabolism, C/N balance sensing, transcriptional regulation, starvation, adaptive mechanisms INTRODUCTION Prochlorococcus is the most abundant photosynthetic organism on Earth (Partensky, Blanchot and Vaulot 1999; Biller et al.2015); together with marine Synechococcus, it is responsible for a very significant part of the global primary production (Partensky, Hess and Vaulot 1999; Scanlan et al.2009). The ecological relevance of marine picocyanobacteria is even more significant in the light of global warming, since oceanic phytoplankton populations are an important carbon sink (Landschützer et al.2015), and recent studies suggest that the effects of climate change will increase their populations (Flombaum et al.2013). Furthermore, improving the understanding of the phytoplankton blooms has been considered the next frontier in order to get climate projections right (Tollefson 2016). Recent long-term studies addressed the factors controlling the appearance of cyanobacterial blooms in the ocean, pointing to temperature as one of the main elements (Hunter-Cervera et al.2016). However, and despite the large number of studies on marine picocyanobacteria, there are still many aspects insufficiently known. Among them, the metabolism of carbon and nitrogen and their regulation is one of the most important fields, since it links photosynthesis (allowing the incorporation of atmospheric CO2) to the utilisation of nitrogen. N is one of the main elements of life, since it constitutes an essential part of proteins and nucleic acids. Because N is scarcely available in the oligotrophic intertropical oceans inhabited by Prochlorococcus, there are large regions where N limitation imposes harsh conditions for this cyanobacterium to thrive (Graziano et al.1996). Our team has studied the regulation of several enzymes involved in the N and C metabolisms in Prochlorococcus, namely glutamine synthetase (El Alaoui et al.2001, 2003; Gómez-Baena et al.2001; Gómez-Baena et al.2006, 2015), isocitrate dehydrogenase (McDonagh et al.2012; Domínguez-Martín et al.2014) and glutamate dehydrogenase (Rangel et al.2009). Besides, we have carried out a gene expression study focused on genes encoding enzymes and regulatory proteins that control the C/N balance in the low-light Prochlorococcus strain SS120 (López-Lozano et al.2009). One of our main conclusions was that this control system seems to have been streamlined in Prochlorococcus, probably due to an evolutionary trend in order to save energy (García-Fernández and Diez 2004; García-Fernández, Tandeau de Marsac and Diez 2004). This fits with the results observed by other authors using different approaches, such as global transcriptomic (Tolonen et al.2006) or proteomic studies (Grzymski and Dussaq 2011; Read et al.2017). In order to further understand the C/N control system in Prochlorococcus, we present a study in Prochlorococcus sp. strain MIT9313, representative of the LLIV ecotype. This is one of the most early-branching strains among the cultured members of the Prochlorococcus genus (Biller et al.2015). In global transcriptomic studies addressing nitrogen availability in Prochlorococcus sp. strains MED4 and MIT9313, it was shown that both strains integrate N and C metabolism in profoundly different ways (Tolonen et al.2006). More recently, a comparative RNA-seq transcriptomics study between the same strains further illustrated those differences, particularly in the case of non-coding RNAs (Voigt et al.2014). The aim of this work is to further understand the differential features in the regulation of the C/N balance in Prochlorococcus sp. MIT9313. To this goal, we studied the expression of icd, the gene encoding the key enzyme isocitrate dehydrogenase, and main regulatory genes of C/N metabolism in cyanobacteria: the master nitrogen regulator ntcA (Luque, Flores and Herrero 1994), and the genes encoding proteins that interact with NtcA, pipX and glnB, encoding the coactivator of NtcA, PipX (Espinosa et al. 2006) and the regulatory PII protein (Forchhammer and Tandeau de Marsac 1994), respectively. We performed a series of experiments to determine gene expression by semiquantitative RT-PCR, under conditions representative of limitations of Prochlorococcus populations in nature; i.e. starvation for N, P and Fe; inhibition of the glutamine synthetase (GS) and glutamate synthase (GOGAT) enzymes; inhibition of the photosynthetic electron transport; and ageing of the cultures. In this work, we describe and discuss the results with respect to those observed in other cyanobacterial strains. MATERIALS AND METHODS Growth of cultures of Prochlorococcus Prochlorococcus marinus sp. strain MIT9313 (LL-adapted) was grown as previously described (El Alaoui et al.2001). Methionine sulfoximine (MSX), azaserine, 3-(3–4-dichlorophenyl)-1,1-dimethylurea (DCMU) and 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone (DBMIB) were dissolved and added to cultures as previously described (El Alaoui et al.2001). Cell collection Cell collection and the preparation of culture media devoid of key elements for experiments addressing nutrient starvation are described in López-Lozano et al. (2009). RNA isolation RNA was isolated from 500 mL culture samples, using the TRIsure RNA Isolation Reagent (Bioline) following the method described previously by our team (Domínguez-Martín, Díez and García-Fernández 2016). Real-time quantitative RT-PCR analysis of gene expression cDNA synthesis from RNA samples was carried out with the iScriptTM cDNA Synthesis kit from Quanta as recommended by the manufacturers (Domínguez-Martín et al.2014). Specific primers for icd, ntcA, glnB and pipX genes (encoding isocitrate dehydrogenase, NtcA, PII and PipX, respectively) were designed as previously described (Domínguez-Martín, Díez and García-Fernández 2016). Specificity of the qRT-PCR reactions was checked by agarose gel electrophoresis. The sequences of the primers used are listed in Table 1. Table 1. Primers used for quantitative real-time RT-PCR reactions. Primer  Sequence 5΄- 3΄  Gene  RT-FMI  CAACATGCTCTTCGGCTAAA  icd  RT-RMI  AGTTCATAGCCCCAGTCACG    RT-FP2M  CGACGACGACAAGGTGGA  glnB  RT-RP2M  CTTGCTGTCACGCTCGCC    RT-FTCA  GCGTGGGGTTACTTCTGC  ntcA  RT-RTCA  CGATGGACTGATGTGAGAGG    RT-FPXM  TTACGCCACGCTCTATGC  pipX  RT-RPXM  AACAACTGCTGCCAACTCTC    FRPM  CTATCTAGGACCGCCGTTAC  rnpB  RRPM  GAGAGTGCCACAGAAAAACA    Primer  Sequence 5΄- 3΄  Gene  RT-FMI  CAACATGCTCTTCGGCTAAA  icd  RT-RMI  AGTTCATAGCCCCAGTCACG    RT-FP2M  CGACGACGACAAGGTGGA  glnB  RT-RP2M  CTTGCTGTCACGCTCGCC    RT-FTCA  GCGTGGGGTTACTTCTGC  ntcA  RT-RTCA  CGATGGACTGATGTGAGAGG    RT-FPXM  TTACGCCACGCTCTATGC  pipX  RT-RPXM  AACAACTGCTGCCAACTCTC    FRPM  CTATCTAGGACCGCCGTTAC  rnpB  RRPM  GAGAGTGCCACAGAAAAACA    View Large qRT-PCR semiquantitative gene expression determinations were carried out as previously described (Domínguez-Martín et al.2014), according to the Pfaffl method (Pfaffl 2001), on an iCycler IQ multicolor real-time PCR detection system (Bio-Rad). The melting point of PCR products was used to confirm the absence of false amplifications. Triplicate determinations from at least three independent biological samples subjected to identical culture conditions were used for calculations. Results were endogenously normalised to rnpB expression (encoding RNase P), using the 2−ΔΔCt method (Pfaffl 2001), since this gene did not change under our experimental conditions. The results shown in all figures correspond to relative expression, so that each value represents the changes under a specific condition with respect to the same culture under control conditions. Prochlorococcus genomic sequences Genomic sequences were retrieved from the Joint Genome Institute (http://genome.jgi-psf.org) and Cyorf (http://cyano.genome.ad.jp/) databases. Statistical analysis Results were obtained by using at least three different samples, and error bars show the standard deviation. Statistical analysis was done using the Student's t-test, as previously described (Domínguez-Martín et al.2014). Assessment of data significance is indicated with asterisks: * indicates P ≤ 0.05; ** indicates P ≤ 0.01. RESULTS AND DISCUSSION Effect of key elements starvation In previous studies on the regulation of nitrogen-related enzymes, we observed that several conditions known to cause strong effects in other cyanobacteria lacked such effect in Prochlorococcus (El Alaoui et al.2001, 2003; Domínguez-Martín et al.2014); thus, we were interested to check whether this might be due to a general streamlining on regulatory networks or to some specific response of these N-related enzymes. We decided to study the effect of the absence of three key elements in the ocean, namely N, P and Fe, which are often in limiting concentration in oligotrophic areas, on the N metabolism of Prochlorococcus sp. MIT9313. Prochlorococcus MIT9313 cells were transferred to media without any added key element (either N, P or Fe), and were kept under such conditions for 5 days, sampling at 48 and 120 h, in order to test whether prolonged starvation effects were different with respect to those observed after 2 days starvation. Aliquots of the same cultures were kept under standard conditions. Nitrogen Figure 1 shows the relative expression changes observed for the ntcA, glnB, pipX and icd genes under N starvation, with respect to cells growing under standard conditions (standard PCR-S11 media, which includes 400 μM (NH4)2SO4). Figure 1. View largeDownload slide Effect of key elements starvation on gene expression in Prochlorococcus sp. strain MIT9313. Cells were subjected to nitrogen (blue), phosphorus (red) or iron (green) starvation for 5 days, keeping an aliquot growing under standard conditions as control. Samples were obtained at 48 and 120 h to determine gene expression by qRT-PCR. The expression levels represent the response of starved cells with respect to the control, for each sample. A, ntcA expression. B, glnB expression. C, pipX expression. D, icd expression. Error bars represent the standard deviation. Figure 1. View largeDownload slide Effect of key elements starvation on gene expression in Prochlorococcus sp. strain MIT9313. Cells were subjected to nitrogen (blue), phosphorus (red) or iron (green) starvation for 5 days, keeping an aliquot growing under standard conditions as control. Samples were obtained at 48 and 120 h to determine gene expression by qRT-PCR. The expression levels represent the response of starved cells with respect to the control, for each sample. A, ntcA expression. B, glnB expression. C, pipX expression. D, icd expression. Error bars represent the standard deviation. ntcA showed a strong increase (over 20-fold) at 48 h, which however disappeared almost completely at 120 h (P = 0.0026). pipX expression showed a similar pattern, although the induction at 48 h was less remarkable (ca. 12-fold). However, glnB and icd changed in the opposite way: their expression showed little change at 48 h, while it was strongly upregulated after 120 h (P = 0.0002 and P = 0.0001, respectively). This behaviour is consistent with previous reports in Prochlorococcus sp. MIT9313 (Tolonen et al.2006) that showed upregulation of ntcA under nitrogen starvation, while glnB was slightly downregulated after 48 h. Our results also fit with previous studies in freshwater cyanobacterial strains, where ntcA (Luque, Flores and Herrero 1994) and pipX (Valladares et al.2011) have been shown to increase upon nitrogen starvation. The study of the promoters of ntcA, glnB and pipX associated with reported transcriptional start sites (TSS) upstream of the coding sequence of these regulatory genes in Prochlorococcus sp. MIT9313 (Voigt et al.2014) showed the presence of a putative NtcA-binding site in all of them (Fig. S1, Supporting Information). Although the NtcA-binding sites of these genes presented some variations with respect to the consensus palindromic sequence GTAN8TAC described for cyanobacteria (Luque, Flores and Herrero 1994), they still conserved the most necessary nucleotides required for this binding (Picossi, Flores and Herrero 2014). NtcA-activated promoters also show a canonical sigma-70 Escherichia coli-like -10 box (TAN3T) that is found in either the ntcA or the pipX promoter, while that of glnB presents an incomplete version of this box in MIT9313 strain. Interestingly, these three regulatory genes also possess potential antisense RNA (aTSS) (Voigt et al.2014) associated with NtcA-binding sites with either activating or repressing function (Fig. S1, Supporting Information). NtcA acts as a repressor when the NtcA-binding site overlaps the RNA polymerase-binding site (García-Domínguez, Reyes and Florencio 2000); while ntcA, glnB and pipX show repressive NtcA-binding sites for all their reported aTSS, only glnB and pipX present additional activator sites linked to –10 non-canonical boxes that could lead the expression of these aTSS. Hence, the balance between the expression of gene coding RNA (gTSS) and aTSS in glnB and pipX, likely controlled by the differential affinity of both NtcA and RNA polymerase for their corresponding binding sites, would explain the differences observed in the expression of those regulatory genes with respect to that of ntcA under nitrogen starvation, despite being modulated by the same transcription factor. This would require further experimental confirmation by northern blot by using specific probes. A significant change was observed when we compared the gene expression results obtained with the Prochlorococcus sp. strain MIT9313 with those reported previously by our team on Prochlorococcus sp. strain SS120 (López-Lozano et al.2009): with that strain, we could see a decrease in glnB and ntcA expression under N starvation. At the same time (48 h), we observed a stronger decrease in glnB expression in MIT9313, followed by an increase of roughly 2-fold at 120 h (Fig. 1B). Besides, we observed an increase in ntcA expression in MIT9313 (Fig. 1A), in contrast to the decrease observed in SS120 (López-Lozano et al.2009). This suggests that, even comparing two low-light adapted strains as SS120 and MIT9313, there exists some differences regarding key regulator proteins as PII and NtcA. The distinct evolutive stories of these strains might help to explain the observed differences (see later). A possible reason for these differences might be that, unlike SS120, Prochlorococcus sp. strain MIT9313 seems to be capable of using glutamate, since it possesses the gdh gene, encoding glutamate dehydrogenase (Rangel et al.2009). The downregulation effect on gdh expression and its activity when MIT9313 cells were subjected to N starvation suggest that this enzyme in Prochlorococcus is involved in the assimilation of amino acids, and is not performing direct ammonium assimilation to produce glutamate (Rangel et al.2009). This might be useful to assimilate glutamate released to culture media in aged cultures (Rangel et al.2009), thus providing an alternate source of nitrogen to Prochlorococcus sp. strain MIT9313, which might be unavailable for the strain SS120. Phosphorus Unlike the results observed under N limitation, P starvation induced the long-term upregulation of all studied genes (ntcA, glnB, pipX and icd). However, the changes were much less remarkable compared to those observed under N starvation (Fig. 1). This suggests that those effects are not mediated by the same regulatory mechanisms as those provoked by N starvation. Interestingly, no clear effect was observed in samples obtained 48 h after the beginning of P starvation. Since ntcA/pipX showed opposite regulatory patterns to glnB under N starvation, the results observed under P starvation might suggest that they are caused by a general stress response, leading to the upregulation of a number of genes. This is in good agreement with global transcriptomic studies focused on the effects of P limitation in Prochlorococcus sp. MIT9313 (Martiny, Coleman and Chisholm 2006). However, no specific changes for the genes studied in our paper were reported by Martiny and coworkers. In transcriptomic studies addressing P limitation in Prochlorococcus sp. MED4, no specific changes for the genes here studied were reported either (Reistetter et al.2013). Iron Fe starvation induced a ca. 4-fold increase in the glnB and pipX expression, and slightly lower in the case of ntcA. Interestingly, this increase was roughly similar at both times of sampling (48 and 120 h), in contrast with the results obtained for both N and P starvation. There was a significant upregulation in icd expression after 120 h (P = 0.001). Our results might suggest that Prochlorococcus can quickly adapt to Fe starvation by increasing the expression of certain genes, keeping them upregulated as long as the starvation persists. This hypothesis, in turn, fits with previous studies suggesting that Prochlorococcus is an organism adapted to grow in environments with low iron concentrations, which has developed specific adaptation mechanisms (i.e. the utilisation of pcb genes as antenna, whose phylogeny is very related to isiA, a gene expressed under Fe starvation in other cyanobacteria; Bibby et al.2003). Effect of ageing Previous studies of our team showed that age of cultures had clear effects on the regulation of some enzymes in Prochlorococcus as glutamine synthetase (Gómez-Baena et al.2006) or glutamate dehydrogenase (Rangel et al.2009). Hence, we studied whether this effect might be due to changes in the expression of regulatory genes, and consequently the expression of other enzyme-coding genes. Figure 2 shows the expression of ntcA, glnB, pipX and icd over the course of 11 days. We observed a progressive increase in the expression of the three regulatory genes: ntcA and pipX, with the latter showing the strongest upregulation (more than 15-fold increase; P = 0.0022), followed by icd (ca. 12-fold; P = 0.0001) and ntcA (ca. 10-fold); glnB expression showed a less marked increase (ca. 3-fold). This suggests that the consumption of nitrogen by Prochlorococcus cells might lead to a reduced availability of this element in aged cultures, thus inducing the expression of the regulatory genes here studied. Those changes, in turn, would induce the icd upregulation (Fig. 2). Figure 2. View largeDownload slide Effect of ageing on gene expression in Prochlorococcus sp. strain MIT9313. Cells were grown under standard conditions for 12 days and samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of cells at the indicated times with respect to the values determined at the beginning of the experiment. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. Figure 2. View largeDownload slide Effect of ageing on gene expression in Prochlorococcus sp. strain MIT9313. Cells were grown under standard conditions for 12 days and samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of cells at the indicated times with respect to the values determined at the beginning of the experiment. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. These results are consistent with the evolution observed for gdhA expression in Prochlorococcus sp. strain MIT9313: it increased over 15-fold after 7 days of cell growth (Rangel et al.2009). Interestingly, the glutamate dehydrogenase enzyme concentration did not significantly change in that period, suggesting that the increase in gene expression was caused by a faster turnover of the protein. Furthermore, we demonstrated that isocitrate dehydrogenase is subjected to oxidative modification (Gómez-Baena et al.2006; McDonagh et al.2012), and this process has been shown to be age-dependent in the case of glutamine synthetase (Gómez-Baena et al.2006). We propose that ageing induces oxidative degradation in isocitrate dehydrogenase from Prochlorococcus MIT9313 cells, accelerating the turnover of this protein. This is compensated by an increased icd expression to overcome degradation of the enzyme under such conditions. Effect of inhibitors of N assimilation MSX and azaserine are specific inhibitors of GS and GOGAT, respectively (Pace and McDermott 1952; Oaks, Sivasankar and Goodfellow 1998), which have been used in physiological studies on the role of both enzymes and the regulatory system of nitrogen metabolism in cyanobacteria. Addition of 100 μM MSX induced a strong upregulation of ntcA (ca. 50-fold), detectable 24 h after its addition to Prochlorococcus sp. MIT9313 cultures (Fig. 3); pipX and icd were also upregulated, but with a less pronounced effect (ca. 9-fold and 7-fold increase in expression, respectively), although in both cases it was significant (P = 0.0001 for both conditions 24 h after addition of inhibitor). The pattern was different in glnB, whose expression decreased at 24 h, after a small increase at 6 h. Figure 3. View largeDownload slide Effect of MSX addition on gene expression in Prochlorococcus sp. strain MIT9313. MSX (100 μM) was added to cultures at 0 time, keeping an aliquot growing under standard conditions without addition. Samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of MSX-treated cells with respect to the control, for each sample. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. Figure 3. View largeDownload slide Effect of MSX addition on gene expression in Prochlorococcus sp. strain MIT9313. MSX (100 μM) was added to cultures at 0 time, keeping an aliquot growing under standard conditions without addition. Samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of MSX-treated cells with respect to the control, for each sample. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. Interestingly, the response in the case of ntcA in Prochlorococcus sp. MIT9313 is opposite to that observed in another low-light adapted Prochlorococcus strain: its expression decreased 0.5-fold 24 h after MSX addition in SS120 (López-Lozano et al.2009) vs ca. 50-fold increase in MIT9313 (Fig. 3). This fact is particularly striking, since ntcA encodes the master nitrogen regulator, and its function seems to have been conserved in the whole cyanobacterial radiation. That two Prochlorococcus strains adapted to grow at depth show such a strong difference in a basic regulatory mechanism is a good example of the diversification experimented by the Prochlorococcus genus. The response of icd after MSX addition was also different between both strains: it showed a comparable increase but with a very different timing, it increased very quickly in SS120 (6-fold after 1 h) but more slowly in MIT9313 (7-fold after 24 h; Fig. 3), despite the huge upregulation of ntcA in this strain. When we analysed the effects of 100 μM azaserine to Prochlorococcus sp. MIT9313 cultures (Fig. 4), we observed an increase in the expression of ntcA, glnB and pipX 5 h after addition of the inhibitor; however, this effect disappeared after 24 h for the three genes, showing a significant decrease in the case of glnB (P = 0.002). Interestingly, icd expression did increase after 24 h. These changes were similar to those observed for the same genes in Prochlorococcus SS120 (López-Lozano et al.2009). Figure 4. View largeDownload slide Effect of azaserine addition on gene expression in Prochlorococcus sp. strain MIT9313. Azaserine (100 μM) was added to cultures at 0 time, keeping an aliquot growing under standard conditions without addition. Samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of azaserine-treated cells with respect to the control, for each sample. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. Figure 4. View largeDownload slide Effect of azaserine addition on gene expression in Prochlorococcus sp. strain MIT9313. Azaserine (100 μM) was added to cultures at 0 time, keeping an aliquot growing under standard conditions without addition. Samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of azaserine-treated cells with respect to the control, for each sample. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. In summary, MSX addition provoked striking differences between MIT9313 and SS120, but the effect of azaserine was alike in both strains. Effects of inhibitors of the photosynthetic electron chain The addition of photosynthetic inhibitors (DCMU and DBMIB, blocking the photosynthetic electron flow before and after the plastoquinone pool, respectively) was studied in order to check whether the electron transport was involved in the control of the C/N balance in Prochlorococcus sp. MIT9313, and more specifically, whether the redox state of plastoquinone could be directly responsible for this control. Both inhibitors were added separately at the indicated concentrations, and samples from Prochlorococcus sp. MIT9313 cultures were taken after 1 and 24 h of the inhibitors’ addition. A control culture with no addition was used in all experiments. DCMU had little effect on the expression of the studied genes (Fig. 5A), with minor up- or downregulation depending on the gene, with the exception of icd, which was significantly upregulated after 24 h (P = 0.0019). However, addition of DBMIB induced an increase in all cases, going from 2-fold increase in the case of glnB to a remarkable ca. 100-fold increase in the case of icd (P = 0.0001). This suggests that electron flow is indeed involved in the control of the C/N balance; taking into account the striking effect of DBMIB, and the lack of effect of DCMU, it seems that reduction of the plastoquinone pool induces gene expression. Figure 5. View largeDownload slide Effect of DCMU and DBMIB addition on gene expression in Prochlorococcus sp. strain MIT9313. (A) DCMU (0.3 μM) and (B) DBMIB (0.06 μM) were added to cultures at 0 time, keeping an aliquot growing under standard conditions without addition. Samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of inhibitor-treated cells with respect to the control, for each sample. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. Figure 5. View largeDownload slide Effect of DCMU and DBMIB addition on gene expression in Prochlorococcus sp. strain MIT9313. (A) DCMU (0.3 μM) and (B) DBMIB (0.06 μM) were added to cultures at 0 time, keeping an aliquot growing under standard conditions without addition. Samples were obtained at the indicated times to determine gene expression by qRT-PCR. The expression levels represent the response of inhibitor-treated cells with respect to the control, for each sample. The expression levels correspond to ntcA (blue), glnB (red), pipX (green) and icd (purple). Error bars represent the standard deviation. Interestingly, we observed similar effects for both inhibitors on ntcA and glnB expression in Prochlorococcus sp. SS120 (López-Lozano et al.2009). However, DBMIB effect on icd expression clearly differs between both strains: icd levels strongly decreased in the SS120 strain, while they showed a huge increase in the MIT9313 strain (Fig. 5B). This points out to fundamental differences in the control of icd expression in Prochlorococcus depending on the studied strain, since isocitrate dehydrogenase is the enzyme linking the C and N metabolisms in cyanobacteria (Domínguez-Martín et al.2014). Remarkable differences in the integration of the C/N metabolisms were also observed in previous transcriptomic studies (Tolonen et al.2006). Our work corroborates these results and provides additional evidence to support a modulation of the C/N balance control systems in Prochlorococcus; early branching low-light strains as MIT9313 show a icd responsiveness to the redox state of the plastoquinone pool that seems to have been lost in more late-branching ecotypes as SS120. This idea fits nicely with the hypothesis of general streamlining in the C/N control systems in Prochlorococcus, previously proposed by our team (García-Fernández, Tandeau de Marsac and Diez 2004), as an adaptive mechanism to very oligotrophic oceans. Related processes have also been described by our team in the regulation of glutamine synthetase in the marine strain Synechococcus sp. WH7803 strain (Domínguez-Martín, Díez and García-Fernández 2016). Concluding remarks The results described in this work evidence clear differences in the expression of key genes in the regulation of C/N in Prochlorococcus sp. strain MIT9313, which are especially remarkable when compared to similar experiments in other low-light adapted strain as SS120: the expression of glnB under nitrogen starvation (Fig. 1B); the expression of ntcA after MSX addition (Fig. 3); and the expression of icd after DBMIB addition (Fig. 5B). All these responses are almost opposite to those found in Prochlorococcus sp. SS120, where glnB, ntcA and icd transcript levels decrease or remain unchanged when cells are subjected to the same conditions (López-Lozano et al.2009). This might be another example of a progressive process of simplification in the regulatory systems of Prochlorococcus, where regulatory proteins become less responsive to changes in the environment: i.e. the lack of phosphorylation of the PII protein (Palinska et al.2002) or the decreased responsiveness of NtcA to 2-oxoglutarate (Domínguez-Martín et al.2017). In this view, late-branching strains of the low-light Prochlorococcus ecotypes (as SS120) show regulatory patterns that are streamlined with respect to early-branching, low-light adapted strains as Prochlorococcus sp. strain MIT9313. SUPPLEMENTARY DATA Supplementary data are available at FEMSLE online. Acknowledgements We thank the Roscoff Culture Collection (Station Biologique, Roscoff, France) and the Massachusetts Institute of Technology Cyanobacterial Collection (Cambridge, USA) for providing Prochlorococcus sp. strain MIT9313. We acknowledge the kind collaboration of the Instituto Español de Oceanografía for supplying seawater. DNA sequencing was carried at the genomics service of the Servicio Centralizado de Apoyo a la Investigación (SCAI, Universidad de Córdoba, Spain). FUNDING This work was supported by grants BFU-2013–44767-P and BFU-2016–76227-P (Spanish Ministerio de Economía y Competitividad, cofunded by the European Social Fund from the European Union), P12-BIO-2141 (Proyectos de Excelencia, Junta de Andalucía, Spain) and Universidad de Córdoba (Programa Propio de Investigación). María Agustina Domínguez-Martín (MAD-M) and Oriol Alberto Rangel-Zúñiga (OAR-Z) received doctoral grants from projects BFU-2013–44767-P and BFU2006–1011/BMC, respectively. Antonio López-Lozano (AL-L) received a post-doctoral grant from project P12-BIO-2141 (Proyectos de Excelencia, Junta de Andalucía, Spain). Conflict of Interest. None declared. REFERENCES Bibby T , Mary I, Nield Jet al.   Low-light-adapted Prochlorococcus species possess specific antennae for each photosystem. Nature  2003; 424: 1051– 4. Google Scholar CrossRef Search ADS PubMed  Biller S , Berube P, Lindell Det al.   Prochlorococcus: the structure and function of collective diversity. Nat Rev Microbiol  2015; 13: 13– 27. Google Scholar CrossRef Search ADS PubMed  Domínguez-Martín M , Díez J, García-Fernández J. Physiological studies of glutamine synthetases I and III from Synechococcus sp. WH7803 reveal differential regulation. Front Microbiol  2016; 7: 969. Google Scholar CrossRef Search ADS PubMed  Domínguez-Martín MA , López-Lozano, A, Clavería-Gimeno, Ret al.   Differential NtcA responsiveness to 2-oxoglutarate underlies the diversity of C/N balance regulation in Prochlorococcus. Front Microbiol  2017; 8: 2641. Domínguez-Martín MA , López-Lozano A, Diez Jet al.   Physiological regulation of isocitrate dehydrogenase and the role of 2-oxoglutarate in Prochlorococcus sp. strain PCC 9511. PLOS One  2014; 9: e103380. Google Scholar CrossRef Search ADS PubMed  El Alaoui S , Diez J, Humanes Let al.   In vivo regulation of glutamine synthetase activity in the marine chlorophyll b-containing cyanobacterium Prochlorococcus sp. strain PCC 9511 (Oxyphotobacteria). Appl Environ Microb  2001; 67: 2202– 7. Google Scholar CrossRef Search ADS   El Alaoui S , Diez J, Toribio Fet al.   Glutamine synthetase from the marine cyanobacteria Prochlorococcus spp.: characterization, phylogeny and response to nutrient limitation. Environ Microbiol  2003; 5: 412– 23. Google Scholar CrossRef Search ADS PubMed  Espinosa J , Forchhammer K, Burillo Set al.   Interaction network in cyanobacterial nitrogen regulation: PipX, a protein that interacts in a 2-oxoglutarate dependent manner with PII and NtcA. Mol Microbiol  2006; 61: 457– 69. Google Scholar CrossRef Search ADS PubMed  Flombaum P , Gallegos JL, Gordillo RAet al.   Present and future global distributions of the marine cyanobacteria Prochlorococcus and Synechococcus. P Natl Acad Sci USA  2013; 110: 9824– 9. Google Scholar CrossRef Search ADS   Forchhammer K , Tandeau de Marsac N. The PII protein in the cyanobacterium Synechococcus sp. strain PCC 7942 is modified by serine phosphorylation and signals the cellular N-status. J Bacteriol  1994; 176: 84– 91. Google Scholar CrossRef Search ADS PubMed  García-Domínguez M , Reyes J, Florencio F. NtcA represses transcription of gifA and gifB, genes that encode inhibitors of glutamine synthetase type I from Synechocystis sp. PCC 6803. Mol Microbiol  2000; 35: 1192– 201. Google Scholar CrossRef Search ADS PubMed  García-Fernández J , Diez J. Adaptive mechanisms of the nitrogen and carbon assimilatory pathways in the marine cyanobacteria Prochlorococcus. Res Microbiol  2004; 155: 795– 802. Google Scholar CrossRef Search ADS PubMed  García-Fernández J , Tandeau de Marsac N, Diez J. Streamlined regulation and gene loss as adaptive mechanisms in Prochlorococcus for optimized nitrogen utilization in oligotrophic environments. Microbiol Mol Biol R  2004; 68: 630– 8. Google Scholar CrossRef Search ADS   Gómez-Baena G , Diez J, García-Fernández Jet al.   Regulation of glutamine synthetase by metal-catalyzed oxidative modification in the marine oxyphotobacterium Prochlorococcus. Biochim Biophys Acta  2001; 1568: 237– 44. Google Scholar CrossRef Search ADS PubMed  Gómez-Baena G , Domínguez-Martín M, Donaldson Ret al.   Nutrient starvation makes glutamine synthetase more sensitive to oxidative modification in Prochlorococcus marinus PCC 9511. PLOS One  2015;doi: 10.1371/journal.pone.0135322. Gómez-Baena G , García-Fernández J, Lopez-Lozano Aet al.   Glutamine synthetase degradation is controlled by oxidative proteolysis in the marine cyanobacterium Prochlorococcus marinus strain PCC 9511. Biochim Biophys Acta  2006; 1760: 930– 40. Google Scholar CrossRef Search ADS PubMed  Graziano L , Geider R, Li Wet al.   Nitrogen limitation of North Atlantic phytoplankton - Analysis of physiological condition in nutrient enrichment experiments. Aquat Microb Ecol  1996; 11: 53– 64. Google Scholar CrossRef Search ADS   Grzymski J , Dussaq A. The significance of nitrogen cost minimization in proteomes of marine microorganisms. ISME J  2011; 6: 71– 80. Google Scholar CrossRef Search ADS PubMed  Hunter-Cervera KR , Neubert MG, Olson RJet al.   Physiological and ecological drivers of early spring blooms of a coastal phytoplankter. Science  2016; 354: 326– 9. Google Scholar CrossRef Search ADS PubMed  Landschützer P , Gruber N, Haumann FAet al.   The reinvigoration of the Southern Ocean carbon sink. Science  2015; 349: 1221– 4. Google Scholar CrossRef Search ADS PubMed  López-Lozano A , Gómez-Baena G, Muñoz-Marín Met al.   Expression of genes involved in nitrogen assimilation and the C/N balance sensing in Prochlorococcus sp. strain SS120. Gene Expression  2009; 14: 279– 89. Google Scholar CrossRef Search ADS PubMed  Luque I , Flores E, Herrero A. Molecular mechanism for the operation of nitrogen control in cyanobacteria. EMBO J  1994; 13: 2862– 9. Google Scholar PubMed  McDonagh B , Domínguez-Martín MA, Gómez-Baena Get al.   Nitrogen starvation induces extensive changes in the redox proteome of Prochlorococcus sp. SS120. Environ Microbiol Rep  2012; 4: 257– 67. Google Scholar CrossRef Search ADS PubMed  Martiny A , Coleman M, Chisholm S. Phosphate acquisition genes in Prochlorococcus ecotypes: evidence for genome-wide adaptation. P Natl Acad Sci USA  2006; 103: 12552– 7. Google Scholar CrossRef Search ADS   Oaks A , Sivasankar S, Goodfellow V. The specificity of methionine sulfoximine and azaserine inhibition in plant tissues. Phytochemistry  1998; 49: 355– 7. Google Scholar CrossRef Search ADS   Pace J , McDermott E. Methionine sulphoximine and some enzyme systems involving glutamine. Nature  1952; 169: 415– 6. Google Scholar CrossRef Search ADS PubMed  Palinska KA , Laloui W, Bedu Set al.   The signal transducer PII and bicarbonate acquisition in Prochlorococcus marinus PCC 9511, a marine cyanobacterium naturally deficient in nitrate and nitrite assimilation. Microbiology  2002; 148: 2405– 12. Google Scholar CrossRef Search ADS PubMed  Partensky F , Blanchot J, Vaulot D. Differential distribution and ecology of Prochlorococcus and Synechococcus in oceanic waters: a review. In: Charpy L, Larkum A (eds). Marine Cyanobacteria , Vol. 19. Numéro Spécial, Monaco: Bulletin de l’Institut Océanographique, 1999, 457– 76. Partensky F , Hess W, Vaulot D. Prochlorococcus, a marine photosynthetic prokaryote of global significance. Microbiol Mol Biol R  1999; 63: 106– 27. Pfaffl M . A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res  2001; 29: e45. Google Scholar CrossRef Search ADS PubMed  Picossi S , Flores E, Herrero A. ChIP analysis unravels an exceptionally wide distribution of DNA binding sites for the NtcA transcription factor in a heterocyst-forming cyanobacterium. BMC Genomics  2014; 15: 22. Rangel O , Gómez-Baena G, López-Lozano Aet al.   Physiological role and regulation of glutamate dehydrogenase in Prochlorococcus MIT9313. Environ Microbiol Rep  2009; 1: 56– 64. Google Scholar CrossRef Search ADS PubMed  Read RW , Berube PM, Biller SJet al.   Nitrogen cost minimization is promoted by structural changes in the transcriptome of N-deprived Prochlorococcus cells. ISME J  2017; 11: 2267– 78. Google Scholar CrossRef Search ADS PubMed  Reistetter EN , Krumhardt K, Callnan Ket al.   Effects of phosphorus starvation versus limitation on the marine cyanobacterium Prochlorococcus MED4 II: gene expression. Environ Microbiol  2013; 15: 2129– 43. Google Scholar CrossRef Search ADS PubMed  Scanlan D , Ostrowski M, Mazard Set al.   Ecological genomics of marine picocyanobacteria. Microbiol Mol Biol R  2009; 73: 249– 99. Google Scholar CrossRef Search ADS   Tollefson J . The hostile ocean that slowed climate change. Science  2016; 349: 346– 8. Tolonen A , Aach J, Lindell Det al.   Global gene expression of Prochlorococcus ecotypes in response to changes in nitrogen availability. Mol Syst Biol  2006; 2: 53. Google Scholar CrossRef Search ADS PubMed  Valladares A , Rodríguez V, Camargo Set al.   Specific role of the cyanobacterial PipX factor in the heterocysts of Anabaena sp. strain PCC 7120. J Bacteriol  2011; 193: 1172– 82. Google Scholar CrossRef Search ADS PubMed  Voigt K , Sharma CM, Mitschke Jet al.   Comparative transcriptomics of two environmentally relevant cyanobacteria reveals unexpected transcriptome diversity. ISME J  2014; 8: 2056– 68. Google Scholar CrossRef Search ADS PubMed  © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Journal

FEMS Microbiology LettersOxford University Press

Published: Feb 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off